ClinVar Miner

Variants from PreventionGenetics,PreventionGenetics with conflicting interpretations

Location: United States — Primary collection method: clinical testing
Minimum review status of the submission from PreventionGenetics,PreventionGenetics: Collection method of the submission from PreventionGenetics,PreventionGenetics:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
3653 5727 187 7520 2177 146 218 8789

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
PreventionGenetics,PreventionGenetics pathogenic likely pathogenic uncertain significance likely benign benign affects association drug response protective risk factor other
pathogenic 16 47 10 1 1 0 0 21 0 21 0
likely pathogenic 54 0 17 2 2 0 0 4 0 2 0
uncertain significance 25 34 21 253 90 0 0 0 0 4 0
likely benign 42 19 1173 17 2030 1 3 2 0 9 2
benign 62 27 744 5390 133 6 12 16 6 36 28

Submitter to submitter summary #

Total submitters: 197
Download table as spreadsheet
Submitter Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
Illumina Clinical Services Laboratory,Illumina 0 2925 0 3842 856 0 4 4702
Invitae 0 5779 0 1609 255 11 31 1905
Genetic Services Laboratory, University of Chicago 0 1103 0 1414 126 3 4 1544
GeneDx 0 5598 3 1100 142 1 15 1261
EGL Genetic Diagnostics,Eurofins Clinical Diagnostics 0 3270 0 587 324 8 8 927
Ambry Genetics 0 2497 0 424 154 0 14 592
Integrated Genetics/Laboratory Corporation of America 0 1068 0 222 103 0 3 327
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories 0 1728 0 275 43 0 4 322
CeGaT Praxis fuer Humangenetik Tuebingen 0 222 0 92 213 0 9 314
Color 0 1146 0 176 124 0 5 305
Laboratory for Molecular Medicine, Partners HealthCare Personalized Medicine 0 2680 0 253 48 0 3 304
Athena Diagnostics Inc 0 1631 0 288 13 0 1 301
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 0 236 0 232 23 0 1 256
Quest Diagnostics Nichols Institute San Juan Capistrano 0 373 0 180 66 0 1 246
Mendelics 0 560 0 162 72 0 6 239
Counsyl 0 552 0 138 60 1 3 202
Biesecker Lab/Clinical Genomics Section,National Institutes of Health 0 207 107 39 54 0 0 200
OMIM 0 55 0 7 36 93 68 196
True Health Diagnostics 0 142 0 175 14 1 2 192
Mayo Clinic Genetic Testing Laboratories,Mayo Clinic 0 654 0 119 30 0 1 150
Department of Pathology and Laboratory Medicine,Sinai Health System 0 284 0 85 14 0 1 100
Division of Genomic Diagnostics,The Children's Hospital of Philadelphia 0 133 0 57 29 0 3 89
Genome Diagnostics Laboratory,University Medical Center Utrecht 0 244 0 80 3 0 0 83
International Society for Gastrointestinal Hereditary Tumours (InSiGHT) 0 19 58 20 5 0 0 83
DNA and Cytogenetics Diagnostics Unit,Erasmus Medical Center 0 372 0 71 7 0 0 78
GeneReviews 0 126 30 12 5 2 30 77
CHEO Genetics Diagnostic Laboratory,Children's Hospital of Eastern Ontario 0 186 0 66 9 0 1 76
Center for Human Genetics, Inc 0 59 0 41 30 0 1 72
Breast Cancer Information Core (BIC) (BRCA2) 0 59 0 10 55 0 1 66
CSER _CC_NCGL, University of Washington 0 72 0 17 36 0 9 62
Institute for Biomarker Research,Medical Diagnostic Laboratories, L.L.C. 0 30 0 58 4 0 0 62
Sharing Clinical Reports Project (SCRP) 0 83 0 40 18 0 2 60
Diagnostic Laboratory, Department of Genetics,University Medical Center Groningen 0 664 0 58 2 0 0 60
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) 0 145 0 52 5 0 1 58
Breast Cancer Information Core (BIC) (BRCA1) 0 38 0 4 45 0 0 49
Fulgent Genetics,Fulgent Genetics 0 96 0 23 11 0 1 35
PharmGKB 0 0 0 0 0 33 0 33
Genome Diagnostics Laboratory,VU University Medical Center Amsterdam 0 136 0 33 0 0 0 33
Pathway Genomics 0 60 0 25 5 0 0 30
Vantari Genetics 0 48 0 24 6 0 0 30
Michigan Medical Genetics Laboratories,University of Michigan 0 82 0 20 3 0 0 23
Center for Advanced Laboratory Medicine, UC San Diego Health,University of California San Diego 0 38 0 22 0 0 0 22
Genomic Research Center, Shahid Beheshti University of Medical Sciences 0 18 0 2 15 0 5 21
University of Washington Department of Laboratory Medicine, University of Washington 0 30 0 4 12 1 4 21
Department of Ophthalmology and Visual Sciences Kyoto University 0 0 3 17 0 0 0 20
Baylor Genetics 0 82 0 15 4 0 0 19
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute 0 58 0 15 3 0 0 18
Cardiovascular Research Group,Instituto Nacional de Saude Doutor Ricardo Jorge 0 24 0 7 11 0 0 18
Laboratory of Genetics and Molecular Cardiology, University of São Paulo 0 12 0 6 11 0 0 17
Foulkes Cancer Genetics LDI, Lady Davis Institute for Medical Research 0 16 0 3 9 0 3 15
GeneKor MSA 0 76 0 5 8 1 1 15
Cancer Genetics Laboratory,Peter MacCallum Cancer Centre 0 5 0 10 5 0 0 15
Cancer Genetics and Genomics Laboratory,British Columbia Cancer Agency 0 53 0 12 3 0 0 15
ClinGen RASopathy Variant Curation Expert Panel 0 35 0 15 0 0 0 15
Soonchunhyang University Bucheon Hospital,Soonchunhyang University Medical Center 0 1 0 2 11 0 1 14
Clinical Biochemistry Laboratory,Health Services Laboratory 0 0 0 0 13 0 0 13
Research and Development, ARUP Laboratories 0 22 0 5 8 0 0 13
Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago 0 0 0 1 12 0 0 13
Robarts Research Institute,Western University 0 13 0 10 2 0 0 12
Research Molecular Genetics Laboratory,Women's College Hospital, University of Toronto 0 30 0 9 2 0 1 12
Blueprint Genetics 0 5 0 3 9 0 0 11
Lupski Lab, Baylor-Hopkins CMG, Baylor College of Medicine 0 1 0 3 6 0 2 11
SIB Swiss Institute of Bioinformatics 0 50 0 9 2 0 0 11
Systems Biology Platform Zhejiang California International NanoSystems Institute 0 0 0 0 0 10 0 10
Database of Curated Mutations (DoCM) 0 2 0 4 0 0 5 9
Centre for Mendelian Genomics,University Medical Centre Ljubljana 0 9 0 1 5 1 2 9
Wong Mito Lab, Molecular and Human Genetics, Baylor College of Medicine 0 23 0 9 0 0 0 9
Stanford Center for Inherited Cardiovascular Disease, Stanford University 0 7 0 2 6 0 0 8
Knight Diagnostic Laboratories,Oregon Health and Sciences University 0 6 0 0 7 0 1 8
Clinical Molecular Genetics Laboratory,Johns Hopkins All Children's Hospital 0 3 0 1 4 0 2 7
NIHR Bioresource Rare Diseases, University of Cambridge 0 0 0 2 2 0 3 7
CFTR-France 0 12 0 4 0 0 3 7
Developmental Genetics Unit,King Faisal Specialist Hospital & Research Centre 0 0 0 5 0 0 1 6
PALB2 database 0 10 0 4 2 0 0 6
A.C.Camargo Cancer Center / LGBM, A.C.Camargo Cancer Center 0 6 0 0 6 0 0 6
Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde,Academisch Medisch Centrum 0 21 0 4 0 0 2 6
Institute for Genomic Medicine (IGM) Clinical Laboratory,Nationwide Children's Hospital 0 20 0 6 0 0 0 6
Johns Hopkins Genomics,Johns Hopkins University 0 7 0 6 0 0 0 6
ClinGen Myeloid Malignancy Variant Curation Expert Panel 0 15 0 4 1 0 1 6
Foundation for Research in Genetics and Endocrinology, FRIGE's Institute of Human Genetics 0 0 0 1 0 0 4 5
Department of Medical Genetics,University Hospital of North Norway 0 4 0 3 2 0 0 5
Center of Medical Genetics and Primary Health Care 0 2 0 1 0 1 3 5
Equipe Genetique des Anomalies du Developpement, Université de Bourgogne 0 4 0 0 5 0 0 5
Inherited Neuropathy Consortium 0 1 0 0 5 0 0 5
SingHealth Duke-NUS Institute of Precision Medicine 0 1 0 1 4 0 0 5
ClinGen PTEN Variant Curation Expert Panel 0 5 0 3 2 0 0 5
Pharmacogenomics Lab,Chungbuk National University 0 0 0 0 0 5 0 5
Claritas Genomics 0 18 0 3 1 0 0 4
Personalized Diabetes Medicine Program,University of Maryland School of Medicine 0 15 0 3 1 0 0 4
ClinGen Inherited Cardiomyopathy Variant Curation Expert Panel, 0 23 0 4 0 0 0 4
Department of Pathology and Molecular Medicine,Queen's University 0 16 0 3 1 0 0 4
Iberoamerican FH Network 0 5 0 3 1 0 0 4
Clinical Genomics Lab,St. Jude Children's Research Hospital 0 13 0 0 4 0 0 4
ClinGen CDH1 Variant Curation Expert Panel 0 6 0 3 1 0 0 4
PreventionGenetics,PreventionGenetics 17923 243 0 1 1 0 1 3
Human Genome Sequencing Center Clinical Lab,Baylor College of Medicine 0 12 0 2 0 1 0 3
Center for Genetic Medicine Research,Children's National Medical Center 0 0 0 0 2 0 1 3
Center for Medical Genetics Ghent,University of Ghent 0 0 0 0 3 0 0 3
Division of Human Genetics,Children's Hospital of Philadelphia 0 2 0 1 0 0 2 3
HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology 0 9 0 2 0 0 1 3
Cardiovascular Biomarker Research Laboratory,Mayo Clinic 0 1 0 3 0 0 0 3
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego 0 2 0 3 0 0 0 3
Phosphorus, Inc. 0 33 0 2 1 0 0 3
Tolun Lab, Human Genetics Laboratory,Bogazici University 0 0 0 0 3 0 0 3
Bruce Budowle Laboratory,University of North Texas Health Science Center 0 0 0 0 0 3 0 3
Department of Human Genetics,Laborarztpraxis Dres. Walther, Weindel und Kollegen 0 6 0 3 0 0 0 3
Greenwood Genetic Center Diagnostic Laboratories,Greenwood Genetic Center 0 17 0 0 2 0 0 2
Molecular Vision Laboratory 0 0 0 0 0 2 0 2
Juha Muilu Group; Institute for Molecular Medicine Finland (FIMM) 0 0 0 0 0 0 2 2
Genetics Laboratories, Oxford Radcliffe Hospitals NHS Trust 0 0 0 1 1 0 0 2
Wellcome Centre for Mitochondrial Research,Newcastle University 0 0 0 0 1 0 1 2
Laboratory of Human Genetics,Universidade de São Paulo 0 0 0 2 0 0 0 2
University of Washington Center for Mendelian Genomics,University of Washington 0 0 0 0 0 0 2 2
NeuroMeGen,Hospital Clinico Santiago de Compostela 0 0 0 0 0 0 2 2
Medical Genetics, University of Parma 0 0 0 0 2 0 0 2
Next Generation Diagnostics,Novartis Institutes for BioMedical Research, Inc. 0 0 0 0 2 0 0 2
Clinical Genetics, Erasmus University Medical Center 0 0 0 0 2 0 0 2
Centre de Génétique Moléculaire et Chromosomique, Unité de génétique de l'Obésité et des Dyslipidémies,APHP, GH Hôpitaux Universitaires Pitié-Salpêtrière / Charles-Foix 0 1 0 2 0 0 0 2
Sharon lab,Hadassah-Hebrew University Medical Center 0 0 0 0 0 0 2 2
Human Genomics Unit,Institute for molecular medicine Finland (FIMM) 0 1 0 0 1 0 1 2
Bioinformatics Core,Luxembourg Center for Systems Biomedicine 0 0 0 0 0 0 2 2
ClinGen PAH Variant Curation Expert Panel 0 4 0 1 1 0 0 2
Medical Genetics Summaries 0 0 0 0 0 2 0 2
Carola Vinuesa Lab,John Curtin School of Medical Research 0 0 0 1 0 0 1 2
3DMed Clinical Laboratory Inc 0 3 0 0 2 0 0 2
Broad Institute Rare Disease Group,Broad Institute 0 1 0 1 0 0 1 2
Hereditary Cancer Genetics group,Vall d'Hebron Institute of Oncology 0 1 0 2 0 0 0 2
Molecular Otolaryngology and Renal Research Laboratories,University of Iowa Hospital and Clinics 0 0 0 1 0 0 0 1
Medical Genetics Laboratory, Kennedy Center,Juliane Marie Center, Rigshospitalet 0 0 0 0 1 0 0 1
Cancer Genomic Medicine Translational Research Lab,Cleveland Clinic Genomic Medicine Institute 0 0 0 0 1 0 0 1
Eye Genetics Research Group,Children's Medical Research Institute 0 0 0 0 1 0 0 1
Academic Department of Medical Genetics, University of Cambridge 0 1 0 1 0 0 0 1
Institute of Human Genetics,Klinikum rechts der Isar 0 1 0 1 0 0 0 1
LDLR-LOVD, British Heart Foundation 0 10 0 1 0 0 0 1
RettBASE 0 4 0 1 0 0 0 1
Molecular Genetics and Enzymology, National Research Centre 0 0 0 0 1 0 0 1
Institute of Human Genetics,Friedrich-Alexander-Universität Erlangen-Nürnberg 0 0 0 1 0 0 0 1
Northcott Neuroscience Laboratory, ANZAC Research Institute 0 0 0 1 0 0 0 1
TilsonLab,Columbia University 0 0 0 0 0 0 1 1
UCLA Clinical Genomics Center, UCLA 0 0 0 0 0 0 1 1
Department of Medical Genetics,Oslo University Hospital 0 8 0 0 0 0 1 1
Department of Pharmacy and Biotechnology,University of Bologna 0 0 0 0 1 0 0 1
Service de Génétique Moléculaire,Hôpital Robert Debré 0 0 0 1 0 0 0 1
Agnes Ginges Centre for Molecular Cardiology,Centenary Institute 0 2 0 1 0 0 0 1
Department of Genetics, Reproduction and Fetal Medicine.,Institute of Biomedicine of Seville (IBIS), University Hospital Virgen del Rocío/CSIC/University of Seville. 0 0 0 0 1 0 0 1
Scripps Translational Science Institute,Scripps Health and The Scripps Research Institute 0 0 0 0 0 0 1 1
Foundation Medicine, Inc. 0 0 0 0 1 0 0 1
Institute for Ophthalmic Research,University Tuebingen 0 0 0 0 1 0 0 1
DST/NWU Preclinical Drug Development Platform,North-West University 0 0 0 0 1 0 0 1
Cytogenetics Laboratory,Banaras Hindu University 0 0 0 0 0 0 1 1
UW Hindbrain Malformation Research Program,University of Washington 0 0 0 0 0 0 1 1
Dr. Peter K. Rogan Lab,Western University 0 1 0 0 0 0 1 1
Baylor-Hopkins Center for Mendelian Genomics,Johns Hopkins University 0 0 0 1 0 0 0 1
Bioinformatics dept.,Datar Cancer Genetics Limited, India 0 2 0 0 0 0 1 1
Institute of Human Genetics, Univ. Regensburg,Univ. Regensburg 0 0 0 0 1 0 0 1
Genetic Testing Lab,Ashok and Rita Patel Institute of Integrated Study and Research in Biotechnology and Allied Sciences 0 0 0 0 0 1 0 1
Reutter Lab, Institute of Human Genetics, University Hospital Bonn 0 0 0 0 0 0 1 1
Medical Molecular Genetics Department, National Research Center 0 0 0 0 1 0 0 1
U4M - Lille University & CHRU Lille, Université de Lille - CHRU de Lille 0 0 0 0 0 0 1 1
Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA), c/o University of Cambridge 0 27 0 0 0 0 1 1
Kasturba Medical College,Manipal University 0 0 0 0 1 0 0 1
