ClinVar Miner

Variants from Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine with conflicting interpretations

Location: United States — Primary collection method: clinical testing
Minimum review status of the submission from Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine: Collection method of the submission from Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
8645 5681 161 4863 3031 109 731 7752

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine pathogenic likely pathogenic uncertain significance likely benign benign association drug response protective risk factor other
pathogenic 79 432 61 9 2 3 10 0 12 4
likely pathogenic 362 3 127 7 2 3 6 1 4 2
uncertain significance 216 296 30 961 267 0 5 0 6 1
likely benign 39 19 1331 3 1103 0 2 0 9 3
benign 46 15 678 2967 46 1 3 4 23 12
drug response 4 4 1 1 0 0 0 1 0 1
risk factor 1 0 0 0 1 0 0 0 0 0
other 0 0 0 0 1 0 0 0 0 0

Submitter to submitter summary #

Total submitters: 206
Download table as spreadsheet
Submitter Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
Illumina Clinical Services Laboratory,Illumina 0 1463 0 1867 972 0 55 2889
GeneDx 0 5279 5 1297 686 2 164 2154
Invitae 0 4379 0 831 666 4 125 1626
EGL Genetic Diagnostics,Eurofins Clinical Diagnostics 0 2763 0 423 629 7 31 1090
Ambry Genetics 0 2579 0 375 309 0 53 737
Genetic Services Laboratory, University of Chicago 0 471 0 490 82 1 3 576
Biesecker Lab/Human Development Section,National Institutes of Health 0 552 56 114 197 0 4 371
Integrated Genetics/Laboratory Corporation of America 0 970 1 200 139 1 24 365
OMIM 0 416 0 86 32 68 154 330
Color 0 974 0 128 182 0 7 317
PreventionGenetics 0 2627 0 241 47 0 3 291
Counsyl 0 652 0 165 102 0 19 286
CHEO Genetics Diagnostic Laboratory,Children's Hospital of Eastern Ontario 0 796 0 140 93 0 10 243
ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories 0 824 0 82 87 0 16 185
Athena Diagnostics Inc 0 634 0 127 42 0 0 169
GeneReviews 0 108 81 19 3 5 39 146
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 0 184 0 110 29 0 4 143
CeGaT Praxis fuer Humangenetik Tuebingen 0 95 0 26 88 0 13 127
Blueprint Genetics, 0 170 0 37 49 3 33 121
Stanford Center for Inherited Cardiovascular Disease,Stanford University 0 264 0 49 43 0 26 118
CSER_CC_NCGL; University of Washington Medical Center 0 184 0 22 73 0 15 110
Diagnostic Laboratory, Department of Genetics,University Medical Center Groningen 0 350 0 66 25 0 4 95
Division of Genomic Diagnostics,The Children's Hospital of Philadelphia 0 138 0 48 42 0 5 94
DNA and Cytogenetics Diagnostics Unit,Erasmus Medical Center 0 236 0 47 28 0 4 79
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute 0 165 0 35 22 1 19 77
Database of Curated Mutations (DoCM) 0 21 0 57 0 4 11 71
Genome Diagnostics Laboratory,University Medical Center Utrecht 0 179 0 39 25 0 5 69
Department of Pathology and Laboratory Medicine,Sinai Health System 0 126 0 31 38 0 0 69
Fulgent Genetics 0 451 0 50 13 0 1 64
Mayo Clinic Genetic Testing Laboratories,Mayo Clinic 0 216 0 28 27 0 5 60
Center for Human Genetics, Inc 0 66 0 24 30 0 1 55
International Society for Gastrointestinal Hereditary Tumours (InSiGHT) 0 61 21 11 21 0 0 53
Laboratory of Genetics and Molecular Cardiology,University of São Paulo 0 31 0 23 8 0 18 49
ClinGen RASopathy Variant Curation Expert Panel, 0 104 0 32 14 0 1 47
Sharing Clinical Reports Project (SCRP) 0 102 0 17 29 0 0 46
Quest Diagnostics Nichols Institute San Juan Capistrano 0 223 0 22 16 0 3 41
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) 0 125 0 16 22 0 1 39
NIHR Bioresource Rare Diseases,University of Cambridge 0 20 0 16 4 0 15 35
True Health Diagnostics 0 60 0 17 17 0 0 34
Soonchunhyang University Bucheon Hospital,Soonchunhyang University Medical Center 0 5 0 6 22 0 5 33
ClinGen Inherited Cardiomyopathy Variant Curation Expert Panel, 0 69 0 22 4 0 6 32
LDLR-LOVD, British Heart Foundation 0 23 0 17 8 0 6 31
Center for Medical Genetics Ghent,University of Ghent 0 36 0 20 4 0 7 31
Michigan Medical Genetics Laboratories,University of Michigan 0 49 0 9 21 0 0 30
Breast Cancer Information Core (BIC) (BRCA2) 0 71 0 3 23 0 3 29
Mendelics 0 81 0 6 18 0 4 28
Robarts Research Institute,Western University 0 8 0 21 4 0 2 27
Genomic Research Center,Shahid Beheshti University of Medical Sciences 0 35 1 6 8 0 11 26
Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde,Academisch Medisch Centrum 0 28 0 9 3 0 11 23
Agnes Ginges Centre for Molecular Cardiology,Centenary Institute 0 40 0 7 7 0 8 22
Centre for Mendelian Genomics,University Medical Centre Ljubljana 0 56 0 6 6 1 9 22
Clinical Molecular Genetics Laboratory,Johns Hopkins All Children's Hospital 0 55 0 8 7 0 6 21
Centre de Génétique Moléculaire et Chromosomique, Unité de génétique de l'Obésité et des Dyslipidémies,APHP, GH Hôpitaux Universitaires Pitié-Salpêtrière / Charles-Foix 0 15 0 11 5 0 3 19
Division of Human Genetics,Children's Hospital of Philadelphia 0 67 0 6 10 0 2 18
Breast Cancer Information Core (BIC) (BRCA1) 0 56 0 0 14 0 3 17
PharmGKB 0 1 0 0 0 16 0 16
Pathway Genomics 0 58 0 7 9 0 0 16
Personalized Diabetes Medicine Program,University of Maryland School of Medicine 0 22 0 10 6 0 0 16
Knight Diagnostic Laboratories,Oregon Health and Sciences University 0 45 0 6 7 1 1 15
Institute for Biomarker Research,Medical Diagnostic Laboratories, L.L.C. 0 21 0 4 11 0 0 15
Equipe Genetique des Anomalies du Developpement,Université de Bourgogne 0 22 0 5 8 0 2 15
Human Genome Sequencing Center Clinical Lab,Baylor College of Medicine 0 48 0 10 0 2 2 14
Center for Human Genetics,University of Leuven 0 51 0 7 1 0 5 13
Cardiovascular Research Group,Instituto Nacional de Saude Doutor Ricardo Jorge 0 25 0 3 6 0 4 13
SIB Swiss Institute of Bioinformatics 0 29 0 9 3 0 1 13
Baylor Miraca Genetics Laboratories, 0 92 0 5 3 0 4 12
Developmental Genetics Unit,King Faisal Specialist Hospital & Research Centre 0 2 0 2 1 0 8 11
Lupski Lab, Baylor-Hopkins CMG,Baylor College of Medicine 0 5 0 4 4 0 3 11
U4M - Lille University & CHRU Lille,Université Lille 2 - CHRU de Lille 0 17 0 4 1 0 6 11
Phosphorus, Inc. 0 31 0 3 6 0 2 11
Cancer Genetics and Genomics Laboratory,British Columbia Cancer Agency 0 25 0 3 8 0 0 11
ClinGen Hearing Loss Variant Curation Expert Panel, 0 33 0 6 4 0 1 11
Genetic Testing Center for Deafness, Department of Otolaryngology Head & Neck Surgery,Institute of Otolaryngology, Chinese PLA General Hospital 0 15 0 11 0 0 0 11
Department of Ophthalmology and Visual Sciences Kyoto University 0 2 1 9 0 0 0 10
Forensic Genetics Laboratory,Harris County Institute of Forensic Sciences 0 0 0 1 0 0 9 10
Vantari Genetics 0 12 0 5 5 0 0 10
Research Molecular Genetics Laboratory,Women's College Hospital, University of Toronto 0 79 0 5 5 0 0 10
Gharavi Laboratory,Columbia University 0 20 0 4 3 0 3 10
University of Washington Department of Laboratory Medicine,University of Washington 0 33 0 2 7 0 1 10
Molecular Diagnostics Lab,Nemours Alfred I. duPont Hospital for Children 0 26 0 8 1 0 0 9
UCLA Clinical Genomics Center, UCLA 0 4 0 6 0 0 3 9
Institute for Integrative and Experimental Genomics,University of Luebeck 0 0 0 6 1 0 2 9
Molecular Genetics Laboratory,Centre for Cardiovascular Surgery and Transplantation 0 6 0 7 1 0 1 9
Center of Genomic medicine, Geneva,University Hospital of Geneva 0 23 0 5 0 0 3 8
Greenwood Genetic Center Diagnostic Laboratories,Greenwood Genetic Center 0 44 0 3 3 0 1 7
Cardiovascular Genetics Laboratory,PathWest Laboratory Medicine WA - Fiona Stanley Hospital 0 17 0 5 0 0 2 7
Foulkes Cancer Genetics LDI,Lady Davis Institute for Medical Research 0 25 0 3 2 0 2 7
Systems Biology Platform Zhejiang California International NanoSystems Institute 0 0 0 0 0 7 0 7
Evolutionary and Medical Genetics Laboratory, Centre for Cellular and Molecular Biology 0 1 2 1 1 0 3 7
Iberoamerican FH Network 0 12 0 2 2 0 3 7
Genome Diagnostics Laboratory,VU University Medical Center Amsterdam 0 50 0 6 1 0 0 7
German Consortium for Hereditary Breast and Ovarian Cancer Center Cologne,University Hospital Cologne 0 28 0 6 0 0 1 7
Erich and Hanna Klessmann Institute for Cardiovascular Research and Development,Heart and Diabetes Center North Rhine-Westphalia 0 11 0 1 1 0 4 6
Fundacion Hipercolesterolemia Familiar 0 14 0 2 1 0 3 6
Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago 0 22 0 2 4 0 0 6
Department of Genetics,Sultan Qaboos University Hospital, Oman 0 3 0 3 0 0 3 6
Clinical Genomics Lab,St. Jude Children's Research Hospital 0 16 0 2 3 0 1 6
Institute for Genomic Medicine (IGM) Clinical Laboratory,Nationwide Children's Hospital 0 12 0 5 1 0 0 6
HudsonAlpha Institute for Biotechnology 0 28 0 2 0 0 3 5
Bioscientia Institut fuer Medizinische Diagnostik GmbH,Sonic Healthcare 0 8 0 2 1 0 2 5
A.C.Camargo Cancer Center / LGBM, A.C.Camargo Cancer Center 0 8 0 0 5 0 0 5
Yale Center for Mendelian Genomics,Yale University 0 3 0 4 0 0 1 5
Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine 22062 12 0 1 0 2 1 4
Clinical Biochemistry Laboratory,Health Services Laboratory 0 3 0 0 4 0 0 4
ClinVar Staff, National Center for Biotechnology Information (NCBI) 0 9 0 0 1 1 2 4
GeneKor MSA 0 69 0 4 0 0 0 4
University of Washington Center for Mendelian Genomics,University of Washington 0 2 0 3 0 0 1 4
Foundation for Research in Genetics and Endocrinology,Institute of Human Genetics 0 4 0 2 0 0 2 4
Albrecht-Kossel-Institute,Medical University Rostock 0 0 0 0 1 4 1 4
Centre for Genomic and Experimental Medicine,University of Edinburgh 0 1 0 3 0 0 1 4
Centre for Genomic Medicine, Manchester,Central Manchester University Hospitals 0 4 0 2 1 0 1 4
Laboratory of Prof. Karen Avraham,Tel Aviv University 0 4 0 2 0 0 2 4
Cardiovascular Biomarker Research Laboratory,Mayo Clinic 0 1 0 1 3 0 0 4
Center for Human Genetics and Laboratory Diagnostics, Dr. Klein, Dr. Rost and Colleagues 0 12 0 0 4 0 0 4
Johns Hopkins Genomics,Johns Hopkins University 0 2 0 1 3 0 0 4
Institute of Human Genetics,Klinikum rechts der Isar 0 11 0 2 0 0 1 3
Wellcome Centre for Mitochondrial Research,Newcastle University 0 2 0 1 1 0 1 3
Center for Genetic Medicine Research,Children's National Medical Center 0 2 0 1 0 0 2 3
Institute of Human Genetics,University Medical Center Hamburg-Eppendorf 0 1 0 3 0 0 0 3
Génétique et pathophysiologie de maladies neurodéveloppementales et épileptogènes, Institut de génétique et de biologie moléculaire et cellulaire 0 0 0 2 1 0 0 3
Medical Genetics,University of Parma 0 0 0 0 2 0 1 3
Baylor-Hopkins Center for Mendelian Genomics,Johns Hopkins University 0 3 0 0 1 0 2 3
Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA), c/o University of Cambridge 0 99 0 2 0 0 1 3
ARUP Institute,ARUP Laboratories 0 20 0 2 1 0 0 3
Department of Pathology and Molecular Medicine,Queen's University 0 19 0 1 2 0 0 3
Section on Medical Neuroendocrinolgy,National Institutes of Health 0 8 0 2 0 0 1 3
Human Genomics Unit,Institute for molecular medicine Finland (FIMM) 0 0 0 0 1 0 2 3
Wong Mito Lab, Molecular and Human Genetics,Baylor College of Medicine 0 3 0 3 0 0 0 3
SingHealth Duke-NUS Institute of Precision Medicine 0 0 0 0 2 0 1 3
Molecular Diagnostics Laboratory,M Health: University of Minnesota 0 5 0 3 0 0 0 3
Institute of Medical Genetics and Genomics,Sir Ganga Ram Hospital 0 0 0 1 0 0 1 2
Molecular Genetics Laboratory,BC Children's and BC Women's Hospitals 0 5 0 0 1 0 1 2
CFTR2 0 4 0 2 0 0 0 2
Cardiovascular Biomedical Research Unit,Royal Brompton & Harefield NHS Foundation Trust 0 140 0 0 0 0 2 2
PXE International 0 1 0 0 0 0 2 2
Scripps Translational Science Institute,Scripps Health and The Scripps Research Institute 0 1 0 0 0 0 2 2
Laboratory of Human Genetics,Universidade de São Paulo 0 0 0 2 0 0 0 2
Medical Research Institute,Tokyo Medical and Dental University 0 0 0 0 0 0 2 2
Center for Statistical Genetics,Baylor College of Medicine 0 2 0 0 1 0 1 2
Human Genetics - Radboudumc,Radboudumc 0 12 0 2 0 0 0 2
Undiagnosed Diseases Network,NIH 0 4 0 1 0 0 1 2
Santos-Cortez Lab,University of Colorado School of Medicine 0 0 0 0 0 0 2 2
Geisinger Autism and Developmental Medicine Institute,Geisinger Health System 0 5 0 1 0 0 1 2
ClinGen PTEN Variant Curation Expert Panel 0 1 0 1 1 0 0 2
Genetics - Viapath,Viapath, Guy's Hospital 0 0 0 0 1 0 0 1
Molecular Diagnostics Laboratory,Seoul National University Hospital 0 0 0 0 1 0 0 1
Division Human Genetics,Medical University Innsbruck 0 13 0 1 0 0 0 1
Juha Muilu Group; Institute for Molecular Medicine Finland (FIMM) 0 0 1 0 0 0 0 1
UniProtKB/Swiss-Prot 0 5 0 1 0 0 0 1
Strand Center for Genomics and Personalized Medicine,Strand Life Sciences Pvt Ltd 0 0 0 0 0 0 1 1
Eye Genetics Research Group,Children's Medical Research Institute 0 2 0 0 0 0 1 1
Science for Life laboratory, Karolinska Institutet 0 0 0 0 0 0 1 1
GenMed Metabolism Lab 0 0 0 0 0 0 1 1
Institute for Genetics of Heart Diseases, University Hospital Muenster 0 0 1 0 0 0 0 1
PALB2 database 0 1 0 1 0 0 0 1
RettBASE 0 0 0 1 0 0 0 1
Institute of Otorhinolaryngology, The First affiliated hospital,Sun Yat-sen University 0 0 0 0 0 0 1 1
Genetics, Bhagwan Mahavir Medical Research Centre 0 1 0 0 0 1 0 1
Molecular Genetics Laboratory; Baylor College of Medicine 0 0 0 0 1 0 0 1
Molecular Genetics and Enzymology, National Research Centre 0 0 0 0 0 0 1 1
Genomics and Pathology Services,Washington University in St.Louis 0 2 0 1 0 0 0 1
Department of Medical Genetics,Oslo University Hospital 0 21 0 1 0 0 0 1
Chan Lab,Boston Children's Hospital 0 0 0 0 0 0 1 1
Department of Neurology, University Hospital of Strasbourg 0 0 0 0 0 0 1 1
Foundation Medicine, Inc. 0 0 0 0 1 0 0 1
Dobyns Lab,Seattle Children's Research Institute 0 1 0 1 0 0 0 1
Neurogenetics of motion laboratory,Montreal Neurological Institute 0 0 0 1 0 0 0 1
Cytogenetics Laboratory,Banaras Hindu University 0 0 0 0 0 0 1 1
UW Hindbrain Malformation Research Program,University of Washington 0 3 0 1 0 0 0 1
Laboratory of Molecular Genetics (Pr. Bezieau's lab),CHU de Nantes 0 5 0 1 0 0 0 1
Genome Sciences Centre,British Columbia Cancer Agency 0 3 0 1 0 0 0 1
Aziz Sancar Institute of Experimental Medicine,Istanbul University 0 0 0 0 0 1 1 1
Next Generation Diagnostics,Novartis Institutes for BioMedical Research, Inc. 0 0 0 0 1 0 0 1
Centre de Biologie Pathologie Génétique,Centre Hospitalier Universitaire de Lille 0 0 0 1 0 0 0 1
Hereditary Research Laboratory,Bethlehem University 0 4 0 0 0 0 1 1
Department of Cardiovascular and Internal Medicine,Kanazawa University Graduate School of Medicine 0 0 0 1 0 0 0 1
Institute of Molecular Biology and Genetics,Federal Almazov North-West Medical Research Centre 0 3 0 0 0 0 1 1
Institute of Human Genetics, Univ. Regensburg,Univ. Regensburg 0 2 0 1 0 0 0 1
Donald Williams Parsons Laboratory,Baylor College of Medicine 0 5 0 1 0 0 0 1
Reutter Lab, Institute of Human Genetics,University Hospital Bonn 0 0 0 0 0 0 1 1
Oxford Haemato-Oncology Service,Oxford University Hospitals NHS Foundation Trust 0 0 0 0 0 1 0 1
Unit for Genetic & Epidemiological Research on Neurological Disorders,Instituto de Investigação e Inovação em Saúde 0 0 0 1 0 0 0 1
Endocrine oncology group,Uppsala University 0 0 0 1 0 0 0 1
Herman Laboratory,Nationwide Children's Hospital 0 1 0 1 0 0 0 1
RBHT Clinical Genetics and Genomics Laboratory,Royal Brompton and Harefield NHS Foundation Trust 0 2 0 1 0 0 0 1
Department of Laboratory Medicine and Genetics,Trillium Health Partners Credit Valley Hospital 0 7 0 0 0 0 1 1
CHLA Center for Personalized Medicine,Children's Hospital, Los Angeles 0 12 0 1 0 0 0 1
Rare Disease Group, Clinical Genetics,Karolinska Institutet 0 0 0 0 0 0 1 1
Medical & Molecular Genetics Group,University of Lincoln 0 1 0 0 0 0 1 1
Pediatric Nephrology (Iijima Lab),Kobe University Graduate School of Medicine 0 0 0 0 1 0 0 1
Bioinformatics Core,Luxembourg Center for Systems Biomedicine 0 0 0 0 0 0 1 1
Dan Cohn Lab,University Of California Los Angeles 0 0 0 1 0 0 0 1
Molecular Medicine,University of Leeds 0 0 0 1 0 0 0 1
Laboratory of Diagnosis and Therapy of Lysosomal Disorders,University of Padova 0 0 0 0 0 0 1 1
Laboratory of Molecular Neuropathology,The University of Texas Health Science Center at Houston 0 0 0 0 0 0 1 1
Dept. of Medical Genetics, Telemark Hospital Trust 0 0 0 0 0 0 1 1
Medical Genetics Summaries 0 0 0 0 0 1 0 1
Cancer Diagnostics Division,Gene Solutions 0 0 0 1 0 0 0 1
Broad Institute Rare Disease Group,Broad Institute 0 6 0 1 0 0 0 1
Liping Wei Laboratory,Peking University 0 1 0 0 0 0 1 1
