ClinVar Miner

Variants with conflicting interpretations "risk factor" and "pathogenic"

Submission 1 (risk factor) minimum review status: Submission 1 (risk factor) method:
Submission 2 (pathogenic) minimum review status: Submission 2 (pathogenic) method:
ClinVar version:

Total variants with conflicting interpretations: 207

CD36, G1439C, 1-BP DEL, 1444A
CX3CR1:c.[841G>A;935C>T] (p.Val294Ile;Thr280Met)
MECP2, 41-BP DEL, NT1157
Multiple alleles
NG_012123.1:g.2493A>G rs1024611
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000041.2(APOE):c.526C>T (p.Arg176Cys) rs7412
NM_000041.4(APOE):c.388T>C (p.Cys130Arg) rs429358
NM_000051.3(ATM):c.7271T>G (p.Val2424Gly) rs28904921
NM_000055.2(BCHE):c.293A>G (p.Asp98Gly) rs1799807
NM_000059.3(BRCA2):c.658_659del (p.Val220fs) rs80359604
NM_000059.4(BRCA2):c.5645C>G (p.Ser1882Ter) rs80358785
NM_000059.4(BRCA2):c.5946del (p.Ser1982fs) rs80359550
NM_000075.4(CDK4):c.70C>T (p.Arg24Cys) rs11547328
NM_000075.4(CDK4):c.71G>A (p.Arg24His) rs104894340
NM_000077.4(CDKN2A):c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) rs587780668
NM_000077.4(CDKN2A):c.159G>C (p.Met53Ile) rs104894095
NM_000077.4(CDKN2A):c.167G>T (p.Ser56Ile) rs104894109
NM_000077.4(CDKN2A):c.176T>G (p.Val59Gly) rs104894099
NM_000077.4(CDKN2A):c.266G>A (p.Gly89Asp) rs137854599
NM_000077.4(CDKN2A):c.301G>T (p.Gly101Trp) rs104894094
NM_000077.4(CDKN2A):c.339_340delGCinsCT (p.Pro114Ser) rs387906410
NM_000077.4(CDKN2A):c.377T>A (p.Val126Asp) rs104894098
NM_000077.4(CDKN2A):c.71G>C (p.Arg24Pro) rs104894097
NM_000102.4(CYP17A1):c.715C>T (p.Arg239Ter) rs104894136
NM_000130.4(F5):c.1601G>A (p.Arg534Gln) rs6025
NM_000157.3(GBA):c.1448T>C rs421016
NM_000157.4(GBA):c.1226A>G (p.Asn409Ser) rs76763715
NM_000157.4(GBA):c.1504C>T (p.Arg502Cys) rs80356771
NM_000186.3(CFH):c.1204= (p.His402=) rs1061170
NM_000186.3(CFH):c.2697T>A (p.Tyr899Ter) rs121913057
NM_000186.3(CFH):c.3572C>T (p.Ser1191Leu) rs460897
NM_000186.3(CFH):c.3628C>T (p.Arg1210Cys) rs121913059
NM_000209.4(PDX1):c.492G>T (p.Glu164Asp) rs80356661
NM_000219.6(KCNE1):c.253G>A (p.Asp85Asn) rs1805128
NM_000224.3(KRT18):c.383A>T (p.His128Leu) rs57758506
NM_000237.3(LPL):c.953A>G (p.Asn318Ser) rs268
NM_000240.3(MAOA):c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) rs1346551029
NM_000242.2(MBL2):c.154C>T rs5030737
NM_000314.7(PTEN):c.701G>A (p.Arg234Gln) rs121909235
NM_000335.5(SCN5A):c.3305C>A (p.Ser1102Tyr) rs7626962
NM_000335.5(SCN5A):c.3575G>A (p.Arg1192Gln) rs41261344
NM_000350.2(ABCA4):c.5882G>A rs1800553
NM_000350.3(ABCA4):c.2828G>A (p.Arg943Gln) rs1801581
NM_000350.3(ABCA4):c.4139C>T (p.Pro1380Leu) rs61750130
NM_000372.5(TYR):c.1205G>A (p.Arg402Gln) rs1126809