Undiagnosed Diseases Network,NIH 0 0 0 0 1 0 0 1
Molecular Genetics Laboratory,Centre for Cardiovascular Surgery and Transplantation 0 1 0 1 0 0 0 1
Caryl and Israel Englander Institute for Precision Medicine,Weill Cornell Medicine 0 0 0 0 1 0 0 1
Unit for Genetic & Epidemiological Research on Neurological Disorders,Instituto de Investigação e Inovação em Saúde 0 0 0 0 1 0 0 1
Endocrine oncology group,Uppsala University 0 0 0 1 0 0 0 1
Laboratoire de Biologie et Génétique du Cancer,Centre François Baclesse 0 0 0 1 0 0 0 1
Yale Center for Mendelian Genomics,Yale University 0 0 0 0 0 0 1 1
Geisinger Autism and Developmental Medicine Institute,Geisinger Health System 0 0 0 0 0 0 1 1
Fundacion Hipercolesterolemia Familiar 0 1 0 1 0 0 0 1
Molecular Oncology Laboratory,Hospital Clínico San Carlos 0 2 0 1 0 0 0 1
CHLA Center for Personalized Medicine,Children's Hospital, Los Angeles 0 2 0 0 1 0 0 1
AlTemaimi Lab, Faculty of Medicine,Kuwait University 0 0 0 0 0 0 1 1
Snyder Lab, Genetics Department,Stanford University 0 1 0 0 0 1 0 1
Leiden Open Variation Database 0 0 0 1 0 0 0 1
Dan Cohn Lab,University Of California Los Angeles 0 0 0 0 1 0 0 1
MAGI'S LAB - Medical Genetics Laboratory,MAGI GROUP 0 0 0 0 1 0 0 1
Translational Research Program on Neuronal Ceroid Lipofuscinosis,Center for the Study of Inborn Errors of Metabolism 0 0 0 0 0 0 1 1
Reproductive Development, Murdoch Childrens Research Institute 0 0 0 1 0 0 0 1
Laboratory of Molecular Neuropathology,The University of Texas Health Science Center at Houston 0 0 0 0 0 0 1 1
Biochemical Molecular Genetic Laboratory,King Abdulaziz Medical City 0 5 0 1 0 0 0 1
Department of Genetic, Henri Mondor Hospital,Assistance Publique des Hôpitaux de Paris 0 0 0 0 0 0 1 1
Hb Lab, Kinderklinik Ulm,University Hospital Ulm 0 0 0 0 0 0 1 1
Department of Genetics,Sultan Qaboos University Hospital, Oman 0 1 0 0 1 0 0 1
Laboratory of Medical Genetics, National & Kapodistrian University of Athens 0 0 0 1 0 0 0 1
Clinical Cancer Genetics and Family Consultants,Athens Medical Center 0 0 0 0 0 0 1 1
Lab. Molecular Oncology,VUB, Free University of Brussels 0 0 0 0 1 0 0 1
ClinGen Hearing Loss Variant Curation Expert Panel, 0 4 0 1 0 0 0 1
Institute of Clinical Molecular Biology,Kiel University 0 0 0 0 0 0 1 1
German Consortium for Hereditary Breast and Ovarian Cancer Center Cologne,University Hospital Cologne 0 9 0 1 0 0 0 1
Center for Reproductive Medicine,Shandong Provincial Hospital Affiliated to Shandong University 0 0 0 0 0 0 1 1
Klaassen Lab,Charite University Medicine Berlin 0 0 0 0 1 0 0 1
Natera Inc 0 5 0 0 1 0 0 1
Genomic Diagnostics Laboratory, National Institute of Medical Genomics 0 0 0 0 0 0 1 1
Xiao lab, Department of Pathology, Memorial Sloan Kettering Cancer Center 0 0 0 0 0 0 1 1
Difficult and Complicated Liver Diseases and Artificial Liver Center,Beijing You An Hospital, Capital Medical University 0 1 0 0 0 0 1 1
Department of Cardiology, Chinese Academy of Medical Sciences,Fuwai Hospital 0 0 0 0 1 0 0 1

All variants with conflicting interpretations #

Total variants: 8789
Download table as spreadsheet
G6PD:c.1455-13T>C rs2071429
MYH11:c.503-14_503-12del rs141564071
NM_000016.5(ACADM):c.*39G>A rs17848065
NM_000016.5(ACADM):c.-34T>C rs59932454
NM_000016.5(ACADM):c.1161A>G (p.Val387=) rs1061337
NM_000016.5(ACADM):c.216+10T>C rs2275378
NM_000016.5(ACADM):c.351A>C (p.Thr117=) rs74090726
NM_000016.5(ACADM):c.469-9A>G rs181322317
NM_000017.4(ACADS):c.*4C>T rs774815274
NM_000017.4(ACADS):c.360C>T (p.Asn120=) rs76543640
NM_000018.4(ACADVL):c.1038G>A (p.Ala346=) rs8064573
NM_000018.4(ACADVL):c.1066A>G (p.Ile356Val) rs150140386
NM_000018.4(ACADVL):c.128G>A (p.Gly43Asp) rs2230178
NM_000018.4(ACADVL):c.1434+14T>A rs202217537
NM_000018.4(ACADVL):c.1828-4C>G rs184559206
NM_000018.4(ACADVL):c.1839G>A (p.Arg613=) rs79125791
NM_000018.4(ACADVL):c.194C>T (p.Pro65Leu) rs28934585
NM_000018.4(ACADVL):c.478-22_478-21del rs60400822
NM_000018.4(ACADVL):c.49C>T (p.Leu17Phe) rs2230179
NM_000018.4(ACADVL):c.693T>A (p.Ser231=) rs77763289
NM_000020.2(ACVRL1):c.1131A>G (p.Ala377=) rs61734313
NM_000020.2(ACVRL1):c.1246+9C>T rs115378744
NM_000020.2(ACVRL1):c.1377+45T>C rs706815
NM_000020.2(ACVRL1):c.330G>A (p.Ser110=) rs77341011
NM_000020.2(ACVRL1):c.642C>T (p.Gly214=) rs139008591
NM_000020.2(ACVRL1):c.747G>A (p.Val249=) rs1058563
NM_000021.4(PSEN1):c.1017A>G (p.Glu339=) rs201776669
NM_000021.4(PSEN1):c.953A>G (p.Glu318Gly) rs17125721
NM_000022.4(ADA):c.239A>G (p.Lys80Arg) rs11555566
NM_000023.4(SGCA):c.37+23G>A rs79410682
NM_000023.4(SGCA):c.528C>T (p.Thr176=) rs1801190
NM_000023.4(SGCA):c.62C>T (p.Thr21Ile) rs199804735
NM_000023.4(SGCA):c.662G>A (p.Arg221His) rs138254713
NM_000023.4(SGCA):c.680C>G (p.Pro227Arg) rs201131924
NM_000023.4(SGCA):c.933C>T (p.Val311=) rs1801191
NM_000026.4(ADSL):c.124C>T (p.Leu42=) rs2228415
NM_000026.4(ADSL):c.270T>C (p.Ala90=) rs143275316
NM_000026.4(ADSL):c.440A>T (p.Lys147Met) rs11089991
NM_000027.4(AGA):c.281+13T>G rs34241758
NM_000027.4(AGA):c.303A>T (p.Ala101=) rs142449515
NM_000029.4(AGT):c.803T>C (p.Met268Thr) rs699
NM_000030.3(AGXT):c.1020A>G (p.Ile340Met) rs4426527
NM_000030.3(AGXT):c.165+16A>G rs66494441
NM_000030.3(AGXT):c.166-14C>T rs180177176
NM_000030.3(AGXT):c.264C>T (p.Ala88=) rs35698882
NM_000030.3(AGXT):c.32C>T (p.Pro11Leu) rs34116584
NM_000030.3(AGXT):c.358+13C>T rs34995778
NM_000030.3(AGXT):c.489G>A (p.Leu163=) rs147601535
NM_000030.3(AGXT):c.654G>A (p.Ser218=) rs33958047
NM_000030.3(AGXT):c.680+17C>T rs11693280
NM_000030.3(AGXT):c.732C>A (p.Ile244=) rs147106773
NM_000030.3(AGXT):c.976G>A (p.Val326Ile) rs115057148
NM_000033.4(ABCD1):c.1489-6del rs398123101
NM_000035.4(ALDOB):c.156T>G (p.Thr52=) rs149671008
NM_000035.4(ALDOB):c.799+6G>A rs141888548
NM_000037.4(ANK1):c.1782C>A (p.Ser594=) rs61753679
NM_000037.4(ANK1):c.183G>C (p.Val61=) rs61753680
NM_000037.4(ANK1):c.3224C>T (p.Thr1075Ile) rs35213384
NM_000037.4(ANK1):c.4008G>A (p.Pro1336=) rs147536061
NM_000037.4(ANK1):c.5544+91C>T rs72638959
NM_000037.4(ANK1):c.654C>A (p.Asn218Lys) rs61735313
NM_000038.6(APC):c.*86C>A rs1804197
NM_000038.6(APC):c.1139G>A (p.Arg380Gln) rs587782886
NM_000038.6(APC):c.120G>A (p.Glu40=) rs142720069
NM_000038.6(APC):c.1240C>T (p.Arg414Cys) rs137854567
NM_000038.6(APC):c.1408+792A>T rs77551834
NM_000038.6(APC):c.1419G>A (p.Gln473=) rs141579422
NM_000038.6(APC):c.1458T>C (p.Tyr486=) rs2229992
NM_000038.6(APC):c.1635G>A (p.Ala545=) rs351771
NM_000038.6(APC):c.1686G>A (p.Thr562=) rs770256026
NM_000038.6(APC):c.1695A>G (p.Glu565=) rs77921116
NM_000038.6(APC):c.1825G>A (p.Val609Ile) rs147863331
NM_000038.6(APC):c.1958+8T>C rs62626346
NM_000038.6(APC):c.1959G>A (p.Arg653=) rs72541809
NM_000038.6(APC):c.2031C>T (p.Val677=) rs769363082
NM_000038.6(APC):c.2222A>G (p.Asn741Ser) rs150209825
NM_000038.6(APC):c.2262T>G (p.Val754=) rs148987776
NM_000038.6(APC):c.2297C>T (p.Ala766Val) rs200339830
NM_000038.6(APC):c.2322C>T (p.Asp774=) rs145792879
NM_000038.6(APC):c.2438A>G (p.Asn813Ser) rs201522866
NM_000038.6(APC):c.2444A>C (p.Asn815Thr) rs762990578
NM_000038.6(APC):c.2608C>T (p.Pro870Ser) rs33974176
NM_000038.6(APC):c.2805C>T (p.Tyr935=) rs137854575
NM_000038.6(APC):c.3165A>T (p.Ile1055=) rs61734287
NM_000038.6(APC):c.3173A>G (p.Asp1058Gly) rs148725540
NM_000038.6(APC):c.317G>A (p.Arg106His) rs201764637
NM_000038.6(APC):c.3249T>G (p.Asp1083Glu) rs201629780
NM_000038.6(APC):c.3264G>A (p.Lys1088=) rs114774495
NM_000038.6(APC):c.3386T>C (p.Leu1129Ser) rs143638171
NM_000038.6(APC):c.3462_3464AGA[2] (p.Glu1157del) rs386833391
NM_000038.6(APC):c.3471G>A (p.Glu1157=) rs143927847
NM_000038.6(APC):c.3511C>T (p.Arg1171Cys) rs201830995
NM_000038.6(APC):c.3624C>T (p.Thr1208=) rs730882125
NM_000038.6(APC):c.3650A>C (p.Asn1217Thr) rs138933660
NM_000038.6(APC):c.3732A>G (p.Gln1244=) rs74380081
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000038.6(APC):c.3949G>C (p.Glu1317Gln) rs1801166
NM_000038.6(APC):c.4326T>A (p.Pro1442=) rs67622085
NM_000038.6(APC):c.4360A>G (p.Lys1454Glu) rs111866410
NM_000038.6(APC):c.4420G>A (p.Ala1474Thr) rs139387758
NM_000038.6(APC):c.4479G>A (p.Thr1493=) rs41115
NM_000038.6(APC):c.4765C>G (p.Arg1589Gly) rs72541813
NM_000038.6(APC):c.4833G>A (p.Gln1611=) rs762030106
NM_000038.6(APC):c.4893T>C (p.Ser1631=) rs35634377
NM_000038.6(APC):c.4905G>A (p.Gly1635=) rs137988845
NM_000038.6(APC):c.5009C>T (p.Ala1670Val) rs202228932
NM_000038.6(APC):c.5026A>G (p.Arg1676Gly) rs370560998
NM_000038.6(APC):c.5034G>A (p.Gly1678=) rs42427
NM_000038.6(APC):c.5140G>A (p.Asp1714Asn) rs148275069
NM_000038.6(APC):c.5147A>G (p.Asn1716Ser) rs141298709
NM_000038.6(APC):c.5250C>G (p.Val1750=) rs2229997
NM_000038.6(APC):c.5265G>A (p.Ala1755=) rs34506289
NM_000038.6(APC):c.5268T>G (p.Ser1756=) rs866006
NM_000038.6(APC):c.5271T>C (p.Ser1757=) rs752875511
NM_000038.6(APC):c.5274T>A (p.Ser1758=) rs199600387
NM_000038.6(APC):c.5298T>C (p.Asp1766=) rs781533317
NM_000038.6(APC):c.5421_5423CAA[1] (p.Asn1808del) rs587782002
NM_000038.6(APC):c.5465T>A (p.Val1822Asp) rs459552
NM_000038.6(APC):c.5506G>A (p.Gly1836Arg) rs766739164
NM_000038.6(APC):c.5790A>G (p.Gln1930=) rs141152252
NM_000038.6(APC):c.5805G>A (p.Gln1935=) rs377040690
NM_000038.6(APC):c.5880G>A (p.Pro1960=) rs465899
NM_000038.6(APC):c.607C>G (p.Gln203Glu) rs141576417
NM_000038.6(APC):c.6135C>T (p.Ser2045=) rs187297940
NM_000038.6(APC):c.6354_6356TGC[5] (p.Ala2122dup) rs587780602
NM_000038.6(APC):c.6510A>C (p.Pro2170=) rs138571760
NM_000038.6(APC):c.6526T>C (p.Leu2176=) rs183468041
NM_000038.6(APC):c.6821C>T (p.Ala2274Val) rs34919187
NM_000038.6(APC):c.6921G>A (p.Ser2307=) rs2229993
NM_000038.6(APC):c.705A>G (p.Leu235=) rs147036141
NM_000038.6(APC):c.7201C>T (p.Leu2401=) rs2229994
NM_000038.6(APC):c.7399C>A (p.Pro2467Thr) rs372305287
NM_000038.6(APC):c.7504G>A (p.Gly2502Ser) rs2229995
NM_000038.6(APC):c.7514G>A (p.Arg2505Gln) rs147549623
NM_000038.6(APC):c.7621A>G (p.Ile2541Val) rs587778033
NM_000038.6(APC):c.7704A>G (p.Gly2568=) rs35043160
NM_000038.6(APC):c.7717A>G (p.Ile2573Val) rs145444830
NM_000038.6(APC):c.7731A>G (p.Ser2577=) rs537187449
NM_000038.6(APC):c.7862C>G (p.Ser2621Cys) rs72541816
NM_000038.6(APC):c.8042C>T (p.Pro2681Leu) rs182456139
NM_000038.6(APC):c.8043G>C (p.Pro2681=) rs149347068
NM_000038.6(APC):c.8068G>A (p.Ala2690Thr) rs140868933
NM_000038.6(APC):c.8389A>G (p.Ser2797Gly) rs147287751
NM_000038.6(APC):c.933+30A>G rs145211300
NM_000045.4(ARG1):c.270C>T (p.Asn90=) rs34504481
NM_000046.5(ARSB):c.1072G>A (p.Val358Met) rs1065757
NM_000046.5(ARSB):c.1126G>A (p.Val376Met) rs1071598
NM_000046.5(ARSB):c.1151G>A (p.Ser384Asn) rs25414
NM_000046.5(ARSB):c.972A>G (p.Gly324=) rs72762973
NM_000048.4(ASL):c.1164C>T (p.His388=) rs75300185
NM_000048.4(ASL):c.602+13C>T rs12536292
NM_000048.4(ASL):c.718+14A>T rs117035302
NM_000049.3(ASPA):c.693C>T (p.Tyr231=) rs12948217
NM_000051.3(ATM):c.-14T>C rs766166610
NM_000051.3(ATM):c.1066-6T>G rs201686625
NM_000051.3(ATM):c.1176C>G (p.Gly392=) rs1800727
NM_000051.3(ATM):c.1229T>C (p.Val410Ala) rs56128736
NM_000051.3(ATM):c.1254A>G (p.Gln418=) rs4987943
NM_000051.3(ATM):c.1272T>C (p.Pro424=) rs35578748
NM_000051.3(ATM):c.146C>G (p.Ser49Cys) rs1800054
NM_000051.3(ATM):c.1541G>A (p.Gly514Asp) rs2235000
NM_000051.3(ATM):c.1595G>A (p.Cys532Tyr) rs35963548
NM_000051.3(ATM):c.162T>C (p.Tyr54=) rs3218690
NM_000051.3(ATM):c.1636C>G (p.Leu546Val) rs2227924
NM_000051.3(ATM):c.1744T>C (p.Phe582Leu) rs2235006
NM_000051.3(ATM):c.1810C>T (p.Pro604Ser) rs2227922
NM_000051.3(ATM):c.1953A>G (p.Leu651=) rs730881283
NM_000051.3(ATM):c.2096A>G (p.Glu699Gly) rs147934285
NM_000051.3(ATM):c.2119T>C (p.Ser707Pro) rs4986761
NM_000051.3(ATM):c.2193C>T (p.Tyr731=) rs2229019
NM_000051.3(ATM):c.2251-10T>G rs730881346
NM_000051.3(ATM):c.2289T>A (p.Phe763Leu) rs34231402
NM_000051.3(ATM):c.2442C>A (p.Asp814Glu) rs3218695
NM_000051.3(ATM):c.2494C>T (p.Arg832Cys) rs2229022
NM_000051.3(ATM):c.2495G>T (p.Arg832Leu) rs199875915
NM_000051.3(ATM):c.2522A>C (p.Asp841Ala) rs587781812
NM_000051.3(ATM):c.2572T>C (p.Phe858Leu) rs1800056
NM_000051.3(ATM):c.2614C>T (p.Pro872Ser) rs3218673
NM_000051.3(ATM):c.2638+2T>C rs587779826
NM_000051.3(ATM):c.2685A>G (p.Leu895=) rs3218687
NM_000051.3(ATM):c.2716T>A (p.Leu906Met) rs368047468
NM_000051.3(ATM):c.2805G>C (p.Thr935=) rs55934812
NM_000051.3(ATM):c.3014A>G (p.Asn1005Ser) rs146531614
NM_000051.3(ATM):c.3118A>G (p.Met1040Val) rs3092857
NM_000051.3(ATM):c.3150T>C (p.Leu1050=) rs3092859
NM_000051.3(ATM):c.3285-9del rs1799757
NM_000051.3(ATM):c.3342G>A (p.Lys1114=) rs138393322
NM_000051.3(ATM):c.3383A>G (p.Gln1128Arg) rs2229020
NM_000051.3(ATM):c.370A>G (p.Ile124Val) rs148590073
NM_000051.3(ATM):c.378T>A (p.Asp126Glu) rs2234997
NM_000051.3(ATM):c.3925G>A (p.Ala1309Thr) rs149711770
NM_000051.3(ATM):c.3993+5G>T rs3092842
NM_000051.3(ATM):c.4060C>A (p.Pro1354Thr) rs145119475
NM_000051.3(ATM):c.4109+6T>C rs368606937
NM_000051.3(ATM):c.4138C>T (p.His1380Tyr) rs3092856
NM_000051.3(ATM):c.4258C>T (p.Leu1420Phe) rs1800058
NM_000051.3(ATM):c.4324T>C (p.Tyr1442His) rs201666889