Clinical Cancer Genetics and Family Consultants,Athens Medical Center 0 0 0 0 0 0 1 1
Dr. Alfred Bastarche Laboratory,Dr. Georges L. Dumont University Hospital Centre 0 0 0 0 0 0 1 1
Core Molecular Diagnostic Lab,McGill University Health Centre 0 0 0 1 0 0 0 1
Breda Genetics srl 0 0 0 0 0 0 1 1
ClinGen CDH1 Variant Curation Expert Panel 0 0 0 1 0 0 0 1
Molecular Genetics Laboratory,University Hospital Copenhagen 0 0 0 0 0 0 1 1

All variants with conflicting interpretations #

Total variants: 7752
Download table as spreadsheet
HGVS dbSNP
G6PD:c.1455-13T>C rs2071429
NC_000012.12:g.121626879_121626884delACCGCC rs1555322544
NC_012920.1:m.1555A>G rs267606617
NM_000014.5(A2M):c.2126-6_2126-2del rs1799759
NM_000016.5(ACADM):c.199T>C (p.Tyr67His) rs121434280
NM_000018.3(ACADVL):c.848T>C (p.Val283Ala) rs113994167
NM_000020.2(ACVRL1):c.1131A>G (p.Ala377=) rs61734313
NM_000020.2(ACVRL1):c.1246+9C>T rs115378744
NM_000020.2(ACVRL1):c.1445C>T (p.Ala482Val) rs139142865
NM_000020.2(ACVRL1):c.747G>A (p.Val249=) rs1058563
NM_000022.2(ADA):c.390G>A (p.Val130=) rs61737144
NM_000022.2(ADA):c.845G>A (p.Arg282Gln) rs751635016
NM_000022.3(ADA):c.239A>G (p.Lys80Arg) rs11555566
NM_000022.3(ADA):c.704G>A (p.Arg235Gln) rs79281338
NM_000023.3(SGCA):c.933C>T (p.Val311=) rs1801191
NM_000026.2(ADSL):c.153+1G>T rs1555903969
NM_000027.3(AGA):c.281+13T>G rs34241758
NM_000030.2(AGXT):c.26C>A (p.Thr9Asn) rs115014558
NM_000031.5(ALAD):c.718C>T (p.Arg240Trp) rs121912982
NM_000038.5(APC):c.1240C>T (p.Arg414Cys) rs137854567
NM_000038.5(APC):c.1458T>C (p.Tyr486=) rs2229992
NM_000038.5(APC):c.1604C>T (p.Ser535Phe) rs75870842
NM_000038.5(APC):c.1631T>C (p.Ile544Thr) rs144056494
NM_000038.5(APC):c.1635G>A (p.Ala545=) rs351771
NM_000038.5(APC):c.2608C>T (p.Pro870Ser) rs33974176
NM_000038.5(APC):c.2805C>T (p.Tyr935=) rs137854575
NM_000038.5(APC):c.295C>T (p.Arg99Trp) rs139196838
NM_000038.5(APC):c.317G>A (p.Arg106His) rs201764637
NM_000038.5(APC):c.3479C>A (p.Thr1160Lys) rs201004111
NM_000038.5(APC):c.3927_3931delAAAGA (p.Glu1309Aspfs) rs121913224
NM_000038.5(APC):c.3949G>C (p.Glu1317Gln) rs1801166
NM_000038.5(APC):c.4237A>G (p.Met1413Val) rs141519952
NM_000038.5(APC):c.4360A>G (p.Lys1454Glu) rs111866410
NM_000038.5(APC):c.4479G>A (p.Thr1493=) rs41115
NM_000038.5(APC):c.5034G>A (p.Gly1678=) rs42427
NM_000038.5(APC):c.5265G>A (p.Ala1755=) rs34506289
NM_000038.5(APC):c.5268T>G (p.Ser1756=) rs866006
NM_000038.5(APC):c.5392A>G (p.Asn1798Asp) rs200794097
NM_000038.5(APC):c.5801C>T (p.Pro1934Leu) rs587780600
NM_000038.5(APC):c.5880G>A (p.Pro1960=) rs465899
NM_000038.5(APC):c.5912C>G (p.Ser1971Cys) rs754691867
NM_000038.5(APC):c.607C>G (p.Gln203Glu) rs141576417
NM_000038.5(APC):c.6679G>T (p.Gly2227Cys) rs367905430
NM_000038.5(APC):c.6873A>T (p.Gln2291His) rs148878262
NM_000038.5(APC):c.70C>T (p.Arg24Ter) rs145945630
NM_000038.5(APC):c.7201C>T (p.Leu2401=) rs2229994
NM_000038.5(APC):c.7399C>A (p.Pro2467Thr) rs372305287
NM_000038.5(APC):c.7704A>G (p.Gly2568=) rs35043160
NM_000038.5(APC):c.7717A>G (p.Ile2573Val) rs145444830
NM_000038.5(APC):c.8068G>A (p.Ala2690Thr) rs140868933
NM_000038.5(APC):c.8383G>A (p.Ala2795Thr) rs369264968
NM_000038.5(APC):c.933+5C>A rs573528468
NM_000038.6(APC):c.5465T>A (p.Val1822Asp) rs459552
NM_000046.4(ARSB):c.1450A>G (p.Arg484Gly) rs201101343
NM_000047.2(ARSE):c.410G>C (p.Gly137Ala) rs80338711
NM_000048.3(ASL):c.578G>A (p.Arg193Gln) rs373697663
NM_000050.4(ASS1):c.787G>A (p.Val263Met) rs192838388
NM_000051.3(ATM):c.3285-9delT rs1799757
NM_000051.3(ATM):c.3403-14dupA rs3218681
NM_000051.3(ATM):c.4578C>T (p.Pro1526=) rs1800889
NM_000051.3(ATM):c.5557G>A (p.Asp1853Asn) rs1801516
NM_000051.3(ATM):c.5793T>C (p.Ala1931=) rs3092910
NM_000053.3(ATP7B):c.2804C>T (p.Thr935Met) rs750019452
NM_000053.3(ATP7B):c.3688A>G (p.Ile1230Val) rs200911496
NM_000054.5(AVPR2):c.26-6T>G rs56689668
NM_000057.3(BLM):c.2207_2212delATCTGAinsTAGATTC (p.Tyr736Leufs) rs113993962
NM_000057.3(BLM):c.2555+7T>C rs3815003
NM_000057.3(BLM):c.3102G>A (p.Thr1034=) rs2227933
NM_000057.3(BLM):c.3531C>A (p.Ala1177=) rs2227934
NM_000057.3(BLM):c.3945C>T (p.Leu1315=) rs1063147
NM_000059.3(BRCA2):c.10045A>G (p.Thr3349Ala) rs80358387
NM_000059.3(BRCA2):c.10095_10096insT (p.Ser3366Terfs) rs730881599
NM_000059.3(BRCA2):c.10202C>T (p.Thr3401Met) rs55853199
NM_000059.3(BRCA2):c.10234A>G (p.Ile3412Val) rs1801426
NM_000059.3(BRCA2):c.1151C>T (p.Ser384Phe) rs41293475
NM_000059.3(BRCA2):c.1385A>G (p.Glu462Gly) rs56403624
NM_000059.3(BRCA2):c.1514T>C (p.Ile505Thr) rs28897708
NM_000059.3(BRCA2):c.1786G>C (p.Asp596His) rs56328701
NM_000059.3(BRCA2):c.1792A>G (p.Thr598Ala) rs28897710
NM_000059.3(BRCA2):c.223G>C (p.Ala75Pro) rs28897701
NM_000059.3(BRCA2):c.231T>G (p.Thr77=) rs114446594
NM_000059.3(BRCA2):c.2350A>G (p.Met784Val) rs11571653
NM_000059.3(BRCA2):c.2803G>A (p.Asp935Asn) rs28897716
NM_000059.3(BRCA2):c.3055C>G (p.Leu1019Val) rs55638633
NM_000059.3(BRCA2):c.3167_3170delAAAA (p.Gln1056Argfs) rs80359372
NM_000059.3(BRCA2):c.3515C>T (p.Ser1172Leu) rs80358600
NM_000059.3(BRCA2):c.3545_3546delTT (p.Phe1182Terfs) rs80359388
NM_000059.3(BRCA2):c.4037_4043delCTGTTTGinsT (p.Thr1346_Cys1348delinsIle) rs276174841
NM_000059.3(BRCA2):c.4146_4148delAGA (p.Glu1382del) rs80359432
NM_000059.3(BRCA2):c.4187A>G (p.Gln1396Arg) rs55969723
NM_000059.3(BRCA2):c.4284dupT (p.Gln1429Serfs) rs80359439
NM_000059.3(BRCA2):c.4585G>A (p.Gly1529Arg) rs28897728
NM_000059.3(BRCA2):c.4588A>T (p.Lys1530Ter) rs80358692
NM_000059.3(BRCA2):c.4656T>C (p.Gly1552=) rs41293491
NM_000059.3(BRCA2):c.5070A>C (p.Lys1690Asn) rs56087561
NM_000059.3(BRCA2):c.517-2A>G rs81002858
NM_000059.3(BRCA2):c.5199C>T (p.Ser1733=) rs28897734
NM_000059.3(BRCA2):c.5312G>A (p.Gly1771Asp) rs80358755
NM_000059.3(BRCA2):c.5744C>T (p.Thr1915Met) rs4987117
NM_000059.3(BRCA2):c.5785A>G (p.Ile1929Val) rs79538375
NM_000059.3(BRCA2):c.5946delT (p.Ser1982Argfs) rs80359550
NM_000059.3(BRCA2):c.5986G>A (p.Ala1996Thr) rs80358833
NM_000059.3(BRCA2):c.6037A>T (p.Lys2013Ter) rs80358840
NM_000059.3(BRCA2):c.6220C>A (p.His2074Asn) rs34309943
NM_000059.3(BRCA2):c.6323G>A (p.Arg2108His) rs35029074
NM_000059.3(BRCA2):c.658_659delGT (p.Val220Ilefs) rs80359604
NM_000059.3(BRCA2):c.68-7T>A rs81002830
NM_000059.3(BRCA2):c.7017G>C (p.Lys2339Asn) rs45574331
NM_000059.3(BRCA2):c.7057G>C (p.Gly2353Arg) rs80358935
NM_000059.3(BRCA2):c.7150C>A (p.Gln2384Lys) rs55977008
NM_000059.3(BRCA2):c.7397C= (p.Ala2466=) rs169547
NM_000059.3(BRCA2):c.7504C>T (p.Arg2502Cys) rs55716624
NM_000059.3(BRCA2):c.7544C>T (p.Thr2515Ile) rs28897744
NM_000059.3(BRCA2):c.7878G>C (p.Trp2626Cys) rs80359013
NM_000059.3(BRCA2):c.7994A>G (p.Asp2665Gly) rs28897745
NM_000059.3(BRCA2):c.8149G>T (p.Ala2717Ser) rs28897747
NM_000059.3(BRCA2):c.8243G>A (p.Gly2748Asp) rs80359071
NM_000059.3(BRCA2):c.831T>G (p.Asn277Lys) rs28897705
NM_000059.3(BRCA2):c.8432A>G (p.Asp2811Gly) rs80359090
NM_000059.3(BRCA2):c.8503T>C (p.Ser2835Pro) rs11571746
NM_000059.3(BRCA2):c.8567A>C (p.Glu2856Ala) rs11571747
NM_000059.3(BRCA2):c.8755-1G>A rs81002812
NM_000059.3(BRCA2):c.8830A>T (p.Ile2944Phe) rs4987047
NM_000059.3(BRCA2):c.8850G>T (p.Lys2950Asn) rs28897754
NM_000059.3(BRCA2):c.8851G>A (p.Ala2951Thr) rs11571769
NM_000059.3(BRCA2):c.9004G>A (p.Glu3002Lys) rs80359152
NM_000059.3(BRCA2):c.9038C>T (p.Thr3013Ile) rs28897755
NM_000059.3(BRCA2):c.9292T>C (p.Tyr3098His) rs41293521
NM_000059.3(BRCA2):c.9586A>G (p.Lys3196Glu) rs80359228
NM_000059.3(BRCA2):c.964A>C (p.Lys322Gln) rs11571640
NM_000059.3(BRCA2):c.978C>A (p.Ser326Arg) rs28897706
NM_000059.3(BRCA2):c.9875C>T (p.Pro3292Leu) rs56121817
NM_000061.2(BTK):c.615G>T (p.Glu205Asp) rs35877704
NM_000063.5(C2):c.1023G>A (p.Ala341=) rs1042663
NM_000063.5(C2):c.954G>C (p.Glu318Asp) rs9332739
NM_000069.2(CACNA1S):c.2691G>T (p.Arg897Ser) rs80338779
NM_000069.2(CACNA1S):c.4060A>T (p.Thr1354Ser) rs145910245
NM_000069.2(CACNA1S):c.530C>T (p.Ser177Leu) rs141204958
NM_000070.2(CAPN3):c.1468C>T (p.Arg490Trp) rs141656719
NM_000070.2(CAPN3):c.318C>T (p.Cys106=) rs117609395
NM_000070.2(CAPN3):c.319G>A (p.Glu107Lys) rs1801505
NM_000070.2(CAPN3):c.96T>C (p.Thr32=) rs1801496
NM_000071.2(CBS):c.*540G>A rs111386779
NM_000071.2(CBS):c.304A>C (p.Lys102Gln) rs34040148
NM_000071.2(CBS):c.531+11G>A rs186114513
NM_000071.2(CBS):c.573G>A (p.Thr191=) rs73906420
NM_000073.2(CD3G):c.390T>C (p.Ala130=) rs3753059
NM_000073.2(CD3G):c.391G>T (p.Val131Phe) rs3753058
NM_000076.2(CDKN1C):c.555T>C (p.Ala185=) rs191294997
NM_000077.4(CDKN2A):c.-25C>T rs144481587
NM_000077.4(CDKN2A):c.150+37G>C rs45456595
NM_000081.3(LYST):c.11268-5delT rs36014994
NM_000081.3(LYST):c.7137A>C (p.Leu2379=) rs61738992
NM_000081.3(LYST):c.9C>T (p.Thr3=) rs33998267
NM_000085.4(CLCNKB):c.1877G>A (p.Cys626Tyr) rs143663847
NM_000085.4(CLCNKB):c.577-5C>T rs1889788
NM_000090.3(COL3A1):c.1051-13G>A rs371934572
NM_000090.3(COL3A1):c.119C>T (p.Ala40Val) rs201380807
NM_000090.3(COL3A1):c.2002C>A (p.Pro668Thr) rs1801183
NM_000090.3(COL3A1):c.3133G>A (p.Ala1045Thr) rs149722210
NM_000090.3(COL3A1):c.3938A>G (p.Lys1313Arg) rs111840783
NM_000091.4(COL4A3):c.1223G>A (p.Arg408His) rs34505188
NM_000091.4(COL4A3):c.1352A>G (p.His451Arg) rs11677877
NM_000091.4(COL4A3):c.1452G>A (p.Gly484=) rs34019152
NM_000091.4(COL4A3):c.1576-15T>G rs56243460
NM_000091.4(COL4A3):c.2715C>T (p.Pro905=) rs75519005
NM_000091.4(COL4A3):c.3258G>A (p.Gly1086=) rs147085074
NM_000091.4(COL4A3):c.3807C>A (p.Asp1269Glu) rs57611801
NM_000091.4(COL4A3):c.4041C>A (p.Asp1347Glu) rs73996414
NM_000091.4(COL4A3):c.766-13G>A rs77431913
NM_000091.4(COL4A3):c.805G>A (p.Glu269Lys) rs80109666
NM_000091.4(COL4A3):c.88-4C>T rs148393022
NM_000091.4(COL4A3):c.976G>T (p.Asp326Tyr) rs55703767
NM_000092.4(COL4A4):c.1323T>C (p.Pro441=) rs35830639
NM_000092.4(COL4A4):c.1634G>C (p.Gly545Ala) rs1800516
NM_000092.4(COL4A4):c.1821G>A (p.Ala607=) rs114684841
NM_000092.4(COL4A4):c.2384-5T>C rs3769641
NM_000092.4(COL4A4):c.2899A>G (p.Ile967Val) rs80243096
NM_000092.4(COL4A4):c.2996G>A (p.Gly999Glu) rs13027659
NM_000092.4(COL4A4):c.3233C>T (p.Ala1078Val) rs79143859
NM_000092.4(COL4A4):c.3963T>C (p.Asp1321=) rs116124529
NM_000092.4(COL4A4):c.3979G>A (p.Val1327Met) rs2229813
NM_000092.4(COL4A4):c.4656G>A (p.Met1552Ile) rs77104306
NM_000092.4(COL4A4):c.948T>C (p.Tyr316=) rs34509421
NM_000093.4(COL5A1):c.1588G>A (p.Gly530Ser) rs61735045
NM_000098.2(CPT2):c.338C>T (p.Ser113Leu) rs74315294
NM_000104.3(CYP1B1):c.1103G>A (p.Arg368His) rs79204362
NM_000109.3(DMD):c.9658T>C (p.Phe3220Leu) rs141392048
NM_000112.3(SLC26A2):c.835C>T (p.Arg279Trp) rs104893915
NM_000115.4(EDNRB):c.*1767C>T rs3027092
NM_000115.4(EDNRB):c.1194+15C>T rs886050325
NM_000115.4(EDNRB):c.1239C>G (p.Ser413=) rs139317762
NM_000115.4(EDNRB):c.169G>A (p.Gly57Ser) rs1801710
NM_000115.4(EDNRB):c.49C>T (p.Leu17Phe) rs5346
NM_000115.4(EDNRB):c.561C>T (p.Ile187=) rs5349
NM_000116.4(TAZ):c.331C>T (p.His111Tyr) rs200405157
NM_000116.4(TAZ):c.383T>C (p.Phe128Ser) rs146934311
NM_000116.4(TAZ):c.873G>A (p.Gly291=) rs35902788
NM_000117.2(EMD):c.144C>T (p.Leu48=) rs200537612
NM_000117.2(EMD):c.272A>G (p.Asn91Ser) rs137977232
NM_000117.2(EMD):c.396C>T (p.His132=) rs145985318
NM_000117.2(EMD):c.400-9C>T rs782061626
NM_000117.2(EMD):c.646G>A (p.Gly216Arg) rs147920229
NM_000118.3(ENG):c.1029C>T (p.Thr343=) rs3739817
NM_000118.3(ENG):c.1060C>T (p.Leu354=) rs36092484
NM_000118.3(ENG):c.1096G>C (p.Asp366His) rs1800956
NM_000118.3(ENG):c.120C>T (p.Gly40=) rs41522944
NM_000118.3(ENG):c.14C>T (p.Thr5Met) rs35400405
NM_000118.3(ENG):c.1633G>A (p.Gly545Ser) rs142896669
NM_000118.3(ENG):c.1794T>C (p.Gly598=) rs41358947
NM_000118.3(ENG):c.1844C>T (p.Ser615Leu) rs148002300
NM_000118.3(ENG):c.207G>A (p.Leu69=) rs11545664
NM_000118.3(ENG):c.219+22C>T rs370257876
NM_000118.3(ENG):c.572G>A (p.Gly191Asp) rs41322046
NM_000118.3(ENG):c.909C>T (p.Ala303=) rs200306464
NM_000130.4(F5):c.1601G>A (p.Arg534Gln) rs6025
NM_000130.4(F5):c.6443T>C (p.Met2148Thr) rs9332701
NM_000132.3(F8):c.3169G>A (p.Glu1057Lys) rs28933673
NM_000136.2(FANCC):c.584A>T (p.Asp195Val) rs1800365
NM_000137.2(FAH):c.1062+5G>A rs80338901
NM_000138.4(FBN1):c.1029G>A (p.Gly343=) rs75655780
NM_000138.4(FBN1):c.1148-2A>G rs397515756
NM_000138.4(FBN1):c.1345G>A (p.Val449Ile) rs139058991
NM_000138.4(FBN1):c.1453C>T (p.Arg485Cys) rs137854485
NM_000138.4(FBN1):c.1468+5G>A rs397515757
NM_000138.4(FBN1):c.1746C>T (p.Cys582=) rs112366266
NM_000138.4(FBN1):c.1846G>A (p.Glu616Lys) rs397515764
NM_000138.4(FBN1):c.184C>T (p.Arg62Cys) rs25403
NM_000138.4(FBN1):c.185G>A (p.Arg62His) rs145942328
NM_000138.4(FBN1):c.1879C>T (p.Arg627Cys) rs727503057
NM_000138.4(FBN1):c.2055C>G (p.Cys685Trp) rs140603
NM_000138.4(FBN1):c.2175T>C (p.Asn725=) rs140606
NM_000138.4(FBN1):c.2489G>C (p.Cys830Ser) rs397515774
NM_000138.4(FBN1):c.2495G>A (p.Cys832Tyr) rs397515775
NM_000138.4(FBN1):c.2855-9C>T rs140590
NM_000138.4(FBN1):c.2895G>A (p.Glu965=) rs140591
NM_000138.4(FBN1):c.2927G>A (p.Arg976His) rs140954477
NM_000138.4(FBN1):c.2956G>A (p.Ala986Thr) rs112287730
NM_000138.4(FBN1):c.3012C>G (p.Tyr1004Ter) rs397515784
NM_000138.4(FBN1):c.3037G>A (p.Gly1013Arg) rs140593
NM_000138.4(FBN1):c.3058A>G (p.Thr1020Ala) rs111801777
NM_000138.4(FBN1):c.306C>T (p.Cys102=) rs25388
NM_000138.4(FBN1):c.3082+8delG rs193922196
NM_000138.4(FBN1):c.3193delG (p.Glu1065Lysfs) rs193922198
NM_000138.4(FBN1):c.3294C>T (p.Asp1098=) rs140587
NM_000138.4(FBN1):c.3373C>T (p.Arg1125Ter) rs727505006
NM_000138.4(FBN1):c.3422C>T (p.Pro1141Leu) rs2228241
NM_000138.4(FBN1):c.3423G>A (p.Pro1141=) rs140396599
NM_000138.4(FBN1):c.3463+3A>G rs80344206
NM_000138.4(FBN1):c.3509G>A (p.Arg1170His) rs137854475
NM_000138.4(FBN1):c.3514G>A (p.Val1172Met) rs200125037
NM_000138.4(FBN1):c.3675G>A (p.Pro1225=) rs148147223
NM_000138.4(FBN1):c.378A>G (p.Gly126=) rs149611106
NM_000138.4(FBN1):c.3965-8T>C rs140637
NM_000138.4(FBN1):c.4222T>C (p.Cys1408Arg) rs397515802
NM_000138.4(FBN1):c.4259G>A (p.Cys1420Tyr) rs397515804
NM_000138.4(FBN1):c.4306G>A (p.Val1436Met) rs377338217
NM_000138.4(FBN1):c.4441A>G (p.Ser1481Gly) rs61730054
NM_000138.4(FBN1):c.4467T>A (p.Asn1489Lys) rs193922205
NM_000138.4(FBN1):c.4505G>A (p.Cys1502Tyr) rs397515810
NM_000138.4(FBN1):c.4567C>T (p.Arg1523Ter) rs397515812
NM_000138.4(FBN1):c.4588C>T (p.Arg1530Cys) rs111401431
NM_000138.4(FBN1):c.4640C>T (p.Thr1547Ile) rs183306990
NM_000138.4(FBN1):c.4683C>T (p.Ser1561=) rs148024160
NM_000138.4(FBN1):c.4750G>A (p.Glu1584Lys) rs148888513
NM_000138.4(FBN1):c.4781G>A (p.Gly1594Asp) rs267606798
NM_000138.4(FBN1):c.4905C>G (p.Thr1635=) rs113115949
NM_000138.4(FBN1):c.4937G>A (p.Cys1646Tyr) rs397515814
NM_000138.4(FBN1):c.4955G>A (p.Cys1652Tyr) rs397515817
NM_000138.4(FBN1):c.5065+10A>G rs375945405
NM_000138.4(FBN1):c.510C>T (p.Tyr170=) rs111671429
NM_000138.4(FBN1):c.5343G>A (p.Val1781=) rs140649
NM_000138.4(FBN1):c.5442C>T (p.Asn1814=) rs397515822
NM_000138.4(FBN1):c.5504G>A (p.Cys1835Tyr) rs111929350
NM_000138.4(FBN1):c.5747G>A (p.Cys1916Tyr) rs397515827
NM_000138.4(FBN1):c.5788+10C>A rs371560107
NM_000138.4(FBN1):c.5788+5G>A rs193922219
NM_000138.4(FBN1):c.5959G>C (p.Gly1987Arg) rs727504642
NM_000138.4(FBN1):c.59A>G (p.Tyr20Cys) rs201309310
NM_000138.4(FBN1):c.6288C>T (p.Cys2096=) rs144822241
NM_000138.4(FBN1):c.6314-15G>A rs200841830
NM_000138.4(FBN1):c.6354C>T (p.Ile2118=) rs112989722
NM_000138.4(FBN1):c.6379+1G>A rs397515833
NM_000138.4(FBN1):c.6393C>T (p.Cys2131=) rs61730051
NM_000138.4(FBN1):c.6446A>G (p.Tyr2149Cys) rs113080385
NM_000138.4(FBN1):c.6594C>T (p.Pro2198=) rs111844882
NM_000138.4(FBN1):c.6658C>T (p.Arg2220Ter) rs113001196
NM_000138.4(FBN1):c.6681A>C (p.Ser2227=) rs363824
NM_000138.4(FBN1):c.6700G>A (p.Val2234Met) rs112084407
NM_000138.4(FBN1):c.6806T>C (p.Ile2269Thr) rs193922228
NM_000138.4(FBN1):c.6832C>T (p.Pro2278Ser) rs363835
NM_000138.4(FBN1):c.7098C>T (p.Asp2366=) rs1005074
NM_000138.4(FBN1):c.718C>T (p.Arg240Cys) rs137854480
NM_000138.4(FBN1):c.7346A>G (p.Asn2449Ser) rs146166400
NM_000138.4(FBN1):c.7497A>G (p.Leu2499=) rs148516442
NM_000138.4(FBN1):c.7540G>A (p.Gly2514Arg) rs363811
NM_000138.4(FBN1):c.7606G>A (p.Gly2536Arg) rs397515854
NM_000138.4(FBN1):c.7661G>A (p.Arg2554Gln) rs199522781
NM_000138.4(FBN1):c.7754T>C (p.Ile2585Thr) rs727503054
NM_000138.4(FBN1):c.7892G>A (p.Cys2631Tyr) rs111856492
NM_000138.4(FBN1):c.7950T>C (p.Asn2650=) rs143055643
NM_000138.4(FBN1):c.79G>A (p.Ala27Thr) rs25397
NM_000138.4(FBN1):c.8283A>T (p.Thr2761=) rs146120912
NM_000138.4(FBN1):c.8378A>G (p.Tyr2793Cys) rs397515863
NM_000138.4(FBN1):c.8385C>T (p.Ile2795=) rs138574576