NM_000410.3(HFE):c.187C>G (p.His63Asp) rs1799945
NM_000410.3(HFE):c.845G>A (p.Cys282Tyr) rs1800562
NM_000416.2(IFNGR1):c.260T>C (p.Ile87Thr) rs104893973
NM_000492.3(CFTR):c.1210-12T[5] rs1805177
NM_000492.3(CFTR):c.1521_1523delCTT (p.Phe508delPhe) rs113993960
NM_000492.4(CFTR):c.2991G>C (p.Leu997Phe) rs1800111
NM_000506.5(F2):c.*97G>A rs1799963
NM_000514.4(GDNF):c.277C>T (p.Arg93Trp) rs36119840
NM_000540.3(RYR1):c.1021G>A (p.Gly341Arg) rs121918592
NM_000540.3(RYR1):c.14387A>G (p.Tyr4796Cys) rs118192167
NM_000540.3(RYR1):c.14477C>T (p.Thr4826Ile) rs121918595
NM_000540.3(RYR1):c.14693T>C (p.Ile4898Thr) rs118192170
NM_000540.3(RYR1):c.1565A>C (p.Tyr522Ser) rs118192162
NM_000540.3(RYR1):c.1840C>T (p.Arg614Cys) rs118192172
NM_000540.3(RYR1):c.487C>T (p.Arg163Cys) rs118192161
NM_000540.3(RYR1):c.6487C>T (p.Arg2163Cys) rs118192175
NM_000540.3(RYR1):c.6488G>A (p.Arg2163His) rs118192163
NM_000540.3(RYR1):c.6502G>A (p.Val2168Met) rs118192176
NM_000540.3(RYR1):c.6617C>T (p.Thr2206Met) rs118192177
NM_000540.3(RYR1):c.7300G>A (p.Gly2434Arg) rs121918593
NM_000540.3(RYR1):c.7372C>T (p.Arg2458Cys) rs28933397
NM_000540.3(RYR1):c.7373G>A (p.Arg2458His) rs121918594
NM_000540.3(RYR1):c.742G>A (p.Gly248Arg) rs1801086
NM_000550.3(TYRP1):c.497C>G (p.Ser166Ter) rs104894130
NM_000552.4(VWF):c.4751A>G (p.Tyr1584Cys) rs1800386
NM_000603.5(NOS3):c.894T>G (p.Asp298Glu) rs1799983
NM_000726.4(CACNB4):c.311G>T (p.Cys104Phe) rs1805031
NM_000902.4(MME):c.467del (p.Pro156fs) rs749320057
NM_000903.3(NQO1):c.559C>T (p.Pro187Ser) rs1800566
NM_001001547.3(CD36):c.975T>G (p.Tyr325Ter) rs3211938
NM_001008212.2(OPTN):c.293T>A (p.Met98Lys) rs11258194
NM_001042723.2(RYR1):c.7039_7041GAG[1] (p.Glu2348del) rs121918596
NM_001072.4(UGT1A6):c.862-10021T>G rs4124874
NM_001098629.3(IRF5):c.-12+198= rs2004640
NM_001110792.2(MECP2):c.916C>T (p.Arg306Ter) rs61751362
NM_001122659.3(EDNRB):c.828G>T (p.Trp276Cys) rs104894387
NM_001127701.1(SERPINA1):c.863A>T (p.Glu288Val) rs17580
NM_001145661.2(GATA2):c.1061C>T (p.Thr354Met) rs387906631
NM_001194958.2(KCNJ18):c.1061C>T (p.Thr354Met) rs527236158
NM_001194958.2(KCNJ18):c.1097A>G (p.Lys366Arg) rs527236159
NM_001194958.2(KCNJ18):c.429del (p.Ile144fs) rs527236153
NM_001195263.2(PDZD7):c.166dup (p.Arg56fs) rs587776894
NM_001199397.3(NEK1):c.3107C>G (p.Ser1036Ter) rs199947197
NM_001256071.3(RNF213):c.14429G>A (p.Arg4810Lys) rs112735431
NM_001278293.3(ARL6):c.506G>C (p.Gly169Ala) rs104893679
NM_001354604.2(MITF):c.1273G>A (p.Glu425Lys) rs149617956
NM_001943.5(DSG2):c.166G>A (p.Val56Met) rs121913013
NM_002016.1(FLG):c.1501C>T (p.Arg501Ter) rs61816761
NM_002016.1(FLG):c.2282_2285delCAGT rs558269137
NM_002016.1(FLG):c.3321del (p.Gly1109fs) rs200519781