NM_000051.3(ATM):c.4362A>C (p.Lys1454Asn) rs148993589
NM_000051.3(ATM):c.4388T>G (p.Phe1463Cys) rs138327406
NM_000051.3(ATM):c.4424A>G (p.Tyr1475Cys) rs34640941
NM_000051.3(ATM):c.4473C>T (p.Phe1491=) rs4988008
NM_000051.3(ATM):c.4578C>T (p.Pro1526=) rs1800889
NM_000051.3(ATM):c.4606A>G (p.Lys1536Glu) rs587779841
NM_000051.3(ATM):c.4626G>A (p.Leu1542=) rs786202784
NM_000051.3(ATM):c.4709T>C (p.Val1570Ala) rs140856217
NM_000051.3(ATM):c.4980C>T (p.Asn1660=) rs144338238
NM_000051.3(ATM):c.5071A>C (p.Ser1691Arg) rs1800059
NM_000051.3(ATM):c.5089A>G (p.Thr1697Ala) rs142455912
NM_000051.3(ATM):c.544G>C (p.Val182Leu) rs3218707
NM_000051.3(ATM):c.5497-8T>C rs3092829
NM_000051.3(ATM):c.5557G>A (p.Asp1853Asn) rs1801516
NM_000051.3(ATM):c.5558A>T (p.Asp1853Val) rs1801673
NM_000051.3(ATM):c.5793T>C (p.Ala1931=) rs3092910
NM_000051.3(ATM):c.5975A>C (p.Lys1992Thr) rs150757822
NM_000051.3(ATM):c.6067G>A (p.Gly2023Arg) rs11212587
NM_000051.3(ATM):c.6088A>G (p.Ile2030Val) rs145847315
NM_000051.3(ATM):c.6095+15T>C rs3212321
NM_000051.3(ATM):c.609C>T (p.Asp203=) rs144709948
NM_000051.3(ATM):c.6176C>T (p.Thr2059Ile) rs144761622
NM_000051.3(ATM):c.6235G>A (p.Val2079Ile) rs1800060
NM_000051.3(ATM):c.6437G>C (p.Ser2146Thr) rs56815840
NM_000051.3(ATM):c.6465G>A (p.Val2155=) rs140423883
NM_000051.3(ATM):c.6572+12G>T rs3218677
NM_000051.3(ATM):c.6572+4T>C rs587780636
NM_000051.3(ATM):c.657T>C (p.Cys219=) rs2235003
NM_000051.3(ATM):c.6795C>T (p.Phe2265=) rs3218699
NM_000051.3(ATM):c.6919C>T (p.Leu2307Phe) rs56009889
NM_000051.3(ATM):c.6975G>A (p.Ala2325=) rs556778314
NM_000051.3(ATM):c.6995T>C (p.Leu2332Pro) rs4988111
NM_000051.3(ATM):c.7327C>T (p.Arg2443Ter) rs121434220
NM_000051.3(ATM):c.735C>T (p.Val245=) rs3218674
NM_000051.3(ATM):c.7630-17T>C rs116047570
NM_000051.3(ATM):c.7788+8G>T rs112775908
NM_000051.3(ATM):c.7816A>G (p.Ile2606Val) rs376824528
NM_000051.3(ATM):c.7875_7876delinsGC (p.Asp2625_Ala2626delinsGluPro) rs267606668
NM_000051.3(ATM):c.7919C>T (p.Thr2640Ile) rs4988125
NM_000051.3(ATM):c.7927+13dup rs587781324
NM_000051.3(ATM):c.8151+11C>T rs555381912
NM_000051.3(ATM):c.8419-19A>G rs12279930
NM_000051.3(ATM):c.8560C>T (p.Arg2854Cys) rs201958469
NM_000051.3(ATM):c.8592C>T (p.Tyr2864=) rs56025670
NM_000051.3(ATM):c.8671+9T>G rs200190537
NM_000051.3(ATM):c.8730C>G (p.Leu2910=) rs551041839
NM_000051.3(ATM):c.8786+1G>A rs17174393
NM_000051.3(ATM):c.8786+8A>C rs4986839
NM_000051.3(ATM):c.8921C>T (p.Pro2974Leu) rs139379666
NM_000051.3(ATM):c.998C>T (p.Ser333Phe) rs28904919
NM_000052.7(ATP7A):c.4226+11T>C rs200009243
NM_000053.4(ATP7B):c.1216T>G (p.Ser406Ala) rs1801243
NM_000053.4(ATP7B):c.1366G>C (p.Val456Leu) rs1801244
NM_000053.4(ATP7B):c.1543+14G>A rs770362811
NM_000053.4(ATP7B):c.1620C>T (p.Leu540=) rs145798966
NM_000053.4(ATP7B):c.2175G>A (p.Arg725=) rs61733684
NM_000053.4(ATP7B):c.2310C>G (p.Leu770=) rs398123136
NM_000053.4(ATP7B):c.2355+13T>G rs139211339
NM_000053.4(ATP7B):c.2855G>A (p.Arg952Lys) rs732774
NM_000053.4(ATP7B):c.2866-13G>C rs7325983
NM_000053.4(ATP7B):c.2973G>A (p.Thr991=) rs1801246
NM_000053.4(ATP7B):c.2976C>A (p.Pro992=) rs746358240
NM_000053.4(ATP7B):c.3009G>A (p.Ala1003=) rs1801247
NM_000053.4(ATP7B):c.3015C>T (p.Asn1005=) rs74085888
NM_000053.4(ATP7B):c.3045G>A (p.Leu1015=) rs1801248
NM_000053.4(ATP7B):c.3060+16G>T rs76163470
NM_000053.4(ATP7B):c.3101A>G (p.His1034Arg) rs74085882
NM_000053.4(ATP7B):c.3419T>C (p.Val1140Ala) rs1801249
NM_000053.4(ATP7B):c.3557-6C>T rs140708492
NM_000053.4(ATP7B):c.3620A>G (p.His1207Arg) rs7334118
NM_000053.4(ATP7B):c.3891C>T (p.Val1297=) rs114771537
NM_000053.4(ATP7B):c.3903+6C>T rs2282057
NM_000053.4(ATP7B):c.4301C>T (p.Thr1434Met) rs60986317
NM_000053.4(ATP7B):c.4302G>A (p.Thr1434=) rs116091486
NM_000053.4(ATP7B):c.4311G>A (p.Lys1437=) rs73202048
NM_000054.6(AVPR2):c.12G>A (p.Ala4=) rs61748993
NM_000054.6(AVPR2):c.26-6T>G rs56689668
NM_000055.4(BCHE):c.849G>C (p.Glu283Asp) rs16849700
NM_000057.4(BLM):c.1928G>A (p.Arg643His) rs12720097
NM_000057.4(BLM):c.2555+7T>C rs3815003
NM_000057.4(BLM):c.2603C>T (p.Pro868Leu) rs2227935
NM_000057.4(BLM):c.3102G>A (p.Thr1034=) rs2227933
NM_000057.4(BLM):c.3531C>A (p.Ala1177=) rs2227934
NM_000057.4(BLM):c.3625T>A (p.Ser1209Thr) rs1801256
NM_000057.4(BLM):c.3798T>G (p.Val1266=) rs138831180
NM_000057.4(BLM):c.3945C>T (p.Leu1315=) rs1063147
NM_000057.4(BLM):c.3961G>A (p.Val1321Ile) rs7167216
NM_000057.4(BLM):c.4076+4T>G rs183176301
NM_000057.4(BLM):c.893C>T (p.Thr298Met) rs28384991
NM_000059.3(BRCA2):c.-11C>T rs76874770
NM_000059.3(BRCA2):c.10095delinsGAATTATATCT (p.Ser3366fs) rs276174803
NM_000059.3(BRCA2):c.10110G>A (p.Arg3370=) rs28897762
NM_000059.3(BRCA2):c.10203G>A (p.Thr3401=) rs147854265
NM_000059.3(BRCA2):c.10234A>G (p.Ile3412Val) rs1801426
NM_000059.3(BRCA2):c.1040A>G (p.Gln347Arg) rs55800493
NM_000059.3(BRCA2):c.1114A>C (p.Asn372His) rs144848
NM_000059.3(BRCA2):c.1151C>T (p.Ser384Phe) rs41293475
NM_000059.3(BRCA2):c.1225G>A (p.Glu409Lys) rs80358416
NM_000059.3(BRCA2):c.125A>G (p.Tyr42Cys) rs4987046
NM_000059.3(BRCA2):c.1275A>G (p.Glu425=) rs34355306
NM_000059.3(BRCA2):c.1362A>G (p.Lys454=) rs55919657
NM_000059.3(BRCA2):c.1385A>G (p.Glu462Gly) rs56403624
NM_000059.3(BRCA2):c.1460C>A (p.Ala487Glu) rs56390402
NM_000059.3(BRCA2):c.1514T>C (p.Ile505Thr) rs28897708
NM_000059.3(BRCA2):c.1786G>C (p.Asp596His) rs56328701
NM_000059.3(BRCA2):c.1788T>C (p.Asp596=) rs11571642
NM_000059.3(BRCA2):c.1813dupA (p.Ile605Asnfs) rs80359306
NM_000059.3(BRCA2):c.1911T>C (p.Gly637=) rs11571652
NM_000059.3(BRCA2):c.1938C>T (p.Ser646=) rs28897711
NM_000059.3(BRCA2):c.1964C>G (p.Pro655Arg) rs28897712
NM_000059.3(BRCA2):c.198A>G (p.Gln66=) rs28897700
NM_000059.3(BRCA2):c.2138A>T (p.Gln713Leu) rs55816687
NM_000059.3(BRCA2):c.223G>C (p.Ala75Pro) rs28897701
NM_000059.3(BRCA2):c.231T>G (p.Thr77=) rs114446594
NM_000059.3(BRCA2):c.2538A>C (p.Ser846=) rs11571654
NM_000059.3(BRCA2):c.2550A>G (p.Gln850=) rs80359785
NM_000059.3(BRCA2):c.2786T>C (p.Leu929Ser) rs2227943
NM_000059.3(BRCA2):c.2803G>A (p.Asp935Asn) rs28897716
NM_000059.3(BRCA2):c.2883G>A (p.Gln961=) rs11571655
NM_000059.3(BRCA2):c.2960A>T (p.Asn987Ile) rs2227944
NM_000059.3(BRCA2):c.2971A>G (p.Asn991Asp) rs1799944
NM_000059.3(BRCA2):c.2987T>G (p.Leu996Arg) rs80358545
NM_000059.3(BRCA2):c.3054G>A (p.Lys1018=) rs368404583
NM_000059.3(BRCA2):c.3073A>G (p.Lys1025Glu) rs80358550
NM_000059.3(BRCA2):c.316+12A>G rs186419778
NM_000059.3(BRCA2):c.316+13A>G rs773097109
NM_000059.3(BRCA2):c.3262C>T (p.Pro1088Ser) rs80358572
NM_000059.3(BRCA2):c.3264T>C (p.Pro1088=) rs36060526
NM_000059.3(BRCA2):c.3264dupT (p.Gln1089Serfs) rs80359380
NM_000059.3(BRCA2):c.3326C>T (p.Ala1109Val) rs41293479
NM_000059.3(BRCA2):c.3462C>T (p.Thr1154=) rs4986856
NM_000059.3(BRCA2):c.3516G>A (p.Ser1172=) rs1799952
NM_000059.3(BRCA2):c.3568C>T (p.Arg1190Trp) rs80358604
NM_000059.3(BRCA2):c.3682A>G (p.Asn1228Asp) rs28897722
NM_000059.3(BRCA2):c.3839A>T (p.Asp1280Val) rs56337919
NM_000059.3(BRCA2):c.3874C>T (p.Leu1292=) rs587780867
NM_000059.3(BRCA2):c.4068G>A (p.Leu1356=) rs28897724
NM_000059.3(BRCA2):c.4090A>C (p.Ile1364Leu) rs56248502
NM_000059.3(BRCA2):c.4258G>T (p.Asp1420Tyr) rs28897727
NM_000059.3(BRCA2):c.440A>G (p.Gln147Arg) rs80358674
NM_000059.3(BRCA2):c.4531G>A (p.Glu1511Lys) rs376338226
NM_000059.3(BRCA2):c.4584C>T (p.Ser1528=) rs80359788
NM_000059.3(BRCA2):c.4614T>C (p.Ser1538=) rs45520945
NM_000059.3(BRCA2):c.4656T>C (p.Gly1552=) rs41293491
NM_000059.3(BRCA2):c.4681C>A (p.His1561Asn) rs2219594
NM_000059.3(BRCA2):c.4686A>G (p.Gln1562=) rs28897730
NM_000059.3(BRCA2):c.502C>A (p.Pro168Thr) rs80358726
NM_000059.3(BRCA2):c.516+14C>T rs182828913
NM_000059.3(BRCA2):c.517-19C>T rs11571623
NM_000059.3(BRCA2):c.5195del (p.Leu1732fs) rs587779363
NM_000059.3(BRCA2):c.5199C>T (p.Ser1733=) rs28897734
NM_000059.3(BRCA2):c.5312G>A (p.Gly1771Asp) rs80358755
NM_000059.3(BRCA2):c.5418A>G (p.Glu1806=) rs34351119
NM_000059.3(BRCA2):c.5423T>C (p.Ile1808Thr) rs397507350
NM_000059.3(BRCA2):c.5428G>A (p.Val1810Ile) rs80358766
NM_000059.3(BRCA2):c.5529A>C (p.Ala1843=) rs372951842
NM_000059.3(BRCA2):c.5640T>G (p.Asn1880Lys) rs11571657
NM_000059.3(BRCA2):c.5661G>A (p.Thr1887=) rs80359793
NM_000059.3(BRCA2):c.5704G>A (p.Asp1902Asn) rs4987048
NM_000059.3(BRCA2):c.5744C>T (p.Thr1915Met) rs4987117
NM_000059.3(BRCA2):c.5752C>T (p.His1918Tyr) rs80358803
NM_000059.3(BRCA2):c.5946del (p.Ser1982fs) rs80359550
NM_000059.3(BRCA2):c.6057C>T (p.Asn2019=) rs147961615
NM_000059.3(BRCA2):c.6100C>T (p.Arg2034Cys) rs1799954
NM_000059.3(BRCA2):c.6220C>A (p.His2074Asn) rs34309943
NM_000059.3(BRCA2):c.627C>T (p.Leu209=) rs28897704
NM_000059.3(BRCA2):c.6290C>T (p.Thr2097Met) rs80358866
NM_000059.3(BRCA2):c.632-13T>G rs775947267
NM_000059.3(BRCA2):c.6322C>T (p.Arg2108Cys) rs55794205
NM_000059.3(BRCA2):c.6323G>A (p.Arg2108His) rs35029074
NM_000059.3(BRCA2):c.6338A>G (p.Asn2113Ser) rs80358874
NM_000059.3(BRCA2):c.6347A>G (p.His2116Arg) rs55953736
NM_000059.3(BRCA2):c.6412G>T (p.Val2138Phe) rs11571659
NM_000059.3(BRCA2):c.6455C>A (p.Ser2152Tyr) rs80358881
NM_000059.3(BRCA2):c.6541G>C (p.Gly2181Arg) rs371067421
NM_000059.3(BRCA2):c.658_659del (p.Val220fs) rs80359604
NM_000059.3(BRCA2):c.67+17T>C rs767648965
NM_000059.3(BRCA2):c.6816_6820del (p.Gly2274fs) rs587781803
NM_000059.3(BRCA2):c.6821G>T (p.Gly2274Val) rs55712212
NM_000059.3(BRCA2):c.6921A>G (p.Ser2307=) rs181183366
NM_000059.3(BRCA2):c.6935A>T (p.Asp2312Val) rs80358916
NM_000059.3(BRCA2):c.7008-62A>G rs76584943
NM_000059.3(BRCA2):c.7017G>C (p.Lys2339Asn) rs45574331
NM_000059.3(BRCA2):c.7050C>T (p.Thr2350=) rs587780870
NM_000059.3(BRCA2):c.7096C>G (p.Leu2366Val) rs80358941
NM_000059.3(BRCA2):c.7319A>G (p.His2440Arg) rs4986860
NM_000059.3(BRCA2):c.742G>A (p.Ala248Thr) rs55854959
NM_000059.3(BRCA2):c.7435+6G>A rs81002852
NM_000059.3(BRCA2):c.7469T>C (p.Ile2490Thr) rs11571707
NM_000059.3(BRCA2):c.7505G>A (p.Arg2502His) rs56070345
NM_000059.3(BRCA2):c.7544C>T (p.Thr2515Ile) rs28897744
NM_000059.3(BRCA2):c.7626G>A (p.Thr2542=) rs61754138
NM_000059.3(BRCA2):c.7805+6C>G rs81002819
NM_000059.3(BRCA2):c.7916C>T (p.Pro2639Leu) rs774723315
NM_000059.3(BRCA2):c.793G>A (p.Gly265Arg) rs1403242422
NM_000059.3(BRCA2):c.8149G>T (p.Ala2717Ser) rs28897747
NM_000059.3(BRCA2):c.8182G>A (p.Val2728Ile) rs28897749
NM_000059.3(BRCA2):c.8187G>T (p.Lys2729Asn) rs80359065
NM_000059.3(BRCA2):c.8378G>A (p.Gly2793Glu) rs80359083
NM_000059.3(BRCA2):c.8417C>T (p.Ser2806Leu) rs587782785
NM_000059.3(BRCA2):c.841G>A (p.Asp281Asn) rs80359088
NM_000059.3(BRCA2):c.8460A>C (p.Val2820=) rs9590940
NM_000059.3(BRCA2):c.8487+19A>G rs11571743
NM_000059.3(BRCA2):c.8567A>C (p.Glu2856Ala) rs11571747
NM_000059.3(BRCA2):c.865A>C (p.Asn289His) rs766173
NM_000059.3(BRCA2):c.8755-19A>G rs398122713
NM_000059.3(BRCA2):c.8830A>T (p.Ile2944Phe) rs4987047
NM_000059.3(BRCA2):c.8850G>T (p.Lys2950Asn) rs28897754
NM_000059.3(BRCA2):c.8851G>A (p.Ala2951Thr) rs11571769
NM_000059.3(BRCA2):c.8917C>T (p.Arg2973Cys) rs45469092
NM_000059.3(BRCA2):c.9038C>T (p.Thr3013Ile) rs28897755
NM_000059.3(BRCA2):c.9257-10del rs276174919
NM_000059.3(BRCA2):c.9257-16T>C rs11571818
NM_000059.3(BRCA2):c.956A>C (p.Asn319Thr) rs55939572
NM_000059.3(BRCA2):c.9634G>C (p.Gly3212Arg) rs55775473
NM_000059.3(BRCA2):c.9649-19G>A rs11571830
NM_000059.3(BRCA2):c.9649-20C>T rs56177715
NM_000059.3(BRCA2):c.9699_9702del (p.Cys3233fs) rs80359775
NM_000059.3(BRCA2):c.9730G>A (p.Val3244Ile) rs11571831
NM_000059.3(BRCA2):c.978C>A (p.Ser326Arg) rs28897706
NM_000059.3(BRCA2):c.9976A>T (p.Lys3326Ter) rs11571833
NM_000059.3(BRCA2):c.9997C>G (p.Leu3333Val) rs567476314
NM_000069.3(CACNA1S):c.1452C>T (p.Tyr484=) rs144206959
NM_000069.3(CACNA1S):c.1506C>T (p.Phe502=) rs141808465
NM_000069.3(CACNA1S):c.1548G>A (p.Ser516=) rs16847669
NM_000069.3(CACNA1S):c.1711G>A (p.Val571Ile) rs114191482
NM_000069.3(CACNA1S):c.1817G>A (p.Ser606Asn) rs142356235
NM_000069.3(CACNA1S):c.1948+10C>G rs201173419
NM_000069.3(CACNA1S):c.1995C>T (p.Ala665=) rs16847664
NM_000069.3(CACNA1S):c.2047C>T (p.Arg683Cys) rs35708442
NM_000069.3(CACNA1S):c.2063+7G>T rs79984703
NM_000069.3(CACNA1S):c.206C>G (p.Ala69Gly) rs12406479
NM_000069.3(CACNA1S):c.2361-13C>T rs2182117
NM_000069.3(CACNA1S):c.2454G>A (p.Ala818=) rs141619541
NM_000069.3(CACNA1S):c.2480T>C (p.Met827Thr) rs61238538
NM_000069.3(CACNA1S):c.252C>T (p.Leu84=) rs112868209
NM_000069.3(CACNA1S):c.2745+14C>T rs74138824
NM_000069.3(CACNA1S):c.2746-14C>T rs113792034
NM_000069.3(CACNA1S):c.3053+13T>C rs41267501
NM_000069.3(CACNA1S):c.3261A>G (p.Gln1087=) rs34515088
NM_000069.3(CACNA1S):c.3795+3G>A rs191758096
NM_000069.3(CACNA1S):c.3796-9G>A rs142184434
NM_000069.3(CACNA1S):c.3811G>A (p.Ala1271Thr) rs138144724
NM_000069.3(CACNA1S):c.383C>G (p.Thr128Ser) rs139491817
NM_000069.3(CACNA1S):c.394C>A (p.Leu132Met) rs377030324
NM_000069.3(CACNA1S):c.3953+6C>T rs115707724
NM_000069.3(CACNA1S):c.3953+7G>A rs141071505
NM_000069.3(CACNA1S):c.399-14C>T rs116534514
NM_000069.3(CACNA1S):c.4668+19T>C rs140742077
NM_000069.3(CACNA1S):c.4686T>C (p.Ile1562=) rs138423302
NM_000069.3(CACNA1S):c.541+9C>T rs375541532