NM_000138.4(FBN1):c.8502T>C (p.Thr2834=) rs363847
NM_000138.4(FBN1):c.986T>C (p.Ile329Thr) rs12324002
NM_000140.3(FECH):c.362A>G (p.Glu121Gly) rs141813907
NM_000140.4(FECH):c.163G>T (p.Gly55Cys) rs3848519
NM_000147.4(FUCA1):c.29C>G (p.Pro10Arg) rs2070956
NM_000152.4(GAA):c.-32-13T>G rs386834236
NM_000153.3(GALC):c.334A>G (p.Thr112Ala) rs147313927
NM_000161.2(GCH1):c.68C>T (p.Pro23Leu) rs41298432
NM_000169.2(GLA):c.-12G>A rs3027585
NM_000169.2(GLA):c.1055C>G (p.Ala352Gly) rs869312162
NM_000169.2(GLA):c.1066C>T (p.Arg356Trp) rs104894827
NM_000169.2(GLA):c.1102G>A (p.Ala368Thr) rs144994244
NM_000169.2(GLA):c.1153A>G (p.Thr385Ala) rs397515869
NM_000169.2(GLA):c.129C>T (p.Gly43=) rs146177035
NM_000169.2(GLA):c.196G>C (p.Glu66Gln) rs104894833
NM_000169.2(GLA):c.352C>T (p.Arg118Cys) rs148158093
NM_000169.2(GLA):c.376A>G (p.Ser126Gly) rs149391489
NM_000169.2(GLA):c.427G>A (p.Ala143Thr) rs104894845
NM_000169.2(GLA):c.427G>C (p.Ala143Pro) rs104894845
NM_000169.2(GLA):c.48T>G (p.Leu16=) rs201449986
NM_000169.2(GLA):c.613C>A (p.Pro205Thr) rs397515870
NM_000169.2(GLA):c.639+6A>C rs200096940
NM_000169.2(GLA):c.639+919G>A rs199473684
NM_000169.2(GLA):c.714T>C (p.Ser238=) rs397515872
NM_000169.2(GLA):c.758T>C (p.Ile253Thr) rs727505292
NM_000169.2(GLA):c.865A>G (p.Ile289Val) rs140329381
NM_000169.2(GLA):c.8T>C (p.Leu3Pro) rs150547672
NM_000169.2(GLA):c.937G>T (p.Asp313Tyr) rs28935490
NM_000169.2(GLA):c.945C>T (p.Asp315=) rs151208856
NM_000169.2(GLA):c.978G>A (p.Lys326=) rs151195362
NM_000171.3(GLRA1):c.1108G>A (p.Gly370Ser) rs116474260
NM_000179.2(MSH6):c.1019T>C (p.Phe340Ser) rs61753793
NM_000179.2(MSH6):c.1037C>T (p.Ser346Phe) rs567785169
NM_000179.2(MSH6):c.10C>T (p.Gln4Ter) rs786201042
NM_000179.2(MSH6):c.1164C>T (p.His388=) rs55708305
NM_000179.2(MSH6):c.116G>A (p.Gly39Glu) rs1042821
NM_000179.2(MSH6):c.1346T>C (p.Leu449Pro) rs63750741
NM_000179.2(MSH6):c.1474A>G (p.Met492Val) rs61754783
NM_000179.2(MSH6):c.1526T>C (p.Val509Ala) rs63751005
NM_000179.2(MSH6):c.186C>A (p.Arg62=) rs1042820
NM_000179.2(MSH6):c.2272C>T (p.Leu758=) rs56371757
NM_000179.2(MSH6):c.2398G>C (p.Val800Leu) rs61748083
NM_000179.2(MSH6):c.2561A>T (p.Lys854Met) rs34374438
NM_000179.2(MSH6):c.276A>G (p.Pro92=) rs1800932
NM_000179.2(MSH6):c.2927G>A (p.Arg976His) rs63751113
NM_000179.2(MSH6):c.3173-1G>C rs397515875
NM_000179.2(MSH6):c.3246G>T (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3259C>T (p.Pro1087Ser) rs63750998
NM_000179.2(MSH6):c.3261dupC (p.Phe1088Leufs) rs267608078
NM_000179.2(MSH6):c.3334G>A (p.Asp1112Asn) rs773955368
NM_000179.2(MSH6):c.3438+14A>T rs2020911
NM_000179.2(MSH6):c.3439-2A>G rs267608098
NM_000179.2(MSH6):c.3476dupA (p.Tyr1159Terfs) rs587782111
NM_000179.2(MSH6):c.3488A>T (p.Glu1163Val) rs63750252
NM_000179.2(MSH6):c.3601C>G (p.Leu1201Val) rs182024561
NM_000179.2(MSH6):c.3724C>A (p.Arg1242Ser) rs587779285
NM_000179.2(MSH6):c.3851C>T (p.Thr1284Met) rs63750836
NM_000179.2(MSH6):c.3939_3940dupTC (p.Gln1314Leufs) rs730881830
NM_000179.2(MSH6):c.3961A>G (p.Arg1321Gly) rs41295278
NM_000179.2(MSH6):c.3991C>T (p.Arg1331Ter) rs267608094
NM_000179.2(MSH6):c.4001G>A (p.Arg1334Gln) rs267608122
NM_000179.2(MSH6):c.4002-10T>A rs545466048
NM_000179.2(MSH6):c.431G>T (p.Ser144Ile) rs3211299
NM_000179.2(MSH6):c.503C>G (p.Ala168Gly) rs774162322
NM_000179.2(MSH6):c.540T>C (p.Asp180=) rs1800935
NM_000179.2(MSH6):c.59C>T (p.Ala20Val) rs63750664
NM_000179.2(MSH6):c.642C>T (p.Tyr214=) rs1800937
NM_000179.2(MSH6):c.73G>T (p.Ala25Ser) rs267608026
NM_000179.2(MSH6):c.866_867delGCinsAA (p.Gly289Glu) rs267608079
NM_000179.2(MSH6):c.884A>G (p.Lys295Arg) rs267608051
NM_000179.2(MSH6):c.892C>T (p.Arg298Ter) rs146816935
NM_000180.3(GUCY2D):c.2101C>T (p.Pro701Ser) rs34598902
NM_000192.3(TBX5):c.710G>A (p.Arg237Gln) rs104894378
NM_000195.4(HPS1):c.11T>C (p.Val4Ala) rs58548334
NM_000195.4(HPS1):c.1472C>G (p.Pro491Arg) rs2296434
NM_000195.4(HPS1):c.1472_1487dup16 (p.His497Glnfs) rs281865163
NM_000195.4(HPS1):c.1808A>G (p.Gln603Arg) rs2296436
NM_000195.4(HPS1):c.297C>T (p.Thr99=) rs11539873
NM_000195.4(HPS1):c.847G>T (p.Gly283Trp) rs11592273
NM_000195.4(HPS1):c.972dupC (p.Met325Hisfs) rs281865082
NM_000195.4(HPS1):c.987+13T>C rs12571249
NM_000204.4(CFI):c.1534+5G>T rs114013791
NM_000209.3(PDX1):c.725C>T (p.Pro242Leu) rs193922358
NM_000211.4(ITGB2):c.31C>T (p.Leu11=) rs5030667
NM_000211.4(ITGB2):c.742-13G>A rs5030670
NM_000214.3(JAG1):c.2612C>G (p.Pro871Arg) rs35761929
NM_000214.3(JAG1):c.267G>A (p.Gly89=) rs1051415
NM_000214.3(JAG1):c.270G>T (p.Gly90=) rs114048678
NM_000214.3(JAG1):c.436G>A (p.Val146Ile) rs6040067
NM_000214.3(JAG1):c.588C>T (p.Cys196=) rs1801138
NM_000214.3(JAG1):c.744A>G (p.Pro248=) rs10485741
NM_000214.3(JAG1):c.924C>T (p.Asn308=) rs45575136
NM_000215.3(JAK3):c.452C>G (p.Pro151Arg) rs55778349
NM_000218.2(KCNQ1):c.-5T>C rs532941548
NM_000218.2(KCNQ1):c.1096C>T (p.Arg366Trp) rs199473411
NM_000218.2(KCNQ1):c.1110G>A (p.Ala370=) rs1805118
NM_000218.2(KCNQ1):c.1129-8G>A rs200612600
NM_000218.2(KCNQ1):c.1179G>T (p.Lys393Asn) rs12720457
NM_000218.2(KCNQ1):c.1222C>G (p.Pro408Ala) rs28730756
NM_000218.2(KCNQ1):c.1343C>G (p.Pro448Arg) rs12720449
NM_000218.2(KCNQ1):c.1394-14C>T rs28730758
NM_000218.2(KCNQ1):c.1394-8C>T rs371488379
NM_000218.2(KCNQ1):c.1455C>T (p.Phe485=) rs17215465
NM_000218.2(KCNQ1):c.1513C>T (p.Gln505Ter) rs397508091
NM_000218.2(KCNQ1):c.1552C>T (p.Arg518Ter) rs17215500
NM_000218.2(KCNQ1):c.1590+14T>C rs11024034
NM_000218.2(KCNQ1):c.160_168dupATCGCGCCC (p.Pro56_Gly57insIleAlaPro) rs397515877
NM_000218.2(KCNQ1):c.1726G>A (p.Val576Ile) rs750409379
NM_000218.2(KCNQ1):c.1781G>A (p.Arg594Gln) rs199472815
NM_000218.2(KCNQ1):c.1794+11G>A rs186188610
NM_000218.2(KCNQ1):c.1800G>A (p.Thr600=) rs147091980
NM_000218.2(KCNQ1):c.1860C>T (p.His620=) rs139893266
NM_000218.2(KCNQ1):c.1927G>A (p.Gly643Ser) rs1800172
NM_000218.2(KCNQ1):c.1942G>A (p.Val648Ile) rs34150427
NM_000218.2(KCNQ1):c.1986C>G (p.Tyr662Ter) rs11601907
NM_000218.2(KCNQ1):c.19C>T (p.Pro7Ser) rs199473443
NM_000218.2(KCNQ1):c.207G>T (p.Ala69=) rs587781009
NM_000218.2(KCNQ1):c.225T>C (p.Val75=) rs367817352
NM_000218.2(KCNQ1):c.328G>A (p.Val110Ile) rs199472677
NM_000218.2(KCNQ1):c.435C>T (p.Ile145=) rs1800170
NM_000218.2(KCNQ1):c.447C>T (p.Ala149=) rs146436765
NM_000218.2(KCNQ1):c.459G>A (p.Thr153=) rs148121889
NM_000218.2(KCNQ1):c.477+9C>T rs28730664
NM_000218.2(KCNQ1):c.478-8C>T rs150711844
NM_000218.2(KCNQ1):c.488delT (p.Leu163Argfs) rs397508112
NM_000218.2(KCNQ1):c.513C>T (p.Tyr171=) rs139042529
NM_000218.2(KCNQ1):c.535G>A (p.Gly179Ser) rs199473394
NM_000218.2(KCNQ1):c.573_577delGCGCT (p.Arg192Cysfs) rs397508118
NM_000218.2(KCNQ1):c.585delG (p.Lys196Serfs) rs397508120
NM_000218.2(KCNQ1):c.605-11G>A rs200828849
NM_000218.2(KCNQ1):c.674C>T (p.Ser225Leu) rs199473456
NM_000218.2(KCNQ1):c.720C>T (p.His240=) rs28730754
NM_000218.2(KCNQ1):c.781-14_781-13delGT rs727503103
NM_000218.2(KCNQ1):c.811C>T (p.Leu271=) rs189991547
NM_000218.2(KCNQ1):c.820A>G (p.Ile274Val) rs199472728
NM_000219.5(KCNE1):c.162C>T (p.Phe54=) rs17173508
NM_000219.5(KCNE1):c.199C>T (p.Arg67Cys) rs199473645
NM_000219.5(KCNE1):c.221C>T (p.Ser74Leu) rs74315446
NM_000219.5(KCNE1):c.226G>A (p.Asp76Asn) rs74315445
NM_000219.5(KCNE1):c.253G>A (p.Asp85Asn) rs1805128
NM_000219.5(KCNE1):c.30G>A (p.Thr10=) rs187686559
NM_000219.5(KCNE1):c.315G>A (p.Ser105=) rs563859144
NM_000219.5(KCNE1):c.374C>T (p.Thr125Met) rs142511345
NM_000219.5(KCNE1):c.84G>A (p.Ser28=) rs17173510
NM_000231.2(SGCG):c.*13C>T rs9510701
NM_000231.2(SGCG):c.195+4_195+7delAGTA rs797045106
NM_000231.2(SGCG):c.228T>C (p.Asp76=) rs1800350
NM_000231.2(SGCG):c.347G>A (p.Arg116His) rs17314986
NM_000231.2(SGCG):c.705T>C (p.Leu235=) rs1800353
NM_000236.2(LIPC):c.866C>T (p.Ser289Phe) rs121912502
NM_000237.3(LPL):c.106G>A (p.Asp36Asn) rs1801177
NM_000238.3(KCNH2):c.1039C>T (p.Pro347Ser) rs138776684
NM_000238.3(KCNH2):c.1467C>T (p.Ile489=) rs740952
NM_000238.3(KCNH2):c.1539C>T (p.Phe513=) rs1805120
NM_000238.3(KCNH2):c.1692A>G (p.Leu564=) rs1805121
NM_000238.3(KCNH2):c.1750G>A (p.Gly584Ser) rs199473428
NM_000238.3(KCNH2):c.1956T>C (p.Tyr652=) rs1137617
NM_000238.3(KCNH2):c.2246G>T (p.Gly749Val) rs199472989
NM_000238.3(KCNH2):c.2254C>T (p.Arg752Trp) rs199472990
NM_000238.3(KCNH2):c.2398+105delC rs546898924
NM_000238.3(KCNH2):c.2467C>T (p.Arg823Trp) rs199473538
NM_000238.3(KCNH2):c.2690A>C (p.Lys897Thr) rs1805123
NM_000238.3(KCNH2):c.2750C>T (p.Pro917Leu) rs76420733
NM_000238.3(KCNH2):c.422C>T (p.Pro141Leu) rs199472864
NM_000238.3(KCNH2):c.442C>T (p.Arg148Trp) rs139544114
NM_000238.3(KCNH2):c.526C>T (p.Arg176Trp) rs36210422
NM_000238.3(KCNH2):c.560_568delGCGCGGGCG (p.Gly187_Gly189del) rs551056698
NM_000242.2(MBL2):c.170G>A (p.Gly57Glu) rs1800451
NM_000242.2(MBL2):c.378C>G (p.Leu126=) rs930507
NM_000243.2(MEFV):c.2084A>G rs104895094
NM_000243.2(MEFV):c.2177T>C (p.Val726Ala) rs28940579
NM_000243.2(MEFV):c.2282G>A (p.Arg761His) rs104895097
NM_000244.3(MEN1):c.1269C>T (p.Asp423=) rs2071313
NM_000244.3(MEN1):c.526C>T (p.Arg176Trp) rs143329068
NM_000245.3(MET):c.2908C>T (p.Arg970Cys) rs34589476
NM_000246.3(CIITA):c.2072C>A (p.Ala691Asp) rs78108426
NM_000246.3(CIITA):c.2342C>T (p.Ser781Leu) rs13330686
NM_000246.3(CIITA):c.2345T>C (p.Val782Ala) rs13336804
NM_000246.3(CIITA):c.2565G>A (p.Ala855=) rs2229321
NM_000248.3(MITF):c.1245G>A (p.Thr415=) rs36118030
NM_000248.3(MITF):c.45C>T (p.His15=) rs140663277
NM_000248.3(MITF):c.559+9C>G rs181810413
NM_000248.3(MITF):c.861A>G (p.Glu287=) rs137904015
NM_000248.3(MITF):c.952G>A (p.Glu318Lys) rs149617956
NM_000248.3(MITF):c.959T>C (p.Val320Ala) rs2055006
NM_000249.3(MLH1):c.-28A>G rs56198082
NM_000249.3(MLH1):c.1013A>G (p.Asn338Ser) rs63751467
NM_000249.3(MLH1):c.1039-8T>A rs193922367
NM_000249.3(MLH1):c.1040C>A (p.Thr347Asn) rs201541505
NM_000249.3(MLH1):c.1151T>A (p.Val384Asp) rs63750447
NM_000249.3(MLH1):c.1166G>A (p.Arg389Gln) rs63750361
NM_000249.3(MLH1):c.1217G>A (p.Ser406Asn) rs41294980
NM_000249.3(MLH1):c.1268G>A (p.Arg423Lys) rs370687064
NM_000249.3(MLH1):c.1321G>A (p.Ala441Thr) rs63750365
NM_000249.3(MLH1):c.1360G>C (p.Gly454Arg) rs63750527
NM_000249.3(MLH1):c.1379A>C (p.Glu460Ala) rs202038499
NM_000249.3(MLH1):c.1668-1G>A rs267607845
NM_000249.3(MLH1):c.1733A>G (p.Glu578Gly) rs63751612
NM_000249.3(MLH1):c.1742C>T (p.Pro581Leu) rs63751684
NM_000249.3(MLH1):c.1820T>A (p.Leu607His) rs41295284
NM_000249.3(MLH1):c.1852A>G (p.Lys618Glu) rs35001569
NM_000249.3(MLH1):c.1853A>C (p.Lys618Thr) rs63750449
NM_000249.3(MLH1):c.1976G>A (p.Arg659Gln) rs63749900
NM_000249.3(MLH1):c.199G>A (p.Gly67Arg) rs63750206
NM_000249.3(MLH1):c.2034A>G (p.Lys678=) rs894876691
NM_000249.3(MLH1):c.2066A>G (p.Gln689Arg) rs63750702
NM_000249.3(MLH1):c.2152C>T (p.His718Tyr) rs2020873
NM_000249.3(MLH1):c.394G>C (p.Asp132His) rs28930073
NM_000249.3(MLH1):c.637G>A (p.Val213Met) rs2308317
NM_000249.3(MLH1):c.655A>G (p.Ile219Val) rs1799977
NM_000249.3(MLH1):c.65G>C (p.Gly22Ala) rs41295280
NM_000249.3(MLH1):c.793C>T (p.Arg265Cys) rs63751194
NM_000249.3(MLH1):c.794G>A (p.Arg265His) rs63751448
NM_000249.3(MLH1):c.803A>G (p.Glu268Gly) rs63750650
NM_000249.3(MLH1):c.977T>C (p.Val326Ala) rs63751049
NM_000251.2(MSH2):c.1168C>T (p.Leu390Phe) rs17224367
NM_000251.2(MSH2):c.1251_1268del18insAGTT (p.Ile418Valfs) rs863225388
NM_000251.2(MSH2):c.128A>G (p.Tyr43Cys) rs17217723
NM_000251.2(MSH2):c.138C>G (p.His46Gln) rs33946261
NM_000251.2(MSH2):c.1511-41G>C rs202215396
NM_000251.2(MSH2):c.1511-9A>T rs12998837
NM_000251.2(MSH2):c.1661+12G>A rs3732183
NM_000251.2(MSH2):c.1690A>G (p.Thr564Ala) rs55778204
NM_000251.2(MSH2):c.1730T>C (p.Ile577Thr) rs63749910
NM_000251.2(MSH2):c.1774A>G (p.Met592Val) rs371614039
NM_000251.2(MSH2):c.2006-6T>C rs2303428
NM_000251.2(MSH2):c.211+9C>G rs2303426
NM_000251.2(MSH2):c.2354A>C (p.His785Pro) rs200252727
NM_000251.2(MSH2):c.2377C>G (p.Gln793Glu) rs730881769
NM_000251.2(MSH2):c.2503A>C (p.Asn835His) rs41295296
NM_000251.2(MSH2):c.2576_2584delAATCGCAAG (p.Glu859_Gln861del) rs587781278
NM_000251.2(MSH2):c.2579C>T (p.Ser860Leu) rs63750849
NM_000251.2(MSH2):c.2680dupA (p.Met894Asnfs) rs876658211
NM_000251.2(MSH2):c.2732T>G (p.Leu911Arg) rs41295182
NM_000251.2(MSH2):c.304G>A (p.Val102Ile) rs193922373
NM_000251.2(MSH2):c.380A>G (p.Asn127Ser) rs17217772
NM_000251.2(MSH2):c.435T>G (p.Ile145Met) rs63750124
NM_000251.2(MSH2):c.645+2T>C rs876658996
NM_000251.2(MSH2):c.645+3A>G rs587779168
NM_000251.2(MSH2):c.815C>T (p.Ala272Val) rs34136999
NM_000251.2(MSH2):c.942+20_942+29delAAAAAAAAAA rs11309117
NM_000252.2(MTM1):c.1260+3G>A rs222410
NM_000255.3(MMUT):c.1595G>A (p.Arg532His) rs1141321
NM_000256.3(MYBPC3):c.1000G>A (p.Glu334Lys) rs573916965
NM_000256.3(MYBPC3):c.1039G>A (p.Gly347Ser) rs397515884
NM_000256.3(MYBPC3):c.1144C>T (p.Arg382Trp) rs11570076
NM_000256.3(MYBPC3):c.1224-2A>G rs397515891
NM_000256.3(MYBPC3):c.1227-10C>T rs374673836
NM_000256.3(MYBPC3):c.1227-13G>A rs397515893
NM_000256.3(MYBPC3):c.1286C>T (p.Ala429Val) rs370412052
NM_000256.3(MYBPC3):c.12G>A (p.Pro4=) rs377292092
NM_000256.3(MYBPC3):c.1320C>T (p.Gly440=) rs368192024
NM_000256.3(MYBPC3):c.1351+1G>A rs727503204
NM_000256.3(MYBPC3):c.13G>C (p.Gly5Arg) rs201278114
NM_000256.3(MYBPC3):c.1418T>C (p.Phe473Ser) rs397515900
NM_000256.3(MYBPC3):c.1458-6G>A rs375347534
NM_000256.3(MYBPC3):c.1458-7C>T rs397515904
NM_000256.3(MYBPC3):c.1467C>T (p.Asp489=) rs35690719
NM_000256.3(MYBPC3):c.1468G>A (p.Gly490Arg) rs200625851
NM_000256.3(MYBPC3):c.1483C>G (p.Arg495Gly) rs397515905
NM_000256.3(MYBPC3):c.1483C>T (p.Arg495Trp) rs397515905
NM_000256.3(MYBPC3):c.1484G>A (p.Arg495Gln) rs200411226
NM_000256.3(MYBPC3):c.148A>G (p.Ser50Gly) rs373164247
NM_000256.3(MYBPC3):c.1504C>T (p.Arg502Trp) rs375882485
NM_000256.3(MYBPC3):c.1505G>A (p.Arg502Gln) rs397515907
NM_000256.3(MYBPC3):c.1513_1515delAAG (p.Lys505del) rs727504287
NM_000256.3(MYBPC3):c.1519G>A (p.Gly507Arg) rs35736435
NM_000256.3(MYBPC3):c.1544A>G (p.Asn515Ser) rs181834806
NM_000256.3(MYBPC3):c.1564G>A (p.Ala522Thr) rs11570082
NM_000256.3(MYBPC3):c.1566G>A (p.Ala522=) rs376041792
NM_000256.3(MYBPC3):c.1575T>G (p.Tyr525Ter) rs397515910
NM_000256.3(MYBPC3):c.1591G>A (p.Gly531Arg) rs397515912
NM_000256.3(MYBPC3):c.1591G>C (p.Gly531Arg) rs397515912
NM_000256.3(MYBPC3):c.1602G>A (p.Ala534=) rs370945942
NM_000256.3(MYBPC3):c.1608T>A (p.Ala536=) rs200224422
NM_000256.3(MYBPC3):c.1624+2T>C rs111437311
NM_000256.3(MYBPC3):c.1624+4A>T rs397515916
NM_000256.3(MYBPC3):c.1624G>C (p.Glu542Gln) rs121909374
NM_000256.3(MYBPC3):c.1641_1642delGT (p.Tyr548Profs) rs398123279
NM_000256.3(MYBPC3):c.1654G>T (p.Ala552Ser) rs727504887
NM_000256.3(MYBPC3):c.166G>A (p.Gly56Ser) rs397515918
NM_000256.3(MYBPC3):c.1786G>A (p.Gly596Arg) rs199728019
NM_000256.3(MYBPC3):c.1790+7G>A rs374852831
NM_000256.3(MYBPC3):c.1790G>A (p.Arg597Gln) rs727503195
NM_000256.3(MYBPC3):c.1812C>T (p.Asp604=) rs397515929
NM_000256.3(MYBPC3):c.1813G>A (p.Asp605Asn) rs376736293
NM_000256.3(MYBPC3):c.1828G>A (p.Asp610Asn) rs371564200
NM_000256.3(MYBPC3):c.1828G>C (p.Asp610His) rs371564200
NM_000256.3(MYBPC3):c.1831G>A (p.Glu611Lys) rs730880555
NM_000256.3(MYBPC3):c.1841A>G (p.Tyr614Cys) rs727503194
NM_000256.3(MYBPC3):c.1855G>A (p.Glu619Lys) rs200352299
NM_000256.3(MYBPC3):c.1863C>T (p.Phe621=) rs193922378
NM_000256.3(MYBPC3):c.1869C>T (p.Cys623=) rs397515932
NM_000256.3(MYBPC3):c.1934C>T (p.Pro645Leu) rs397515938
NM_000256.3(MYBPC3):c.2003G>A (p.Arg668His) rs727503191
NM_000256.3(MYBPC3):c.2048G>A (p.Trp683Ter) rs397515942
NM_000256.3(MYBPC3):c.206G>A (p.Arg69Gln) rs397515945
NM_000256.3(MYBPC3):c.2148+6_2148+9delTGAG rs397515949
NM_000256.3(MYBPC3):c.2149-5C>T rs36211722
NM_000256.3(MYBPC3):c.2149-8C>G rs397515950
NM_000256.3(MYBPC3):c.2234A>G (p.Asp745Gly) rs727503190
NM_000256.3(MYBPC3):c.223G>A (p.Asp75Asn) rs375471260
NM_000256.3(MYBPC3):c.2274C>T (p.Gly758=) rs397515957
NM_000256.3(MYBPC3):c.2308+12C>T rs727505335
NM_000256.3(MYBPC3):c.2308G>A (p.Asp770Asn) rs36211723
NM_000256.3(MYBPC3):c.2374T>C (p.Trp792Arg) rs187830361
NM_000256.3(MYBPC3):c.2381C>T (p.Pro794Leu) rs730880565
NM_000256.3(MYBPC3):c.2394dupT (p.Gly799Trpfs) rs730880341
NM_000256.3(MYBPC3):c.2429G>A (p.Arg810His) rs375675796
NM_000256.3(MYBPC3):c.2441_2443delAGA (p.Lys814del) rs727504288
NM_000256.3(MYBPC3):c.2449C>T (p.Arg817Trp) rs727503188
NM_000256.3(MYBPC3):c.2450G>A (p.Arg817Gln) rs397515964
NM_000256.3(MYBPC3):c.2459G>A (p.Arg820Gln) rs2856655
NM_000256.3(MYBPC3):c.2460G>A (p.Arg820=) rs532996422
NM_000256.3(MYBPC3):c.246T>C (p.Ile82=) rs372502369
NM_000256.3(MYBPC3):c.2487G>T (p.Leu829=) rs201040413