NM_002016.1(FLG):c.7661C>G (p.Ser2554Ter) rs121909626
NM_002273.4(KRT8):c.160T>C (p.Tyr54His) rs57749775
NM_002273.4(KRT8):c.184G>T (p.Gly62Cys) rs11554495
NM_002382.5(MAX):c.1A>G (p.Met1Val) rs387906649
NM_002382.5(MAX):c.223C>T (p.Arg75Ter) rs387906650
NM_002382.5(MAX):c.295+1G>A rs786203385
NM_002382.5(MAX):c.97C>T (p.Arg33Ter) rs387906651
NM_002386.3(MC1R):c.451C>T (p.Arg151Cys) rs1805007
NM_002386.3(MC1R):c.478C>T (p.Arg160Trp) rs1805008
NM_002485.5(NBN):c.511A>G (p.Ile171Val) rs61754966
NM_002485.5(NBN):c.657_661del (p.Lys219fs) rs587776650
NM_002691.4(POLD1):c.1421T>C (p.Leu474Pro) rs587777627
NM_002691.4(POLD1):c.1433G>A (p.Ser478Asn) rs397514632
NM_002878.3(RAD51D):c.556C>T (p.Arg186Ter) rs387906843
NM_002878.3(RAD51D):c.757C>T (p.Arg253Ter) rs137886232
NM_003122.4(SPINK1):c.101A>G (p.Asn34Ser) rs17107315
NM_003647.3(DGKE):c.966G>A (p.Trp322Ter) rs138924661
NM_003661.4(APOL1):c.1164_1169del (p.Asn388_Tyr389del) rs71785313
NM_004304.5(ALK):c.3383G>C (p.Gly1128Ala) rs113994088
NM_004304.5(ALK):c.3452C>T (p.Thr1151Met) rs113994091
NM_004304.5(ALK):c.3575G>C (p.Arg1192Pro) rs113994089
NM_004304.5(ALK):c.3824G>A (p.Arg1275Gln) rs113994087
NM_004612.4(TGFBR1):c.1240C>T (p.Arg414Ter) rs387906697
NM_004972.3(JAK2):c.1849G>T (p.Val617Phe) rs77375493
NM_004993.5(ATXN3):c.892_894CAG(8_36) (p.Gln298_Gln305=) rs193922928
NM_005084.4(PLA2G7):c.663+1G>A rs201899866
NM_005084.4(PLA2G7):c.835G>T (p.Val279Phe) rs76863441
NM_005430.4(WNT1):c.859dup (p.His287fs) rs387907353
NM_005957.4(MTHFR):c.1683G>A (p.Trp561Ter) rs786204030
NM_006231.3(POLE):c.1270C>G (p.Leu424Val) rs483352909
NM_006267.5(RANBP2):c.1754C>T (p.Thr585Met) rs121434502
NM_006267.5(RANBP2):c.1958C>T (p.Thr653Ile) rs121434503
NM_006267.5(RANBP2):c.1966A>G (p.Ile656Val) rs121434504
NM_006361.5(HOXB13):c.251G>A (p.Gly84Glu) rs138213197
NM_006516.3(SLC2A1):c.1372C>T (p.Arg458Trp) rs13306758
NM_006516.3(SLC2A1):c.694C>T (p.Arg232Cys) rs387907313
NM_007194.4(CHEK2):c.1100del (p.Thr367fs) rs555607708
NM_007194.4(CHEK2):c.1283C>T (p.Ser428Phe) rs137853011
NM_007194.4(CHEK2):c.470T>C (p.Ile157Thr) rs17879961
NM_007272.3(CTRC):c.164G>A (p.Trp55Ter) rs121909294
NM_007272.3(CTRC):c.760C>T (p.Arg254Trp) rs121909293
NM_007294.3(BRCA1):c.5266dupC (p.Gln1756Profs) rs80357906
NM_007294.4(BRCA1):c.66_67AG[1] (p.Glu23fs) rs80357914
NM_012452.2(TNFRSF13B):c.310T>C (p.Cys104Arg) rs34557412
NM_014625.3(NPHS2):c.686G>A (p.Arg229Gln) rs61747728
NM_014625.4(NPHS2):c.868G>A (p.Val290Met) rs200482683
NM_014946.3(SPAST):c.131C>T (p.Ser44Leu) rs121908515
NM_014946.3(SPAST):c.134C>A (p.Pro45Gln) rs121908517
NM_015074.3(KIF1B):c.4442G>A (p.Ser1481Asn) rs121908164
NM_015272.5(RPGRIP1L):c.685G>A (p.Ala229Thr) rs61747071