NM_000069.3(CACNA1S):c.5490_5497del (p.Leu1832fs) rs554596425
NM_000069.3(CACNA1S):c.773G>A (p.Gly258Asp) rs35534614
NM_000069.3(CACNA1S):c.858C>T (p.Tyr286=) rs61734621
NM_000069.3(CACNA1S):c.895T>C (p.Tyr299His) rs35856559
NM_000070.3(CAPN3):c.1029+3A>G rs28364442
NM_000070.3(CAPN3):c.1302C>T (p.Asn434=) rs751429914
NM_000070.3(CAPN3):c.1355-6G>A rs28364485
NM_000070.3(CAPN3):c.1543G>A (p.Gly515Arg) rs150226817
NM_000070.3(CAPN3):c.1668C>T (p.Ile556=) rs199884116
NM_000070.3(CAPN3):c.2235C>T (p.Tyr745=) rs147774793
NM_000070.3(CAPN3):c.2264-11C>T rs28364537
NM_000070.3(CAPN3):c.2332G>A (p.Asp778Asn) rs115311625
NM_000070.3(CAPN3):c.2380+12del rs28364538
NM_000070.3(CAPN3):c.2381-12A>G rs73402734
NM_000070.3(CAPN3):c.2433T>C (p.Val811=) rs28364543
NM_000070.3(CAPN3):c.318C>T (p.Cys106=) rs117609395
NM_000070.3(CAPN3):c.319G>A (p.Glu107Lys) rs1801505
NM_000070.3(CAPN3):c.479C>G (p.Ala160Gly) rs17592
NM_000070.3(CAPN3):c.495C>T (p.Phe165=) rs1801324
NM_000070.3(CAPN3):c.551C>T (p.Thr184Met) rs35889956
NM_000070.3(CAPN3):c.606T>C (p.Ser202=) rs17593
NM_000070.3(CAPN3):c.62G>A (p.Gly21Glu) rs28364364
NM_000070.3(CAPN3):c.78G>A (p.Pro26=) rs62642519
NM_000070.3(CAPN3):c.939G>A (p.Pro313=) rs78369269
NM_000070.3(CAPN3):c.96T>C (p.Thr32=) rs1801496
NM_000070.3(CAPN3):c.984C>T (p.Cys328=) rs28364441
NM_000075.4(CDK4):c.522+8G>A rs758294834
NM_000075.4(CDK4):c.776C>T (p.Ser259Leu) rs201617914
NM_000075.4(CDK4):c.779T>A (p.Val260Glu) rs200215596
NM_000076.2(CDKN1C):c.528G>C (p.Ala176=) rs533485167
NM_000076.2(CDKN1C):c.555T>C (p.Ala185=) rs191294997
NM_000076.2(CDKN1C):c.708G>A (p.Glu236=) rs3741341
NM_000077.4(CDKN2A):c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) rs587780668
NM_000077.4(CDKN2A):c.-25C>T rs144481587
NM_000077.4(CDKN2A):c.-2G>A rs191394143
NM_000077.4(CDKN2A):c.146T>C (p.Ile49Thr) rs199907548
NM_000077.4(CDKN2A):c.150+37G>C rs45456595
NM_000077.4(CDKN2A):c.170C>T (p.Ala57Val) rs372266620
NM_000077.4(CDKN2A):c.251A>C (p.Asp84Ala) rs587782792
NM_000077.4(CDKN2A):c.318G>A (p.Val106=) rs199888003
NM_000077.4(CDKN2A):c.369T>A (p.His123Gln) rs6413463
NM_000077.4(CDKN2A):c.373G>C (p.Asp125His) rs146179135
NM_000077.4(CDKN2A):c.379G>T (p.Ala127Ser) rs6413464
NM_000077.4(CDKN2A):c.430C>T (p.Arg144Cys) rs116150891
NM_000077.4(CDKN2A):c.442G>A (p.Ala148Thr) rs3731249
NM_000080.4(CHRNE):c.*5C>T rs747566295
NM_000080.4(CHRNE):c.*6A>G rs55806270
NM_000080.4(CHRNE):c.-8G>A rs77481135
NM_000080.4(CHRNE):c.1033-6C>T rs2075763
NM_000080.4(CHRNE):c.1220-45C>T rs75492003
NM_000080.4(CHRNE):c.1305A>G (p.Arg435=) rs55681486
NM_000080.4(CHRNE):c.1402G>C (p.Val468Leu) rs139171143
NM_000080.4(CHRNE):c.1416C>T (p.Leu472=) rs145456588
NM_000080.4(CHRNE):c.1425C>T (p.Leu475=) rs151193377
NM_000080.4(CHRNE):c.45C>T (p.Leu15=) rs34563587
NM_000080.4(CHRNE):c.6A>G (p.Ala2=) rs202198207
NM_000080.4(CHRNE):c.966C>T (p.Cys322=) rs56377005
NM_000082.3(ERCC8):c.1080T>C (p.Ala360=) rs4647130
NM_000082.3(ERCC8):c.363T>C (p.Asp121=) rs4647088
NM_000086.2(CLN3):c.1211A>G (p.His404Arg) rs77595156
NM_000086.2(CLN3):c.831G>A (p.Val277=) rs1142183
NM_000088.3(COL1A1):c.177G>T (p.Arg59=) rs1057297
NM_000088.3(COL1A1):c.1930-14T>C rs2696247
NM_000088.3(COL1A1):c.2298T>C (p.Thr766=) rs2734272
NM_000088.3(COL1A1):c.4249-12G>A rs2249492
NM_000088.3(COL1A1):c.859-14T>G rs17639446
NM_000088.3(COL1A1):c.904-9G>T rs141726413
NM_000089.3(COL1A2):c.3135C>T (p.Gly1045=) rs1800248
NM_000089.3(COL1A2):c.948C>T (p.Gly316=) rs34511999
NM_000090.3(COL3A1):c.114C>G (p.Ser38=) rs141241764
NM_000090.3(COL3A1):c.1550C>T (p.Pro517Leu) rs142085247
NM_000090.3(COL3A1):c.1804C>A (p.Pro602Thr) rs35795890
NM_000090.3(COL3A1):c.1816-19T>C rs114299724
NM_000090.3(COL3A1):c.1927T>C (p.Leu643=) rs41263757
NM_000090.3(COL3A1):c.2002C>A (p.Pro668Thr) rs1801183
NM_000090.3(COL3A1):c.2035G>A (p.Ala679Thr) rs41263773
NM_000090.3(COL3A1):c.3525+19del rs138061246
NM_000090.3(COL3A1):c.3642C>A (p.Gly1214=) rs184402915
NM_000090.3(COL3A1):c.4011+34A>G rs41265549
NM_000090.3(COL3A1):c.583-8C>T rs10166835
NM_000091.4(COL4A3):c.1223G>A (p.Arg408His) rs34505188
NM_000091.4(COL4A3):c.1352A>G (p.His451Arg) rs11677877
NM_000091.4(COL4A3):c.1398T>C (p.Asp466=) rs145833114
NM_000091.4(COL4A3):c.1452G>A (p.Gly484=) rs34019152
NM_000091.4(COL4A3):c.1576-15T>G rs56243460
NM_000091.4(COL4A3):c.222G>T (p.Pro74=) rs187950806
NM_000091.4(COL4A3):c.2501A>G (p.Lys834Arg) rs56226424
NM_000091.4(COL4A3):c.2715C>T (p.Pro905=) rs75519005
NM_000091.4(COL4A3):c.3031C>T (p.Arg1011Cys) rs73996408
NM_000091.4(COL4A3):c.3258G>A (p.Gly1086=) rs147085074
NM_000091.4(COL4A3):c.3270A>C (p.Pro1090=) rs201989155
NM_000091.4(COL4A3):c.3325C>T (p.Pro1109Ser) rs55816283
NM_000091.4(COL4A3):c.346C>A (p.Pro116Thr) rs115324397
NM_000091.4(COL4A3):c.3807C>A (p.Asp1269Glu) rs57611801
NM_000091.4(COL4A3):c.4380T>C (p.Cys1460=) rs114430490
NM_000091.4(COL4A3):c.4484A>G (p.Gln1495Arg) rs77964815
NM_000091.4(COL4A3):c.4665G>A (p.Ala1555=) rs200858199
NM_000091.4(COL4A3):c.4707A>T (p.Pro1569=) rs113401495
NM_000091.4(COL4A3):c.4893C>T (p.Phe1631=) rs183218622
NM_000091.4(COL4A3):c.547-9A>C rs55667591
NM_000091.4(COL4A3):c.766-13G>A rs77431913
NM_000091.4(COL4A3):c.805G>A (p.Glu269Lys) rs80109666
NM_000091.4(COL4A3):c.88-4C>T rs148393022
NM_000091.4(COL4A3):c.976G>T (p.Asp326Tyr) rs55703767
NM_000092.4(COL4A4):c.1323T>C (p.Pro441=) rs35830639
NM_000092.4(COL4A4):c.1634G>C (p.Gly545Ala) rs1800516
NM_000092.4(COL4A4):c.1781A>G (p.Glu594Gly) rs35998949
NM_000092.4(COL4A4):c.195T>C (p.Gly65=) rs201278620
NM_000092.4(COL4A4):c.2008G>A (p.Val670Ile) rs34236495
NM_000092.4(COL4A4):c.2276C>T (p.Pro759Leu) rs36121515
NM_000092.4(COL4A4):c.2384-5T>C rs3769641
NM_000092.4(COL4A4):c.2439A>T (p.Gly813=) rs34835657
NM_000092.4(COL4A4):c.2630G>A (p.Arg877Gln) rs150979437
NM_000092.4(COL4A4):c.2717-5A>T rs1800519
NM_000092.4(COL4A4):c.2899A>G (p.Ile967Val) rs80243096
NM_000092.4(COL4A4):c.2996G>A (p.Gly999Glu) rs13027659
NM_000092.4(COL4A4):c.3486A>G (p.Pro1162=) rs2229815
NM_000092.4(COL4A4):c.3963T>C (p.Asp1321=) rs116124529
NM_000092.4(COL4A4):c.3979G>A (p.Val1327Met) rs2229813
NM_000092.4(COL4A4):c.4041A>G (p.Leu1347=) rs16823077
NM_000092.4(COL4A4):c.4090+14T>C rs147376687
NM_000092.4(COL4A4):c.4217-15T>C rs200926310
NM_000092.4(COL4A4):c.5016A>G (p.Glu1672=) rs34761049
NM_000094.3(COL7A1):c.2242G>A (p.Glu748Lys) rs148411473
NM_000094.3(COL7A1):c.3830C>T (p.Pro1277Leu) rs35761247
NM_000094.3(COL7A1):c.4483-11T>C rs74390291
NM_000094.3(COL7A1):c.6696C>A (p.Pro2232=) rs61729223
NM_000095.3(COMP):c.*1G>C rs77185131
NM_000095.3(COMP):c.1156A>G (p.Asn386Asp) rs61739916
NM_000095.3(COMP):c.1755G>A (p.Thr585=) rs34467947
NM_000095.3(COMP):c.218-14C>T rs150008764
NM_000095.3(COMP):c.2267A>G (p.Gln756Arg) rs61752496
NM_000095.3(COMP):c.511G>A (p.Ala171Thr) rs115338183
NM_000100.3(CSTB):c.15G>T (p.Ala5=) rs4533
NM_000100.3(CSTB):c.67-3T>C rs6383
NM_000101.4(CYBA):c.214T>C (p.Tyr72His) rs4673
NM_000104.3(CYP1B1):c.-1-12C>T rs2617266
NM_000104.3(CYP1B1):c.1358A>G (p.Asn453Ser) rs1800440
NM_000104.3(CYP1B1):c.564C>A (p.Gly188=) rs9341247
NM_000108.5(DLD):c.439-7T>C rs10263341
NM_000109.4(DMD):c.1294G>A (p.Glu432Lys) rs189143447
NM_000109.4(DMD):c.70-16dup rs3834997
NM_000110.3(DPYD):c.1129-15T>C rs56293913
NM_000110.3(DPYD):c.1601G>A (p.Ser534Asn) rs1801158
NM_000110.3(DPYD):c.1627A>G (p.Ile543Val) rs1801159
NM_000110.3(DPYD):c.1896T>C (p.Phe632=) rs17376848
NM_000110.3(DPYD):c.2194G>A (p.Val732Ile) rs1801160
NM_000110.3(DPYD):c.496A>G (p.Met166Val) rs2297595
NM_000110.3(DPYD):c.775A>G (p.Lys259Glu) rs45589337
NM_000112.3(SLC26A2):c.1761C>T (p.Leu587=) rs745590895
NM_000112.3(SLC26A2):c.2065A>T (p.Thr689Ser) rs3776070
NM_000112.3(SLC26A2):c.2220A>G (p.Ter740=) rs61732052
NM_000113.3(TOR1A):c.246C>T (p.Ala82=) rs2296793
NM_000113.3(TOR1A):c.646G>C (p.Asp216His) rs1801968
NM_000113.3(TOR1A):c.749-11C>A rs72755217
NM_000116.5(TAZ):c.110-17= rs62617809
NM_000118.3(ENG):c.*190C>T rs181330955
NM_000118.3(ENG):c.1029C>T (p.Thr343=) rs3739817
NM_000118.3(ENG):c.1060C>T (p.Leu354=) rs36092484
NM_000118.3(ENG):c.1096G>C (p.Asp366His) rs1800956
NM_000118.3(ENG):c.120C>T (p.Gly40=) rs41522944
NM_000118.3(ENG):c.1374A>G (p.Pro458=) rs34828244
NM_000118.3(ENG):c.1452C>T (p.Ser484=) rs115450389
NM_000118.3(ENG):c.14C>T (p.Thr5Met) rs35400405
NM_000118.3(ENG):c.1510G>A (p.Val504Met) rs116330805
NM_000118.3(ENG):c.1844C>T (p.Ser615Leu) rs148002300
NM_000118.3(ENG):c.207G>A (p.Leu69=) rs11545664
NM_000118.3(ENG):c.572G>A (p.Gly191Asp) rs41322046
NM_000118.3(ENG):c.732C>T (p.Pro244=) rs112262663
NM_000119.3(EPB42):c.1122T>C (p.Asp374=) rs150481419
NM_000119.3(EPB42):c.1369C>T (p.Arg457Cys) rs45594632
NM_000119.3(EPB42):c.1408+4C>T rs45498491
NM_000119.3(EPB42):c.29C>T (p.Ser10Leu) rs77809780
NM_000119.3(EPB42):c.420G>A (p.Ala140=) rs1042168
NM_000119.3(EPB42):c.543T>C (p.Asn181=) rs114136713
NM_000119.3(EPB42):c.89G>A (p.Ser30Asn) rs149249456
NM_000119.3(EPB42):c.923-4A>G rs61343376
NM_000119.3(EPB42):c.984C>T (p.Thr328=) rs35719500
NM_000123.3(ERCC5):c.138T>C (p.His46=) rs1047768
NM_000123.3(ERCC5):c.1440C>T (p.His480=) rs4150316
NM_000123.3(ERCC5):c.1586G>C (p.Cys529Ser) rs2227869
NM_000123.3(ERCC5):c.3310G>C (p.Asp1104His) rs17655
NM_000123.3(ERCC5):c.760A>G (p.Met254Val) rs1047769
NM_000123.3(ERCC5):c.945C>T (p.His315=) rs34061299
NM_000124.4(ERCC6):c.1196G>A (p.Gly399Asp) rs2228528
NM_000124.4(ERCC6):c.1337G>A (p.Gly446Asp) rs4253047
NM_000124.4(ERCC6):c.135C>G (p.Leu45=) rs2228524
NM_000124.4(ERCC6):c.2751C>T (p.Gly917=) rs2229760
NM_000124.4(ERCC6):c.3289A>G (p.Met1097Val) rs2228526
NM_000124.4(ERCC6):c.3637A>G (p.Arg1213Gly) rs2228527
NM_000124.4(ERCC6):c.3689G>C (p.Arg1230Pro) rs4253211
NM_000124.4(ERCC6):c.4065T>G (p.Asp1355Glu) rs34917815
NM_000124.4(ERCC6):c.411G>A (p.Leu137=) rs4253013
NM_000124.4(ERCC6):c.4238A>G (p.Gln1413Arg) rs2228529
NM_000127.2(EXT1):c.114A>G (p.Glu38=) rs17506447
NM_000127.2(EXT1):c.1536+7G>A rs200128437
NM_000128.3(F11):c.1812G>T (p.Arg604=) rs5971
NM_000128.3(F11):c.1839G>A (p.Glu613=) rs5976
NM_000128.3(F11):c.429C>T (p.Asp143=) rs5973
NM_000129.3(F13A1):c.103G>T (p.Val35Leu) rs5985
NM_000129.3(F13A1):c.1694C>T (p.Pro565Leu) rs5982
NM_000129.3(F13A1):c.1704A>G (p.Glu568=) rs5986
NM_000129.3(F13A1):c.1951G>A (p.Val651Ile) rs5987
NM_000129.3(F13A1):c.1954G>C (p.Glu652Gln) rs5988
NM_000129.3(F13A1):c.996A>C (p.Pro332=) rs5981
NM_000130.4(F5):c.1238T>C (p.Met413Thr) rs6033
NM_000130.4(F5):c.1242A>G (p.Lys414=) rs6035
NM_000130.4(F5):c.1380C>T (p.Asn460=) rs6015
NM_000130.4(F5):c.1716G>A (p.Glu572=) rs6036
NM_000130.4(F5):c.1926C>A (p.Thr642=) rs6037
NM_000130.4(F5):c.2208C>T (p.Ile736=) rs6016
NM_000130.4(F5):c.2235T>C (p.Asn745=) rs6017
NM_000130.4(F5):c.2289A>G (p.Glu763=) rs6024
NM_000130.4(F5):c.2301A>G (p.Ser767=) rs6021
NM_000130.4(F5):c.237A>G (p.Gln79=) rs6028
NM_000130.4(F5):c.2425C>T (p.Pro809Ser) rs6031
NM_000130.4(F5):c.2450A>C (p.Asn817Thr) rs6018
NM_000130.4(F5):c.2573A>G (p.Lys858Arg) rs4524
NM_000130.4(F5):c.2594A>G (p.His865Arg) rs4525
NM_000130.4(F5):c.2773A>G (p.Lys925Glu) rs6032
NM_000130.4(F5):c.319G>C (p.Asp107His) rs6019
NM_000130.4(F5):c.3804T>C (p.Ser1268=) rs1800594
NM_000130.4(F5):c.3853C>A (p.Leu1285Ile) rs1046712
NM_000130.4(F5):c.3948C>T (p.Leu1316=) rs9287090
NM_000130.4(F5):c.3980A>G (p.His1327Arg) rs1800595
NM_000130.4(F5):c.405G>A (p.Ala135=) rs6029
NM_000130.4(F5):c.4095C>T (p.Thr1365=) rs9332607
NM_000130.4(F5):c.5290A>G (p.Met1764Val) rs6030
NM_000130.4(F5):c.5419+12A>G rs6009
NM_000130.4(F5):c.552G>T (p.Ser184=) rs6022
NM_000130.4(F5):c.6443T>C (p.Met2148Thr) rs9332701
NM_000130.4(F5):c.6665A>G (p.Asp2222Gly) rs6027
NM_000130.4(F5):c.730+7C>T rs6023
NM_000130.4(F5):c.816C>T (p.Asn272=) rs9332578
NM_000131.4(F7):c.1238G>A (p.Arg413Gln) rs6046
NM_000131.4(F7):c.806-10T>C rs3093266
NM_000132.3(F8):c.4500G>A (p.Pro1500=) rs33921347
NM_000133.3(F9):c.580A>G (p.Thr194Ala) rs6048
NM_000135.4(FANCA):c.-18G>A rs886038245
NM_000135.4(FANCA):c.1143G>T (p.Thr381=) rs1800331
NM_000135.4(FANCA):c.115A>C (p.Arg39=) rs17232091
NM_000135.4(FANCA):c.1235C>T (p.Ala412Val) rs11646374
NM_000135.4(FANCA):c.1290G>A (p.Ala430=) rs1800332
NM_000135.4(FANCA):c.1471-12A>G rs9282684
NM_000135.4(FANCA):c.17T>A (p.Val6Asp) rs1800282
NM_000135.4(FANCA):c.1830A>G (p.Ala610=) rs1800338
NM_000135.4(FANCA):c.1927C>G (p.Pro643Ala) rs17232910
NM_000135.4(FANCA):c.1941G>A (p.Glu647=) rs17232917
NM_000135.4(FANCA):c.2151G>T (p.Met717Ile) rs1131660
NM_000135.4(FANCA):c.2216C>T (p.Pro739Leu) rs45441106
NM_000135.4(FANCA):c.24C>G (p.Asn8Lys) rs76275444
NM_000135.4(FANCA):c.2779-7T>C rs17233253
NM_000135.4(FANCA):c.2901C>T (p.Ser967=) rs17226980
NM_000135.4(FANCA):c.3067-4T>C rs17227064
NM_000135.4(FANCA):c.3263C>T (p.Ser1088Phe) rs17233497
NM_000135.4(FANCA):c.3348+18A>G rs1800347
NM_000135.4(FANCA):c.3591G>A (p.Leu1197=) rs55773634
NM_000135.4(FANCA):c.3654A>G (p.Pro1218=) rs1800358
NM_000135.4(FANCA):c.3807G>C (p.Leu1269=) rs11649210
NM_000135.4(FANCA):c.3859G>A (p.Val1287Ile) rs17227354
NM_000135.4(FANCA):c.3982A>G (p.Thr1328Ala) rs9282681