NM_000256.3(MYBPC3):c.2490dupT (p.His831Serfs) rs397515966
NM_000256.3(MYBPC3):c.2497G>A (p.Ala833Thr) rs199865688
NM_000256.3(MYBPC3):c.2498C>T (p.Ala833Val) rs3729952
NM_000256.3(MYBPC3):c.2541C>G (p.Tyr847Ter) rs397515974
NM_000256.3(MYBPC3):c.2547C>T (p.Val849=) rs3729953
NM_000256.3(MYBPC3):c.26-2A>G rs376395543
NM_000256.3(MYBPC3):c.2601C>T (p.Ile867=) rs11570097
NM_000256.3(MYBPC3):c.2610dupC (p.Ser871Glnfs) rs397515979
NM_000256.3(MYBPC3):c.2614G>A (p.Glu872Lys) rs190765116
NM_000256.3(MYBPC3):c.2618C>A (p.Pro873His) rs371401403
NM_000256.3(MYBPC3):c.2640C>T (p.Asp880=) rs397515980
NM_000256.3(MYBPC3):c.2670G>A (p.Trp890Ter) rs397515982
NM_000256.3(MYBPC3):c.2671C>T (p.Arg891Trp) rs727504418
NM_000256.3(MYBPC3):c.2686G>A (p.Val896Met) rs35078470
NM_000256.3(MYBPC3):c.2737+12C>T rs3729936
NM_000256.3(MYBPC3):c.2800C>T (p.Leu934=) rs367980215
NM_000256.3(MYBPC3):c.2833_2834delCG (p.Arg945Glyfs) rs397515987
NM_000256.3(MYBPC3):c.284T>C (p.Ile95Thr) rs727504945
NM_000256.3(MYBPC3):c.2864_2865delCT (p.Pro955Argfs) rs397515990
NM_000256.3(MYBPC3):c.2870C>G (p.Thr957Ser) rs193922380
NM_000256.3(MYBPC3):c.2873C>T (p.Thr958Ile) rs376504548
NM_000256.3(MYBPC3):c.2877G>A (p.Thr959=) rs727503181
NM_000256.3(MYBPC3):c.2904G>C (p.Leu968=) rs747974933
NM_000256.3(MYBPC3):c.2905+1G>A rs397515991
NM_000256.3(MYBPC3):c.2905+5G>T rs193922381
NM_000256.3(MYBPC3):c.2992C>G (p.Gln998Glu) rs11570112
NM_000256.3(MYBPC3):c.2995-5C>G rs376083315
NM_000256.3(MYBPC3):c.2997C>T (p.Gly999=) rs377283955
NM_000256.3(MYBPC3):c.3004C>T (p.Arg1002Trp) rs3729799
NM_000256.3(MYBPC3):c.3005G>A (p.Arg1002Gln) rs727504235
NM_000256.3(MYBPC3):c.3048C>T (p.Gly1016=) rs397515998
NM_000256.3(MYBPC3):c.3049G>A (p.Glu1017Lys) rs368180702
NM_000256.3(MYBPC3):c.3065G>C (p.Arg1022Pro) rs397516000
NM_000256.3(MYBPC3):c.3083C>T (p.Thr1028Ile) rs397516002
NM_000256.3(MYBPC3):c.3102C>T (p.Ala1034=) rs200663253
NM_000256.3(MYBPC3):c.3106C>T (p.Arg1036Cys) rs61729664
NM_000256.3(MYBPC3):c.3107G>A (p.Arg1036His) rs374255381
NM_000256.3(MYBPC3):c.3137C>T (p.Thr1046Met) rs371061770
NM_000256.3(MYBPC3):c.3190+5G>A rs587782958
NM_000256.3(MYBPC3):c.3217dupC (p.Arg1073Profs) rs730880668
NM_000256.3(MYBPC3):c.3229G>A (p.Ala1077Thr) rs397516009
NM_000256.3(MYBPC3):c.3253G>T (p.Glu1085Ter) rs397516010
NM_000256.3(MYBPC3):c.3276C>T (p.Val1092=) rs376344765
NM_000256.3(MYBPC3):c.3285G>A (p.Thr1095=) rs367927327
NM_000256.3(MYBPC3):c.3286G>T (p.Glu1096Ter) rs121909377
NM_000256.3(MYBPC3):c.3288G>A (p.Glu1096=) rs1052373
NM_000256.3(MYBPC3):c.3297dupG (p.Tyr1100Valfs) rs397516014
NM_000256.3(MYBPC3):c.3315C>A (p.Ala1105=) rs200372325
NM_000256.3(MYBPC3):c.3315C>T (p.Ala1105=) rs200372325
NM_000256.3(MYBPC3):c.3326C>T (p.Thr1109Ile) rs397516016
NM_000256.3(MYBPC3):c.3330+2T>G rs387906397
NM_000256.3(MYBPC3):c.3330+5G>C rs373746463
NM_000256.3(MYBPC3):c.3330+5G>T rs373746463
NM_000256.3(MYBPC3):c.3332_3335dupAGTG (p.Trp1112Terfs) rs730880337
NM_000256.3(MYBPC3):c.3362G>A (p.Arg1121His) rs397516018
NM_000256.3(MYBPC3):c.3373G>A (p.Val1125Met) rs121909378
NM_000256.3(MYBPC3):c.3413G>A (p.Arg1138His) rs187705120
NM_000256.3(MYBPC3):c.3472G>A (p.Val1158Ile) rs542350927
NM_000256.3(MYBPC3):c.3491-2A>T rs397516022
NM_000256.3(MYBPC3):c.3535G>A (p.Glu1179Lys) rs199669878
NM_000256.3(MYBPC3):c.3599T>C (p.Leu1200Pro) rs397516028
NM_000256.3(MYBPC3):c.3613C>T (p.Arg1205Trp) rs727503171
NM_000256.3(MYBPC3):c.3624dupC (p.Lys1209Glnfs) rs397516029
NM_000256.3(MYBPC3):c.3628-41_3628-17delAGCCTGGATGGCTTCCCTCCCTCTC rs36212066
NM_000256.3(MYBPC3):c.3672C>T (p.Asp1224=) rs368221517
NM_000256.3(MYBPC3):c.3682C>T (p.Arg1228Cys) rs201312636
NM_000256.3(MYBPC3):c.3697C>T (p.Gln1233Ter) rs397516037
NM_000256.3(MYBPC3):c.3699G>A (p.Gln1233=) rs200162906
NM_000256.3(MYBPC3):c.3735delC (p.Phe1246Leufs) rs397516038
NM_000256.3(MYBPC3):c.3742_3759dup18 (p.Cys1253_Arg1254insGlyGlyIleTyrValCys) rs193922384
NM_000256.3(MYBPC3):c.3763G>A (p.Ala1255Thr) rs727503167
NM_000256.3(MYBPC3):c.3771C>A (p.Asn1257Lys) rs730880603
NM_000256.3(MYBPC3):c.3776delA (p.Gln1259Argfs) rs727503166
NM_000256.3(MYBPC3):c.3797G>A (p.Cys1266Tyr) rs397516041
NM_000256.3(MYBPC3):c.3811C>T (p.Arg1271Ter) rs397516042
NM_000256.3(MYBPC3):c.3815-10T>G rs397516043
NM_000256.3(MYBPC3):c.3815-1G>A rs397516044
NM_000256.3(MYBPC3):c.3G>C (p.Met1Ile) rs397516045
NM_000256.3(MYBPC3):c.405A>G (p.Lys135=) rs727504318
NM_000256.3(MYBPC3):c.442G>A (p.Gly148Arg) rs397516050
NM_000256.3(MYBPC3):c.450C>T (p.Pro150=) rs377520770
NM_000256.3(MYBPC3):c.459delC (p.Ile154Leufs) rs397516052
NM_000256.3(MYBPC3):c.46C>T (p.Pro16Ser) rs730880573
NM_000256.3(MYBPC3):c.471C>T (p.Phe157=) rs150291001
NM_000256.3(MYBPC3):c.472G>A (p.Val158Met) rs3729986
NM_000256.3(MYBPC3):c.478C>T (p.Arg160Trp) rs193068692
NM_000256.3(MYBPC3):c.481C>A (p.Pro161Thr) rs397516053
NM_000256.3(MYBPC3):c.492C>T (p.Gly164=) rs3218719
NM_000256.3(MYBPC3):c.501C>T (p.Thr167=) rs397516054
NM_000256.3(MYBPC3):c.503T>C (p.Val168Ala) rs727505267
NM_000256.3(MYBPC3):c.505+5G>C rs727503219
NM_000256.3(MYBPC3):c.506-12delC rs11570050
NM_000256.3(MYBPC3):c.530G>A (p.Arg177His) rs201012766
NM_000256.3(MYBPC3):c.537C>T (p.Ala179=) rs11570051
NM_000256.3(MYBPC3):c.551dupT (p.Lys185Glufs) rs397516059
NM_000256.3(MYBPC3):c.558G>T (p.Pro186=) rs370962887
NM_000256.3(MYBPC3):c.565G>A (p.Val189Ile) rs11570052
NM_000256.3(MYBPC3):c.604A>C (p.Lys202Gln) rs730880623
NM_000256.3(MYBPC3):c.624G>C (p.Gln208His) rs202139499
NM_000256.3(MYBPC3):c.643C>T (p.Arg215Cys) rs397516063
NM_000256.3(MYBPC3):c.646G>A (p.Ala216Thr) rs201098973
NM_000256.3(MYBPC3):c.649A>G (p.Ser217Gly) rs138753870
NM_000256.3(MYBPC3):c.655G>C (p.Val219Leu) rs397516068
NM_000256.3(MYBPC3):c.706A>G (p.Ser236Gly) rs3729989
NM_000256.3(MYBPC3):c.710A>C (p.Tyr237Ser) rs397516070
NM_000256.3(MYBPC3):c.772+10C>T rs375525278
NM_000256.3(MYBPC3):c.772+1G>A rs397516072
NM_000256.3(MYBPC3):c.772G>A (p.Glu258Lys) rs397516074
NM_000256.3(MYBPC3):c.786C>T (p.Thr262=) rs11570058
NM_000256.3(MYBPC3):c.821+1G>A rs397516073
NM_000256.3(MYBPC3):c.821+5G>A rs397516077
NM_000256.3(MYBPC3):c.833delG (p.Gly278Glufs) rs727503212
NM_000256.3(MYBPC3):c.841C>A (p.Arg281=) rs371711564
NM_000256.3(MYBPC3):c.852-10C>G rs750425291
NM_000256.3(MYBPC3):c.906-7G>T rs397516079
NM_000256.3(MYBPC3):c.913_914delTT (p.Phe305Profs) rs397516080
NM_000256.3(MYBPC3):c.926+8C>T rs377595584
NM_000256.3(MYBPC3):c.927-9G>A rs397516083
NM_000256.3(MYBPC3):c.932C>A (p.Ser311Ter) rs193922386
NM_000256.3(MYBPC3):c.933G>C (p.Ser311=) rs374326087
NM_000256.3(MYBPC3):c.93C>T (p.Ala31=) rs397516085
NM_000256.3(MYBPC3):c.977G>A (p.Arg326Gln) rs34580776
NM_000257.2(MYH7):c.1148A>G (p.Lys383Arg) rs397516092
NM_000257.2(MYH7):c.1273G>A (p.Gly425Arg) rs397516097
NM_000257.2(MYH7):c.1370T>C (p.Ile457Thr) rs397516103
NM_000257.2(MYH7):c.1477A>G (p.Met493Val) rs730880875
NM_000257.2(MYH7):c.2206A>G (p.Ile736Val) rs397516138
NM_000257.2(MYH7):c.2525G>A (p.Ser842Asn) rs397516154
NM_000257.2(MYH7):c.2788G>A (p.Glu930Lys) rs397516171
NM_000257.2(MYH7):c.2845G>A (p.Glu949Lys) rs121913629
NM_000257.2(MYH7):c.4259G>A (p.Arg1420Gln) rs397516207
NM_000257.2(MYH7):c.4399C>G (p.Leu1467Val) rs397516214
NM_000257.2(MYH7):c.4557C>T (p.Ser1519=) rs150552664
NM_000257.2(MYH7):c.5380C>A (p.Gln1794Lys) rs397516247
NM_000257.2(MYH7):c.5380C>G (p.Gln1794Glu) rs397516247
NM_000257.2(MYH7):c.5647G>A (p.Glu1883Lys) rs121913652
NM_000257.2(MYH7):c.709C>T (p.Arg237Trp) rs45516091
NM_000257.2(MYH7):c.848A>G (p.Tyr283Cys) rs727503274
NM_000257.3(MYH7):c.1000-7C>T rs200129563
NM_000257.3(MYH7):c.1013T>C (p.Val338Ala) rs397516087
NM_000257.3(MYH7):c.1063G>A (p.Ala355Thr) rs397516088
NM_000257.3(MYH7):c.1106G>C (p.Arg369Pro) rs397516089
NM_000257.3(MYH7):c.1139-14C>T rs397516091
NM_000257.3(MYH7):c.114C>T (p.Phe38=) rs146210693
NM_000257.3(MYH7):c.115G>A (p.Val39Met) rs376160714
NM_000257.3(MYH7):c.1191G>A (p.Lys397=) rs139506719
NM_000257.3(MYH7):c.1220G>T (p.Gly407Val) rs397516095
NM_000257.3(MYH7):c.1318G>A (p.Val440Met) rs397516098
NM_000257.3(MYH7):c.1322C>T (p.Thr441Met) rs121913653
NM_000257.3(MYH7):c.1324C>T (p.Arg442Cys) rs148808089
NM_000257.3(MYH7):c.1357C>A (p.Arg453Ser) rs121913625
NM_000257.3(MYH7):c.1436A>G (p.Asn479Ser) rs727504236
NM_000257.3(MYH7):c.1477_1478delAT (p.Met493Valfs) rs727504336
NM_000257.3(MYH7):c.1491G>T (p.Glu497Asp) rs267606911
NM_000257.3(MYH7):c.1532T>C (p.Ile511Thr) rs397516110
NM_000257.3(MYH7):c.1573G>A (p.Glu525Lys) rs606231324
NM_000257.3(MYH7):c.1727A>G (p.His576Arg) rs727504238
NM_000257.3(MYH7):c.1750G>A (p.Gly584Ser) rs121913626
NM_000257.3(MYH7):c.1816G>A (p.Val606Met) rs121913627
NM_000257.3(MYH7):c.1826A>G (p.Tyr609Cys) rs727504925
NM_000257.3(MYH7):c.1954A>G (p.Arg652Gly) rs727504239
NM_000257.3(MYH7):c.1983C>T (p.Asn661=) rs146474860
NM_000257.3(MYH7):c.1987C>T (p.Arg663Cys) rs397516127
NM_000257.3(MYH7):c.2011C>T (p.Arg671Cys) rs727503263
NM_000257.3(MYH7):c.2052G>A (p.Met684Ile) rs727503262
NM_000257.3(MYH7):c.2069T>C (p.Met690Thr) rs397516128
NM_000257.3(MYH7):c.2080C>T (p.Arg694Cys) rs727504240
NM_000257.3(MYH7):c.2091T>C (p.Gly697=) rs140380523
NM_000257.3(MYH7):c.2093T>C (p.Val698Ala) rs397516130
NM_000257.3(MYH7):c.2129C>A (p.Pro710His) rs727504272
NM_000257.3(MYH7):c.2168G>A (p.Arg723His) rs397516135
NM_000257.3(MYH7):c.2183C>T (p.Ala728Val) rs121913644
NM_000257.3(MYH7):c.2221G>A (p.Gly741Arg) rs121913632
NM_000257.3(MYH7):c.2302G>A (p.Gly768Arg) rs727503260
NM_000257.3(MYH7):c.2334C>T (p.Asp778=) rs2069544
NM_000257.3(MYH7):c.2348G>A (p.Arg783His) rs397516142
NM_000257.3(MYH7):c.2349C>T (p.Arg783=) rs139882431
NM_000257.3(MYH7):c.2358G>A (p.Thr786=) rs36211714
NM_000257.3(MYH7):c.2389G>A (p.Ala797Thr) rs3218716
NM_000257.3(MYH7):c.240C>T (p.Asn80=) rs200493975
NM_000257.3(MYH7):c.2471T>C (p.Val824Ala) rs727503255
NM_000257.3(MYH7):c.2472C>T (p.Val824=) rs397516150
NM_000257.3(MYH7):c.2539_2541delAAG (p.Lys847del) rs397516155
NM_000257.3(MYH7):c.2543A>G (p.Glu848Gly) rs727504311
NM_000257.3(MYH7):c.2555T>C (p.Met852Thr) rs397516157
NM_000257.3(MYH7):c.2602G>C (p.Ala868Pro) rs727504356
NM_000257.3(MYH7):c.2606G>A (p.Arg869His) rs202141173
NM_000257.3(MYH7):c.2644C>G (p.Gln882Glu) rs397516160
NM_000257.3(MYH7):c.2710C>T (p.Arg904Cys) rs727503253
NM_000257.3(MYH7):c.2711G>A (p.Arg904His) rs397516165
NM_000257.3(MYH7):c.2770G>A (p.Glu924Lys) rs121913628
NM_000257.3(MYH7):c.2782G>A (p.Asp928Asn) rs727503252
NM_000257.3(MYH7):c.2788G>C (p.Glu930Gln) rs397516171
NM_000257.3(MYH7):c.2791_2793delGAG (p.Glu931del) rs397516172
NM_000257.3(MYH7):c.2890G>C (p.Val964Leu) rs45496496
NM_000257.3(MYH7):c.28G>C (p.Gly10Arg) rs199577321
NM_000257.3(MYH7):c.2922G>A (p.Lys974=) rs147727900
NM_000257.3(MYH7):c.298G>A (p.Ala100Thr) rs730880154
NM_000257.3(MYH7):c.3134G>T (p.Arg1045Leu) rs397516178
NM_000257.3(MYH7):c.3235C>T (p.Arg1079Trp) rs192722540
NM_000257.3(MYH7):c.3346G>A (p.Glu1116Lys) rs727504274
NM_000257.3(MYH7):c.3613G>A (p.Glu1205Lys) rs727505026
NM_000257.3(MYH7):c.3726+6C>T rs377745688
NM_000257.3(MYH7):c.3960G>A (p.Glu1320=) rs147797612
NM_000257.3(MYH7):c.3972+15C>T rs3729820
NM_000257.3(MYH7):c.3993C>T (p.His1331=) rs200288088
NM_000257.3(MYH7):c.4031G>A (p.Arg1344Gln) rs797045097
NM_000257.3(MYH7):c.4076G>A (p.Arg1359His) rs750836033
NM_000257.3(MYH7):c.4135G>A (p.Ala1379Thr) rs397516202
NM_000257.3(MYH7):c.4182C>T (p.Ala1394=) rs765895405
NM_000257.3(MYH7):c.4188G>A (p.Arg1396=) rs200852418
NM_000257.3(MYH7):c.4239G>A (p.Ser1413=) rs3729821
NM_000257.3(MYH7):c.427C>T (p.Arg143Trp) rs727503278
NM_000257.3(MYH7):c.4283T>C (p.Leu1428Ser) rs727503244
NM_000257.3(MYH7):c.4353+10G>A rs202205780
NM_000257.3(MYH7):c.438G>T (p.Lys146Asn) rs397516212
NM_000257.3(MYH7):c.4470G>C (p.Glu1490Asp) rs730880911
NM_000257.3(MYH7):c.4487A>C (p.Glu1496Ala) rs397516218
NM_000257.3(MYH7):c.4498C>T (p.Arg1500Trp) rs45544633
NM_000257.3(MYH7):c.452C>T (p.Pro151Leu) rs730880837
NM_000257.3(MYH7):c.4618C>T (p.Leu1540=) rs368734580
NM_000257.3(MYH7):c.4644+3G>A rs397516226
NM_000257.3(MYH7):c.4803G>A (p.Leu1601=) rs397516228
NM_000257.3(MYH7):c.4806C>T (p.Asp1602=) rs142034311
NM_000257.3(MYH7):c.4817G>A (p.Arg1606His) rs373514686
NM_000257.3(MYH7):c.4827C>T (p.Asn1609=) rs587781085
NM_000257.3(MYH7):c.4911C>T (p.Ala1637=) rs151113658
NM_000257.3(MYH7):c.4954G>T (p.Asp1652Tyr) rs397516233
NM_000257.3(MYH7):c.5134C>T (p.Arg1712Trp) rs121913650
NM_000257.3(MYH7):c.5186_5188delAGA (p.Lys1729del) rs367543052
NM_000257.3(MYH7):c.5342G>A (p.Arg1781His) rs397516246
NM_000257.3(MYH7):c.5344A>G (p.Met1782Val) rs727504385
NM_000257.3(MYH7):c.5361A>G (p.Glu1787=) rs201171029
NM_000257.3(MYH7):c.5399C>T (p.Ala1800Val) rs730880817
NM_000257.3(MYH7):c.5559+4C>T rs727504319
NM_000257.3(MYH7):c.5561C>T (p.Thr1854Met) rs372381770
NM_000257.3(MYH7):c.5562G>A (p.Thr1854=) rs368706722
NM_000257.3(MYH7):c.5690G>A (p.Arg1897His) rs727503240
NM_000257.3(MYH7):c.5718A>C (p.Ala1906=) rs45523233
NM_000257.3(MYH7):c.5725C>A (p.Arg1909=) rs146796870
NM_000257.3(MYH7):c.596C>T (p.Ala199Val) rs727504283
NM_000257.3(MYH7):c.611G>A (p.Arg204His) rs397516260
NM_000257.3(MYH7):c.611G>T (p.Arg204Leu) rs397516260
NM_000257.3(MYH7):c.619A>C (p.Lys207Gln) rs727504273
NM_000257.3(MYH7):c.677C>T (p.Ala226Val) rs876657887
NM_000257.3(MYH7):c.715G>A (p.Asp239Asn) rs397516264
NM_000257.3(MYH7):c.725C>G (p.Ser242Cys) rs730880921
NM_000257.3(MYH7):c.727C>T (p.Arg243Cys) rs397516265
NM_000257.3(MYH7):c.732+1G>A rs730880850
NM_000257.3(MYH7):c.740T>G (p.Phe247Cys) rs730880922
NM_000257.3(MYH7):c.746G>A (p.Arg249Gln) rs3218713
NM_000257.3(MYH7):c.767G>A (p.Gly256Glu) rs121913633
NM_000257.3(MYH7):c.842G>C (p.Arg281Thr) rs730880856
NM_000257.3(MYH7):c.872C>T (p.Ser291Phe) rs397516272
NM_000257.3(MYH7):c.957C>T (p.Thr319=) rs368699342
NM_000257.3(MYH7):c.958G>A (p.Val320Met) rs376897125
NM_000257.3(MYH7):c.976G>C (p.Ala326Pro) rs372731424
NM_000257.4(MYH7):c.1002C>T (p.Asn334=) rs34803781
NM_000257.4(MYH7):c.1062C>T (p.Gly354=) rs735712
NM_000257.4(MYH7):c.1106G>A (p.Arg369Gln) rs397516089
NM_000257.4(MYH7):c.1157A>G (p.Tyr386Cys) rs727503269
NM_000257.4(MYH7):c.1357C>T (p.Arg453Cys) rs121913625
NM_000257.4(MYH7):c.1358G>A (p.Arg453His) rs397516101
NM_000257.4(MYH7):c.1395C>T (p.Phe465=) rs45508293
NM_000257.4(MYH7):c.1594T>C (p.Ser532Pro) rs121913642
NM_000257.4(MYH7):c.1750G>C (p.Gly584Arg) rs121913626
NM_000257.4(MYH7):c.1767C>T (p.Asn589=) rs3729816
NM_000257.4(MYH7):c.1988G>A (p.Arg663His) rs371898076
NM_000257.4(MYH7):c.2146G>A (p.Gly716Arg) rs121913638
NM_000257.4(MYH7):c.2156G>A (p.Arg719Gln) rs121913641
NM_000257.4(MYH7):c.2162+4G>A rs145738465
NM_000257.4(MYH7):c.2167C>G (p.Arg723Gly) rs121913630
NM_000257.4(MYH7):c.2167C>T (p.Arg723Cys) rs121913630
NM_000257.4(MYH7):c.2207T>C (p.Ile736Thr) rs727503261
NM_000257.4(MYH7):c.2221G>C (p.Gly741Arg) rs121913632
NM_000257.4(MYH7):c.2221G>T (p.Gly741Trp) rs121913632
NM_000257.4(MYH7):c.2358G>T (p.Thr786=) rs36211714
NM_000257.4(MYH7):c.2360G>A (p.Arg787His) rs376754645
NM_000257.4(MYH7):c.2514G>A (p.Pro838=) rs45560638
NM_000257.4(MYH7):c.2608C>T (p.Arg870Cys) rs138049878
NM_000257.4(MYH7):c.261C>T (p.Ile87=) rs148560996
NM_000257.4(MYH7):c.2678C>T (p.Ala893Val) rs727503254
NM_000257.4(MYH7):c.2681A>G (p.Glu894Gly) rs397516161
NM_000257.4(MYH7):c.2769C>T (p.Asn923=) rs36211716
NM_000257.4(MYH7):c.2907C>T (p.His969=) rs142573531
NM_000257.4(MYH7):c.2945T>C (p.Met982Thr) rs145532615
NM_000257.4(MYH7):c.297C>T (p.Pro99=) rs140245862
NM_000257.4(MYH7):c.3036C>T (p.Ala1012=) rs145379951
NM_000257.4(MYH7):c.3133C>T (p.Arg1045Cys) rs45611033
NM_000257.4(MYH7):c.3153G>A (p.Ala1051=) rs45540831
NM_000257.4(MYH7):c.3156G>A (p.Lys1052=) rs138294643
NM_000257.4(MYH7):c.3158G>A (p.Arg1053Gln) rs587782962
NM_000257.4(MYH7):c.3169G>A (p.Gly1057Ser) rs397516179
NM_000257.4(MYH7):c.327C>T (p.Tyr109=) rs36211408
NM_000257.4(MYH7):c.3286G>T (p.Asp1096Tyr) rs45478699
NM_000257.4(MYH7):c.3337-3dup rs45504498
NM_000257.4(MYH7):c.3351G>A (p.Glu1117=) rs45554236
NM_000257.4(MYH7):c.3382G>A (p.Ala1128Thr) rs199552354
NM_000257.4(MYH7):c.3578G>A (p.Arg1193His) rs397516187
NM_000257.4(MYH7):c.3770A>G (p.Asn1257Ser) rs574005462
NM_000257.4(MYH7):c.3777C>T (p.His1259=) rs149103761
NM_000257.4(MYH7):c.3853+7C>T rs45467397
NM_000257.4(MYH7):c.3918C>T (p.Leu1306=) rs144420313
NM_000257.4(MYH7):c.3981C>A (p.Asn1327Lys) rs141764279
NM_000257.4(MYH7):c.4005G>A (p.Ser1335=) rs144465613
NM_000257.4(MYH7):c.4066G>A (p.Glu1356Lys) rs727503246
NM_000257.4(MYH7):c.4130C>T (p.Thr1377Met) rs397516201