NM_015697.8(COQ2):c.1159C>T (p.Arg387Ter) rs751185256
NM_015697.8(COQ2):c.382A>G (p.Met128Val) rs778094136
NM_016038.4(SBDS):c.258+2T>C rs113993993
NM_016222.4(DDX41):c.3G>A (p.Met1Ile) rs141601766
NM_016222.4(DDX41):c.415_418dup (p.Asp140delinsGlyTer) rs762890562
NM_016335.5(PRODH):c.1292G>A (p.Arg431His) rs2904552
NM_016335.5(PRODH):c.1322T>C (p.Leu441Pro) rs2904551
NM_016335.5(PRODH):c.1363G>T (p.Ala455Ser) rs1807467
NM_016335.5(PRODH):c.1397C>T (p.Thr466Met) rs2870984
NM_016335.5(PRODH):c.865T>A (p.Leu289Met) rs137852934
NM_016335.6(PRODH):c.1357C>T (p.Arg453Cys) rs3970559
NM_016335.6(PRODH):c.1562= (p.Arg521=) rs450046
NM_016362.5(GHRL):c.214C>A (p.Leu72Met) rs696217
NM_016835.4(MAPT):c.1835_1837ATA[1] (p.Asn613del) rs63751392
NM_017411.3(SMN2):c.859G>C (p.Gly287Arg) rs121909192
NM_017849.3(TMEM127):c.410-2A>C rs121908826
NM_017849.3(TMEM127):c.475C>T (p.Gln159Ter) rs121908830
NM_018100.4(EFHC1):c.628G>A (p.Asp210Asn) rs137852777
NM_018196.4(TMLHE):c.959_960AT[1] (p.Ile321fs) rs782624357
NM_020937.4(FANCM):c.5101C>T (p.Gln1701Ter) rs147021911
NM_022162.3(NOD2):c.2798+158C>T rs5743289
NM_022437.3(ABCG8):c.55G>C (p.Asp19His) rs11887534
NM_023110.2(FGFR1):c.1042G>A (p.Gly348Arg) rs886037634
NM_023110.2(FGFR1):c.1825C>T (p.Arg609Ter) rs121909639
NM_023110.2(FGFR1):c.1864C>T (p.Arg622Ter) rs121909628
NM_024675.3(PALB2):c.1027C>T (p.Gln343Ter) rs180177097
NM_024675.3(PALB2):c.1592del (p.Leu531fs) rs180177102
NM_024675.3(PALB2):c.2323C>T (p.Gln775Ter) rs180177111
NM_024675.3(PALB2):c.2962C>T (p.Gln988Ter) rs118203999
NM_024675.3(PALB2):c.3113G>A (p.Trp1038Ter) rs180177132
NM_024675.3(PALB2):c.3116del (p.Asn1039fs) rs180177133
NM_024675.3(PALB2):c.3256C>T (p.Arg1086Ter) rs587776527
NM_024675.3(PALB2):c.3549C>G (p.Tyr1183Ter) rs118203998
NM_024675.4(PALB2):c.168_171TTGT[1] (p.Gln60fs) rs180177143
NM_033629.6(TREX1):c.341G>A (p.Arg114His) rs72556554
NM_058197.4(CDKN2A):c.*149_*167del rs587776716
NM_058216.3(RAD51C):c.230del (p.Gly77fs) rs1057519355
NM_058216.3(RAD51C):c.397C>T (p.Gln133Ter) rs387907159
NM_058216.3(RAD51C):c.837+1G>A rs760235677
NM_058216.3(RAD51C):c.93del (p.Phe32fs) rs730881942
NM_144670.6(A2ML1):c.2478_2485dup (p.Ser829fs) rs863224951
NM_172201.1(KCNE2):c.161T>C (p.Met54Thr) rs74315447
NM_178857.6(RP1L1):c.133C>T (p.Arg45Trp) rs267607017
NM_181332.3(NLGN4X):c.1252_1253GA[1] (p.Glu418fs) rs1569118680
NM_181798.1(KCNQ1):c.1366C>T (p.Arg456Cys) rs17221854
NM_197947.3(CLEC7A):c.714T>G (p.Tyr238Ter) rs16910526
NM_198253.3(TERT):c.3184G>A (p.Ala1062Thr) rs35719940
NM_198578.4(LRRK2):c.7153G>A (p.Gly2385Arg) rs34778348
PALB2:c.2515-1G>T rs587776417
TBX21, -1993T-C

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.