NM_000135.4(FANCA):c.4332T>G (p.Pro1444=) rs149531696
NM_000135.4(FANCA):c.542C>T (p.Ala181Val) rs17232246
NM_000135.4(FANCA):c.623C>T (p.Ser208Leu) rs144420697
NM_000135.4(FANCA):c.755A>G (p.Asp252Gly) rs17225943
NM_000135.4(FANCA):c.894-8A>G rs11648881
NM_000135.4(FANCA):c.932T>C (p.Ile311Thr) rs75501942
NM_000136.3(FANCC):c.*42G>A rs7029888
NM_000136.3(FANCC):c.1345G>A (p.Val449Met) rs1800367
NM_000136.3(FANCC):c.408A>G (p.Gln136=) rs1800360
NM_000136.3(FANCC):c.416G>A (p.Gly139Glu) rs1800362
NM_000136.3(FANCC):c.584A>T (p.Asp195Val) rs1800365
NM_000136.3(FANCC):c.77C>T (p.Ser26Phe) rs1800361
NM_000137.3(FAH):c.1056C>T (p.Ser352=) rs1801374
NM_000137.3(FAH):c.1180+4A>G rs60585303
NM_000137.3(FAH):c.267G>C (p.Leu89=) rs33929922
NM_000138.4(FBN1):c.1746C>T (p.Cys582=) rs112366266
NM_000138.4(FBN1):c.1960+30G>A rs25459
NM_000138.4(FBN1):c.2113+19A>T rs541501178
NM_000138.4(FBN1):c.2855-9C>T rs140590
NM_000138.4(FBN1):c.2956G>A (p.Ala986Thr) rs112287730
NM_000138.4(FBN1):c.306C>T (p.Cys102=) rs25388
NM_000138.4(FBN1):c.3294C>T (p.Asp1098=) rs140587
NM_000138.4(FBN1):c.3589+11TTTTA[5] rs72158035
NM_000138.4(FBN1):c.3965-8T>C rs140637
NM_000138.4(FBN1):c.4905C>G (p.Thr1635=) rs113115949
NM_000138.4(FBN1):c.5065+10A>G rs375945405
NM_000138.4(FBN1):c.5097C>T (p.Tyr1699=) rs368979510
NM_000138.4(FBN1):c.510C>T (p.Tyr170=) rs111671429
NM_000138.4(FBN1):c.5296+14G>A rs140650
NM_000138.4(FBN1):c.5343G>A (p.Val1781=) rs140649
NM_000138.4(FBN1):c.6577G>A (p.Glu2193Lys) rs201361628
NM_000138.4(FBN1):c.6594C>T (p.Pro2198=) rs111844882
NM_000138.4(FBN1):c.6681A>C (p.Ser2227=) rs363824
NM_000138.4(FBN1):c.6705A>C (p.Gly2235=) rs2229326
NM_000138.4(FBN1):c.6832C>T (p.Pro2278Ser) rs363835
NM_000138.4(FBN1):c.6932G>A (p.Arg2311His) rs141868829
NM_000138.4(FBN1):c.6998-40del rs193922229
NM_000138.4(FBN1):c.7051G>A (p.Gly2351Ser) rs746127796
NM_000138.4(FBN1):c.783T>C (p.Asn261=) rs113721547
NM_000138.4(FBN1):c.8176C>T (p.Arg2726Trp) rs61746008
NM_000142.4(FGFR3):c.1959+8C>T rs371666188
NM_000143.3(FH):c.6C>T (p.Tyr2=) rs199971078
NM_000143.3(FH):c.739-10T>C rs201971572
NM_000143.3(FH):c.77C>T (p.Pro26Leu) rs187226800
NM_000145.3(FSHR):c.24G>T (p.Leu8Phe) rs115030945
NM_000145.3(FSHR):c.919G>A (p.Ala307Thr) rs6165
NM_000146.4(FTL):c.163T>C (p.Leu55=) rs2230267
NM_000151.4(G6PC):c.*3G>A rs191399793
NM_000151.4(G6PC):c.432G>A (p.Pro144=) rs161628
NM_000152.3(GAA):c.2065G>A (p.Glu689Lys) rs1800309
NM_000152.5(GAA):c.*3G>A rs1800317
NM_000152.5(GAA):c.1327-18A>G rs2278619
NM_000152.5(GAA):c.1374C>T (p.Tyr458=) rs1800305
NM_000152.5(GAA):c.1552-13G>A rs111261964
NM_000152.5(GAA):c.1581G>A (p.Arg527=) rs1042396
NM_000152.5(GAA):c.1599C>T (p.Cys533=) rs142766716
NM_000152.5(GAA):c.1726G>A (p.Gly576Ser) rs1800307
NM_000152.5(GAA):c.1754+12G>A rs2304840
NM_000152.5(GAA):c.1830C>T (p.Ala610=) rs61736896
NM_000152.5(GAA):c.1920T>G (p.Pro640=) rs144090460
NM_000152.5(GAA):c.2133A>G (p.Thr711=) rs1800310
NM_000152.5(GAA):c.2331+24T>C rs2304831
NM_000152.5(GAA):c.2332-12A>T rs200965268
NM_000152.5(GAA):c.2400C>T (p.Ser800=) rs115705591
NM_000152.5(GAA):c.2446G>A (p.Val816Ile) rs1800314
NM_000152.5(GAA):c.2668G>C (p.Val890Leu) rs377286472
NM_000152.5(GAA):c.271G>A (p.Asp91Asn) rs1800299
NM_000152.5(GAA):c.2780C>T (p.Thr927Ile) rs1800315
NM_000152.5(GAA):c.32G>A (p.Arg11Gln) rs138812846
NM_000152.5(GAA):c.447G>A (p.Thr149=) rs2289536
NM_000152.5(GAA):c.600C>T (p.Val200=) rs150895924
NM_000152.5(GAA):c.642C>T (p.Ser214=) rs1800301
NM_000152.5(GAA):c.658G>T (p.Val220Leu) rs530478036
NM_000152.5(GAA):c.668G>A (p.Arg223His) rs1042395
NM_000152.5(GAA):c.917C>T (p.Ser306Leu) rs138097673
NM_000152.5(GAA):c.921A>T (p.Ala307=) rs1800303
NM_000153.4(GALC):c.1302C>T (p.Ser434=) rs3213918
NM_000153.4(GALC):c.1685T>C (p.Ile562Thr) rs398607
NM_000153.4(GALC):c.18C>G (p.Leu6=) rs886038260
NM_000153.4(GALC):c.195+19G>A rs189853941
NM_000153.4(GALC):c.397T>C (p.Leu133=) rs56194647
NM_000153.4(GALC):c.42G>C (p.Ala14=) rs112992946
NM_000153.4(GALC):c.550C>T (p.Arg184Cys) rs1805078
NM_000153.4(GALC):c.61G>C (p.Ala21Pro) rs111887056
NM_000153.4(GALC):c.742G>A (p.Asp248Asn) rs34362748
NM_000153.4(GALC):c.75C>A (p.Gly25=) rs111976362
NM_000155.4(GALT):c.753C>T (p.Tyr251=) rs367543261
NM_000155.4(GALT):c.876G>A (p.Thr292=) rs1055607
NM_000155.4(GALT):c.940A>G (p.Asn314Asp) rs2070074
NM_000155.4(GALT):c.945T>C (p.His315=) rs61735982
NM_000156.6(GAMT):c.312A>G (p.Pro104=) rs779679242
NM_000156.6(GAMT):c.571-6G>A rs2074899
NM_000156.6(GAMT):c.626C>T (p.Thr209Met) rs17851582
NM_000157.4(GBA):c.1093G>A (p.Glu365Lys) rs2230288
NM_000157.4(GBA):c.1223C>T (p.Thr408Met) rs75548401
NM_000157.4(GBA):c.667T>C (p.Trp223Arg) rs61748906
NM_000158.4(GBE1):c.118C>A (p.Pro40Thr) rs35196441
NM_000158.4(GBE1):c.143+10G>T rs9820490
NM_000158.4(GBE1):c.1519A>G (p.Thr507Ala) rs2228389
NM_000158.4(GBE1):c.1716C>T (p.Asp572=) rs2229520
NM_000158.4(GBE1):c.176T>C (p.Ile59Thr) rs28763904
NM_000158.4(GBE1):c.2017G>A (p.Ala673Thr) rs193074572
NM_000158.4(GBE1):c.839G>A (p.Gly280Asp) rs28763902
NM_000159.4(GCDH):c.1167G>A (p.Leu389=) rs398123191
NM_000161.3(GCH1):c.211C>T (p.Leu71=) rs141883031
NM_000162.5(GCK):c.1253+8C>T rs2908274
NM_000162.5(GCK):c.209-8G>A rs144798843
NM_000162.5(GCK):c.31G>A (p.Ala11Thr) rs116093166
NM_000162.5(GCK):c.333C>T (p.Pro111=) rs61736250
NM_000162.5(GCK):c.339C>T (p.Asp113=) rs149412035
NM_000162.5(GCK):c.46-12C>T rs142829768
NM_000162.5(GCK):c.645C>T (p.Tyr215=) rs144723656
NM_000162.5(GCK):c.954G>C (p.Gly318=) rs145764627
NM_000163.5(GHR):c.1098A>G (p.Leu366=) rs116466139
NM_000163.5(GHR):c.1473C>T (p.Ser491=) rs6176
NM_000163.5(GHR):c.1630A>C (p.Ile544Leu) rs6180
NM_000163.5(GHR):c.195A>G (p.Ser65=) rs140501920
NM_000163.5(GHR):c.785-9G>A rs34190075
NM_000165.5(GJA1):c.717G>A (p.Arg239=) rs57946868
NM_000165.5(GJA1):c.758C>T (p.Ala253Val) rs17653265
NM_000168.6(GLI3):c.*30G>T rs77886553
NM_000168.6(GLI3):c.1029-11C>T rs116195563
NM_000168.6(GLI3):c.1029-22dup rs559579130
NM_000168.6(GLI3):c.1243-40A>C rs77659679
NM_000168.6(GLI3):c.1357-17C>G rs190600888
NM_000168.6(GLI3):c.1393G>C (p.Gly465Arg) rs35488756
NM_000168.6(GLI3):c.1509C>T (p.Asn503=) rs34020684
NM_000168.6(GLI3):c.2165A>G (p.Asn722Ser) rs146130351
NM_000168.6(GLI3):c.2373G>A (p.Pro791=) rs61754622
NM_000168.6(GLI3):c.2826G>C (p.Pro942=) rs34245321
NM_000168.6(GLI3):c.2835G>C (p.Leu945=) rs61758978
NM_000168.6(GLI3):c.3083G>T (p.Ser1028Ile) rs79049330
NM_000168.6(GLI3):c.3084C>T (p.Ser1028=) rs79703713
NM_000168.6(GLI3):c.3774C>G (p.Leu1258=) rs35448119
NM_000168.6(GLI3):c.3894G>A (p.Pro1298=) rs530418832
NM_000168.6(GLI3):c.4007G>A (p.Gly1336Glu) rs35280470
NM_000168.6(GLI3):c.4020C>T (p.Pro1340=) rs35139358
NM_000168.6(GLI3):c.4609C>T (p.Arg1537Cys) rs35364414
NM_000168.6(GLI3):c.840C>G (p.Ser280=) rs77084911
NM_000169.2(GLA):c.-12G>A rs3027585
NM_000169.2(GLA):c.937G>T (p.Asp313Tyr) rs28935490
NM_000169.2(GLA):c.978G>A (p.Lys326=) rs151195362
NM_000170.2(GLDC):c.1229G>A (p.Arg410Lys) rs144090917
NM_000170.2(GLDC):c.1545G>A (p.Arg515=) rs121964976
NM_000170.2(GLDC):c.2316-13dup rs3215923
NM_000170.2(GLDC):c.2380G>A (p.Ala794Thr) rs141933811
NM_000170.2(GLDC):c.319A>G (p.Met107Val) rs138454333
NM_000170.2(GLDC):c.498T>C (p.Pro166=) rs150193069
NM_000173.7(GP1BA):c.1311_1349del (p.415_427SEPAPSPTTPEPT[2]) rs770991996
NM_000173.7(GP1BA):c.1321_1359del (p.415_427SEPAPSPTTPEPT[2]) rs1259394995
NM_000173.7(GP1BA):c.482C>T (p.Thr161Met) rs6065
NM_000174.4(GP9):c.132G>A (p.Thr44=) rs6069
NM_000179.2(MSH6):c.1050C>T (p.Ala350=) rs730881802
NM_000179.2(MSH6):c.1164C>T (p.His388=) rs55708305
NM_000179.2(MSH6):c.116G>A (p.Gly39Glu) rs1042821
NM_000179.2(MSH6):c.1186C>G (p.Leu396Val) rs2020908
NM_000179.2(MSH6):c.1449G>T (p.Val483=) rs35590297
NM_000179.2(MSH6):c.1474A>G (p.Met492Val) rs61754783
NM_000179.2(MSH6):c.1508C>G (p.Ser503Cys) rs63750897
NM_000179.2(MSH6):c.178T>C (p.Leu60=) rs35819209
NM_000179.2(MSH6):c.186C>A (p.Arg62=) rs1042820
NM_000179.2(MSH6):c.2006T>C (p.Ile669Thr) rs555209664
NM_000179.2(MSH6):c.2239C>T (p.Leu747=) rs63751305
NM_000179.2(MSH6):c.2253T>C (p.Asn751=) rs2020913
NM_000179.2(MSH6):c.2272C>T (p.Leu758=) rs56371757
NM_000179.2(MSH6):c.2319C>T (p.Leu773=) rs63749895
NM_000179.2(MSH6):c.2398G>C (p.Val800Leu) rs61748083
NM_000179.2(MSH6):c.2412A>G (p.Lys804=) rs201460265
NM_000179.2(MSH6):c.2561A>T (p.Lys854Met) rs34374438
NM_000179.2(MSH6):c.2633T>C (p.Val878Ala) rs2020912
NM_000179.2(MSH6):c.276A>G (p.Pro92=) rs1800932
NM_000179.2(MSH6):c.2940A>G (p.Glu980=) rs730881818
NM_000179.2(MSH6):c.3151G>A (p.Val1051Ile) rs576269342
NM_000179.2(MSH6):c.3162C>T (p.Ile1054=) rs149605979
NM_000179.2(MSH6):c.3173-18T>A rs189672273
NM_000179.2(MSH6):c.3203G>A (p.Arg1068Gln) rs398123230
NM_000179.2(MSH6):c.3217C>T (p.Pro1073Ser) rs142254875
NM_000179.2(MSH6):c.3245C>T (p.Pro1082Leu) rs191109849
NM_000179.2(MSH6):c.3246G>T (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3306T>A (p.Thr1102=) rs2020910
NM_000179.2(MSH6):c.33C>G (p.Phe11Leu) rs747802641
NM_000179.2(MSH6):c.3438+11_3438+14del rs377746844
NM_000179.2(MSH6):c.3438+14A>T rs2020911
NM_000179.2(MSH6):c.3439-16C>T rs192614006
NM_000179.2(MSH6):c.3478G>A (p.Val1160Ile) rs376799914
NM_000179.2(MSH6):c.3488A>T (p.Glu1163Val) rs63750252
NM_000179.2(MSH6):c.3727A>T (p.Thr1243Ser) rs147453999
NM_000179.2(MSH6):c.3801+17T>C rs3136365
NM_000179.2(MSH6):c.38A>G (p.Lys13Arg) rs41294988
NM_000179.2(MSH6):c.3911G>A (p.Arg1304Lys) rs34625968
NM_000179.2(MSH6):c.3961A>G (p.Arg1321Gly) rs41295278
NM_000179.2(MSH6):c.4001+2TAAC[2] rs267608132
NM_000179.2(MSH6):c.431G>T (p.Ser144Ile) rs3211299
NM_000179.2(MSH6):c.457+13A>G rs1800933
NM_000179.2(MSH6):c.540T>C (p.Asp180=) rs1800935
NM_000179.2(MSH6):c.628-7C>A rs373129248
NM_000179.2(MSH6):c.642C>T (p.Tyr214=) rs1800937
NM_000179.2(MSH6):c.663A>C (p.Glu221Asp) rs41557217
NM_000180.3(GUCY2D):c.154G>T (p.Ala52Ser) rs61749665
NM_000180.3(GUCY2D):c.2101C>T (p.Pro701Ser) rs34598902
NM_000180.3(GUCY2D):c.61T>C (p.Trp21Arg) rs9905402
NM_000181.4(GUSB):c.1740C>T (p.Tyr580=) rs1061361
NM_000190.4(HMBS):c.606G>T (p.Val202=) rs1131488
NM_000192.3(TBX5):c.331G>T (p.Asp111Tyr) rs77357563
NM_000192.3(TBX5):c.663+36G>T rs2236017
NM_000193.4(SHH):c.570G>A (p.Ser190=) rs9333633
NM_000193.4(SHH):c.876G>A (p.Gly292=) rs112055654
NM_000195.5(HPS1):c.*12C>T rs112544050
NM_000195.5(HPS1):c.11T>C (p.Val4Ala) rs58548334
NM_000195.5(HPS1):c.1397+7_1397+8delinsCT rs886038270
NM_000195.5(HPS1):c.1472C>G (p.Pro491Arg) rs2296434
NM_000195.5(HPS1):c.1527C>G (p.Leu509=) rs17109850
NM_000195.5(HPS1):c.1683C>T (p.Cys561=) rs112337765
NM_000195.5(HPS1):c.1808A>G (p.Gln603Arg) rs2296436
NM_000195.5(HPS1):c.2052C>T (p.Ala684=) rs576260502
NM_000195.5(HPS1):c.297C>T (p.Thr99=) rs11539873
NM_000195.5(HPS1):c.678C>T (p.Ala226=) rs539822608
NM_000195.5(HPS1):c.847G>T (p.Gly283Trp) rs11592273
NM_000195.5(HPS1):c.987+13T>C rs12571249
NM_000199.5(SGSH):c.1002C>T (p.Ala334=) rs145596938
NM_000199.5(SGSH):c.1081G>A (p.Val361Ile) rs9894254
NM_000199.5(SGSH):c.1116G>A (p.Met372Ile) rs58786455
NM_000199.5(SGSH):c.1182G>T (p.Met394Ile) rs34297805
NM_000203.5(IDUA):c.1081G>A (p.Ala361Thr) rs6831280
NM_000203.5(IDUA):c.1230C>G (p.Thr410=) rs115790973
NM_000203.5(IDUA):c.1403-14G>T rs368368416
NM_000203.5(IDUA):c.246C>G (p.His82Gln) rs148775298
NM_000203.5(IDUA):c.299+6C>T rs147498923
NM_000203.5(IDUA):c.314G>A (p.Arg105Gln) rs3755955
NM_000203.5(IDUA):c.352C>T (p.Leu118=) rs3755954
NM_000207.3(INS):c.*9C>T rs3842752
NM_000207.3(INS):c.-9C>T rs5505
NM_000209.4(PDX1):c.226G>A (p.Asp76Asn) rs137852783
NM_000209.4(PDX1):c.285G>A (p.Pro95=) rs797045885
NM_000212.2(ITGB3):c.-7G>C rs117052258
NM_000212.2(ITGB3):c.176T>C (p.Leu59Pro) rs5918
NM_000212.2(ITGB3):c.342T>C (p.Ile114=) rs5920
NM_000214.3(JAG1):c.1349-11T>G rs80338240
NM_000214.3(JAG1):c.1578C>T (p.Ile526=) rs1801139
NM_000214.3(JAG1):c.2612C>G (p.Pro871Arg) rs35761929
NM_000214.3(JAG1):c.267G>A (p.Gly89=) rs1051415
NM_000214.3(JAG1):c.270G>T (p.Gly90=) rs114048678
NM_000214.3(JAG1):c.2766C>T (p.Asp922=) rs2229895
NM_000214.3(JAG1):c.2810G>A (p.Arg937Gln) rs145895196
NM_000214.3(JAG1):c.294C>T (p.Ser98=) rs79338570
NM_000214.3(JAG1):c.436G>A (p.Val146Ile) rs6040067
NM_000214.3(JAG1):c.588C>T (p.Cys196=) rs1801138
NM_000214.3(JAG1):c.744A>G (p.Pro248=) rs10485741
NM_000214.3(JAG1):c.765C>T (p.Tyr255=) rs1131695
NM_000214.3(JAG1):c.924C>T (p.Asn308=) rs45575136
NM_000222.2(KIT):c.-14T>A rs140909964
NM_000222.2(KIT):c.1119C>T (p.Tyr373=) rs72549293
NM_000222.2(KIT):c.1621A>C (p.Met541Leu) rs3822214
NM_000222.2(KIT):c.1638A>G (p.Lys546=) rs55986963
NM_000222.2(KIT):c.2394C>T (p.Ile798=) rs55789615
NM_000222.2(KIT):c.252G>T (p.Thr84=) rs56411694
NM_000222.2(KIT):c.2586G>C (p.Leu862=) rs3733542
NM_000222.2(KIT):c.2805T>A (p.Ile935=) rs72549296
NM_000228.3(LAMB3):c.332A>G (p.Asp111Gly) rs55824996
NM_000231.2(SGCG):c.*10G>A rs139369964
NM_000231.2(SGCG):c.*13C>T rs9510701
NM_000231.2(SGCG):c.102C>T (p.Arg34=) rs140810408
NM_000231.2(SGCG):c.228T>C (p.Asp76=) rs1800350
NM_000231.2(SGCG):c.347G>A (p.Arg116His) rs17314986