NM_000257.4(MYH7):c.4258C>T (p.Arg1420Trp) rs145213771
NM_000257.4(MYH7):c.4276G>A (p.Glu1426Lys) rs397516208
NM_000257.4(MYH7):c.428G>A (p.Arg143Gln) rs397516209
NM_000257.4(MYH7):c.4354-7C>T rs370093487
NM_000257.4(MYH7):c.4377G>T (p.Lys1459Asn) rs201307101
NM_000257.4(MYH7):c.4452C>T (p.Leu1484=) rs61737803
NM_000257.4(MYH7):c.4472C>G (p.Ser1491Cys) rs3729823
NM_000257.4(MYH7):c.4566T>C (p.Thr1522=) rs2754155
NM_000257.4(MYH7):c.4588C>T (p.Arg1530Ter) rs397516225
NM_000257.4(MYH7):c.4671G>A (p.Lys1557=) rs200601164
NM_000257.4(MYH7):c.4716C>T (p.Ile1572=) rs7140196
NM_000257.4(MYH7):c.480C>T (p.Asn160=) rs45500700
NM_000257.4(MYH7):c.4909G>A (p.Ala1637Thr) rs141122361
NM_000257.4(MYH7):c.4974C>T (p.Asp1658=) rs374289523
NM_000257.4(MYH7):c.5135G>A (p.Arg1712Gln) rs193922390
NM_000257.4(MYH7):c.5302G>A (p.Glu1768Lys) rs397516241
NM_000257.4(MYH7):c.5329G>A (p.Ala1777Thr) rs200939753
NM_000257.4(MYH7):c.5401G>A (p.Glu1801Lys) rs397516248
NM_000257.4(MYH7):c.5704G>C (p.Glu1902Gln) rs187073962
NM_000257.4(MYH7):c.5736C>T (p.Ile1912=) rs200728597
NM_000257.4(MYH7):c.5740G>A (p.Glu1914Lys) rs397516254
NM_000257.4(MYH7):c.597A>G (p.Ala199=) rs2069541
NM_000257.4(MYH7):c.77C>T (p.Ala26Val) rs186964570
NM_000257.4(MYH7):c.788T>C (p.Ile263Thr) rs397516269
NM_000257.4(MYH7):c.930T>C (p.Tyr310=) rs111626355
NM_000257.4(MYH7):c.975C>T (p.Asp325=) rs2231124
NM_000258.2(MYL3):c.130-14G>T rs192329378
NM_000258.2(MYL3):c.170C>A (p.Ala57Asp) rs139794067
NM_000258.2(MYL3):c.170C>G (p.Ala57Gly) rs139794067
NM_000258.2(MYL3):c.184G>A (p.Asp62Asn) rs730880954
NM_000258.2(MYL3):c.281G>A (p.Arg94His) rs199474703
NM_000258.2(MYL3):c.307+15C>T rs184025552
NM_000258.2(MYL3):c.427G>A (p.Glu143Lys) rs104893750
NM_000258.2(MYL3):c.461G>A (p.Arg154His) rs104893749
NM_000258.2(MYL3):c.466G>T (p.Val156Leu) rs199474707
NM_000258.2(MYL3):c.477G>T (p.Thr159=) rs148365503
NM_000258.2(MYL3):c.482-14C>A rs201780962
NM_000258.2(MYL3):c.532G>A (p.Asp178Asn) rs145520567
NM_000258.2(MYL3):c.559+6C>T rs199474709
NM_000258.2(MYL3):c.69C>T (p.Pro23=) rs2233264
NM_000258.2(MYL3):c.81T>C (p.Pro27=) rs147584015
NM_000258.2(MYL3):c.92G>A (p.Arg31His) rs199639940
NM_000260.3(MYO7A):c.1200+1G>A rs397516283
NM_000260.3(MYO7A):c.1208A>G (p.Tyr403Cys) rs797044511
NM_000260.3(MYO7A):c.132+5G>A rs397516284
NM_000260.3(MYO7A):c.133-14C>T rs116228809
NM_000260.3(MYO7A):c.133-7C>T rs111033221
NM_000260.3(MYO7A):c.1343+8G>A rs2276278
NM_000260.3(MYO7A):c.1403_1404insGCA (p.Arg467_His468insGln) rs111033219
NM_000260.3(MYO7A):c.1554+7C>T rs150114658
NM_000260.3(MYO7A):c.1554+8G>A rs111033227
NM_000260.3(MYO7A):c.1556G>A (p.Gly519Asp) rs111033206
NM_000260.3(MYO7A):c.1605C>T (p.Asn535=) rs111033228
NM_000260.3(MYO7A):c.1619C>A (p.Pro540His) rs782607566
NM_000260.3(MYO7A):c.1726G>A (p.Asp576Asn) rs187165412
NM_000260.3(MYO7A):c.1854G>A (p.Leu618=) rs35429535
NM_000260.3(MYO7A):c.2005C>T (p.Arg669Ter) rs111033201
NM_000260.3(MYO7A):c.2011G>A (p.Gly671Ser) rs387906699
NM_000260.3(MYO7A):c.2035G>A (p.Val679Ile) rs35641839
NM_000260.3(MYO7A):c.2122A>G (p.Met708Val) rs397516293
NM_000260.3(MYO7A):c.2187+1G>A rs111033290
NM_000260.3(MYO7A):c.2236G>A (p.Asp746Asn) rs36090425
NM_000260.3(MYO7A):c.2282+5G>A rs540145750
NM_000260.3(MYO7A):c.2283G>A (p.Arg761=) rs111033229
NM_000260.3(MYO7A):c.2323C>T (p.Gln775Ter) rs201892914
NM_000260.3(MYO7A):c.2447G>A (p.Arg816His) rs148343670
NM_000260.3(MYO7A):c.2476G>A (p.Ala826Thr) rs368341987
NM_000260.3(MYO7A):c.2617C>T (p.Arg873Trp) rs200454015
NM_000260.3(MYO7A):c.2754C>T (p.Ala918=) rs78072361
NM_000260.3(MYO7A):c.285+2T>C rs782292032
NM_000260.3(MYO7A):c.286-5C>T rs111033471
NM_000260.3(MYO7A):c.2886G>C (p.Gln962His) rs200641606
NM_000260.3(MYO7A):c.288G>A (p.Thr96=) rs56023295
NM_000260.3(MYO7A):c.3042G>T (p.Thr1014=) rs111033507
NM_000260.3(MYO7A):c.3086A>G (p.His1029Arg) rs60103800
NM_000260.3(MYO7A):c.3246G>A (p.Thr1082=) rs35963362
NM_000260.3(MYO7A):c.3476G>T (p.Gly1159Val) rs199897298
NM_000260.3(MYO7A):c.3503G>A (p.Arg1168Gln) rs797044516
NM_000260.3(MYO7A):c.3508G>A (p.Glu1170Lys) rs111033214
NM_000260.3(MYO7A):c.3591_3592delCT (p.Cys1198Argfs) rs1555090368
NM_000260.3(MYO7A):c.3602G>C (p.Cys1201Ser) rs117966637
NM_000260.3(MYO7A):c.3719G>A (p.Arg1240Gln) rs111033178
NM_000260.3(MYO7A):c.3750+7G>A rs397516305
NM_000260.3(MYO7A):c.3750+9G>A rs111033252
NM_000260.3(MYO7A):c.3764delA (p.Lys1255Argfs) rs111033347
NM_000260.3(MYO7A):c.3827C>T (p.Ser1276Leu) rs369458838
NM_000260.3(MYO7A):c.3828G>A (p.Ser1276=) rs78871677
NM_000260.3(MYO7A):c.3858G>A (p.Ala1286=) rs372623270
NM_000260.3(MYO7A):c.3892G>A (p.Gly1298Arg) rs727503329
NM_000260.3(MYO7A):c.3978C>T (p.Cys1326=) rs111033376
NM_000260.3(MYO7A):c.4023C>T (p.Pro1341=) rs73495790
NM_000260.3(MYO7A):c.4074C>T (p.Ser1358=) rs78996818
NM_000260.3(MYO7A):c.4153-10C>G rs397516306
NM_000260.3(MYO7A):c.4153-11C>T rs727503330
NM_000260.3(MYO7A):c.4153-8C>G rs143216377
NM_000260.3(MYO7A):c.4360G>A (p.Val1454Ile) rs397516309
NM_000260.3(MYO7A):c.4441+7C>T rs372493678
NM_000260.3(MYO7A):c.4461C>T (p.Asn1487=) rs56174006
NM_000260.3(MYO7A):c.448C>A (p.Arg150=) rs121965079
NM_000260.3(MYO7A):c.4505A>G (p.Asp1502Gly) rs757460257
NM_000260.3(MYO7A):c.4544_4551delAGATCATGinsCA (p.Glu1515_Met1517delinsAla) rs111033259
NM_000260.3(MYO7A):c.4568+12C>G rs72933642
NM_000260.3(MYO7A):c.4589C>T (p.Ser1530Leu) rs111033183
NM_000260.3(MYO7A):c.4619C>T (p.Ala1540Val) rs111033511
NM_000260.3(MYO7A):c.4620G>A (p.Ala1540=) rs41298745
NM_000260.3(MYO7A):c.468C>T (p.Ile156=) rs12420129
NM_000260.3(MYO7A):c.4697C>T (p.Thr1566Met) rs41298747
NM_000260.3(MYO7A):c.4698G>A (p.Thr1566=) rs200207753
NM_000260.3(MYO7A):c.4757A>G (p.Asn1586Ser) rs201251963
NM_000260.3(MYO7A):c.47T>C (p.Leu16Ser) rs1052030
NM_000260.3(MYO7A):c.4805G>A (p.Arg1602Gln) rs139889944
NM_000260.3(MYO7A):c.4821T>A (p.Tyr1607Ter) rs397516315
NM_000260.3(MYO7A):c.4845C>A (p.Pro1615=) rs61900036
NM_000260.3(MYO7A):c.4851C>T (p.Pro1617=) rs372535399
NM_000260.3(MYO7A):c.494C>T (p.Thr165Met) rs111033174
NM_000260.3(MYO7A):c.4950C>T (p.Asn1650=) rs80033599
NM_000260.3(MYO7A):c.4983C>T (p.Asp1661=) rs111033331
NM_000260.3(MYO7A):c.4992C>T (p.Thr1664=) rs181573957
NM_000260.3(MYO7A):c.5101C>T (p.Arg1701Ter) rs111033182
NM_000260.3(MYO7A):c.510G>A (p.Leu170=) rs34477144
NM_000260.3(MYO7A):c.5156A>G (p.Tyr1719Cys) rs77625410
NM_000260.3(MYO7A):c.5169-6C>T rs768594224
NM_000260.3(MYO7A):c.5172C>G (p.Pro1724=) rs727505004
NM_000260.3(MYO7A):c.5215C>A (p.Arg1739=) rs111033477
NM_000260.3(MYO7A):c.5227C>A (p.Arg1743=) rs111033287
NM_000260.3(MYO7A):c.5227C>T (p.Arg1743Trp) rs111033287
NM_000260.3(MYO7A):c.5253G>T (p.Pro1751=) rs377388669
NM_000260.3(MYO7A):c.5324T>C (p.Ile1775Thr) rs115123584
NM_000260.3(MYO7A):c.5326+13C>T rs114157944
NM_000260.3(MYO7A):c.5481-14G>A rs113075052
NM_000260.3(MYO7A):c.5573T>C (p.Leu1858Pro) rs368657015
NM_000260.3(MYO7A):c.5598C>A (p.Leu1866=) rs111033504
NM_000260.3(MYO7A):c.5598C>T (p.Leu1866=) rs111033504
NM_000260.3(MYO7A):c.5617C>T (p.Arg1873Trp) rs397516321
NM_000260.3(MYO7A):c.5618G>A (p.Arg1873Gln) rs397516322
NM_000260.3(MYO7A):c.5619G>A (p.Arg1873=) rs45450893
NM_000260.3(MYO7A):c.5648G>A (p.Arg1883Gln) rs111033215
NM_000260.3(MYO7A):c.5660C>T (p.Pro1887Leu) rs199606180
NM_000260.3(MYO7A):c.5804T>C (p.Leu1935Pro) rs397516323
NM_000260.3(MYO7A):c.5824G>T (p.Gly1942Ter) rs111033192
NM_000260.3(MYO7A):c.5835C>T (p.Leu1945=) rs111033476
NM_000260.3(MYO7A):c.5866G>A (p.Val1956Ile) rs142293185
NM_000260.3(MYO7A):c.5899C>T (p.Arg1967Ter) rs376764423
NM_000260.3(MYO7A):c.5904C>T (p.His1968=) rs41298753
NM_000260.3(MYO7A):c.593-4G>A rs876657534
NM_000260.3(MYO7A):c.593-5C>T rs762666
NM_000260.3(MYO7A):c.6052-11G>C rs112564978
NM_000260.3(MYO7A):c.6062A>G (p.Lys2021Arg) rs876657655
NM_000260.3(MYO7A):c.6063G>A (p.Lys2021=) rs111033209
NM_000260.3(MYO7A):c.6165C>T (p.Ser2055=) rs397516327
NM_000260.3(MYO7A):c.6214G>A (p.Val2072Ile) rs200313391
NM_000260.3(MYO7A):c.6240C>T (p.Ser2080=) rs41298757
NM_000260.3(MYO7A):c.6318G>A (p.Lys2106=) rs11237123
NM_000260.3(MYO7A):c.631A>G (p.Ser211Gly) rs111033486
NM_000260.3(MYO7A):c.6326C>T (p.Thr2109Ile) rs377670513
NM_000260.3(MYO7A):c.635G>A (p.Arg212His) rs28934610
NM_000260.3(MYO7A):c.6424G>A (p.Asp2142Asn) rs1132036
NM_000260.3(MYO7A):c.6439-2A>G rs397516330
NM_000260.3(MYO7A):c.6519C>T (p.Asn2173=) rs111033230
NM_000260.3(MYO7A):c.652G>A (p.Asp218Asn) rs201539845
NM_000260.3(MYO7A):c.6559-11C>T rs34517202
NM_000260.3(MYO7A):c.6560G>A (p.Gly2187Asp) rs397516332
NM_000260.3(MYO7A):c.6614_6634dup21 (p.Ser2211_Arg2212insMetSerLysGlnArgGlySer) rs111033388
NM_000260.3(MYO7A):c.6640G>A (p.Gly2214Ser) rs111033231
NM_000260.3(MYO7A):c.689C>T (p.Ala230Val) rs797044512
NM_000260.3(MYO7A):c.73G>A (p.Gly25Arg) rs782252317
NM_000260.3(MYO7A):c.803A>G (p.Lys268Arg) rs184866544
NM_000260.3(MYO7A):c.849+7C>G rs370740228
NM_000260.3(MYO7A):c.93C>T (p.Cys31=) rs35689081
NM_000260.3(MYO7A):c.977T>A (p.Leu326Gln) rs797044491
NM_000260.4(MYO7A):c.1007G>A (p.Arg336His) rs45629132
NM_000260.4(MYO7A):c.324C>T (p.Tyr108=) rs116892396
NM_000260.4(MYO7A):c.905G>A (p.Arg302His) rs41298135
NM_000261.1(MYOC):c.1193A>G (p.Lys398Arg) rs56314834
NM_000262.2(NAGA):c.479C>G (p.Ser160Cys) rs121434532
NM_000264.3(PTCH1):c.3944C>T (p.Pro1315Leu) rs357564
NM_000267.3(NF1):c.1994C>T (p.Ser665Phe) rs145891889
NM_000267.3(NF1):c.4267A>G (p.Lys1423Glu) rs137854550
NM_000267.3(NF1):c.4299C>T (p.Leu1433=) rs864622298
NM_000267.3(NF1):c.4661+11A>G rs368649260
NM_000267.3(NF1):c.4972A>G (p.Ile1658Val) rs147327414
NM_000267.3(NF1):c.528T>A (p.Asp176Glu) rs112306990
NM_000267.3(NF1):c.5446G>A (p.Asp1816Asn) rs771597781
NM_000267.3(NF1):c.6084+8C>G rs182709912
NM_000267.3(NF1):c.6858+10G>A rs767166725
NM_000267.3(NF1):c.6866C>T (p.Pro2289Leu) rs148736217
NM_000267.3(NF1):c.7468G>C (p.Val2490Leu) rs2230850
NM_000268.3(NF2):c.240+15C>T rs200701337
NM_000268.3(NF2):c.613A>G (p.Met205Val) rs141629512
NM_000270.3(PNP):c.171C>T (p.Pro57=) rs1130650
NM_000270.3(PNP):c.286-18G>A rs1026474882
NM_000270.3(PNP):c.60C>T (p.His20=) rs1049562
NM_000271.4(NPC1):c.1628C>T (p.Pro543Leu) rs369368181
NM_000271.4(NPC1):c.1926G>C (p.Met642Ile) rs1788799
NM_000271.4(NPC1):c.2073G>A (p.Pro691=) rs113013085
NM_000271.4(NPC1):c.2572A>G (p.Ile858Val) rs1805082
NM_000271.4(NPC1):c.2621A>T (p.Asp874Val) rs372030650
NM_000271.4(NPC1):c.387T>C (p.Tyr129=) rs12970899
NM_000271.4(NPC1):c.644A>G (p.His215Arg) rs1805081
NM_000275.2(OCA2):c.1441G>A (p.Ala481Thr) rs74653330
NM_000275.2(OCA2):c.574-19A>G rs145242923
NM_000275.2(OCA2):c.593C>T (p.Pro198Leu) rs183487020
NM_000277.1(PAH):c.842+5G>A rs62516146
NM_000282.3(PCCA):c.627A>G (p.Ala209=) rs538229
NM_000283.3(PDE6B):c.291C>A (p.Tyr97Ter) rs876657718
NM_000285.3(PEPD):c.660T>C (p.Tyr220=) rs3745969
NM_000286.2(PEX12):c.102A>T (p.Arg34Ser) rs147530802
NM_000295.4(SERPINA1):c.1177C>T (p.Pro393Ser) rs61761869
NM_000295.4(SERPINA1):c.424C>T (p.Leu142=) rs20546
NM_000295.4(SERPINA1):c.840T>C (p.Asp280=) rs1049800
NM_000298.5(PKLR):c.1456C>T (p.Arg486Trp) rs116100695
NM_000303.2(PMM2):c.422G>A (p.Arg141His) rs28936415
NM_000303.2(PMM2):c.590A>C (p.Glu197Ala) rs34258285
NM_000310.3(PPT1):c.363-4G>A rs117284255
NM_000314.4(PTEN):c.737C>T (p.Pro246Leu) rs587782350
NM_000314.6(PTEN):c.1003C>T (p.Arg335Ter) rs121909231
NM_000314.6(PTEN):c.518G>A (p.Arg173His) rs121913294
NM_000314.6(PTEN):c.802-3delT rs34003473
NM_000314.7(PTEN):c.-1084C>T rs538728843
NM_000321.2(RB1):c.1961-12T>C rs201697122
NM_000321.2(RB1):c.2360G>A (p.Arg787Gln) rs748094394
NM_000321.2(RB1):c.920C>T (p.Thr307Ile) rs183898408
NM_000321.2(RB1):c.929G>A (p.Gly310Glu) rs200844292
NM_000328.2(RPGR):c.141T>G (p.Ser47=) rs62638631
NM_000335.4(SCN5A):c.1336G>A (p.Glu446Lys) rs199473339
NM_000335.4(SCN5A):c.1844G>A (p.Gly615Glu) rs12720452
NM_000335.4(SCN5A):c.1852C>T (p.Leu618Phe) rs45488304
NM_000335.4(SCN5A):c.2074C>A (p.Gln692Lys) rs45553235
NM_000335.4(SCN5A):c.2436+12G>A rs41312419
NM_000335.4(SCN5A):c.3575G>A (p.Arg1192Gln) rs41261344
NM_000335.4(SCN5A):c.3908C>T (p.Thr1303Met) rs199473603
NM_000335.4(SCN5A):c.4531C>T (p.Arg1511Trp) rs137854602
NM_000335.4(SCN5A):c.4845C>T (p.Phe1615=) rs41315495
NM_000335.4(SCN5A):c.5357G>A (p.Ser1786Asn) rs199473316
NM_000335.4(SCN5A):c.5474G>A (p.Arg1825His) rs137854610
NM_000335.4(SCN5A):c.5690G>A (p.Arg1897His) rs370694515
NM_000335.4(SCN5A):c.5708C>T (p.Ser1903Leu) rs150264233
NM_000335.4(SCN5A):c.5841C>T (p.Ile1947=) rs13324293
NM_000335.4(SCN5A):c.5848G>T (p.Val1950Leu) rs41315493
NM_000335.4(SCN5A):c.5958C>A (p.Asn1986Lys) rs199473335
NM_000335.4(SCN5A):c.659C>T (p.Thr220Ile) rs45620037
NM_000336.2(SCNN1B):c.1401C>T (p.Ser467=) rs74012901
NM_000336.2(SCNN1B):c.1706C>T (p.Ala569Val) rs140927806
NM_000336.2(SCNN1B):c.777-5T>C rs61759915
NM_000337.5(SGCD):c.*2A>C rs200757725
NM_000337.5(SGCD):c.-179A>G rs77808502
NM_000337.5(SGCD):c.-303A>T rs7725121
NM_000337.5(SGCD):c.105G>C (p.Leu35=) rs193922392
NM_000337.5(SGCD):c.123C>G (p.Leu41=) rs200670993
NM_000337.5(SGCD):c.144G>C (p.Val48=) rs372152495
NM_000337.5(SGCD):c.193-12G>T rs727503421
NM_000337.5(SGCD):c.213G>A (p.Arg71=) rs74846539
NM_000337.5(SGCD):c.290G>A (p.Arg97Gln) rs45559835
NM_000337.5(SGCD):c.294+8T>C rs11748588
NM_000337.5(SGCD):c.383-11A>T rs727504584
NM_000337.5(SGCD):c.394G>A (p.Val132Ile) rs367819390
NM_000337.5(SGCD):c.451T>G (p.Ser151Ala) rs121909298
NM_000337.5(SGCD):c.45T>A (p.Pro15=) rs727505092
NM_000337.5(SGCD):c.507G>A (p.Ala169=) rs10071079
NM_000337.5(SGCD):c.699+18C>G rs180898690
NM_000337.5(SGCD):c.69C>T (p.Tyr23=) rs397517923
NM_000337.5(SGCD):c.848A>G (p.Gln283Arg) rs397516338
NM_000338.2(SLC12A1):c.2873T>C (p.Val958Ala) rs1552311
NM_000339.2(SLC12A3):c.2221G>A (p.Gly741Arg) rs138977195
NM_000339.2(SLC12A3):c.363G>C (p.Glu121Asp) rs146632606
NM_000340.1(SLC2A2):c.1437C>T (p.Phe479=) rs5398
NM_000341.3(SLC3A1):c.1136+3delT rs796262035
NM_000342.3(SLC4A1):c.539G>A (p.Arg180His) rs147390654
NM_000343.3(SLC5A1):c.1231G>A (p.Ala411Thr) rs17683430
NM_000343.3(SLC5A1):c.1275C>T (p.Ala425=) rs17683448
NM_000343.3(SLC5A1):c.152A>G (p.Asn51Ser) rs17683011
NM_000343.3(SLC5A1):c.1836A>G (p.Leu612=) rs17683704
NM_000343.3(SLC5A1):c.1845C>G (p.His615Gln) rs33954001
NM_000343.3(SLC5A1):c.1899G>A (p.Thr633=) rs33943816
NM_000343.3(SLC5A1):c.1938C>T (p.Asn646=) rs33954397
NM_000350.2(ABCA4):c.2588G>C rs76157638
NM_000350.2(ABCA4):c.3113C>T (p.Ala1038Val) rs61751374
NM_000350.2(ABCA4):c.5882G>A rs1800553
NM_000352.4(ABCC8):c.3399+13G>A rs182340196
NM_000363.4(TNNI3):c.12-7delC rs370714315
NM_000363.4(TNNI3):c.150+13G>A rs73617692
NM_000363.4(TNNI3):c.151-6C>G rs377258542
NM_000363.4(TNNI3):c.198G>A (p.Glu66=) rs3729710
NM_000363.4(TNNI3):c.204G>T (p.Arg68=) rs3729711
NM_000363.4(TNNI3):c.204delG (p.Arg69Alafs) rs727504872
NM_000363.4(TNNI3):c.235C>T (p.Arg79Cys) rs3729712
NM_000363.4(TNNI3):c.244C>T (p.Pro82Ser) rs77615401
NM_000363.4(TNNI3):c.25-4C>T rs202086705
NM_000363.4(TNNI3):c.25-8T>A rs3729836
NM_000363.4(TNNI3):c.336C>T (p.Tyr112=) rs559450042
NM_000363.4(TNNI3):c.370G>C (p.Glu124Gln) rs727503506
NM_000363.4(TNNI3):c.372+7C>T rs367809676
NM_000363.4(TNNI3):c.373-10G= rs7252610
NM_000363.4(TNNI3):c.384G>A (p.Leu128=) rs373130533
NM_000363.4(TNNI3):c.422G>A (p.Arg141Gln) rs397516347
NM_000363.4(TNNI3):c.428C>A (p.Thr143Asn) rs397516348
NM_000363.4(TNNI3):c.433C>T (p.Arg145Trp) rs104894724
NM_000363.4(TNNI3):c.434G>A (p.Arg145Gln) rs397516349
NM_000363.4(TNNI3):c.484C>T (p.Arg162Trp) rs368861241
NM_000363.4(TNNI3):c.485G>A (p.Arg162Gln) rs397516354
NM_000363.4(TNNI3):c.485G>C (p.Arg162Pro) rs397516354
NM_000363.4(TNNI3):c.497C>T (p.Ser166Phe) rs727504242
NM_000363.4(TNNI3):c.508C>G (p.Arg170Gly) rs727503504
NM_000363.4(TNNI3):c.508C>T (p.Arg170Trp) rs727503504
NM_000363.4(TNNI3):c.509G>A (p.Arg170Gln) rs727503503
NM_000363.4(TNNI3):c.526G>A (p.Val176Met) rs727503501
NM_000363.4(TNNI3):c.537G>A (p.Glu179=) rs3729841
NM_000363.4(TNNI3):c.544G>A (p.Glu182Lys) rs397516355
NM_000363.4(TNNI3):c.550-10C>T rs201240150
NM_000363.4(TNNI3):c.557G>A (p.Arg186Gln) rs397516357
NM_000363.4(TNNI3):c.575G>A (p.Arg192His) rs104894729
NM_000363.4(TNNI3):c.586G>A (p.Asp196Asn) rs104894727
NM_000363.4(TNNI3):c.592C>G (p.Leu198Val) rs727504285
NM_000363.4(TNNI3):c.610C>T (p.Arg204Cys) rs727504243
NM_000363.4(TNNI3):c.611G>A (p.Arg204His) rs727504275
NM_000363.4(TNNI3):c.6G>A (p.Ala2=) rs397516361
NM_000364.3(TNNT2):c.113C>T (p.Ala38Val) rs200754249
NM_000364.3(TNNT2):c.136G>C (p.Ala46Pro) rs397516447
NM_000364.3(TNNT2):c.294+7G>A rs45490292