NM_000231.2(SGCG):c.435C>T (p.Asn145=) rs35628352
NM_000231.2(SGCG):c.579-22G>T rs111358030
NM_000231.2(SGCG):c.705T>C (p.Leu235=) rs1800353
NM_000232.4(SGCB):c.92G>T (p.Ser31Ile) rs115928999
NM_000232.4(SGCB):c.943G>A (p.Gly315Arg) rs150395645
NM_000235.4(LIPA):c.67G>A (p.Gly23Arg) rs1051339
NM_000243.2(MEFV):c.1105C>T (p.Pro369Ser) rs11466023
NM_000243.2(MEFV):c.1223G>A (p.Arg408Gln) rs11466024
NM_000243.2(MEFV):c.1422G>A (p.Glu474=) rs224208
NM_000243.2(MEFV):c.1428A>G (p.Gln476=) rs224207
NM_000243.2(MEFV):c.1530T>C (p.Asp510=) rs224206
NM_000243.2(MEFV):c.1760-4G>A rs79662406
NM_000243.2(MEFV):c.2118G>A (p.Pro706=) rs2234939
NM_000243.2(MEFV):c.306T>C (p.Asp102=) rs224225
NM_000243.2(MEFV):c.414A>G (p.Gly138=) rs224224
NM_000243.2(MEFV):c.442G>C (p.Glu148Gln) rs3743930
NM_000243.2(MEFV):c.495C>A (p.Ala165=) rs224223
NM_000243.2(MEFV):c.605G>A (p.Arg202Gln) rs224222
NM_000243.2(MEFV):c.942C>T (p.Arg314=) rs224213
NM_000244.3(MEN1):c.-22C>A rs374749001
NM_000244.3(MEN1):c.1018C>A (p.Arg340=) rs371364206
NM_000244.3(MEN1):c.1064+9C>T rs200517349
NM_000244.3(MEN1):c.1269C>T (p.Asp423=) rs2071313
NM_000244.3(MEN1):c.1311G>A (p.Leu437=) rs138770431
NM_000244.3(MEN1):c.1366-4C>T rs764408631
NM_000244.3(MEN1):c.1424C>T (p.Pro475Leu) rs750112288
NM_000244.3(MEN1):c.1653G>A (p.Pro551=) rs368783097
NM_000244.3(MEN1):c.30G>T (p.Leu10=) rs371192390
NM_000244.3(MEN1):c.435C>T (p.Ser145=) rs61736636
NM_000244.3(MEN1):c.527G>A (p.Arg176Gln) rs607969
NM_000244.3(MEN1):c.612C>T (p.His204=) rs150512958
NM_000244.3(MEN1):c.669+18C>T rs180737290
NM_000244.3(MEN1):c.670-6C>T rs77461664
NM_000248.3(MITF):c.559+9C>G rs181810413
NM_000248.3(MITF):c.952G>A (p.Glu318Lys) rs149617956
NM_000249.3(MLH1):c.-117G>T rs565891017
NM_000249.3(MLH1):c.-42C>T rs41285097
NM_000249.3(MLH1):c.-93G>A rs1800734
NM_000249.3(MLH1):c.1050A>G (p.Pro350=) rs137937003
NM_000249.3(MLH1):c.1151T>A (p.Val384Asp) rs63750447
NM_000249.3(MLH1):c.1217G>A (p.Ser406Asn) rs41294980
NM_000249.3(MLH1):c.1321G>A (p.Ala441Thr) rs63750365
NM_000249.3(MLH1):c.1410-54C>T rs7633154
NM_000249.3(MLH1):c.1558+14G>A rs41562513
NM_000249.3(MLH1):c.1565G>A (p.Arg522Gln) rs63751630
NM_000249.3(MLH1):c.1668-19A>G rs9876116
NM_000249.3(MLH1):c.1732-19T>A rs77120160
NM_000249.3(MLH1):c.1808C>G (p.Pro603Arg) rs63750876
NM_000249.3(MLH1):c.1897-17C>G rs2308316
NM_000249.3(MLH1):c.1959G>T (p.Leu653=) rs1800146
NM_000249.3(MLH1):c.1963A>G (p.Ile655Val) rs55907433
NM_000249.3(MLH1):c.1989+1G>T rs267607879
NM_000249.3(MLH1):c.199G>A (p.Gly67Arg) rs63750206
NM_000249.3(MLH1):c.2146G>A (p.Val716Met) rs35831931
NM_000249.3(MLH1):c.2152C>T (p.His718Tyr) rs2020873
NM_000249.3(MLH1):c.222T>C (p.Asp74=) rs755073786
NM_000249.3(MLH1):c.375A>G (p.Ala125=) rs1800144
NM_000249.3(MLH1):c.394G>C (p.Asp132His) rs28930073
NM_000249.3(MLH1):c.474C>T (p.Asn158=) rs4647256
NM_000249.3(MLH1):c.588+11G>C rs4647258
NM_000249.3(MLH1):c.589-15C>T rs55658850
NM_000249.3(MLH1):c.637G>A (p.Val213Met) rs2308317
NM_000249.3(MLH1):c.655A>G (p.Ile219Val) rs1799977
NM_000249.3(MLH1):c.790+10A>G rs182733777
NM_000249.3(MLH1):c.885-21TC[2] rs267607804
NM_000249.3(MLH1):c.977T>C (p.Val326Ala) rs63751049
NM_000251.2(MSH2):c.-118T>C rs2303425
NM_000251.2(MSH2):c.-179C>T rs17224094
NM_000251.2(MSH2):c.-185C>A rs188036046
NM_000251.2(MSH2):c.1077-10T>C rs17224360
NM_000251.2(MSH2):c.1168C>T (p.Leu390Phe) rs17224367
NM_000251.2(MSH2):c.1277-16T>C rs368653974
NM_000251.2(MSH2):c.1356A>G (p.Glu452=) rs63751212
NM_000251.2(MSH2):c.1387-8G>T rs187525243
NM_000251.2(MSH2):c.1461C>G (p.Asp487Glu) rs35107951
NM_000251.2(MSH2):c.1511-9A>T rs12998837
NM_000251.2(MSH2):c.1661+12G>A rs3732183
NM_000251.2(MSH2):c.1661+17T>G rs377461923
NM_000251.2(MSH2):c.1662-9G>A rs17218356
NM_000251.2(MSH2):c.1666T>C (p.Leu556=) rs61756466
NM_000251.2(MSH2):c.1737A>G (p.Lys579=) rs61756467
NM_000251.2(MSH2):c.1748A>G (p.Asn583Ser) rs201118107
NM_000251.2(MSH2):c.1787A>G (p.Asn596Ser) rs41295288
NM_000251.2(MSH2):c.1886A>G (p.Gln629Arg) rs61756468
NM_000251.2(MSH2):c.1963G>A (p.Val655Ile) rs549467183
NM_000251.2(MSH2):c.2006-4G>A rs369853630
NM_000251.2(MSH2):c.2006-6T>C rs2303428
NM_000251.2(MSH2):c.2043A>G (p.Gln681=) rs730881763
NM_000251.2(MSH2):c.211+9C>G rs2303426
NM_000251.2(MSH2):c.2154A>G (p.Gln718=) rs63750810
NM_000251.2(MSH2):c.2205C>T (p.Ile735=) rs533553381
NM_000251.2(MSH2):c.23C>T (p.Thr8Met) rs17217716
NM_000251.2(MSH2):c.2500G>A (p.Ala834Thr) rs63750757
NM_000251.2(MSH2):c.2732T>G (p.Leu911Arg) rs41295182
NM_000251.2(MSH2):c.2766T>C (p.Phe922=) rs55859129
NM_000251.2(MSH2):c.279_281delTCT rs267607919
NM_000251.2(MSH2):c.339G>A (p.Lys113=) rs35898375
NM_000251.2(MSH2):c.366+4A>C rs876659880
NM_000251.2(MSH2):c.380A>G (p.Asn127Ser) rs17217772
NM_000251.2(MSH2):c.409G>C (p.Gly137Arg) rs587781795
NM_000251.2(MSH2):c.435T>G (p.Ile145Met) rs63750124
NM_000251.2(MSH2):c.471C>A (p.Gly157=) rs61756463
NM_000251.2(MSH2):c.471C>T (p.Gly157=) rs61756463
NM_000251.2(MSH2):c.55T>C (p.Phe19Leu) rs141711342
NM_000251.2(MSH2):c.573C>T (p.Leu191=) rs1800151
NM_000251.2(MSH2):c.815C>T (p.Ala272Val) rs34136999
NM_000251.2(MSH2):c.819A>G (p.Val273=) rs146577635
NM_000251.2(MSH2):c.965G>A (p.Gly322Asp) rs4987188
NM_000251.2(MSH2):c.984C>T (p.Ala328=) rs4987189
NM_000252.2(MTM1):c.1260+3G>A rs222410
NM_000255.4(MMUT):c.1495G>A (p.Ala499Thr) rs2229385
NM_000255.4(MMUT):c.1595G>A (p.Arg532His) rs1141321
NM_000255.4(MMUT):c.711A>G (p.Pro237=) rs138085432
NM_000256.3(MYBPC3):c.1144C>T (p.Arg382Trp) rs11570076
NM_000256.3(MYBPC3):c.1519G>A (p.Gly507Arg) rs35736435
NM_000256.3(MYBPC3):c.1608T>A (p.Ala536=) rs200224422
NM_000256.3(MYBPC3):c.2498C>T (p.Ala833Val) rs3729952
NM_000256.3(MYBPC3):c.2547C>T (p.Val849=) rs3729953
NM_000256.3(MYBPC3):c.2601C>T (p.Ile867=) rs11570097
NM_000256.3(MYBPC3):c.2737+12C>T rs3729936
NM_000256.3(MYBPC3):c.3288G>A (p.Glu1096=) rs1052373
NM_000256.3(MYBPC3):c.3699G>A (p.Gln1233=) rs200162906
NM_000256.3(MYBPC3):c.472G>A (p.Val158Met) rs3729986
NM_000256.3(MYBPC3):c.492C>T (p.Gly164=) rs3218719
NM_000256.3(MYBPC3):c.506-12del rs11570050
NM_000256.3(MYBPC3):c.537C>T (p.Ala179=) rs11570051
NM_000256.3(MYBPC3):c.706A>G (p.Ser236Gly) rs3729989
NM_000256.3(MYBPC3):c.786C>T (p.Thr262=) rs11570058
NM_000257.4(MYH7):c.*20G>A rs45548631
NM_000257.4(MYH7):c.1002C>T (p.Asn334=) rs34803781
NM_000257.4(MYH7):c.1062C>T (p.Gly354=) rs735712
NM_000257.4(MYH7):c.1408-42del rs45490796
NM_000257.4(MYH7):c.1767C>T (p.Asn589=) rs3729816
NM_000257.4(MYH7):c.2162+4G>A rs145738465
NM_000257.4(MYH7):c.3036C>T (p.Ala1012=) rs145379951
NM_000257.4(MYH7):c.3153G>A (p.Ala1051=) rs45540831
NM_000257.4(MYH7):c.3337-4dup rs45504498
NM_000257.4(MYH7):c.3351G>A (p.Glu1117=) rs45554236
NM_000257.4(MYH7):c.3853+7C>T rs45467397
NM_000257.4(MYH7):c.3918C>T (p.Leu1306=) rs144420313
NM_000257.4(MYH7):c.3972+15C>T rs3729820
NM_000257.4(MYH7):c.4239G>A (p.Ser1413=) rs3729821
NM_000257.4(MYH7):c.4353+10G>A rs202205780
NM_000257.4(MYH7):c.4452C>T (p.Leu1484=) rs61737803
NM_000257.4(MYH7):c.4472C>G (p.Ser1491Cys) rs3729823
NM_000257.4(MYH7):c.4566T>C (p.Thr1522=) rs2754155
NM_000257.4(MYH7):c.4716C>T (p.Ile1572=) rs7140196
NM_000257.4(MYH7):c.4806C>T (p.Asp1602=) rs142034311
NM_000257.4(MYH7):c.480C>T (p.Asn160=) rs45500700
NM_000257.4(MYH7):c.5283+19C>T rs45582836
NM_000257.4(MYH7):c.5519T>C (p.Met1840Thr) rs149193520
NM_000257.4(MYH7):c.5736C>T (p.Ile1912=) rs200728597
NM_000257.4(MYH7):c.597A>G (p.Ala199=) rs2069541
NM_000257.4(MYH7):c.895+12C>A rs186276057
NM_000257.4(MYH7):c.975C>T (p.Asp325=) rs2231124
NM_000258.2(MYL3):c.69C>T (p.Pro23=) rs2233264
NM_000259.3(MYO5A):c.2814G>A (p.Glu938=) rs190656197
NM_000259.3(MYO5A):c.3207C>T (p.Leu1069=) rs183302379
NM_000259.3(MYO5A):c.696T>C (p.Tyr232=) rs148997257
NM_000260.4(MYO7A):c.1343+8G>A rs2276278
NM_000260.4(MYO7A):c.1726G>A (p.Asp576Asn) rs187165412
NM_000260.4(MYO7A):c.288G>A (p.Thr96=) rs56023295
NM_000260.4(MYO7A):c.3828G>A (p.Ser1276=) rs78871677
NM_000260.4(MYO7A):c.448C>A (p.Arg150=) rs121965079
NM_000260.4(MYO7A):c.4589C>T (p.Ser1530Leu) rs111033183
NM_000260.4(MYO7A):c.468C>T (p.Ile156=) rs12420129
NM_000260.4(MYO7A):c.47T>C (p.Leu16Ser) rs1052030
NM_000260.4(MYO7A):c.5326+13C>T rs114157944
NM_000260.4(MYO7A):c.6559-11C>T rs34517202
NM_000260.4(MYO7A):c.93C>T (p.Cys31=) rs35689081
NM_000261.2(MYOC):c.227G>A (p.Arg76Lys) rs2234926
NM_000267.3(NF1):c.1032A>G (p.Leu344=) rs199832006
NM_000267.3(NF1):c.1137C>T (p.Cys379=) rs139648455
NM_000267.3(NF1):c.168C>T (p.Ser56=) rs17881168
NM_000267.3(NF1):c.1810T>C (p.Leu604=) rs142712751
NM_000267.3(NF1):c.1846-12A>T rs188510882
NM_000267.3(NF1):c.1994C>T (p.Ser665Phe) rs145891889
NM_000267.3(NF1):c.2022C>T (p.Ser674=) rs2230851
NM_000267.3(NF1):c.2034G>A (p.Pro678=) rs2285892
NM_000267.3(NF1):c.2191C>T (p.Leu731Phe) rs185204667
NM_000267.3(NF1):c.2544G>A (p.Gly848=) rs17883704
NM_000267.3(NF1):c.2585C>G (p.Thr862Ser) rs200302954
NM_000267.3(NF1):c.2985G>C (p.Leu995=) rs17881467
NM_000267.3(NF1):c.3197+9dup rs755212937
NM_000267.3(NF1):c.3270A>C (p.Gly1090=) rs150015024
NM_000267.3(NF1):c.340C>T (p.Leu114=) rs7207410
NM_000267.3(NF1):c.3468C>T (p.Asn1156=) rs147955381
NM_000267.3(NF1):c.3496+19T>C rs9890283
NM_000267.3(NF1):c.3498C>T (p.Gly1166=) rs2066733
NM_000267.3(NF1):c.369C>G (p.Thr123=) rs146691765
NM_000267.3(NF1):c.3867C>T (p.Phe1289=) rs138186428
NM_000267.3(NF1):c.4111-8_4111-6del rs751729752
NM_000267.3(NF1):c.4206A>G (p.Glu1402=) rs17886566
NM_000267.3(NF1):c.4514+12C>T rs17878332
NM_000267.3(NF1):c.4661+11A>G rs368649260
NM_000267.3(NF1):c.4686A>G (p.Glu1562=) rs144091165
NM_000267.3(NF1):c.4772+36T>C rs16972128
NM_000267.3(NF1):c.4819T>C (p.Leu1607=) rs10512435
NM_000267.3(NF1):c.4866G>A (p.Val1622=) rs17880521
NM_000267.3(NF1):c.4972A>G (p.Ile1658Val) rs147327414
NM_000267.3(NF1):c.4986C>T (p.Asn1662=) rs140994965
NM_000267.3(NF1):c.5172G>A (p.Lys1724=) rs17887014
NM_000267.3(NF1):c.528T>A (p.Asp176Glu) rs112306990
NM_000267.3(NF1):c.6084+8C>G rs182709912
NM_000267.3(NF1):c.6330C>T (p.His2110=) rs17881788
NM_000267.3(NF1):c.655-29T>C rs182325576
NM_000267.3(NF1):c.6859-14_6859-13del rs146785663
NM_000267.3(NF1):c.6866C>T (p.Pro2289Leu) rs148736217
NM_000267.3(NF1):c.702G>A (p.Leu234=) rs1801052
NM_000267.3(NF1):c.7127-33TTGT[3] rs149197458
NM_000267.3(NF1):c.7127-5del rs769290414
NM_000267.3(NF1):c.731-6A>C rs369366499
NM_000267.3(NF1):c.7398A>G (p.Thr2466=) rs149924365
NM_000267.3(NF1):c.7521A>G (p.Gln2507=) rs55865524
NM_000267.3(NF1):c.7532C>T (p.Ala2511Val) rs148154172
NM_000267.3(NF1):c.7692C>T (p.Ser2564=) rs17881980
NM_000267.3(NF1):c.7807-13dup rs369360556
NM_000267.3(NF1):c.7847G>A (p.Arg2616Gln) rs560262404
NM_000267.3(NF1):c.8088G>A (p.Pro2696=) rs2285895
NM_000267.3(NF1):c.8436T>C (p.Asn2812=) rs142636150
NM_000267.3(NF1):c.846G>A (p.Gln282=) rs138840528
NM_000271.5(NPC1):c.1926G>C (p.Met642Ile) rs1788799
NM_000271.5(NPC1):c.1947+14G>T rs3745024
NM_000271.5(NPC1):c.2073G>A (p.Pro691=) rs113013085
NM_000271.5(NPC1):c.2572A>G (p.Ile858Val) rs1805082
NM_000271.5(NPC1):c.2793C>T (p.Asn931=) rs1140458
NM_000271.5(NPC1):c.3198C>T (p.Thr1066=) rs145145840
NM_000271.5(NPC1):c.3217G>A (p.Gly1073Ser) rs141440861
NM_000271.5(NPC1):c.3561G>T (p.Ala1187=) rs55724504
NM_000271.5(NPC1):c.3797G>A (p.Arg1266Gln) rs1805084
NM_000271.5(NPC1):c.387T>C (p.Tyr129=) rs12970899
NM_000271.5(NPC1):c.612C>T (p.Thr204=) rs151084683
NM_000271.5(NPC1):c.644A>G (p.His215Arg) rs1805081
NM_000271.5(NPC1):c.665A>G (p.Asn222Ser) rs55680026
NM_000271.5(NPC1):c.66A>G (p.Ser22=) rs144415945
NM_000271.5(NPC1):c.709C>T (p.Pro237Ser) rs80358251
NM_000272.4(NPHP1):c.115C>A (p.Pro39Thr) rs33958626
NM_000272.4(NPHP1):c.133A>C (p.Ile45Leu) rs145479679
NM_000272.4(NPHP1):c.1437+9G>A rs13414551
NM_000272.4(NPHP1):c.14G>T (p.Arg5Leu) rs190983114
NM_000272.4(NPHP1):c.2081A>G (p.Gln694Arg) rs186950965
NM_000272.4(NPHP1):c.654G>A (p.Glu218=) rs11675767
NM_000272.4(NPHP1):c.689C>T (p.Ala230Val) rs113450177
NM_000272.4(NPHP1):c.810C>T (p.Cys270=) rs73954628
NM_000272.4(NPHP1):c.829C>A (p.Arg277=) rs367600757
NM_000272.4(NPHP1):c.940-17G>A rs146343637
NM_000273.3(GPR143):c.456-9G>C rs376437604
NM_000275.3(OCA2):c.1007C>T (p.Ala336Val) rs34010619
NM_000275.3(OCA2):c.1026C>T (p.Tyr342=) rs1800403
NM_000275.3(OCA2):c.1113C>T (p.Gly371=) rs1800405
NM_000275.3(OCA2):c.1256G>A (p.Arg419Gln) rs1800407
NM_000275.3(OCA2):c.1320G>C (p.Leu440Phe) rs1800408
NM_000275.3(OCA2):c.1441G>A (p.Ala481Thr) rs74653330
NM_000275.3(OCA2):c.144G>A (p.Ser48=) rs374819923
NM_000275.3(OCA2):c.1887G>T (p.Val629=) rs1800415
NM_000275.3(OCA2):c.2058A>C (p.Ala686=) rs1800416
NM_000275.3(OCA2):c.913C>T (p.Arg305Trp) rs1800401
NM_000276.4(OCRL):c.41C>T (p.Thr14Ile) rs61752970
NM_000277.3(PAH):c.*19G>T rs372637021
NM_000277.3(PAH):c.1242C>T (p.Tyr414=) rs1801152
NM_000277.3(PAH):c.1278T>C (p.Asn426=) rs59326968
NM_000280.4(PAX6):c.-129+9G>A rs56139994
NM_000282.4(PCCA):c.1423A>G (p.Ile475Val) rs35719359
NM_000282.4(PCCA):c.1429+7A>G rs16957276
NM_000282.4(PCCA):c.1651G>T (p.Val551Phe) rs61749895
NM_000282.4(PCCA):c.1745C>T (p.Ser582Leu) rs16957356
NM_000282.4(PCCA):c.24A>G (p.Thr8=) rs117397004
NM_000282.4(PCCA):c.627A>G (p.Ala209=) rs538229
NM_000287.4(PEX6):c.1646C>T (p.Ala549Val) rs115960224
NM_000287.4(PEX6):c.235G>C (p.Ala79Pro) rs61752141
NM_000287.4(PEX6):c.2364G>A (p.Val788=) rs2274515
NM_000287.4(PEX6):c.2936C>T (p.Ala979Val) rs115180949
NM_000287.4(PEX6):c.813G>T (p.Ala271=) rs35503676
NM_000288.4(PEX7):c.-31G>A rs115866467
NM_000288.4(PEX7):c.377A>C (p.Gln126Pro) rs113268723
NM_000289.6(PFKM):c.1342-14G>T rs56117548
NM_000289.6(PFKM):c.1500+32C>T rs41291967
NM_000289.6(PFKM):c.2087G>A (p.Arg696His) rs41291971
NM_000289.6(PFKM):c.246G>A (p.Thr82=) rs2228501
NM_000289.6(PFKM):c.306C>T (p.Ala102=) rs11552507
NM_000289.6(PFKM):c.747+24T>G rs149600978
NM_000292.3(PHKA2):c.112G>C (p.Glu38Gln) rs17313469
NM_000292.3(PHKA2):c.2077A>G (p.Ile693Val) rs143732206
NM_000292.3(PHKA2):c.742A>C (p.Arg248=) rs149219369
NM_000293.3(PHKB):c.1127-14A>G rs185628131
NM_000293.3(PHKB):c.1363+13G>T rs117536391
NM_000293.3(PHKB):c.1459-9G>T rs201995780
NM_000293.3(PHKB):c.2244C>G (p.Leu748=) rs34717357
NM_000293.3(PHKB):c.2309A>G (p.Tyr770Cys) rs16945474
NM_000293.3(PHKB):c.2453_2455AAG[2] (p.Glu820del) rs532057230
NM_000293.3(PHKB):c.318T>C (p.Asp106=) rs17738933
NM_000294.3(PHKG2):c.1137T>C (p.Pro379=) rs61731628
NM_000294.3(PHKG2):c.174A>T (p.Thr58=) rs56207641
NM_000294.3(PHKG2):c.288C>T (p.Ser96=) rs56029513
NM_000294.3(PHKG2):c.585G>A (p.Ala195=) rs187710792
NM_000294.3(PHKG2):c.96-10G>T rs74015042
NM_000295.5(SERPINA1):c.424C>T (p.Leu142=) rs20546
NM_000295.5(SERPINA1):c.840T>C (p.Asp280=) rs1049800
NM_000297.4(PKD2):c.1359A>G (p.Pro453=) rs17013754
NM_000297.4(PKD2):c.1445T>G (p.Phe482Cys) rs75762896
NM_000297.4(PKD2):c.1548+9G>C rs376901684
NM_000297.4(PKD2):c.1549-4T>C rs374450718
NM_000297.4(PKD2):c.1830G>A (p.Ala610=) rs144968710
NM_000297.4(PKD2):c.2398A>C (p.Met800Leu) rs2234917
NM_000297.4(PKD2):c.2420G>A (p.Arg807Gln) rs147654263
NM_000297.4(PKD2):c.420G>A (p.Gly140=) rs2728118
NM_000297.4(PKD2):c.444C>T (p.Gly148=) rs181704860
NM_000297.4(PKD2):c.568G>A (p.Ala190Thr) rs117078377
NM_000297.4(PKD2):c.570G>T (p.Ala190=) rs541702320
NM_000297.4(PKD2):c.83G>C (p.Arg28Pro) rs1805044
NM_000302.4(PLOD1):c.1534C>T (p.Arg512Cys) rs138490756
NM_000302.4(PLOD1):c.1632A>C (p.Ala544=) rs2230898
NM_000303.3(PMM2):c.324G>A (p.Ala108=) rs62031146
NM_000303.3(PMM2):c.590A>C (p.Glu197Ala) rs34258285
NM_000310.3(PPT1):c.401T>C (p.Ile134Thr) rs1800205
NM_000310.3(PPT1):c.837G>C (p.Gln279His) rs72937434
NM_000312.3(PROC):c.-50A>T rs1799810
NM_000312.3(PROC):c.423G>T (p.Ser141=) rs5936
NM_000312.3(PROC):c.768T>C (p.Asp256=) rs5937
NM_000314.6(PTEN):c.-1027C>A rs587781128
NM_000314.6(PTEN):c.165-13_165-10delGTTT rs786204877
NM_000314.7(PTEN):c.-975G>C rs587780001
NM_000314.7(PTEN):c.-9C>G rs11202592
NM_000314.7(PTEN):c.1104T>C (p.Asp368=) rs35979531
NM_000314.7(PTEN):c.132C>T (p.Gly44=) rs150651961
NM_000314.7(PTEN):c.210-39A>G rs370918174
NM_000314.7(PTEN):c.235G>A (p.Ala79Thr) rs202004587
NM_000314.7(PTEN):c.253+4_253+7del rs876659695
NM_000314.7(PTEN):c.651C>T (p.Val217=) rs886038278
NM_000314.7(PTEN):c.78C>T (p.Thr26=) rs786201280
NM_000318.3(PEX2):c.733G>A (p.Ala245Thr) rs112108739
NM_000321.2(RB1):c.1216-29A>G rs3092886
NM_000321.2(RB1):c.1390-11A>G rs200658795
NM_000321.2(RB1):c.1390-14A>T rs9535023
NM_000321.2(RB1):c.380+12T>C rs3092881
NM_000321.2(RB1):c.920C>T (p.Thr307Ile) rs183898408
NM_000322.5(PRPH2):c.*13C>T rs361524
NM_000322.5(PRPH2):c.-11A>C rs114062933
NM_000322.5(PRPH2):c.1013A>G (p.Asp338Gly) rs434102
NM_000322.5(PRPH2):c.318T>C (p.Val106=) rs7764439
NM_000322.5(PRPH2):c.801C>T (p.Val267=) rs189358082
NM_000322.5(PRPH2):c.910C>G (p.Gln304Glu) rs390659
NM_000322.5(PRPH2):c.929G>A (p.Arg310Lys) rs425876
NM_000325.6(PITX2):c.618T>G (p.Ser206=) rs35946364
NM_000328.3(RPGR):c.1059+6G>A rs377731326
NM_000328.3(RPGR):c.1245+6A>G rs886038281
NM_000328.3(RPGR):c.141T>G (p.Ser47=) rs62638631
NM_000328.3(RPGR):c.732G>A (p.Lys244=) rs62638654
NM_000328.3(RPGR):c.905G>C (p.Cys302Ser) rs62640590
NM_000329.3(RPE65):c.1056G>A (p.Glu352=) rs12145904
NM_000334.4(SCN4A):c.1100+7G>A rs200770684
NM_000334.4(SCN4A):c.1167T>C (p.Tyr389=) rs16947296
NM_000334.4(SCN4A):c.1606+20G>A rs73326363
NM_000334.4(SCN4A):c.2289C>T (p.Ile763=) rs76894284
NM_000334.4(SCN4A):c.2341G>A (p.Val781Ile) rs62070884
NM_000334.4(SCN4A):c.241G>C (p.Glu81Gln) rs111926172
NM_000334.4(SCN4A):c.2631T>C (p.Asp877=) rs79893125
NM_000334.4(SCN4A):c.2717G>C (p.Ser906Thr) rs41280102
NM_000334.4(SCN4A):c.2722G>A (p.Glu908Lys) rs117664682
NM_000334.4(SCN4A):c.2919C>T (p.Pro973=) rs73992419
NM_000334.4(SCN4A):c.2989+5G>A rs115695396
NM_000334.4(SCN4A):c.3441+7G>A rs142270113
NM_000334.4(SCN4A):c.366C>T (p.Arg122=) rs41280108
NM_000334.4(SCN4A):c.3720+10A>G rs111679484
NM_000334.4(SCN4A):c.3759C>T (p.Ala1253=) rs72851170
NM_000334.4(SCN4A):c.4017+15G>T rs77844100
NM_000334.4(SCN4A):c.403A>C (p.Met135Leu) rs148028364
NM_000334.4(SCN4A):c.4125C>T (p.Asp1375=) rs375607705
NM_000334.4(SCN4A):c.4215C>T (p.Leu1405=) rs141215137
NM_000334.4(SCN4A):c.4288+10G>T rs114059193
NM_000334.4(SCN4A):c.483-9C>A rs201552497
NM_000334.4(SCN4A):c.489C>G (p.Thr163=) rs146590697
NM_000334.4(SCN4A):c.4905C>T (p.Ile1635=) rs59081944
NM_000334.4(SCN4A):c.726C>T (p.Ala242=) rs73326368
NM_000334.4(SCN4A):c.92G>T (p.Arg31Leu) rs112142736
NM_000334.4(SCN4A):c.968C>T (p.Thr323Met) rs80338952
NM_000336.3(SCNN1B):c.1543-17C>T rs35074083
NM_000336.3(SCNN1B):c.1731C>T (p.Thr577=) rs61759923
NM_000336.3(SCNN1B):c.1782G>A (p.Thr594=) rs13306628
NM_000337.5(SGCD):c.213G>A (p.Arg71=) rs74846539
NM_000337.5(SGCD):c.290G>A (p.Arg97Gln) rs45559835
NM_000337.5(SGCD):c.294+8T>C rs11748588
NM_000337.5(SGCD):c.3+19C>T rs182715924
NM_000337.5(SGCD):c.69C>T (p.Tyr23=) rs397517923
NM_000339.3(SLC12A3):c.1023C>T (p.Phe341=) rs2229209
NM_000339.3(SLC12A3):c.1395C>T (p.Thr465=) rs5801
NM_000339.3(SLC12A3):c.1825+9C>A rs35797045
NM_000339.3(SLC12A3):c.1884G>A (p.Ser628=) rs5802
NM_000339.3(SLC12A3):c.2142C>T (p.Ala714=) rs5803
NM_000339.3(SLC12A3):c.2179-8C>T rs13306676
NM_000339.3(SLC12A3):c.2625C>T (p.Gly875=) rs5804
NM_000339.3(SLC12A3):c.2738G>A (p.Arg913Gln) rs11643718
NM_000339.3(SLC12A3):c.2748-13T>C rs34772420
NM_000339.3(SLC12A3):c.366A>G (p.Ala122=) rs2304479
NM_000340.2(SLC2A2):c.*8del (p.Ter525=) rs573575421
NM_000340.2(SLC2A2):c.1069-9T>C rs5407
NM_000340.2(SLC2A2):c.1437C>T (p.Phe479=) rs5398
NM_000340.2(SLC2A2):c.247G>A (p.Glu83Lys) rs150851401
NM_000340.2(SLC2A2):c.301G>A (p.Val101Ile) rs1800572
NM_000340.2(SLC2A2):c.329C>T (p.Thr110Ile) rs5400
NM_000340.2(SLC2A2):c.594G>A (p.Thr198=) rs5404
NM_000340.2(SLC2A2):c.661C>T (p.Leu221=) rs5405
NM_000342.3(SLC4A1):c.118G>A (p.Glu40Lys) rs45562031
NM_000342.4(SLC4A1):c.113A>C (p.Asp38Ala) rs5035
NM_000342.4(SLC4A1):c.1249C>T (p.Leu417=) rs5015
NM_000342.4(SLC4A1):c.1323G>A (p.Leu441=) rs5017
NM_000342.4(SLC4A1):c.16-14G>A rs145502796
NM_000342.4(SLC4A1):c.166A>G (p.Lys56Glu) rs5036
NM_000342.4(SLC4A1):c.1770G>A (p.Lys590=) rs35807245
NM_000342.4(SLC4A1):c.1953C>T (p.His651=) rs5021
NM_000342.4(SLC4A1):c.2561C>T (p.Pro854Leu) rs2285644
NM_000342.4(SLC4A1):c.2584G>A (p.Val862Ile) rs5026
NM_000342.4(SLC4A1):c.2688T>C (p.Asp896=) rs45497993
NM_000342.4(SLC4A1):c.2712C>T (p.Tyr904=) rs45519733
NM_000342.4(SLC4A1):c.539G>A (p.Arg180His) rs147390654
NM_000342.4(SLC4A1):c.924G>A (p.Leu308=) rs5013
NM_000350.3(ABCA4):c.1268A>G (p.His423Arg) rs3112831
NM_000350.3(ABCA4):c.1269C>T (p.His423=) rs4147831
NM_000350.3(ABCA4):c.2828G>A (p.Arg943Gln) rs1801581
NM_000350.3(ABCA4):c.3285C>T (p.Tyr1095=) rs570745701
NM_000350.3(ABCA4):c.4203C>A (p.Pro1401=) rs1801666
NM_000350.3(ABCA4):c.4203C>T (p.Pro1401=) rs1801666
NM_000350.3(ABCA4):c.5603A>T (p.Asn1868Ile) rs1801466
NM_000350.3(ABCA4):c.5682G>C (p.Leu1894=) rs1801574
NM_000350.3(ABCA4):c.5814A>G (p.Leu1938=) rs4147857
NM_000350.3(ABCA4):c.5836-11G>A rs1800739
NM_000350.3(ABCA4):c.5843C>T (p.Pro1948Leu) rs56142141
NM_000350.3(ABCA4):c.5844A>G (p.Pro1948=) rs2275029
NM_000350.3(ABCA4):c.6249C>T (p.Ile2083=) rs1801359
NM_000350.3(ABCA4):c.6282+7G>A rs17110761
NM_000350.3(ABCA4):c.635G>A (p.Arg212His) rs6657239
NM_000350.3(ABCA4):c.6529G>A (p.Asp2177Asn) rs1800555
NM_000350.3(ABCA4):c.6730-19G>A rs375179475
NM_000350.3(ABCA4):c.6732G>A (p.Val2244=) rs77293072
NM_000350.3(ABCA4):c.6764G>T (p.Ser2255Ile) rs6666652
NM_000353.3(TAT):c.309G>A (p.Ser103=) rs78302875
NM_000356.4(TCOF1):c.1347C>T (p.Pro449=) rs2071238
NM_000356.4(TCOF1):c.1530G>T (p.Gly510=) rs7701163
NM_000356.4(TCOF1):c.1611A>G (p.Ser537=) rs2071239
NM_000356.4(TCOF1):c.162A>G (p.Gln54=) rs73270831
NM_000356.4(TCOF1):c.1762G>C (p.Ala588Pro) rs2071240
NM_000356.4(TCOF1):c.2014C>T (p.Pro672Ser) rs73270846
NM_000356.4(TCOF1):c.2429T>C (p.Val810Ala) rs7713638
NM_000356.4(TCOF1):c.2531C>T (p.Pro844Leu) rs150515843
NM_000356.4(TCOF1):c.2534C>T (p.Ser845Leu) rs114689020
NM_000356.4(TCOF1):c.295G>A (p.Ala99Thr) rs112332762
NM_000356.4(TCOF1):c.3296C>G (p.Pro1099Arg) rs1136103
NM_000356.4(TCOF1):c.3370-3C>T rs11743855
NM_000356.4(TCOF1):c.3773A>G (p.Lys1258Arg) rs55980697
NM_000356.4(TCOF1):c.3938C>T (p.Ala1313Val) rs15251
NM_000356.4(TCOF1):c.4061G>C (p.Gly1354Ala) rs45491898
NM_000356.4(TCOF1):c.579G>A (p.Ala193=) rs142965998
NM_000358.3(TGFBI):c.1416C>T (p.Leu472=) rs1133170
NM_000358.3(TGFBI):c.1620T>C (p.Phe540=) rs4669
NM_000358.3(TGFBI):c.651G>C (p.Leu217=) rs1442
NM_000358.3(TGFBI):c.981A>G (p.Val327=) rs1054124
NM_000359.3(TGM1):c.1146C>A (p.Gly382=) rs1126432
NM_000359.3(TGM1):c.125C>A (p.Ser42Tyr) rs41295338
NM_000359.3(TGM1):c.1552G>A (p.Val518Met) rs35312232
NM_000359.3(TGM1):c.726G>A (p.Glu242=) rs35755034
NM_000360.4(TH):c.1200+9C>T rs11564717
NM_000360.4(TH):c.186G>A (p.Ser62=) rs34510659
NM_000360.4(TH):c.210T>C (p.Ala70=) rs7950050
NM_000360.4(TH):c.267G>A (p.Arg89=) rs76240471
NM_000363.5(TNNI3):c.-35C>A rs3729707
NM_000363.5(TNNI3):c.150+13G>A rs73617692
NM_000363.5(TNNI3):c.198G>A (p.Glu66=) rs3729710
NM_000363.5(TNNI3):c.204G>T (p.Arg68=) rs3729711
NM_000363.5(TNNI3):c.244C>T (p.Pro82Ser) rs77615401
NM_000363.5(TNNI3):c.25-8T>A rs3729836
NM_000363.5(TNNI3):c.373-10= rs7252610
NM_000363.5(TNNI3):c.537G>A (p.Glu179=) rs3729841
NM_000363.5(TNNI3):c.550-10C>T rs201240150
NM_000368.4(TSC1):c.-7C>T rs62621221
NM_000368.4(TSC1):c.106+15A>G rs80258442
NM_000368.4(TSC1):c.1079C>A (p.Thr360Asn) rs118203493
NM_000368.4(TSC1):c.1208C>T (p.Ser403Leu) rs118203504
NM_000368.4(TSC1):c.1218C>T (p.Tyr406=) rs373465241
NM_000368.4(TSC1):c.1335A>G (p.Glu445=) rs7862221
NM_000368.4(TSC1):c.1342C>T (p.Pro448Ser) rs118203518
NM_000368.4(TSC1):c.1700C>T (p.Ala567Val) rs397514880
NM_000368.4(TSC1):c.1701G>A (p.Ala567=) rs35478675
NM_000368.4(TSC1):c.1726T>C (p.Leu576=) rs118203567
NM_000368.4(TSC1):c.1760A>G (p.Lys587Arg) rs118203576
NM_000368.4(TSC1):c.1773G>A (p.Pro591=) rs146578402
NM_000368.4(TSC1):c.1874A>C (p.Glu625Ala) rs886038287
NM_000368.4(TSC1):c.1960C>G (p.Gln654Glu) rs75820036
NM_000368.4(TSC1):c.201A>G (p.Pro67=) rs371555137
NM_000368.4(TSC1):c.210+33G>A rs118203350
NM_000368.4(TSC1):c.2194C>T (p.His732Tyr) rs118203657
NM_000368.4(TSC1):c.2209-9C>G rs118203660
NM_000368.4(TSC1):c.2285A>G (p.Asn762Ser) rs118203670
NM_000368.4(TSC1):c.250G>A (p.Ala84Thr) rs118203357
NM_000368.4(TSC1):c.2646C>T (p.Ala882=) rs118203720
NM_000368.4(TSC1):c.273G>A (p.Ser91=) rs115097221
NM_000368.4(TSC1):c.2829C>T (p.Ala943=) rs4962081
NM_000368.4(TSC1):c.2865C>T (p.Thr955=) rs45468995
NM_000368.4(TSC1):c.3103G>A (p.Gly1035Ser) rs118203742
NM_000368.4(TSC1):c.3324C>T (p.Gly1108=) rs35593170
NM_000368.4(TSC1):c.379G>A (p.Val127Ile) rs372215435
NM_000368.4(TSC1):c.552G>C (p.Val184=) rs118203397
NM_000368.4(TSC1):c.615T>C (p.Ser205=) rs118203414
NM_000368.4(TSC1):c.810A>G (p.Ser270=) rs142336706
NM_000368.4(TSC1):c.876C>T (p.Val292=) rs116756594
NM_000368.4(TSC1):c.915G>C (p.Gly305=) rs397515293
NM_000368.4(TSC1):c.965T>C (p.Met322Thr) rs1073123
NM_000369.2(TSHR):c.106G>C (p.Asp36His) rs61747482
NM_000369.2(TSHR):c.1377G>A (p.Ala459=) rs113951800
NM_000369.2(TSHR):c.154C>A (p.Pro52Thr) rs2234919
NM_000369.2(TSHR):c.2181G>C (p.Glu727Asp) rs1991517
NM_000369.2(TSHR):c.545+13A>G rs2241119
NM_000369.2(TSHR):c.561T>C (p.Asn187=) rs2075179
NM_000371.3(TTR):c.336+19G>A rs75517067
NM_000372.5(TYR):c.114G>A (p.Pro38=) rs1939261
NM_000372.5(TYR):c.1205G>A (p.Arg402Gln) rs1126809
NM_000372.5(TYR):c.575C>A (p.Ser192Tyr) rs1042602
NM_000373.4(UMPS):c.638G>C (p.Gly213Ala) rs1801019
NM_000373.4(UMPS):c.88A>G (p.Ser30Gly) rs17843776
NM_000374.5(UROD):c.603A>G (p.Pro201=) rs2228084
NM_000377.2(WAS):c.1299G>A (p.Ala433=) rs372649110
NM_000377.2(WAS):c.273+10_273+11dup rs58371799
NM_000377.2(WAS):c.273+11dupC rs58371799
NM_000377.2(WAS):c.873C>T (p.Tyr291=) rs149123892
NM_000377.2(WAS):c.995T>C (p.Val332Ala) rs2737799
NM_000379.4(XDH):c.2107A>G (p.Ile703Val) rs17011368
NM_000379.4(XDH):c.3276+12A>G rs1366813
NM_000379.4(XDH):c.3717G>A (p.Glu1239=) rs207440
NM_000383.4(AIRE):c.1095+6G>A rs1800525