NM_000364.3(TNNT2):c.68-5_68-3delinsTT rs397516362
NM_000364.3(TNNT2):c.753G>T (p.Glu251Asp) rs45466197
NM_000364.3(TNNT2):c.853C>T (p.Arg285Cys) rs121964857
NM_000364.3(TNNT2):c.877C>T (p.Arg293Cys) rs367785431
NM_000366.5(TPM1):c.375-3C>T rs202228866
NM_000366.5(TPM1):c.845C>G (p.Thr282Ser) rs397516395
NM_000368.4(TSC1):c.106+15A>G rs80258442
NM_000368.4(TSC1):c.1250C>T (p.Thr417Ile) rs77464996
NM_000368.4(TSC1):c.1335A>G (p.Glu445=) rs7862221
NM_000368.4(TSC1):c.1760A>G (p.Lys587Arg) rs118203576
NM_000368.4(TSC1):c.1960C>G (p.Gln654Glu) rs75820036
NM_000368.4(TSC1):c.2194C>T (p.His732Tyr) rs118203657
NM_000368.4(TSC1):c.2285A>G (p.Asn762Ser) rs118203670
NM_000368.4(TSC1):c.2646C>T (p.Ala882=) rs118203720
NM_000368.4(TSC1):c.2829C>T (p.Ala943=) rs4962081
NM_000368.4(TSC1):c.2865C>T (p.Thr955=) rs45468995
NM_000368.4(TSC1):c.3045C>T (p.Asn1015=) rs759047948
NM_000368.4(TSC1):c.3184C>T (p.Arg1062Trp) rs118203745
NM_000368.4(TSC1):c.965T>C (p.Met322Thr) rs1073123
NM_000371.3(TTR):c.14G>A (p.Arg5His) rs138657343
NM_000371.3(TTR):c.190T>C (p.Phe64Leu) rs138065384
NM_000371.3(TTR):c.238A>G (p.Thr80Ala) rs121918070
NM_000371.3(TTR):c.328C>A (p.His110Asn) rs121918074
NM_000371.3(TTR):c.349G>T (p.Ala117Ser) rs267607161
NM_000371.3(TTR):c.354C>T (p.Asn118=) rs11541797
NM_000371.3(TTR):c.360C>T (p.Ser120=) rs150127220
NM_000371.3(TTR):c.371G>A (p.Arg124His) rs121918095
NM_000371.3(TTR):c.416C>T (p.Thr139Met) rs28933981
NM_000371.3(TTR):c.417G>A (p.Thr139=) rs2276382
NM_000371.3(TTR):c.424_426delGTC (p.Val142del) rs121918096
NM_000371.3(TTR):c.68C>T (p.Thr23Met) rs377052919
NM_000372.4(TYR):c.1217C>T (p.Pro406Leu) rs104894313
NM_000372.4(TYR):c.1336G>A (p.Gly446Ser) rs104894317
NM_000372.4(TYR):c.242C>T (p.Pro81Leu) rs28940876
NM_000379.3(XDH):c.1686+1G>C rs148412639
NM_000384.2(APOB):c.10579C>T (p.Arg3527Trp) rs144467873
NM_000384.2(APOB):c.10580G>A (p.Arg3527Gln) rs5742904
NM_000384.2(APOB):c.10672C>T (p.Arg3558Cys) rs12713559
NM_000384.2(APOB):c.10708C>T (p.His3570Tyr) rs201736972
NM_000384.2(APOB):c.10913G>A (p.Arg3638Gln) rs1801701
NM_000384.2(APOB):c.11477C>T (p.Thr3826Met) rs61744153
NM_000384.2(APOB):c.11761G>A (p.Val3921Ile) rs72654409
NM_000384.2(APOB):c.1223T>C (p.Ile408Thr) rs12714225
NM_000384.2(APOB):c.13154G>A (p.Arg4385His) rs533755016
NM_000384.2(APOB):c.2068-4T>A rs41291161
NM_000384.2(APOB):c.2981C>T (p.Pro994Leu) rs41288783
NM_000384.2(APOB):c.3337G>C (p.Asp1113His) rs12713844
NM_000384.2(APOB):c.3383G>A (p.Arg1128His) rs12713843
NM_000384.2(APOB):c.3427C>T (p.Pro1143Ser) rs72653077
NM_000384.2(APOB):c.35delT (p.Leu12Argfs) rs1060499841
NM_000384.2(APOB):c.5066G>A (p.Arg1689His) rs151009667
NM_000384.2(APOB):c.5741A>G (p.Asn1914Ser) rs1801699
NM_000384.2(APOB):c.6639_6641delTGA (p.Asp2213del) rs541497967
NM_000384.2(APOB):c.6895G>C (p.Asp2299His) rs12713681
NM_000384.2(APOB):c.7285T>A (p.Ser2429Thr) rs72653092
NM_000384.2(APOB):c.7696G>A (p.Glu2566Lys) rs1801696
NM_000384.2(APOB):c.7853T>C (p.Ile2618Thr) rs531273434
NM_000384.2(APOB):c.8462C>T (p.Pro2821Leu) rs72653095
NM_000384.2(APOB):c.9175C>T (p.Arg3059Cys) rs146377316
NM_000384.2(APOB):c.9639C>A (p.Asn3213Lys) rs574725520
NM_000384.2(APOB):c.9835A>G (p.Ser3279Gly) rs12720854
NM_000391.3(TPP1):c.299A>G (p.Gln100Arg) rs1800746
NM_000402.4(G6PD):c.292G>A (p.Val98Met) rs1050828
NM_000406.2(GNRHR):c.317A>G (p.Gln106Arg) rs104893836
NM_000410.3(HFE):c.187C>G (p.His63Asp) rs1799945
NM_000410.3(HFE):c.340+4T>C rs2071303
NM_000410.3(HFE):c.845G>A (p.Cys282Tyr) rs1800562
NM_000411.6(HLCS):c.1672G>A (p.Glu558Lys) rs149736764
NM_000411.6(HLCS):c.424G>A (p.Val142Ile) rs149291867
NM_000414.3(HSD17B4):c.*6A>G rs111671384
NM_000414.3(HSD17B4):c.1059G>A (p.Ala353=) rs57972893
NM_000414.3(HSD17B4):c.1210-8T>C rs34254740
NM_000414.3(HSD17B4):c.1471G>A (p.Ala491Thr) rs28943591
NM_000414.3(HSD17B4):c.1566T>A (p.Ser522Arg) rs184492796
NM_000414.3(HSD17B4):c.1596T>C (p.His532=) rs758045328
NM_000414.3(HSD17B4):c.1767+8T>C rs190659146
NM_000414.3(HSD17B4):c.1791C>T (p.Val597=) rs2560722
NM_000414.3(HSD17B4):c.2060C>T (p.Thr687Ile) rs28943592
NM_000414.3(HSD17B4):c.2182A>G (p.Met728Val) rs28943594
NM_000414.3(HSD17B4):c.2199C>T (p.Tyr733=) rs12714
NM_000414.3(HSD17B4):c.420A>T (p.Lys140Asn) rs28943589
NM_000414.3(HSD17B4):c.666C>G (p.Val222=) rs150677536
NM_000414.3(HSD17B4):c.875C>G (p.Thr292Ser) rs1143650
NM_000416.2(IFNGR1):c.1050T>G (p.Ser350=) rs11914
NM_000417.2(IL2RA):c.84G>A (p.Pro28=) rs2228150
NM_000431.3(MVK):c.155G>A (p.Ser52Asn) rs7957619
NM_000431.3(MVK):c.405G>A (p.Ser135=) rs34368092
NM_000432.3(MYL2):c.132T>C (p.Ile44=) rs2301610
NM_000432.3(MYL2):c.141C>A (p.Asn47Lys) rs199474808
NM_000432.3(MYL2):c.163G>T (p.Ala55Ser) rs727504425
NM_000432.3(MYL2):c.170G>A (p.Gly57Glu) rs199474809
NM_000432.3(MYL2):c.173G>A (p.Arg58Gln) rs104894369
NM_000432.3(MYL2):c.239C>A (p.Thr80Asn) rs587782965
NM_000432.3(MYL2):c.243G>T (p.Val81=) rs368851472
NM_000432.3(MYL2):c.260G>C (p.Gly87Ala) rs397516399
NM_000432.3(MYL2):c.274+9G>A rs371405579
NM_000432.3(MYL2):c.275-14G>C rs375703502
NM_000432.3(MYL2):c.279G>A (p.Ala93=) rs28645088
NM_000432.3(MYL2):c.33G>A (p.Gly11=) rs199742269
NM_000432.3(MYL2):c.342G>A (p.Leu114=) rs199572927
NM_000432.3(MYL2):c.355G>A (p.Val119Ile) rs730880940
NM_000432.3(MYL2):c.36C>T (p.Gly12=) rs139794370
NM_000432.3(MYL2):c.37G>A (p.Ala13Thr) rs104894363
NM_000432.3(MYL2):c.4-14C>T rs12301951
NM_000432.3(MYL2):c.401A>C (p.Glu134Ala) rs143139258
NM_000432.3(MYL2):c.484G>A (p.Gly162Arg) rs199474814
NM_000432.3(MYL2):c.64G>A (p.Glu22Lys) rs104894368
NM_000435.2(NOTCH3):c.509A>G (p.His170Arg) rs147373451
NM_000441.1(SLC26A4):c.-103T>C rs60284988
NM_000441.1(SLC26A4):c.-3-2A>G rs397516411
NM_000441.1(SLC26A4):c.-66C>G rs17154282
NM_000441.1(SLC26A4):c.1001+1G>A rs80338849
NM_000441.1(SLC26A4):c.1002-9A>C rs10234822
NM_000441.1(SLC26A4):c.1003T>C (p.Phe335Leu) rs111033212
NM_000441.1(SLC26A4):c.1050G>A (p.Leu350=) rs727504993
NM_000441.1(SLC26A4):c.1061T>C (p.Phe354Ser) rs111033243
NM_000441.1(SLC26A4):c.1069G>A (p.Ala357Thr) rs145467740
NM_000441.1(SLC26A4):c.1151A>G (p.Glu384Gly) rs111033244
NM_000441.1(SLC26A4):c.1198delT (p.Cys400Valfs) rs397516413
NM_000441.1(SLC26A4):c.1204G>A (p.Val402Met) rs397516414
NM_000441.1(SLC26A4):c.1226G>A (p.Arg409His) rs111033305
NM_000441.1(SLC26A4):c.1229C>T (p.Thr410Met) rs111033220
NM_000441.1(SLC26A4):c.1246A>C (p.Thr416Pro) rs28939086
NM_000441.1(SLC26A4):c.1264-1G>C rs111033311
NM_000441.1(SLC26A4):c.1284_1286delTGC (p.Ala429del) rs111033306
NM_000441.1(SLC26A4):c.1336C>T (p.Gln446Ter) rs397516416
NM_000441.1(SLC26A4):c.1437+2T>G rs397516418
NM_000441.1(SLC26A4):c.1468A>C (p.Ile490Leu) rs200511789
NM_000441.1(SLC26A4):c.147C>G (p.Ser49Arg) rs756969021
NM_000441.1(SLC26A4):c.1488C>T (p.Leu496=) rs77407094
NM_000441.1(SLC26A4):c.1489G>A (p.Gly497Ser) rs111033308
NM_000441.1(SLC26A4):c.1522A>G (p.Thr508Ala) rs727505088
NM_000441.1(SLC26A4):c.1541A>G (p.Gln514Arg) rs111033316
NM_000441.1(SLC26A4):c.1544+1G>A rs876657722
NM_000441.1(SLC26A4):c.1545-5T>G rs77944876
NM_000441.1(SLC26A4):c.1588T>C (p.Tyr530His) rs111033254
NM_000441.1(SLC26A4):c.15C>A (p.Gly5=) rs7811324
NM_000441.1(SLC26A4):c.1614C>T (p.Asn538=) rs111033193
NM_000441.1(SLC26A4):c.1708G>A (p.Val570Ile) rs397516421
NM_000441.1(SLC26A4):c.1790T>C (p.Leu597Ser) rs55638457
NM_000441.1(SLC26A4):c.17G>T (p.Gly6Val) rs111033423
NM_000441.1(SLC26A4):c.1826T>G (p.Val609Gly) rs17154335
NM_000441.1(SLC26A4):c.1924T>C (p.Ser642Pro) rs397516423
NM_000441.1(SLC26A4):c.1963A>G (p.Ile655Val) rs397516424
NM_000441.1(SLC26A4):c.200C>G (p.Thr67Ser) rs111033240
NM_000441.1(SLC26A4):c.2027T>A (p.Leu676Gln) rs111033318
NM_000441.1(SLC26A4):c.2089+1G>A rs727503430
NM_000441.1(SLC26A4):c.2139T>G (p.Ile713Met) rs143708308
NM_000441.1(SLC26A4):c.2145G>T (p.Lys715Asn) rs397516427
NM_000441.1(SLC26A4):c.2162C>T (p.Thr721Met) rs121908363
NM_000441.1(SLC26A4):c.2168A>G (p.His723Arg) rs121908362
NM_000441.1(SLC26A4):c.2171A>G (p.Asp724Gly) rs757820624
NM_000441.1(SLC26A4):c.2190G>T (p.Gln730His) rs142723249
NM_000441.1(SLC26A4):c.2215C>T (p.Gln739Ter) rs727503431
NM_000441.1(SLC26A4):c.2218G>A (p.Gly740Ser) rs17154353
NM_000441.1(SLC26A4):c.2320-4A>C rs727503432
NM_000441.1(SLC26A4):c.294_298delCACGC (p.Thr99Alafs) rs111033241
NM_000441.1(SLC26A4):c.349C>T rs145254330
NM_000441.1(SLC26A4):c.416-7T>C rs111033387
NM_000441.1(SLC26A4):c.554G>C (p.Arg185Thr) rs542620119
NM_000441.1(SLC26A4):c.565G>T (p.Ala189Ser) rs35045430
NM_000441.1(SLC26A4):c.578C>T rs111033348
NM_000441.1(SLC26A4):c.68C>A (p.Ser23Ter) rs397516430
NM_000441.1(SLC26A4):c.706C>G (p.Leu236Val) rs111033242
NM_000441.1(SLC26A4):c.707T>C (p.Leu236Pro) rs80338848
NM_000441.1(SLC26A4):c.716T>A (p.Val239Asp) rs111033256
NM_000441.1(SLC26A4):c.796G>A (p.Asp266Asn) rs138462416
NM_000441.1(SLC26A4):c.841G>A (p.Val281Ile) rs727505080
NM_000441.1(SLC26A4):c.845G>A (p.Cys282Tyr) rs111033454
NM_000441.1(SLC26A4):c.849G>C (p.Met283Ile) rs146348818
NM_000441.1(SLC26A4):c.85G>C (p.Glu29Gln) rs111033205
NM_000441.1(SLC26A4):c.898A>C (p.Ile300Leu) rs111033304
NM_000441.1(SLC26A4):c.919-2A>G rs111033313
NM_000441.1(SLC26A4):c.964A>G (p.Asn322Asp) rs143002265
NM_000441.1(SLC26A4):c.970A>T (p.Asn324Tyr) rs36039758
NM_000443.3(ABCB4):c.523A>G (p.Thr175Ala) rs58238559
NM_000443.3(ABCB4):c.959C>T (p.Ser320Phe) rs72552778
NM_000445.4(PLEC):c.10006C>T (p.Arg3336Cys) rs77303974
NM_000445.4(PLEC):c.10026C>T (p.Ser3342=) rs28657061
NM_000445.4(PLEC):c.10095C>T (p.Val3365=) rs35775257
NM_000445.4(PLEC):c.10139G>C (p.Gly3380Ala) rs35261863
NM_000445.4(PLEC):c.10693T>C (p.Leu3565=) rs6992333
NM_000445.4(PLEC):c.10746G>A (p.Thr3582=) rs6984820
NM_000445.4(PLEC):c.11001C>T (p.Tyr3667=) rs28455570
NM_000445.4(PLEC):c.11170C>T (p.Leu3724=) rs17062686
NM_000445.4(PLEC):c.11208T>C (p.Ala3736=) rs7819099
NM_000445.4(PLEC):c.11682C>T (p.Asp3894=) rs75833626
NM_000445.4(PLEC):c.11709A>G (p.Pro3903=) rs7822511
NM_000445.4(PLEC):c.1176T>C (p.Asp392=) rs11783799
NM_000445.4(PLEC):c.11967A>G (p.Thr3989=) rs6558406
NM_000445.4(PLEC):c.1239C>G (p.Ser413Arg) rs201667254
NM_000445.4(PLEC):c.12642C>T (p.Asp4214=) rs11998271
NM_000445.4(PLEC):c.12894A>G (p.Ser4298=) rs6558405
NM_000445.4(PLEC):c.13191C>T (p.Ala4397=) rs187810163
NM_000445.4(PLEC):c.13286C>T (p.Thr4429Met) rs113513807
NM_000445.4(PLEC):c.13542T>C (p.Ala4514=) rs7014582
NM_000445.4(PLEC):c.1592C>T (p.Ala531Val) rs11136336
NM_000445.4(PLEC):c.1787G>A (p.Arg596Gln) rs3135103
NM_000445.4(PLEC):c.2298G>A (p.Gln766=) rs116612406
NM_000445.4(PLEC):c.2385+13dupG rs35671527
NM_000445.4(PLEC):c.2538+6C>T rs11780911
NM_000445.4(PLEC):c.2694-7C>A rs11990994
NM_000445.4(PLEC):c.3459G>A (p.Glu1153=) rs11991764
NM_000445.4(PLEC):c.3631T>C (p.Leu1211=) rs3135109
NM_000445.4(PLEC):c.3827G>A (p.Arg1276Gln) rs11136334
NM_000445.4(PLEC):c.3838-6A>G rs11136333
NM_000445.4(PLEC):c.4046A>G (p.His1349Arg) rs55895668
NM_000445.4(PLEC):c.4126-4A>G rs7002152
NM_000445.4(PLEC):c.4494T>C (p.Ala1498=) rs35916068
NM_000445.4(PLEC):c.4536T>G (p.Ala1512=) rs56117011
NM_000445.4(PLEC):c.4557G>A (p.Ala1519=) rs55646585
NM_000445.4(PLEC):c.459T>C (p.Ala153=) rs6993938
NM_000445.4(PLEC):c.4638G>A (p.Ser1546=) rs79705634
NM_000445.4(PLEC):c.4761G>A (p.Ala1587=) rs55836855
NM_000445.4(PLEC):c.5310G>A (p.Ala1770=) rs140406501
NM_000445.4(PLEC):c.5664G>A (p.Ala1888=) rs75586449
NM_000445.4(PLEC):c.5946G>A (p.Ala1982=) rs62642469
NM_000445.4(PLEC):c.5988T>C (p.Ala1996=) rs2857829
NM_000445.4(PLEC):c.6009G>A (p.Ala2003=) rs1140522
NM_000445.4(PLEC):c.6150C>G (p.Arg2050=) rs376365984
NM_000445.4(PLEC):c.6251C>T (p.Ala2084Val) rs7002002
NM_000445.4(PLEC):c.6395C>T (p.Ala2132Val) rs74772299
NM_000445.4(PLEC):c.6522G>A (p.Ala2174=) rs7016416
NM_000445.4(PLEC):c.6658C>T (p.Leu2220=) rs28610521
NM_000445.4(PLEC):c.7662A>C (p.Ala2554=) rs11778026
NM_000445.4(PLEC):c.7807C>T (p.Leu2603=) rs11988293
NM_000445.4(PLEC):c.7959G>A (p.Leu2653=) rs34803322
NM_000445.4(PLEC):c.799+10C>T rs12545876
NM_000445.4(PLEC):c.8041T>C (p.Ser2681Pro) rs7833924
NM_000445.4(PLEC):c.8093G>A (p.Arg2698Gln) rs28526657
NM_000445.4(PLEC):c.8106C>T (p.Gly2702=) rs35139934
NM_000445.4(PLEC):c.8334C>T (p.Asn2778=) rs11777402
NM_000445.4(PLEC):c.8400C>T (p.Ala2800=) rs34534853
NM_000445.4(PLEC):c.8576G>A (p.Arg2859His) rs6558407
NM_000445.4(PLEC):c.8901C>G (p.Asp2967Glu) rs58308209
NM_000445.4(PLEC):c.9182C>T (p.Ala3061Val) rs35858667
NM_000445.4(PLEC):c.9504C>T (p.Gly3168=) rs61529674
NM_000449.3(RFX5):c.1226C>G (p.Pro409Arg) rs2233854
NM_000452.2(SLC10A2):c.868C>T (p.Pro290Ser) rs56398830
NM_000455.4(STK11):c.1062C>G (p.Phe354Leu) rs59912467
NM_000455.4(STK11):c.1211C>T (p.Ser404Phe) rs200078204
NM_000455.4(STK11):c.1226G>A (p.Arg409Gln) rs587782364
NM_000455.4(STK11):c.465-4G>A rs587780009
NM_000457.4(HNF4A):c.416C>T (p.Thr139Ile) rs1800961
NM_000458.3(HNF1B):c.244G>A (p.Asp82Asn) rs140562402
NM_000465.3(BARD1):c.1053G>C (p.Thr351=) rs2070096
NM_000465.3(BARD1):c.1518T>C (p.His506=) rs2070093
NM_000465.3(BARD1):c.1568+14C>T rs5031011
NM_000466.2(PEX1):c.2331C>A (p.Gly777=) rs10278857
NM_000466.2(PEX1):c.2584-10delT rs5885806
NM_000478.5(ALPL):c.455G>A (p.Arg152His) rs149344982
NM_000479.4(AMH):c.974A>G (p.Gln325Arg) rs140765565
NM_000492.3(CFTR):c.-8G>C rs1800501
NM_000492.3(CFTR):c.1210-11T>G rs73715573
NM_000492.3(CFTR):c.1210-12T[5] rs1805177
NM_000492.3(CFTR):c.1210-12T[9] rs1805177
NM_000492.3(CFTR):c.1210-13G>T rs10229820
NM_000492.3(CFTR):c.1327G>T (p.Asp443Tyr) rs147422190
NM_000492.3(CFTR):c.1408G>A (p.Val470Met) rs213950
NM_000492.3(CFTR):c.1521_1523delCTT (p.Phe508delPhe) rs113993960
NM_000492.3(CFTR):c.1523T>G (p.Phe508Cys) rs74571530
NM_000492.3(CFTR):c.1581A>G (p.Glu527=) rs1800094
NM_000492.3(CFTR):c.1652G>A (p.Gly551Asp) rs75527207
NM_000492.3(CFTR):c.1727G>C (p.Gly576Ala) rs1800098
NM_000492.3(CFTR):c.1766+5G>T rs121908796
NM_000492.3(CFTR):c.1865G>A (p.Gly622Asp) rs121908759
NM_000492.3(CFTR):c.2002C>T (p.Arg668Cys) rs1800100
NM_000492.3(CFTR):c.224G>A (p.Arg75Gln) rs1800076
NM_000492.3(CFTR):c.2562T>G (p.Thr854=) rs1042077
NM_000492.3(CFTR):c.274-6T>C rs371315549
NM_000492.3(CFTR):c.2820T>G (p.Thr940=) rs60887846
NM_000492.3(CFTR):c.2898G>A (p.Thr966=) rs1800109
NM_000492.3(CFTR):c.2909G>A (p.Gly970Asp) rs386134230
NM_000492.3(CFTR):c.3180A>G (p.Lys1060=) rs142526976
NM_000492.3(CFTR):c.3208C>T (p.Arg1070Trp) rs202179988
NM_000492.3(CFTR):c.3285A>T (p.Thr1095=) rs1800118
NM_000492.3(CFTR):c.3705T>G (p.Ser1235Arg) rs34911792
NM_000492.3(CFTR):c.3846G>A (p.Trp1282Ter) rs77010898
NM_000492.3(CFTR):c.3870A>G (p.Pro1290=) rs1800130
NM_000492.3(CFTR):c.3897A>G (p.Thr1299=) rs1800131
NM_000492.3(CFTR):c.4242+13A>G rs76179227
NM_000492.3(CFTR):c.4389G>A (p.Gln1463=) rs1800136
NM_000492.3(CFTR):c.869+11C>T rs1800503
NM_000492.3(CFTR):c.890G>A (p.Arg297Gln) rs143486492
NM_000495.4(COL4A5):c.2858G>T (p.Gly953Val) rs78972735
NM_000497.3(CYP11B1):c.1120C>A (p.Arg374=) rs61752786
NM_000500.7(CYP21A2):c.806G>C (p.Ser269Thr) rs6472
NM_000500.7(CYP21A2):c.844G>T (p.Val282Leu) rs6471
NM_000501.3(ELN):c.1415-9A>G rs727503032
NM_000501.3(ELN):c.1566T>A (p.Gly522=) rs61734584
NM_000501.3(ELN):c.1828G>A (p.Gly610Ser) rs140425210
NM_000501.3(ELN):c.212C>T (p.Ala71Val) rs41350445
NM_000501.3(ELN):c.427+8C>T rs55868272
NM_000503.5(EYA1):c.1141-15T>G rs186249248
NM_000503.5(EYA1):c.1200-11C>A rs181457812
NM_000503.5(EYA1):c.1276G>A (p.Gly426Ser) rs121909199
NM_000503.5(EYA1):c.1460C>T (p.Ser487Leu) rs139717960
NM_000503.5(EYA1):c.164C>T (p.Thr55Met) rs201434219
NM_000503.5(EYA1):c.1699-3C>T rs117149407
NM_000503.5(EYA1):c.1699-8T>C rs201537030
NM_000503.5(EYA1):c.744G>A (p.Thr248=) rs10098224
NM_000503.5(EYA1):c.782C>T (p.Pro261Leu) rs77825059
NM_000503.5(EYA1):c.840C>A (p.Ile280=) rs55972891
NM_000503.5(EYA1):c.890G>A (p.Arg297Gln) rs148647933
NM_000503.5(EYA1):c.966+4C>T rs139429307
NM_000514.3(GDNF):c.277C>T (p.Arg93Trp) rs36119840
NM_000520.4(HEXA):c.745C>T (p.Arg249Trp) rs138058578
NM_000520.5(HEXA):c.672+30T>G rs117160567
NM_000527.4(LDLR):c.1003G>A (p.Gly335Ser) rs544453230
NM_000527.4(LDLR):c.1024G>A (p.Asp342Asn) rs139361635
NM_000527.4(LDLR):c.1024G>T (p.Asp342Tyr) rs139361635
NM_000527.4(LDLR):c.1027G>A (p.Gly343Ser) rs730882096
NM_000527.4(LDLR):c.1056_1060+3delCGAAGGTG rs879254770
NM_000527.4(LDLR):c.1060+10G>C rs12710260
NM_000527.4(LDLR):c.1060+7T>C rs2738442
NM_000527.4(LDLR):c.1217G>A (p.Arg406Gln) rs552422789
NM_000527.4(LDLR):c.1222G>A (p.Glu408Lys) rs137943601
NM_000527.4(LDLR):c.131G>A (p.Trp44Ter) rs267607213
NM_000527.4(LDLR):c.1329G>C (p.Trp443Cys) rs879254867
NM_000527.4(LDLR):c.1358+2T>A rs193922567
NM_000527.4(LDLR):c.1359-1G>A rs139617694
NM_000527.4(LDLR):c.1359-5C>G rs531005522
NM_000527.4(LDLR):c.1413A>G (p.Arg471=) rs5930
NM_000527.4(LDLR):c.1414G>T (p.Asp472Tyr) rs730882102
NM_000527.4(LDLR):c.148G>A (p.Ala50Thr) rs137853960
NM_000527.4(LDLR):c.148G>T (p.Ala50Ser) rs137853960
NM_000527.4(LDLR):c.1576C>T (p.Pro526Ser) rs730882106
NM_000527.4(LDLR):c.1706-10G>A rs17248882
NM_000527.4(LDLR):c.1725C>T (p.Leu575=) rs1799898
NM_000527.4(LDLR):c.1773C>T (p.Asn591=) rs688
NM_000527.4(LDLR):c.1775G>A (p.Gly592Glu) rs137929307
NM_000527.4(LDLR):c.1836C>T (p.Ala612=) rs143872778
NM_000527.4(LDLR):c.185C>T (p.Thr62Met) rs376207800
NM_000527.4(LDLR):c.1876G>A (p.Glu626Lys) rs139791325
NM_000527.4(LDLR):c.2043C>A (p.Cys681Ter) rs121908031
NM_000527.4(LDLR):c.2054C>T (p.Pro685Leu) rs28942084
NM_000527.4(LDLR):c.2225C>T (p.Thr742Ile) rs767546791
NM_000527.4(LDLR):c.2232A>G (p.Arg744=) rs5927
NM_000527.4(LDLR):c.2389G>A (p.Val797Met) rs750518671
NM_000527.4(LDLR):c.2506G>A (p.Val836Ile) rs879255220
NM_000527.4(LDLR):c.259T>G (p.Trp87Gly) rs121908025
NM_000527.4(LDLR):c.269A>G (p.Asp90Gly) rs771019366
NM_000527.4(LDLR):c.301G>A (p.Glu101Lys) rs144172724
NM_000527.4(LDLR):c.313+1G>A rs112029328
NM_000527.4(LDLR):c.313+1G>C rs112029328
NM_000527.4(LDLR):c.313+2T>C rs793888517
NM_000527.4(LDLR):c.352G>T (p.Asp118Tyr) rs730882080
NM_000527.4(LDLR):c.370C>T (p.Arg124Trp) rs879254498
NM_000527.4(LDLR):c.400T>C (p.Cys134Arg) rs875989900
NM_000527.4(LDLR):c.507C>T (p.Asn169=) rs146354103
NM_000527.4(LDLR):c.638G>C (p.Ser213Thr) rs879254604
NM_000527.4(LDLR):c.662A>G (p.Asp221Gly) rs373822756
NM_000527.4(LDLR):c.680_681delAC (p.Asp227Glyfs) rs387906305
NM_000527.4(LDLR):c.681C>G (p.Asp227Glu) rs121908028
NM_000527.4(LDLR):c.682G>A (p.Glu228Lys) rs121908029
NM_000527.4(LDLR):c.761A>C (p.Gln254Pro) rs879254667
NM_000527.4(LDLR):c.798T>A (p.Asp266Glu) rs139043155
NM_000527.4(LDLR):c.970G>A (p.Gly324Ser) rs72658860
NM_000528.3(MAN2B1):c.1010G>A (p.Arg337Gln) rs1133330
NM_000528.3(MAN2B1):c.832C>G (p.Leu278Val) rs1054486
NM_000528.3(MAN2B1):c.935C>T (p.Thr312Ile) rs1054487
NM_000531.5(OTC):c.140A>C (p.Asn47Thr) rs67939655
NM_000535.5(PMS2):c.1080A>G (p.Ile360Met) rs567102013
NM_000535.5(PMS2):c.2192_2196delTAACT (p.Leu731Cysfs) rs63750695
NM_000535.6(PMS2):c.1004A>G (p.Asn335Ser) rs200513014
NM_000535.6(PMS2):c.1096G>C (p.Asp366His) rs141769057
NM_000535.6(PMS2):c.1364C>T (p.Ser455Phe) rs748698776
NM_000535.6(PMS2):c.137G>T (p.Ser46Ile) rs121434629
NM_000535.6(PMS2):c.1408C>T (p.Pro470Ser) rs1805321
NM_000535.6(PMS2):c.1454C>A (p.Thr485Lys) rs1805323
NM_000535.6(PMS2):c.1688G>T (p.Arg563Leu) rs63750668
NM_000535.6(PMS2):c.1831dup (p.Ile611Asnfs) rs63750250
NM_000535.6(PMS2):c.1866G>A (p.Met622Ile) rs1805324
NM_000535.6(PMS2):c.1A>G (p.Met1Val) rs587779333
NM_000535.6(PMS2):c.2007-4G>A rs1805326
NM_000535.6(PMS2):c.59G>A (p.Arg20Gln) rs10254120
NM_000535.6(PMS2):c.620G>A (p.Gly207Glu) rs374704824
NM_000535.6(PMS2):c.706-4delT rs60794673
NM_000535.6(PMS2):c.780C>G (p.Ser260=) rs1805319
NM_000535.6(PMS2):c.953A>G (p.Tyr318Cys) rs139438201
NM_000540.2(RYR1):c.10204T>G (p.Cys3402Gly) rs367543058
NM_000540.2(RYR1):c.10616G>A (p.Arg3539His) rs143987857
NM_000540.2(RYR1):c.10687-7C>T rs2960354
NM_000540.2(RYR1):c.11315G>A (p.Arg3772Gln) rs193922839
NM_000540.2(RYR1):c.11547G>A (p.Gln3849=) rs142518033
NM_000540.2(RYR1):c.1201C>T (p.Arg401Cys) rs193922764
NM_000540.2(RYR1):c.13317C>T (p.Ala4439=) rs113579185
NM_000540.2(RYR1):c.13934G>A (p.Arg4645Gln) rs193922860
NM_000540.2(RYR1):c.14524G>A rs193922879
NM_000540.2(RYR1):c.1840C>T (p.Arg614Cys) rs118192172
NM_000540.2(RYR1):c.2122G>A (p.Asp708Asn) rs138874610
NM_000540.2(RYR1):c.297G>A (p.Thr99=) rs144241486
NM_000540.2(RYR1):c.4711A>G (p.Ile1571Val) rs146429605
NM_000540.2(RYR1):c.5036G>A (p.Arg1679His) rs146504767
NM_000540.2(RYR1):c.594A>G (p.Leu198=) rs2229139
NM_000540.2(RYR1):c.6178G>T (p.Gly2060Cys) rs35364374
NM_000540.2(RYR1):c.6549-8G>A rs756593088
NM_000540.2(RYR1):c.6617C>T (p.Thr2206Met) rs118192177
NM_000540.2(RYR1):c.6721C>T rs200563280
NM_000540.2(RYR1):c.6961A>G (p.Ile2321Val) rs34390345
NM_000540.2(RYR1):c.7025A>G (p.Asn2342Ser) rs147213895
NM_000540.2(RYR1):c.7300G>A (p.Gly2434Arg) rs121918593
NM_000540.2(RYR1):c.7360C>T (p.Arg2454Cys) rs193922816
NM_000540.2(RYR1):c.7372C>T (p.Arg2458Cys) rs28933397
NM_000540.2(RYR1):c.8327C>T (p.Ser2776Phe) rs147707463
NM_000540.2(RYR1):c.9713A>G (p.Glu3238Gly) rs200950673
NM_000543.4(SMPD1):c.138_143delGCTGGC (p.Ala48_Leu49del) rs3838786
NM_000543.4(SMPD1):c.1522G>A (p.Gly508Arg) rs1050239
NM_000543.4(SMPD1):c.757G>C (p.Asp253His) rs398123479
NM_000545.6(HNF1A):c.1748G>A (p.Arg583Gln) rs137853242
NM_000546.5(TP53):c.1040C>A (p.Ala347Asp) rs397516434
NM_000546.5(TP53):c.139C>T (p.Pro47Ser) rs1800371
NM_000546.5(TP53):c.31G>C (p.Glu11Gln) rs201382018
NM_000546.5(TP53):c.380C>T (p.Ser127Phe) rs730881999
NM_000546.5(TP53):c.473G>A (p.Arg158His) rs587782144
NM_000546.5(TP53):c.524G>A (p.Arg175His) rs28934578
NM_000546.5(TP53):c.542G>A (p.Arg181His) rs397514495
NM_000546.5(TP53):c.638G>A (p.Arg213Gln) rs587778720
NM_000546.5(TP53):c.639A>G (p.Arg213=) rs1800372
NM_000546.5(TP53):c.733G>A (p.Gly245Ser) rs28934575
NM_000546.5(TP53):c.742C>T (p.Arg248Trp) rs121912651
NM_000546.5(TP53):c.77_80delTTCCinsAAGAACGT (p.Leu26Glnfs) rs397516438
NM_000546.5(TP53):c.817C>T (p.Arg273Cys) rs121913343
NM_000546.5(TP53):c.847C>T (p.Arg283Cys) rs149633775
NM_000546.5(TP53):c.869G>A (p.Arg290His) rs55819519
NM_000546.5(TP53):c.885T>C (p.Pro295=) rs200073907
NM_000546.5(TP53):c.903A>G (p.Pro301=) rs72661120
NM_000546.5(TP53):c.920-2A>G rs397516439
NM_000546.5(TP53):c.949C>T (p.Gln317Ter) rs764735889
NM_000546.5(TP53):c.993+309C>T rs758194998
NM_000548.3(TSC2):c.1100G>A (p.Arg367Gln) rs1800725
NM_000548.3(TSC2):c.4527_4529delCTT (p.Phe1510del) rs137854239
NM_000548.3(TSC2):c.5202T>C (p.Asp1734=) rs1748
NM_000548.3(TSC2):c.5383C>T (p.Arg1795Cys) rs45517423
NM_000548.4(TSC2):c.1070C>T (p.Ala357Val) rs150195368
NM_000548.4(TSC2):c.1110G>A (p.Gln370=) rs1800742
NM_000548.4(TSC2):c.1276C>T (p.Leu426=) rs45478593
NM_000548.4(TSC2):c.1378G>A (p.Ala460Thr) rs137854154
NM_000548.4(TSC2):c.1578C>T (p.Ser526=) rs34012042
NM_000548.4(TSC2):c.1600-14C>T rs45517185
NM_000548.4(TSC2):c.1609C>T (p.Arg537Cys) rs142257684
NM_000548.4(TSC2):c.2031C>T (p.Pro677=) rs45517208
NM_000548.4(TSC2):c.2476C>A (p.Leu826Met) rs45517238
NM_000548.4(TSC2):c.2545+26G>A rs45517242
NM_000548.4(TSC2):c.2580T>C (p.Phe860=) rs13337626
NM_000548.4(TSC2):c.2632C>T (p.Pro878Ser) rs397515077
NM_000548.4(TSC2):c.275A>T (p.Glu92Val) rs137853994
NM_000548.4(TSC2):c.2784C>T (p.Pro928=) rs45517267
NM_000548.4(TSC2):c.3002G>A (p.Gly1001Glu) rs368878445
NM_000548.4(TSC2):c.3421G>A (p.Ala1141Thr) rs45505895
NM_000548.4(TSC2):c.3914C>T (p.Pro1305Leu) rs45517320
NM_000548.4(TSC2):c.3915G>A (p.Pro1305=) rs11551373
NM_000548.4(TSC2):c.3989C>T (p.Thr1330Met) rs397515209
NM_000548.4(TSC2):c.4195G>A (p.Gly1399Arg) rs45466399
NM_000548.4(TSC2):c.4269G>A (p.Leu1423=) rs45438898
NM_000548.4(TSC2):c.429C>G (p.Phe143Leu) rs137854406
NM_000548.4(TSC2):c.482-3C>T rs1800720
NM_000548.4(TSC2):c.4959C>T (p.Ser1653=) rs45517384
NM_000548.4(TSC2):c.4983C>T (p.Thr1661=) rs35534817
NM_000548.4(TSC2):c.5068+27_5068+60del34 rs137854209
NM_000548.4(TSC2):c.5161-10A>C rs1800718
NM_000548.4(TSC2):c.5161-9C>T rs45515893
NM_000548.4(TSC2):c.5260-12C>T rs769264472
NM_000548.4(TSC2):c.5260-15C>T rs45517416
NM_000548.4(TSC2):c.5397G>C (p.Ser1799=) rs1051771
NM_000548.4(TSC2):c.729C>G (p.Leu243=) rs45473698
NM_000548.4(TSC2):c.856A>G (p.Met286Val) rs1800748
NM_000551.3(VHL):c.150C>G (p.Ala50=) rs61751580
NM_000551.3(VHL):c.208G>A (p.Glu70Lys) rs5030802
NM_000551.3(VHL):c.241C>T (p.Pro81Ser) rs104893829
NM_000551.3(VHL):c.256C>T (p.Pro86Ser) rs398123481
NM_000551.3(VHL):c.319C>G (p.Arg107Gly) rs397516440
NM_000551.3(VHL):c.340+5G>C rs61758376
NM_000551.3(VHL):c.463+8C>T rs5030834
NM_000551.3(VHL):c.467A>G (p.Tyr156Cys) rs397516441
NM_000551.3(VHL):c.481C>T (p.Arg161Ter) rs5030818
NM_000551.3(VHL):c.562C>G (p.Leu188Val) rs5030824
NM_000551.3(VHL):c.598C>T (p.Arg200Trp) rs28940298
NM_000552.4(VWF):c.3797C>T (p.Pro1266Leu) rs61749370
NM_000552.4(VWF):c.6187C>T (p.Pro2063Ser) rs61750615
NM_000559.2(HBG1):c.227C>T (p.Thr76Ile) rs1061234
NM_000601.4(HGF):c.2179C>T (p.Gln727Ter) rs140790665
NM_000601.5(HGF):c.1008G>A (p.Glu336=) rs148714837
NM_000601.5(HGF):c.1272-4A>G rs1800793
NM_000601.5(HGF):c.137C>T (p.Ala46Val) rs150267054
NM_000601.5(HGF):c.1814C>T (p.Thr605Ile) rs147075806
NM_000601.5(HGF):c.1832G>C (p.Ser611Thr) rs141774517
NM_000601.5(HGF):c.1891G>A (p.Val631Met) rs145494248
NM_000601.5(HGF):c.270T>C (p.Asp90=) rs145598174
NM_000601.5(HGF):c.333A>G (p.Glu111=) rs5745635
NM_000601.5(HGF):c.471A>G (p.Pro157=) rs142045938
NM_000601.5(HGF):c.910G>A (p.Glu304Lys) rs5745687
NM_000603.4(NOS3):c.894T>G (p.Asp298Glu) rs1799983
NM_000618.4(IGF1):c.*263T>A rs70961704
NM_000628.4(IL10RB):c.139A>G (p.Lys47Glu) rs2834167
NM_000642.2(AGL):c.1481G>A (p.Arg494His) rs141043166
NM_000709.3(BCKDHA):c.511delC (p.Leu171Trpfs) rs762084007
NM_000719.6(CACNA1C):c.1468G>A (p.Gly490Arg) rs121912775
NM_000719.6(CACNA1C):c.6040G>A (p.Val2014Ile) rs199473660
NM_000720.3(CACNA1D):c.1378G>A (p.Gly460Ser) rs35874056
NM_000720.3(CACNA1D):c.2058G>A (p.Leu686=) rs146747080
NM_000720.3(CACNA1D):c.2865G>C (p.Leu955=) rs150266932
NM_000720.3(CACNA1D):c.2913C>T (p.Cys971=) rs147169370
NM_000720.3(CACNA1D):c.3952C>T (p.Pro1318Ser) rs72556360
NM_000720.3(CACNA1D):c.5827_5829del (p.Phe1943del) rs72556363
NM_000720.3(CACNA1D):c.6171A>G (p.Thr2057=) rs76868547
NM_000720.3(CACNA1D):c.6477C>T (p.Asp2159=) rs375811590
NM_000720.3(CACNA1D):c.954G>A (p.Ala318=) rs147336902
NM_000724.3(CACNB2):c.1346C>T (p.Thr449Ile) rs143326262
NM_000724.3(CACNB2):c.1611C>A (p.Asp537Glu) rs144182966
NM_000724.3(CACNB2):c.215C>T (p.Ala72Val) rs200367454
NM_000724.3(CACNB2):c.425C>T (p.Ser142Phe) rs150528041
NM_000724.3(CACNB2):c.476G>C (p.Ser159Thr) rs149253719
NM_000739.2(CHRM2):c.691G>A (p.Val231Ile) rs76394680
NM_000739.2(CHRM2):c.703C>A (p.Leu235Met) rs138886480
NM_000739.2(CHRM2):c.773A>G (p.Asn258Ser) rs142006633
NM_000739.2(CHRM2):c.860C>G (p.Thr287Ser) rs138193709
NM_000782.4(CYP24A1):c.1039C>T (p.Gln347Ter) rs777947329
NM_000784.3(CYP27A1):c.1151C>T (p.Pro384Leu) rs41272687
NM_000784.3(CYP27A1):c.1214G>A (p.Arg405Gln) rs121908099
NM_000789.3(ACE):c.12_31del20 (p.Ser5Alafs) rs797045079
NM_001001430.1(TNNT2):c.53-11_53-7delCTTCT rs45533739
NM_001001430.2(TNNT2):c.133+12G>A rs45580032
NM_001001430.2(TNNT2):c.170-11A>G rs368658464
NM_001001430.2(TNNT2):c.170-4C>G rs397516448
NM_001001430.2(TNNT2):c.178A>G (p.Met60Val) rs141837529
NM_001001430.2(TNNT2):c.207G>A (p.Ser69=) rs3729845
NM_001001430.2(TNNT2):c.240C>G (p.Pro80=) rs140245123
NM_001001430.2(TNNT2):c.244G>A (p.Gly82Arg) rs727504255
NM_001001430.2(TNNT2):c.247G>A (p.Glu83Lys) rs727504244
NM_001001430.2(TNNT2):c.251G>C (p.Arg84Thr) rs397516452
NM_001001430.2(TNNT2):c.257A>C (p.Asp86Ala) rs397516455
NM_001001430.2(TNNT2):c.275G>A (p.Arg92Gln) rs121964856
NM_001001430.2(TNNT2):c.280C>T (p.Arg94Cys) rs727503513
NM_001001430.2(TNNT2):c.281G>A (p.Arg94His) rs397516457
NM_001001430.2(TNNT2):c.281G>T (p.Arg94Leu) rs397516457
NM_001001430.2(TNNT2):c.291G>T (p.Lys97Asn) rs397516459
NM_001001430.2(TNNT2):c.311C>T (p.Ala104Val) rs727504245
NM_001001430.2(TNNT2):c.318C>T (p.Ile106=) rs3729547
NM_001001430.2(TNNT2):c.330T>G (p.Phe110Leu) rs727504331
NM_001001430.2(TNNT2):c.382-6_382-4delCCT rs397516462
NM_001001430.2(TNNT2):c.388C>T (p.Arg130Cys) rs397516463
NM_001001430.2(TNNT2):c.391C>T (p.Arg131Trp) rs74315380
NM_001001430.2(TNNT2):c.392G>C (p.Arg131Pro) rs397516464
NM_001001430.2(TNNT2):c.415C>T (p.Arg139Cys) rs397516465
NM_001001430.2(TNNT2):c.416G>A (p.Arg139His) rs397516466
NM_001001430.2(TNNT2):c.430C>T (p.Arg144Trp) rs483352832
NM_001001430.2(TNNT2):c.444G>C (p.Arg148=) rs35914325
NM_001001430.2(TNNT2):c.476G>A (p.Arg159Gln) rs45501500
NM_001001430.2(TNNT2):c.492C>T (p.Asn164=) rs483352833
NM_001001430.2(TNNT2):c.514G>T (p.Ala172Ser) rs730881097
NM_001001430.2(TNNT2):c.517C>T (p.Arg173Trp) rs727503512
NM_001001430.2(TNNT2):c.518G>A (p.Arg173Gln) rs397516471
NM_001001430.2(TNNT2):c.52+7G>A rs374443596
NM_001001430.2(TNNT2):c.536C>T (p.Ser179Phe) rs727504246
NM_001001430.2(TNNT2):c.571-1G>A rs483352835
NM_001001430.2(TNNT2):c.614G>A (p.Arg205Gln) rs121964860
NM_001001430.2(TNNT2):c.63T>G (p.Val21=) rs397516477
NM_001001430.2(TNNT2):c.662T>C (p.Ile221Thr) rs45520032
NM_001001430.2(TNNT2):c.690-13_690-11delCTT rs397516480
NM_001001430.2(TNNT2):c.690-4G>T rs201753429
NM_001001430.2(TNNT2):c.690-6G>A rs113471285
NM_001001430.2(TNNT2):c.754G>A (p.Glu252Lys) rs727504488
NM_001001430.2(TNNT2):c.758A>G (p.Lys253Arg) rs3730238
NM_001001430.2(TNNT2):c.773A>T (p.Lys258Ile) rs397516482
NM_001001430.2(TNNT2):c.807C>T (p.Asn269=) rs376923877
NM_001001430.2(TNNT2):c.833G>C (p.Arg278Pro) rs397516484
NM_001001430.2(TNNT2):c.836G>A (p.Gly279Glu) rs727505233
NM_001001430.2(TNNT2):c.857G>A (p.Arg286His) rs141121678
NM_001001430.2(TNNT2):c.860G>A (p.Trp287Ter) rs727504247
NM_001001430.2(TNNT2):c.861G>A (p.Trp287Ter) rs730881116
NM_001001557.2(GDF6):c.746C>A (p.Ala249Glu) rs121909352
NM_001002295.1(GATA3):c.573C>T (p.Pro191=) rs35508267
NM_001003841.2(SLC6A19):c.517G>A (p.Asp173Asn) rs121434346
NM_001004334.3(GPR179):c.799_803delCAGGTinsTGATCTAC (p.Gln267_Leu602delinsTer) rs886043488
NM_001005242.2(PKP2):c.156G>A (p.Lys52=) rs201210997
NM_001005242.2(PKP2):c.1930T>C (p.Ser644Pro) rs144601090
NM_001005242.2(PKP2):c.2018C>T (p.Pro673Leu) rs144018320
NM_001005360.2(DNM2):c.2139T>C (p.Ala713=) rs2229920
NM_001005741.2(GBA):c.1093G>A (p.Glu365Lys) rs2230288
NM_001005862.2(ERBB2):c.2239G>T (p.Val747Leu) rs121913471
NM_001006658.2(CR2):c.524C>T (p.Pro175Leu) rs75282758
NM_001009944.2(PKD1):c.6598C>T (p.Arg2200Cys) rs140869992
NM_001010892.2(RSPH4A):c.*8A>G rs575857124
NM_001010892.2(RSPH4A):c.-16_-12delTTCTTinsCACGCCCCTTTCATCCA rs727504884
NM_001010892.2(RSPH4A):c.144G>A (p.Gly48=) rs112350099
NM_001010892.2(RSPH4A):c.1489G>A (p.Val497Ile) rs117169123
NM_001010892.2(RSPH4A):c.1662+15C>T rs183372450
NM_001010892.2(RSPH4A):c.1667G>A (p.Arg556His) rs6927567
NM_001010892.2(RSPH4A):c.1879A>C (p.Asn627His) rs9488991
NM_001010892.2(RSPH4A):c.1974A>G (p.Thr658=) rs142977481
NM_001010892.2(RSPH4A):c.2099C>T (p.Ala700Val) rs9488992
NM_001010892.2(RSPH4A):c.446C>G (p.Thr149Ser) rs13213314
NM_001010892.2(RSPH4A):c.731G>A (p.Arg244His) rs41289942
NM_001014763.1(ETFB):c.278dupC (p.Pro94Thrfs) rs74357706
NM_001017420.2(ESCO2):c.294_297delGAGA (p.Arg99Serfs) rs80359845
NM_001017535.1(VDR):c.1056T>C (p.Ile352=) rs731236
NM_001017535.1(VDR):c.2T>C (p.Met1Thr) rs2228570
NM_001018004.1(TPM1):c.775A>G (p.Lys259Glu) rs144045691
NM_001018005.1(TPM1):c.*4001G>A rs730881128
NM_001018005.1(TPM1):c.114+14C>T rs576659891
NM_001018005.1(TPM1):c.180C>T (p.Tyr60=) rs17850194
NM_001018005.1(TPM1):c.240+1G>A rs730881146
NM_001018005.1(TPM1):c.27G>A (p.Gln9=) rs397516365
NM_001018005.1(TPM1):c.284T>C (p.Val95Ala) rs104894504
NM_001018005.1(TPM1):c.337C>G (p.Leu113Val) rs397516369
NM_001018005.1(TPM1):c.453C>A (p.Ala151=) rs1071646
NM_001018005.1(TPM1):c.457C>G (p.His153Asp) rs397516372
NM_001018005.1(TPM1):c.460A>G (p.Ile154Val) rs1555408679
NM_001018005.1(TPM1):c.475G>A (p.Asp159Asn) rs397516373
NM_001018005.1(TPM1):c.479G>A (p.Arg160His) rs199476311
NM_001018005.1(TPM1):c.486T>C (p.Tyr162=) rs11558747
NM_001018005.1(TPM1):c.522C>T (p.Ser174=) rs200173919
NM_001018005.1(TPM1):c.564-11G>A rs532254032
NM_001018005.1(TPM1):c.574G>A (p.Glu192Lys) rs199476315
NM_001018005.1(TPM1):c.639+13delG rs397516488
NM_001018005.1(TPM1):c.644C>T (p.Ser215Leu) rs199476316
NM_001018005.1(TPM1):c.64G>A (p.Ala22Thr) rs397516382
NM_001018005.1(TPM1):c.712C>T (p.Arg238Trp) rs397516386
NM_001018005.1(TPM1):c.842T>C (p.Met281Thr) rs199476321
NM_001018116.2(CAVIN4):c.57G>A (p.Ser19=) rs141589872
NM_001024847.2(TGFBR2):c.1732T>A (p.Ser578Thr) rs112215250
NM_001024847.2(TGFBR2):c.539C>T (p.Thr180Ile) rs727504406
NM_001031681.2(CTNS):c.504G>A (p.Thr168=) rs1800528
NM_001033503.2(SAR1B):c.409G>A (p.Asp137Asn) rs28942109
NM_001033855.2(DCLRE1C):c.457G>A (p.Gly153Arg) rs41297018
NM_001033855.2(DCLRE1C):c.728A>G (p.His243Arg) rs12768894
NM_001034853.1(RPGR):c.223A>G (p.Ile75Val) rs111631988
NM_001035.2(RYR2):c.(?_169)_(273_?)del (p.(?))
NM_001035.2(RYR2):c.10046C>T (p.Ser3349Leu) rs786205455
NM_001035.2(RYR2):c.1005+13A>G rs552027921
NM_001035.2(RYR2):c.10231-4T>C rs117180147
NM_001035.2(RYR2):c.10231-5C>T rs186326951
NM_001035.2(RYR2):c.10254C>T (p.Asn3418=) rs138073811
NM_001035.2(RYR2):c.10324-4A>G rs72751287
NM_001035.2(RYR2):c.10503C>T (p.Thr3501=) rs2797441
NM_001035.2(RYR2):c.1053A>G (p.Thr351=) rs187565743
NM_001035.2(RYR2):c.10641G>A (p.Thr3547=) rs144256966
NM_001035.2(RYR2):c.10776C>T (p.Ser3592=) rs2685301
NM_001035.2(RYR2):c.10941T>G (p.Pro3647=) rs370332882
NM_001035.2(RYR2):c.11092-6A>T rs397516501
NM_001035.2(RYR2):c.11246-11delA rs397516503
NM_001035.2(RYR2):c.1134C>T (p.Asp378=) rs193922621
NM_001035.2(RYR2):c.1143C>T (p.Ser381=) rs368844286
NM_001035.2(RYR2):c.11476+15C>T rs192323827
NM_001035.2(RYR2):c.11496C>T (p.Asp3832=) rs397516505
NM_001035.2(RYR2):c.11835C>T (p.Val3945=) rs78939657
NM_001035.2(RYR2):c.11880+13_11880+16delACTG rs199562036
NM_001035.2(RYR2):c.11963-11T>C rs790889
NM_001035.2(RYR2):c.11988C>T (p.Gly3996=) rs56226196
NM_001035.2(RYR2):c.12159G>A (p.Glu4053=) rs41267517
NM_001035.2(RYR2):c.1218G>A (p.Ser406=) rs147389346
NM_001035.2(RYR2):c.12609G>T (p.Ala4203=) rs372943408
NM_001035.2(RYR2):c.12663C>T (p.Ser4221=) rs370297602
NM_001035.2(RYR2):c.12705C>T (p.Phe4235=) rs373606009
NM_001035.2(RYR2):c.12842C>T (p.Thr4281Met) rs201829896
NM_001035.2(RYR2):c.12919C>T (p.Arg4307Cys) rs200092869
NM_001035.2(RYR2):c.1296C>A (p.Gly432=) rs184176405
NM_001035.2(RYR2):c.1298T>C (p.Leu433Pro) rs121918602
NM_001035.2(RYR2):c.13260+14A>G rs141528541
NM_001035.2(RYR2):c.13326C>T (p.Ala4442=) rs768161152
NM_001035.2(RYR2):c.13329-3T>C rs542440592
NM_001035.2(RYR2):c.13528G>A (p.Ala4510Thr) rs397516510
NM_001035.2(RYR2):c.13593G>A (p.Lys4531=) rs548313130
NM_001035.2(RYR2):c.1359C>T (p.Ser453=) rs3765097
NM_001035.2(RYR2):c.13656T>C (p.His4552=) rs397516512
NM_001035.2(RYR2):c.13740G>A (p.Thr4580=) rs115854664
NM_001035.2(RYR2):c.13783-6A>G rs790901
NM_001035.2(RYR2):c.13913+12A>C rs790900
NM_001035.2(RYR2):c.13977G>A (p.Glu4659=) rs78369334
NM_001035.2(RYR2):c.13983C>T (p.Tyr4661=) rs138498780
NM_001035.2(RYR2):c.14091-11delT rs35563566
NM_001035.2(RYR2):c.14091-11dup rs35563566
NM_001035.2(RYR2):c.14299-12A>G rs41267519
NM_001035.2(RYR2):c.14421C>T (p.Asp4807=) rs75206601
NM_001035.2(RYR2):c.14481C>T (p.Ile4827=) rs114303476
NM_001035.2(RYR2):c.14484G>T (p.Gly4828=) rs370996795
NM_001035.2(RYR2):c.14756+12C>T rs2275693
NM_001035.2(RYR2):c.1477-11delT rs397516518
NM_001035.2(RYR2):c.14809-15C>G rs790897
NM_001035.2(RYR2):c.1519G>A (p.Val507Ile) rs16835270
NM_001035.2(RYR2):c.1548T>C (p.Asp516=) rs146129084
NM_001035.2(RYR2):c.1611G>A (p.Leu537=) rs78281932
NM_001035.2(RYR2):c.1612+13A>G rs368200572
NM_001035.2(RYR2):c.1612+14T>C rs2045955
NM_001035.2(RYR2):c.1776A>T (p.Gly592=) rs72549414
NM_001035.2(RYR2):c.1822C>T (p.His608Tyr) rs727504718
NM_001035.2(RYR2):c.1863C>T (p.His621=) rs17686573
NM_001035.2(RYR2):c.2046A>G (p.Thr682=) rs116098815
NM_001035.2(RYR2):c.2204-7C>G rs147479514
NM_001035.2(RYR2):c.2267G>A (p.Ser756Asn) rs193922623
NM_001035.2(RYR2):c.2301G>T (p.Ser767=) rs117588730
NM_001035.2(RYR2):c.231G>A (p.Ala77=) rs376225470
NM_001035.2(RYR2):c.2397-6C>T rs78165942
NM_001035.2(RYR2):c.2711A>G (p.Tyr904Cys) rs201131315
NM_001035.2(RYR2):c.2719-4T>A rs397516523
NM_001035.2(RYR2):c.2755G>A (p.Val919Met) rs201079716
NM_001035.2(RYR2):c.2760G>A (p.Glu920=) rs186181155
NM_001035.2(RYR2):c.2935G>T (p.Ala979Ser) rs202015519
NM_001035.2(RYR2):c.2973A>G (p.Ser991=) rs2253273
NM_001035.2(RYR2):c.3030T>C (p.Asp1010=) rs138064129
NM_001035.2(RYR2):c.3038G>A (p.Arg1013Gln) rs149514924
NM_001035.2(RYR2):c.3054T>C (p.Tyr1018=) rs113422365
NM_001035.2(RYR2):c.3153C>T (p.Arg1051=) rs397516524
NM_001035.2(RYR2):c.3225C>T (p.Ala1075=) rs727505215
NM_001035.2(RYR2):c.3230T>C (p.Val1077Ala) rs202176504
NM_001035.2(RYR2):c.3251G>A (p.Arg1084Lys) rs193922624
NM_001035.2(RYR2):c.3320C>T (p.Thr1107Met) rs200236750
NM_001035.2(RYR2):c.3380A>G (p.Glu1127Gly) rs200525962
NM_001035.2(RYR2):c.3407C>T (p.Ala1136Val) rs72549415
NM_001035.2(RYR2):c.3537T>C (p.Gly1179=) rs397516526
NM_001035.2(RYR2):c.3599-9delT rs11331089
NM_001035.2(RYR2):c.365G>A (p.Arg122His) rs727503396
NM_001035.2(RYR2):c.3735G>A (p.Arg1245=) rs190884873
NM_001035.2(RYR2):c.375T>C (p.Tyr125=) rs397516528
NM_001035.2(RYR2):c.385-14T>C rs372287944
NM_001035.2(RYR2):c.385-9A>C rs140998248
NM_001035.2(RYR2):c.3888C>T (p.Asn1296=) rs373721253
NM_001035.2(RYR2):c.4068C>T (p.Pro1356=) rs199821105
NM_001035.2(RYR2):c.4069G>C (p.Asp1357His) rs193922626
NM_001035.2(RYR2):c.4160+7A>G rs377465289
NM_001035.2(RYR2):c.4198A>G (p.Ser1400Gly) rs56229512
NM_001035.2(RYR2):c.4347T>C (p.Asp1449=) rs368930040
NM_001035.2(RYR2):c.4445G>A (p.Arg1482His) rs373024059
NM_001035.2(RYR2):c.4465T>C (p.Cys1489Arg) rs200450676
NM_001035.2(RYR2):c.4597-11delA rs3841805
NM_001035.2(RYR2):c.4605G>A (p.Pro1535=) rs201916326
NM_001035.2(RYR2):c.464-8A>C rs10925391
NM_001035.2(RYR2):c.4684-11C>T rs7546045
NM_001035.2(RYR2):c.4684-5G>C rs7522981
NM_001035.2(RYR2):c.4734C>T (p.Pro1578=) rs201880756
NM_001035.2(RYR2):c.4740G>A (p.Pro1580=) rs79811945
NM_001035.2(RYR2):c.4941G>A (p.Gln1647=) rs727504997
NM_001035.2(RYR2):c.4989C>T (p.Ala1663=) rs147060179
NM_001035.2(RYR2):c.5001T>C (p.Leu1667=) rs397516537
NM_001035.2(RYR2):c.506G>A (p.Arg169Gln) rs397516539
NM_001035.2(RYR2):c.5136C>T (p.Ser1712=) rs397516540
NM_001035.2(RYR2):c.5154G>A (p.Arg1718=) rs114534505
NM_001035.2(RYR2):c.5190G>A (p.Thr1730=) rs397516541
NM_001035.2(RYR2):c.5400A>G (p.Lys1800=) rs3820216
NM_001035.2(RYR2):c.5571G>A (p.Pro1857=) rs371934582
NM_001035.2(RYR2):c.5586C>T (p.Asp1862=) rs193922628
NM_001035.2(RYR2):c.5619A>G (p.Ala1873=) rs373282364
NM_001035.2(RYR2):c.5654G>A (p.Gly1885Glu) rs41315858
NM_001035.2(RYR2):c.5656G>A (p.Gly1886Ser) rs3766871
NM_001035.2(RYR2):c.576+7G>C rs10925392
NM_001035.2(RYR2):c.6337G>A (p.Val2113Met) rs186906598
NM_001035.2(RYR2):c.649A>G (p.Ile217Val) rs200642525
NM_001035.2(RYR2):c.6555+6G>A rs372661934
NM_001035.2(RYR2):c.6689-12T>C rs370972311
NM_001035.2(RYR2):c.677-11T>A rs10754602
NM_001035.2(RYR2):c.684C>T (p.Leu228=) rs72549417
NM_001035.2(RYR2):c.6906T>C (p.Leu2302=) rs707189
NM_001035.2(RYR2):c.6928+4G>A rs79862521
NM_001035.2(RYR2):c.7038A>C (p.Ala2346=) rs116601686
NM_001035.2(RYR2):c.7159G>A (p.Ala2387Thr) rs794728753
NM_001035.2(RYR2):c.7161G>A (p.Ala2387=) rs371560909
NM_001035.2(RYR2):c.7222-12_7222-11insT rs145140335
NM_001035.2(RYR2):c.7233C>T (p.Ala2411=) rs367994477
NM_001035.2(RYR2):c.726C>T (p.Asp242=) rs76380341
NM_001035.2(RYR2):c.7365C>T (p.Asp2455=) rs72549416
NM_001035.2(RYR2):c.7488C>T (p.Leu2496=) rs143906555
NM_001035.2(RYR2):c.7513-8T>G rs727503402
NM_001035.2(RYR2):c.7608T>C (p.Ala2536=) rs367987360
NM_001035.2(RYR2):c.7619A>G (p.His2540Arg) rs200105499
NM_001035.2(RYR2):c.7806C>T (p.His2602=) rs684923
NM_001035.2(RYR2):c.8162T>C (p.Ile2721Thr) rs201500134
NM_001035.2(RYR2):c.8209-7_8209-4delTTTT rs876657992
NM_001035.2(RYR2):c.8437-7dupG rs148246251
NM_001035.2(RYR2):c.8448C>T (p.Asp2816=) rs144876996
NM_001035.2(RYR2):c.849-8T>C rs16835237
NM_001035.2(RYR2):c.8736G>A (p.Leu2912=) rs762521873
NM_001035.2(RYR2):c.8873A>G (p.Gln2958Arg) rs34967813
NM_001035.2(RYR2):c.8913T>C (p.Ile2971=) rs755520825
NM_001035.2(RYR2):c.9318T>G (p.Ser3106=) rs2797436
NM_001035.2(RYR2):c.9449+8T>A rs60777199
NM_001035.2(RYR2):c.9450-3T>C rs188671846
NM_001035.2(RYR2):c.9519T>C (p.Thr3173=) rs371931287
NM_001035.2(RYR2):c.9560A>G (p.Lys3187Arg) rs184218219
NM_001035.2(RYR2):c.9619A>G (p.Asn3207Asp) rs372601642
NM_001035.2(RYR2):c.9655G>A (p.Val3219Met) rs371147744
NM_001035.2(RYR2):c.9666C>T (p.Ala3222=) rs116442127
NM_001035.2(RYR2):c.9672C>T (p.Ser3224=) rs370740528
NM_001035.2(RYR2):c.9867G>A (p.Gly3289=) rs190537182
NM_001037.4(SCN1B):c.448+193G>A rs66876876
NM_001037.4(SCN1B):c.457G>A (p.Asp153Asn) rs72550247
NM_001038.5(SCNN1A):c.-28T>C rs61759919
NM_001038.5(SCNN1A):c.-48A>G rs150809388
NM_001038.5(SCNN1A):c.1477T>C (p.Trp493Arg) rs5742912
NM_001038.5(SCNN1A):c.978C>T (p.Asn326=) rs61731141
NM_001038603.2(MARVELD2):c.1059A>G (p.Ile353Met) rs727503158
NM_001038603.2(MARVELD2):c.1147-9T>G rs299099
NM_001038603.2(MARVELD2):c.1248A>C (p.Thr416=) rs146746360
NM_001038603.2(MARVELD2):c.1407C>T (p.Tyr469=) rs61736168
NM_001038603.2(MARVELD2):c.1498C>T (p.Arg500Ter) rs118203957
NM_001038603.2(MARVELD2):c.364G>A (p.Ala122Thr) rs140764671
NM_001038603.2(MARVELD2):c.500A>G (p.Gln167Arg) rs139854607
NM_001038603.2(MARVELD2):c.898T>A (p.Leu300Met) rs72773422
NM_001038603.2(MARVELD2):c.900G>A (p.Leu300=) rs138680809
NM_001038603.2(MARVELD2):c.98C>T (p.Thr33Ile) rs1185246
NM_001038603.3(MARVELD2):c.1331+1G>A rs762352115
NM_001039.3(SCNN1G):c.1575G>A (p.Glu525=) rs72647541
NM_001039.3(SCNN1G):c.435C>T (p.Ser145=) rs62639702
NM_001039.3(SCNN1G):c.547G>A (p.Gly183Ser) rs5736
NM_001039.3(SCNN1G):c.636C>T (p.Ser212=) rs5739
NM_001039141.2(TRIOBP):c.265C>G (p.Pro89Ala) rs199646135
NM_001039141.2(TRIOBP):c.391G>A (p.Gly131Ser) rs144634857
NM_001039141.2(TRIOBP):c.4031G>A (p.Arg1344Gln) rs34066624
NM_001039141.2(TRIOBP):c.4077T>C (p.Pro1359=) rs139074745
NM_001039141.2(TRIOBP):c.4165C>A (p.Leu1389Ile) rs144175566
NM_001039141.2(TRIOBP):c.4783C>T (p.Arg1595Cys) rs201117318
NM_001039141.2(TRIOBP):c.483G>A (p.Glu161=) rs368119524
NM_001039141.2(TRIOBP):c.5014G>T (p.Gly1672Ter) rs200045032
NM_001039141.2(TRIOBP):c.5052G>T (p.Thr1684=) rs41283241
NM_001039141.2(TRIOBP):c.5224C>T (p.Leu1742Phe) rs200493962
NM_001039141.2(TRIOBP):c.584C>T (p.Thr195Ile) rs143157673
NM_001039141.2(TRIOBP):c.6135C>T (p.Pro2045=) rs11546529
NM_001039141.2(TRIOBP):c.6362C>T (p.Ser2121Leu) rs201724032
NM_001039141.2(TRIOBP):c.6472+10C>T rs369182277
NM_001039141.2(TRIOBP):c.6571C>T (p.His2191Tyr) rs61729063
NM_001039141.2(TRIOBP):c.6736G>A (p.Glu2246Lys) rs138139146
NM_001039141.2(TRIOBP):c.6771G>A (p.Gln2257=) rs200793989
NM_001039141.2(TRIOBP):c.6806A>G (p.Asn2269Ser) rs61729060
NM_001039141.2(TRIOBP):c.7032G>A (p.Glu2344=) rs61737839
NM_001039213.4(CEACAM16):c.352G>A (p.Glu118Lys) rs183860695
NM_001039213.4(CEACAM16):c.738G>A (p.Thr246=) rs199779296
NM_001039569.1(AP1S3):c.97C>T (p.Arg33Trp) rs138292988
NM_001039876.2(SYNE4):c.543G>A (p.Arg181=) rs143940810
NM_001039876.2(SYNE4):c.805C>T (p.Leu269=) rs147433902
NM_001039891.2(ZNF674):c.601C>T (p.Arg201Ter) rs182004761
NM_001039958.2(MESP2):c.573G>A (p.Gly191=) rs113097169
NM_001040113.1(MYH11):c.1270-11G>C rs2280764
NM_001040113.1(MYH11):c.3721G>A (p.Ala1241Thr) rs16967494
NM_001040113.1(MYH11):c.3988C>T (p.Leu1330=) rs12907
NM_001040113.1(MYH11):c.760C>T (p.Arg254Cys) rs150759461
NM_001041.3(SI):c.1730T>G (p.Val577Gly) rs121912615
NM_001042351.2(G6PD):c.1311T= (p.Tyr437=) rs2230037
NM_001042492.2(NF1):c.168C>T (p.Ser56=) rs17881168
NM_001042492.2(NF1):c.1810T>C (p.Leu604=) rs142712751
NM_001042492.2(NF1):c.2022C>T (p.Ser674=) rs2230851
NM_001042492.2(NF1):c.2034G>A (p.Pro678=) rs2285892
NM_001042492.2(NF1):c.2288T>C (p.Leu763Pro) rs199474762
NM_001042492.2(NF1):c.2544G>A (p.Gly848=) rs17883704
NM_001042492.2(NF1):c.2553C>T (p.Cys851=) rs2230852
NM_001042492.2(NF1):c.2985G>C (p.Leu995=) rs17881467
NM_001042492.2(NF1):c.3270A>C (p.Gly1090=) rs150015024
NM_001042492.2(NF1):c.3436G>A (p.Val1146Ile) rs201047812
NM_001042492.2(NF1):c.3498C>T (p.Gly1166=) rs2066733
NM_001042492.2(NF1):c.3732T>A (p.Val1244=) rs756653022
NM_001042492.2(NF1):c.3867C>T (p.Phe1289=) rs138186428
NM_001042492.2(NF1):c.3883A>G (p.Thr1295Ala) rs143836226
NM_001042492.2(NF1):c.4269A>G (p.Glu1423=) rs17886566
NM_001042492.2(NF1):c.4577+12C>T rs17878332
NM_001042492.2(NF1):c.4882T>C (p.Leu1628=) rs10512435
NM_001042492.2(NF1):c.4929G>A (p.Val1643=) rs17880521
NM_001042492.2(NF1):c.5235G>A (p.Lys1745=) rs17887014
NM_001042492.2(NF1):c.6172A>G (p.Ile2058Val) rs201712827
NM_001042492.2(NF1):c.6393C>T (p.His2131=) rs17881788
NM_001042492.2(NF1):c.702G>A (p.Leu234=) rs1801052
NM_001042492.2(NF1):c.7368A>G (p.Lys2456=) rs201287021
NM_001042492.2(NF1):c.7461A>G (p.Thr2487=) rs149924365
NM_001042492.2(NF1):c.7584A>G (p.Gln2528=) rs55865524
NM_001042492.2(NF1):c.7755C>T (p.Ser2585=) rs17881980
NM_001042492.2(NF1):c.8151G>A (p.Pro2717=) rs2285895
NM_001042492.2(NF1):c.846G>A (p.Gln282=) rs138840528
NM_001042492.2(NF1):c.8499T>C (p.Asn2833=) rs142636150
NM_001042702.3(PJVK):c.*2A>C rs200811582
NM_001042702.3(PJVK):c.766+8T>C rs185220846
NM_001042702.3(PJVK):c.86A>G (p.Asp29Gly) rs200502817
NM_001042702.3(PJVK):c.874G>A (p.Gly292Arg) rs79399438
NM_001065.3(TNFRSF1A):c.362G>A (p.Arg121Gln) rs4149584
NM_001065.3(TNFRSF1A):c.36A>G (p.Pro12=) rs767455
NM_001065.3(TNFRSF1A):c.625+10A>G rs1800693
NM_001077186.1(MYH14):c.3369-3C>T rs78192108
NM_001077269.1(WIPF1):c.1446C>T (p.Asn482=) rs116757787
NM_001079515.2(TBCE):c.100+48_100+65del rs10524346
NM_001079802.1(FKTN):c.1026C>A (p.Leu342=) rs17309806
NM_001079802.1(FKTN):c.166C>T (p.Arg56Cys) rs41277797
NM_001079802.1(FKTN):c.608G>A (p.Arg203Gln) rs34787999
NM_001079812.2(DIAPH1):c.1821_1826dup (p.Pro611_Leu612insProPro) rs3075570
NM_001080114.1(LDB3):c.1130G>A (p.Arg377His) rs146265188
NM_001080114.1(LDB3):c.1205A>C (p.Gln402Pro) rs138951890
NM_001080114.1(LDB3):c.1342A>G (p.Ile448Val) rs372331627
NM_001080114.1(LDB3):c.345-15G>A rs113445294
NM_001080114.1(LDB3):c.494C>T (p.Ala165Val) rs121908334
NM_001080114.1(LDB3):c.504T>C (p.Asp168=) rs76615432
NM_001080114.1(LDB3):c.546T>C (p.Ser182=) rs71473272
NM_001080114.1(LDB3):c.781G>A (p.Ala261Thr) rs45539535
NM_001080116.1(LDB3):c.*18610T>G rs566463138
NM_001080116.1(LDB3):c.*26800C>T rs45578640
NM_001080116.1(LDB3):c.163G>A (p.Val55Ile) rs3740343
NM_001080116.1(LDB3):c.302C>T (p.Pro101Leu) rs45592139
NM_001080116.1(LDB3):c.321+1523C>T rs45487699
NM_001080116.1(LDB3):c.321+1656G>A rs45563234
NM_001080116.1(LDB3):c.322-14C>T rs754704023
NM_001080116.1(LDB3):c.349G>A (p.Asp117Asn) rs121908338
NM_001080116.1(LDB3):c.456G>A (p.Ala152=) rs371708921
NM_001080116.1(LDB3):c.456G>T (p.Ala152=) rs371708921
NM_001080116.1(LDB3):c.611A>G (p.Lys204Arg) rs34423165
NM_001080116.1(LDB3):c.756-13_756-10delCTCT rs71019410
NM_001080116.1(LDB3):c.802C>T (p.Arg268Cys) rs121908335
NM_001080463.1(DYNC2H1):c.12478-6C>T rs11225812
NM_001080463.1(DYNC2H1):c.21C>T (p.Asp7=) rs17301028
NM_001080463.1(DYNC2H1):c.2454G>A (p.Glu818=) rs77738279
NM_001080463.1(DYNC2H1):c.5558+4A>G rs11225578
NM_001080463.1(DYNC2H1):c.911A>T (p.Gln304Leu) rs12146610
NM_001080467.2(MYO5B):c.3396+9T>C rs75971548
NM_001080467.2(MYO5B):c.921G>T (p.Lys307Asn) rs17659179
NM_001080476.2(GRXCR1):c.140C>T (p.Ala47Val) rs57655409
NM_001080476.2(GRXCR1):c.25G>A (p.Glu9Lys) rs78136490
NM_001080476.2(GRXCR1):c.272G>T (p.Gly91Val) rs113203706
NM_001080476.2(GRXCR1):c.753C>T (p.Ser251=) rs374667597
NM_001080522.2(CC2D2A):c.4667A>T (p.Asp1556Val) rs201502401
NM_001083116.1(PRF1):c.272C>T (p.Ala91Val) rs35947132
NM_001083116.2(PRF1):c.822C>T (p.Ala274=) rs885821
NM_001089.2(ABCA3):c.1755C>G (p.Pro585=) rs323043
NM_001089.2(ABCA3):c.2199C>T (p.Ile733=) rs138901284
NM_001089.2(ABCA3):c.2296C>T (p.Pro766Ser) rs45592239
NM_001089.2(ABCA3):c.2514-8C>T rs45502600
NM_001089.2(ABCA3):c.4420C>T (p.Arg1474Trp) rs146709251
NM_001089.2(ABCA3):c.447+11C>T rs117031141
NM_001089.2(ABCA3):c.448-14C>G rs62040683
NM_001089.2(ABCA3):c.450G>A (p.Val150=) rs74002800
NM_001089.2(ABCA3):c.681C>T (p.Ala227=) rs45480502
NM_001089.2(ABCA3):c.977T>C (p.Leu326Pro) rs121909185
NM_001089.2(ABCA3):c.990+14C>T rs185179294
NM_001089.3(ABCA3):c.1502C>A (p.Ala501Glu) rs141621969
NM_001089.3(ABCA3):c.875A>T (p.Glu292Val) rs149989682
NM_001099404.1(SCN5A):c.1441C>T (p.Arg481Trp) rs144511230
NM_001099404.1(SCN5A):c.892G>A (p.Gly298Ser) rs137854608
NM_001100.3(ACTA1):c.130-10G>C rs41271481
NM_001100.3(ACTA1):c.130-5T>C rs11803533
NM_001100.3(ACTA1):c.808G>C (p.Gly270Arg) rs121909525
NM_001100.3(ACTA1):c.809-14G>C rs6673359
NM_001100112.1(MYH2):c.2414T>C (p.Val805Ala) rs200662973
NM_001101426.3(CRPPA):c.407C>T (p.Ala136Val) rs61734789
NM_001101426.3(CRPPA):c.685-13_685-11dupGTT rs142647500
NM_001103.3(ACTN2):c.-3G>T rs201920417
NM_001103.3(ACTN2):c.1040C>T (p.Thr347Met) rs727504590
NM_001103.3(ACTN2):c.1104G>A (p.Val368=) rs397516563
NM_001103.3(ACTN2):c.1235C>T (p.Thr412Met) rs139515659
NM_001103.3(ACTN2):c.1296G>A (p.Ala432=) rs35956798
NM_001103.3(ACTN2):c.1298C>T (p.Ser433Leu) rs143749154
NM_001103.3(ACTN2):c.1341C>T (p.Phe447=) rs34785693
NM_001103.3(ACTN2):c.1371C>T (p.Arg457=) rs114008185
NM_001103.3(ACTN2):c.1383C>T (p.Ile461=) rs34827377
NM_001103.3(ACTN2):c.1406+8C>T rs397516567
NM_001103.3(ACTN2):c.1423G>A (p.Asp475Asn) rs80257412
NM_001103.3(ACTN2):c.1426G>A (p.Ala476Thr) rs142943120
NM_001103.3(ACTN2):c.1452G>A (p.Gln484=) rs200529923
NM_001103.3(ACTN2):c.1484C>T (p.Thr495Met) rs200248944
NM_001103.3(ACTN2):c.1794G>A (p.Pro598=) rs137890030
NM_001103.3(ACTN2):c.1810A>G (p.Met604Val) rs35997569
NM_001103.3(ACTN2):c.1864G>A (p.Asp622Asn) rs138452803
NM_001103.3(ACTN2):c.18C>A (p.Pro6=) rs368367224
NM_001103.3(ACTN2):c.1932C>A (p.Ala644=) rs144680712
NM_001103.3(ACTN2):c.1975-12C>T rs371352710
NM_001103.3(ACTN2):c.1975-6C>A rs201255023
NM_001103.3(ACTN2):c.1975-6C>G rs201255023
NM_001103.3(ACTN2):c.2076C>T (p.Ile692=) rs144122893
NM_001103.3(ACTN2):c.2139G>A (p.Thr713Thr=) rs34975493
NM_001103.3(ACTN2):c.2147C>T (p.Thr716Met) rs193922635
NM_001103.3(ACTN2):c.2161C>A (p.Arg721Ser) rs149433837
NM_001103.3(ACTN2):c.2367+8A>G rs112714025
NM_001103.3(ACTN2):c.2568G>A (p.Pro856=) rs149554430
NM_001103.3(ACTN2):c.2601C>T (p.Pro867=) rs147245615
NM_001103.3(ACTN2):c.2610G>A (p.Ser870=) rs12063382
NM_001103.3(ACTN2):c.2649G>A (p.Ala883=) rs146426213
NM_001103.3(ACTN2):c.26A>G (p.Gln9Arg) rs121434525
NM_001103.3(ACTN2):c.536+10C>T rs141219516
NM_001103.3(ACTN2):c.615+15C>T rs369293885
NM_001103.3(ACTN2):c.705G>C (p.Val235=) rs2288599
NM_001103.3(ACTN2):c.877-6G>A rs397516585
NM_001103.3(ACTN2):c.877-8C>G rs2288601
NM_001103.3(ACTN2):c.893G>A (p.Arg298His) rs142482143
NM_001105206.2(LAMA4):c.196-12T>C rs78871662
NM_001105206.2(LAMA4):c.2569G>A (p.Ala857Thr) rs144123257
NM_001105206.2(LAMA4):c.264C>T (p.Ser88=) rs201152817
NM_001105206.2(LAMA4):c.5207-14G>C rs112265545
NM_001105209.2(LAMA4):c.339T>C (p.Leu113=) rs147118520
NM_001111.5(ADAR):c.577C>G (p.Pro193Ala) rs145588689
NM_001114086.1(CLIC5):c.770C>A (p.Pro257His) rs35822882
NM_001114753.2(ENG):c.1932C>T (p.Ile644=) rs181330955
NM_001122606.1(LAMP2):c.1093+2514G>A rs144140265
NM_001127180.1(MYO7A):c.1117C>T (p.Arg373Cys) rs868979094
NM_001127180.1(MYO7A):c.3491G>A (p.Arg1164Gln) rs782350886
NM_001127217.2(SMAD9):c.12C>T (p.Thr4=) rs78237438
NM_001127217.2(SMAD9):c.65T>C (p.Leu22Pro) rs111748421
NM_001127217.2(SMAD9):c.756T>C (p.His252=) rs146836873
NM_001127221.1(CACNA1A):c.1360G>A (p.Ala454Thr) rs41276886
NM_001127221.1(CACNA1A):c.5900G>A (p.Arg1967Gln) rs199886234
NM_001127593.1(FCGR3A):c.197T>A (p.Leu66His) rs10127939
NM_001127593.1(FCGR3A):c.526T>G (p.Phe176Val) rs396991
NM_001127701.1(SERPINA1):c.1096G>A (p.Glu366Lys) rs28929474
NM_001127701.1(SERPINA1):c.1200A>C (p.Glu400Asp) rs1303
NM_001127701.1(SERPINA1):c.374G>A (p.Arg125His) rs709932
NM_001127701.1(SERPINA1):c.710T>C (p.Val237Ala) rs6647
NM_001127701.1(SERPINA1):c.739C>T (p.Arg247Cys) rs28929470
NM_001128227.2(GNE):c.1225G>T (p.Asp409Tyr) rs199877522
NM_001128228.2(TPRN):c.2023G>A (p.Ala675Thr) rs139520402
NM_001128228.2(TPRN):c.2057C>T (p.Pro686Leu) rs727503520
NM_001128425.1(MUTYH):c.1014G>C (p.Gln338His) rs3219489
NM_001128425.1(MUTYH):c.1038G>A (p.Ser346=) rs372673338
NM_001128425.1(MUTYH):c.1187-2A>G rs587781628
NM_001128425.1(MUTYH):c.1187G>A (p.Gly396Asp) rs36053993
NM_001128425.1(MUTYH):c.1227_1228dupGG (p.Glu410Glyfs) rs587780078
NM_001128425.1(MUTYH):c.1276C>T (p.Arg426Cys) rs150792276
NM_001128425.1(MUTYH):c.1431G>C (p.Thr477=) rs74318065
NM_001128425.1(MUTYH):c.290G>A (p.Arg97Gln) rs755653922
NM_001128425.1(MUTYH):c.312C>T (p.Tyr104=) rs121908380
NM_001128425.1(MUTYH):c.53C>T (p.Pro18Leu) rs79777494
NM_001128425.1(MUTYH):c.700G>A (p.Val234Met) rs200165598
NM_001128425.1(MUTYH):c.74G>A (p.Gly25Asp) rs75321043
NM_001128425.1(MUTYH):c.821G>A (p.Arg274Gln) rs149866955
NM_001128425.1(MUTYH):c.933+3A>C rs587780751
NM_001128425.1(MUTYH):c.934-2A>G rs77542170
NM_001130089.1(KARS):c.1163-7C>T rs16941301
NM_001130089.1(KARS):c.1262G>A (p.Arg421Gln)