NM_000383.4(AIRE):c.1197T>C (p.Ala399=) rs1800521
NM_000383.4(AIRE):c.1411C>T (p.Arg471Cys) rs74203920
NM_000383.4(AIRE):c.1476C>T (p.Pro492=) rs72650679
NM_000383.4(AIRE):c.1567-5C>T rs192215705
NM_000383.4(AIRE):c.1578T>C (p.Asp526=) rs1133779
NM_000383.4(AIRE):c.588C>T (p.Ser196=) rs878081
NM_000383.4(AIRE):c.681C>T (p.Gly227=) rs1055311
NM_000383.4(AIRE):c.834C>G (p.Ser278Arg) rs1800520
NM_000383.4(AIRE):c.99T>C (p.Ala33=) rs3746964
NM_000384.3(APOB):c.10737C>T (p.Thr3579=) rs12713554
NM_000384.3(APOB):c.10913G>A (p.Arg3638Gln) rs1801701
NM_000384.3(APOB):c.11808C>T (p.Ile3936=) rs12720852
NM_000384.3(APOB):c.11904-7C>T rs12720851
NM_000384.3(APOB):c.12541G>A (p.Glu4181Lys) rs1042031
NM_000384.3(APOB):c.12697T>A (p.Ser4233Thr) rs61743299
NM_000384.3(APOB):c.12809G>C (p.Arg4270Thr) rs1801702
NM_000384.3(APOB):c.13013G>A (p.Ser4338Asn) rs1042034
NM_000384.3(APOB):c.13441G>A (p.Ala4481Thr) rs1801695
NM_000384.3(APOB):c.13451C>T (p.Thr4484Met) rs12713450
NM_000384.3(APOB):c.1594C>T (p.Arg532Trp) rs13306194
NM_000384.3(APOB):c.1853C>T (p.Ala618Val) rs679899
NM_000384.3(APOB):c.2188G>A (p.Val730Ile) rs12691202
NM_000384.3(APOB):c.2604+15G>C rs72653066
NM_000384.3(APOB):c.26_34TGGCGCTGC[1] (p.9_11LAL[1]) rs17240441
NM_000384.3(APOB):c.2706C>T (p.Asn902=) rs1801700
NM_000384.3(APOB):c.293C>T (p.Thr98Ile) rs1367117
NM_000384.3(APOB):c.3122-6G>A rs72653071
NM_000384.3(APOB):c.3337G>C (p.Asp1113His) rs12713844
NM_000384.3(APOB):c.3509-10G>A rs12720770
NM_000384.3(APOB):c.5741A>G (p.Asn1914Ser) rs1801699
NM_000384.3(APOB):c.5768A>G (p.His1923Arg) rs533617
NM_000384.3(APOB):c.6936_6937inv (p.Ile2313Val) rs1041968
NM_000384.3(APOB):c.7367C>A (p.Ala2456Asp) rs12713675
NM_000384.3(APOB):c.7545C>T (p.Thr2515=) rs693
NM_000384.3(APOB):c.7612C>T (p.Leu2538=) rs72653093
NM_000384.3(APOB):c.7696G>A (p.Glu2566Lys) rs1801696
NM_000384.3(APOB):c.8216C>T (p.Pro2739Leu) rs676210
NM_000384.3(APOB):c.8462C>T (p.Pro2821Leu) rs72653095
NM_000384.3(APOB):c.9835A>G (p.Ser3279Gly) rs12720854
NM_000384.3(APOB):c.9880T>C (p.Ser3294Pro) rs12720855
NM_000388.4(CASR):c.1285C>T (p.His429Tyr) rs142818334
NM_000388.4(CASR):c.1333A>G (p.Thr445Ala) rs12493789
NM_000388.4(CASR):c.1631G>A (p.Arg544Gln) rs115230894
NM_000388.4(CASR):c.1733-9A>G rs190731787
NM_000388.4(CASR):c.2956G>T (p.Ala986Ser) rs1801725
NM_000391.4(TPP1):c.1044C>T (p.Ala348=) rs35706972
NM_000391.4(TPP1):c.1266+5G>A rs1800753
NM_000391.4(TPP1):c.1494C>T (p.Pro498=) rs117942457
NM_000391.4(TPP1):c.1542A>T (p.Gly514=) rs1128396
NM_000391.4(TPP1):c.299A>G (p.Gln100Arg) rs1800746
NM_000391.4(TPP1):c.381-10dup rs146315473
NM_000391.4(TPP1):c.441A>G (p.Glu147=) rs2555170
NM_000391.4(TPP1):c.688-18C>T rs376868997
NM_000392.5(ABCC2):c.1446C>G (p.Thr482=) rs113646094
NM_000393.5(COL5A2):c.1006-9C>T rs73978832
NM_000393.5(COL5A2):c.1081A>C (p.Met361Leu) rs76148000
NM_000393.5(COL5A2):c.1104+15T>C rs75486409
NM_000393.5(COL5A2):c.1378C>T (p.Pro460Ser) rs35830636
NM_000393.5(COL5A2):c.1400C>T (p.Pro467Leu) rs115570272
NM_000393.5(COL5A2):c.1535T>C (p.Val512Ala) rs35852101
NM_000393.5(COL5A2):c.1618-19C>G rs189970491
NM_000393.5(COL5A2):c.198T>C (p.Asn66=) rs76511879
NM_000393.5(COL5A2):c.2032-7G>A rs141571092
NM_000393.5(COL5A2):c.2492G>C (p.Gly831Ala) rs141210030
NM_000393.5(COL5A2):c.2498C>T (p.Pro833Leu) rs116298748
NM_000393.5(COL5A2):c.249C>T (p.Ala83=) rs142388534
NM_000393.5(COL5A2):c.2554-14A>G rs142429770
NM_000393.5(COL5A2):c.2562C>T (p.Asp854=) rs148430780
NM_000393.5(COL5A2):c.2770-15del rs577038385
NM_000393.5(COL5A2):c.3098C>T (p.Pro1033Leu) rs75542756
NM_000393.5(COL5A2):c.3201+14C>T rs368713290
NM_000393.5(COL5A2):c.322+8T>C rs372227642
NM_000393.5(COL5A2):c.33C>T (p.Leu11=) rs140108893
NM_000393.5(COL5A2):c.3471+8A>T rs367643805
NM_000393.5(COL5A2):c.3689C>G (p.Thr1230Arg) rs62184175
NM_000393.5(COL5A2):c.3690A>C (p.Thr1230=) rs10197596
NM_000393.5(COL5A2):c.370-16C>T rs148220961
NM_000393.5(COL5A2):c.3720T>C (p.Tyr1240=) rs10208525
NM_000393.5(COL5A2):c.403-3T>C rs369733690
NM_000393.5(COL5A2):c.4389A>G (p.Glu1463=) rs146100075
NM_000393.5(COL5A2):c.4392T>C (p.Tyr1464=) rs142544320
NM_000393.5(COL5A2):c.4449C>T (p.Gly1483=) rs78905646
NM_000393.5(COL5A2):c.568-10G>A rs58106884
NM_000393.5(COL5A2):c.75A>G (p.Lys25=) rs549894501
NM_000393.5(COL5A2):c.852+14C>T rs56310996
NM_000393.5(COL5A2):c.975C>T (p.Pro325=) rs144344474
NM_000393.5(COL5A2):c.98-12T>G rs117917418
NM_000394.4(CRYAA):c.327C>T (p.Tyr109=) rs79100529
NM_000394.4(CRYAA):c.444T>A (p.Thr148=) rs61735857
NM_000399.5(EGR2):c.1086A>C (p.Arg362=) rs45602133
NM_000400.3(ERCC2):c.2190+12G>A rs3916881
NM_000400.3(ERCC2):c.477+9A>C rs1799785
NM_000401.3(EXT2):c.*56G>A rs77554103
NM_000401.3(EXT2):c.1687G>A (p.Glu563Lys) rs148711133
NM_000401.3(EXT2):c.223A>G (p.Met75Val) rs4755779
NM_000404.4(GLB1):c.1233+8T>C rs13093698
NM_000404.4(GLB1):c.1594A>G (p.Ser532Gly) rs73826339
NM_000404.4(GLB1):c.29C>T (p.Pro10Leu) rs7637099
NM_000404.4(GLB1):c.34T>C (p.Leu12=) rs7614776
NM_000404.4(GLB1):c.458-11T>C rs34204221
NM_000404.4(GLB1):c.792+10G>T rs79518579
NM_000405.5(GM2A):c.55G>A (p.Ala19Thr) rs1048719
NM_000407.4(GP1BB):c.399C>T (p.Ala133=) rs142352780
NM_000409.4(GUCA1A):c.567C>T (p.Asp189=) rs34925828
NM_000410.3(HFE):c.340+4T>C rs2071303
NM_000411.8(HLCS):c.1179+7del rs140568778
NM_000411.8(HLCS):c.126G>T (p.Glu42Asp) rs61732504
NM_000411.8(HLCS):c.286G>A (p.Val96Ile) rs61732502
NM_000411.8(HLCS):c.834C>T (p.Ser278=) rs1065758
NM_000414.4(HSD17B4):c.1210-8T>C rs34254740
NM_000414.4(HSD17B4):c.1767+8T>C rs190659146
NM_000414.4(HSD17B4):c.1791C>T (p.Val597=) rs2560722
NM_000414.4(HSD17B4):c.2182A>G (p.Met728Val) rs28943594
NM_000414.4(HSD17B4):c.2199C>T (p.Tyr733=) rs12714
NM_000414.4(HSD17B4):c.420A>T (p.Lys140Asn) rs28943589
NM_000414.4(HSD17B4):c.666C>G (p.Val222=) rs150677536
NM_000414.4(HSD17B4):c.875C>G (p.Thr292Ser) rs1143650
NM_000419.5(ITGA2B):c.1545-8C>A rs41361752
NM_000419.5(ITGA2B):c.2094+13C>T rs12938868
NM_000419.5(ITGA2B):c.2621T>G (p.Ile874Ser) rs5911
NM_000424.4(KRT5):c.156G>A (p.Ala52=) rs74093478
NM_000424.4(KRT5):c.30G>A (p.Arg10=) rs61747182
NM_000426.3(LAMA2):c.1206+11C>T rs115007959
NM_000426.3(LAMA2):c.1403C>G (p.Ala468Gly) rs111695726
NM_000426.3(LAMA2):c.1491T>C (p.Cys497=) rs2306220
NM_000426.3(LAMA2):c.1533T>C (p.Asn511=) rs9492266
NM_000426.3(LAMA2):c.156C>T (p.Ile52=) rs1140366
NM_000426.3(LAMA2):c.1634T>A (p.Leu545Gln) rs118083923
NM_000426.3(LAMA2):c.1701C>T (p.Ile567=) rs111381107
NM_000426.3(LAMA2):c.1798G>A (p.Gly600Arg) rs36044314
NM_000426.3(LAMA2):c.1930C>G (p.His644Asp) rs35879899
NM_000426.3(LAMA2):c.2323-18T>A rs199846930
NM_000426.3(LAMA2):c.2476C>T (p.Arg826Trp) rs118147866
NM_000426.3(LAMA2):c.2736G>A (p.Ala912=) rs142671449
NM_000426.3(LAMA2):c.2756G>T (p.Arg919Leu) rs35277491
NM_000426.3(LAMA2):c.3412G>A (p.Val1138Met) rs2306942
NM_000426.3(LAMA2):c.3556-15T>G rs17741922
NM_000426.3(LAMA2):c.3597T>C (p.Asp1199=) rs199904029
NM_000426.3(LAMA2):c.3613A>G (p.Thr1205Ala) rs35889149
NM_000426.3(LAMA2):c.411G>A (p.Ala137=) rs149347601
NM_000426.3(LAMA2):c.4437-5T>A rs41285288
NM_000426.3(LAMA2):c.4750G>A (p.Gly1584Ser) rs117781224
NM_000426.3(LAMA2):c.4935C>A (p.Thr1645=) rs35579821
NM_000426.3(LAMA2):c.4956C>G (p.Thr1652=) rs17057184
NM_000426.3(LAMA2):c.5121C>T (p.Asp1707=) rs151199929
NM_000426.3(LAMA2):c.5280G>A (p.Glu1760=) rs376693904
NM_000426.3(LAMA2):c.5530C>A (p.Arg1844Ser) rs56173620
NM_000426.3(LAMA2):c.6150T>C (p.Asp2050=) rs114766691
NM_000426.3(LAMA2):c.6161A>G (p.Gln2054Arg) rs56035053
NM_000426.3(LAMA2):c.6237G>A (p.Thr2079=) rs2297738
NM_000426.3(LAMA2):c.6649G>A (p.Val2217Ile) rs147857398
NM_000426.3(LAMA2):c.675C>T (p.Ala225=) rs139665175
NM_000426.3(LAMA2):c.7395T>C (p.Asp2465=) rs140483001
NM_000426.3(LAMA2):c.7431A>T (p.Arg2477Ser) rs34367843
NM_000426.3(LAMA2):c.7906A>G (p.Thr2636Ala) rs2244008
NM_000426.3(LAMA2):c.8028T>C (p.Asn2676=) rs35313209
NM_000426.3(LAMA2):c.8124T>A (p.Gly2708=) rs34997144
NM_000426.3(LAMA2):c.8528A>G (p.Asn2843Ser) rs73599293
NM_000426.3(LAMA2):c.8548-10T>C rs113644365
NM_000426.3(LAMA2):c.8586T>C (p.Tyr2862=) rs142451929
NM_000426.3(LAMA2):c.8989-12C>G rs144860334
NM_000426.3(LAMA2):c.9123C>T (p.Val3041=) rs61749497
NM_000426.3(LAMA2):c.9211+6T>C rs201375881
NM_000428.3(LTBP2):c.1287G>A (p.Leu429=) rs61738025
NM_000428.3(LTBP2):c.2406T>C (p.Thr802=) rs699374
NM_000428.3(LTBP2):c.2788+13C>T rs78258030
NM_000428.3(LTBP2):c.4905G>C (p.Leu1635=) rs144520047
NM_000428.3(LTBP2):c.956C>A (p.Pro319Gln) rs2304707
NM_000430.4(PAFAH1B1):c.118-14T>C rs147692085
NM_000430.4(PAFAH1B1):c.568+27C>T rs3213696
NM_000430.4(PAFAH1B1):c.672-10A>C rs77153143
NM_000430.4(PAFAH1B1):c.693A>T (p.Thr231=) rs2228614
NM_000431.4(MVK):c.155G>A (p.Ser52Asn) rs7957619
NM_000431.4(MVK):c.371+8C>T rs67886029
NM_000431.4(MVK):c.405G>A (p.Ser135=) rs34368092
NM_000431.4(MVK):c.510C>T (p.Asp170=) rs2287218
NM_000431.4(MVK):c.831C>T (p.Arg277=) rs104895353
NM_000431.4(MVK):c.924C>T (p.Leu308=) rs72648042
NM_000432.3(MYL2):c.132T>C (p.Ile44=) rs2301610
NM_000432.3(MYL2):c.4-14C>T rs12301951
NM_000433.3(NCF2):c.1001-10T>G rs36113295
NM_000433.3(NCF2):c.1167C>A (p.His389Gln) rs17849502
NM_000433.3(NCF2):c.606G>A (p.Ala202=) rs17849501
NM_000435.3(NOTCH3):c.1140T>C (p.Pro380=) rs61749020
NM_000435.3(NOTCH3):c.120C>G (p.Ala40=) rs146904189
NM_000435.3(NOTCH3):c.1487C>T (p.Pro496Leu) rs11670799
NM_000435.3(NOTCH3):c.1490C>T (p.Ser497Leu) rs114207045
NM_000435.3(NOTCH3):c.1725G>A (p.Thr575=) rs79926127
NM_000435.3(NOTCH3):c.1782C>T (p.Gly594=) rs35793356
NM_000435.3(NOTCH3):c.2039G>A (p.Arg680His) rs10406745
NM_000435.3(NOTCH3):c.2202C>T (p.Ala734=) rs140040122
NM_000435.3(NOTCH3):c.2300G>A (p.Arg767His) rs75291244
NM_000435.3(NOTCH3):c.2411-4C>G rs190177286
NM_000435.3(NOTCH3):c.3058G>C (p.Ala1020Pro) rs35769976
NM_000435.3(NOTCH3):c.3399C>A (p.His1133Gln) rs112197217
NM_000435.3(NOTCH3):c.4044C>T (p.Gly1348=) rs78926093
NM_000435.3(NOTCH3):c.4552C>A (p.Leu1518Met) rs141320511
NM_000435.3(NOTCH3):c.4679G>C (p.Arg1560Pro) rs78501403
NM_000435.3(NOTCH3):c.5370C>T (p.Phe1790=) rs35887416
NM_000435.3(NOTCH3):c.5400G>T (p.Gly1800=) rs34480308
NM_000435.3(NOTCH3):c.5854G>A (p.Val1952Met) rs115582213
NM_000435.3(NOTCH3):c.6031G>A (p.Val2011Ile) rs142007575
NM_000435.3(NOTCH3):c.6813T>C (p.Pro2271=) rs61731974
NM_000441.2(SLC26A4):c.1002-9A>C rs10234822
NM_000445.5(PLEC):c.10693T>C (p.Leu3565=) rs6992333
NM_000445.5(PLEC):c.10746G>A (p.Thr3582=) rs6984820
NM_000445.5(PLEC):c.11067C>T (p.Thr3689=) rs35134741
NM_000445.5(PLEC):c.11170C>T (p.Leu3724=) rs17062686
NM_000445.5(PLEC):c.11208T>C (p.Ala3736=) rs7819099
NM_000445.5(PLEC):c.11709A>G (p.Pro3903=) rs7822511
NM_000445.5(PLEC):c.1176T>C (p.Asp392=) rs11783799
NM_000445.5(PLEC):c.11967A>G (p.Thr3989=) rs6558406
NM_000445.5(PLEC):c.12441G>A (p.Pro4147=) rs146781600
NM_000445.5(PLEC):c.12894A>G (p.Ser4298=) rs6558405
NM_000445.5(PLEC):c.13542T>C (p.Ala4514=) rs7014582
NM_000445.5(PLEC):c.1455C>T (p.Thr485=) rs115081018
NM_000445.5(PLEC):c.1592C>T (p.Ala531Val) rs11136336
NM_000445.5(PLEC):c.1833C>T (p.Pro611=) rs185978075
NM_000445.5(PLEC):c.2385+9dup rs35671527
NM_000445.5(PLEC):c.2386-10del rs142120912
NM_000445.5(PLEC):c.2538+6C>T rs11780911
NM_000445.5(PLEC):c.2739G>A (p.Leu913=) rs78012434
NM_000445.5(PLEC):c.3631T>C (p.Leu1211=) rs3135109
NM_000445.5(PLEC):c.3798C>T (p.Ala1266=) rs112173070
NM_000445.5(PLEC):c.3827G>A (p.Arg1276Gln) rs11136334
NM_000445.5(PLEC):c.3838-6A>G rs11136333
NM_000445.5(PLEC):c.3838-9A>G rs57461687
NM_000445.5(PLEC):c.4046A>G (p.His1349Arg) rs55895668
NM_000445.5(PLEC):c.4126-4A>G rs7002152
NM_000445.5(PLEC):c.4494T>C (p.Ala1498=) rs35916068
NM_000445.5(PLEC):c.4536T>G (p.Ala1512=) rs56117011
NM_000445.5(PLEC):c.4557G>A (p.Ala1519=) rs55646585
NM_000445.5(PLEC):c.459T>C (p.Ala153=) rs6993938
NM_000445.5(PLEC):c.4725G>A (p.Ala1575=) rs62642470
NM_000445.5(PLEC):c.4761G>A (p.Ala1587=) rs55836855
NM_000445.5(PLEC):c.5310G>A (p.Ala1770=) rs140406501
NM_000445.5(PLEC):c.5988T>C (p.Ala1996=) rs2857829
NM_000445.5(PLEC):c.6009G>A (p.Ala2003=) rs1140522
NM_000445.5(PLEC):c.6251C>T (p.Ala2084Val) rs7002002
NM_000445.5(PLEC):c.6522G>A (p.Ala2174=) rs7016416
NM_000445.5(PLEC):c.7662A>C (p.Ala2554=) rs11778026
NM_000445.5(PLEC):c.799+10C>T rs12545876
NM_000445.5(PLEC):c.8041T>C (p.Ser2681Pro) rs7833924
NM_000445.5(PLEC):c.8106C>T (p.Gly2702=) rs35139934
NM_000445.5(PLEC):c.8334C>T (p.Asn2778=) rs11777402
NM_000445.5(PLEC):c.8570A>G (p.Tyr2857Cys) rs199720608
NM_000445.5(PLEC):c.8576G>A (p.Arg2859His) rs6558407
NM_000445.5(PLEC):c.9154G>A (p.Val3052Ile) rs35027700
NM_000445.5(PLEC):c.9182C>T (p.Ala3061Val) rs35858667
NM_000445.5(PLEC):c.9858T>A (p.Ser3286=) rs34644439
NM_000447.3(PSEN2):c.129C>T (p.Asn43=) rs6759
NM_000447.3(PSEN2):c.261C>T (p.His87=) rs1046240
NM_000447.3(PSEN2):c.366G>A (p.Thr122=) rs148996705
NM_000447.3(PSEN2):c.441C>T (p.Ser147=) rs114334281
NM_000447.3(PSEN2):c.69T>C (p.Ala23=) rs11405
NM_000447.3(PSEN2):c.708T>C (p.Ser236=) rs61730652
NM_000447.3(PSEN2):c.756G>C (p.Ala252=) rs147702142
NM_000447.3(PSEN2):c.903G>T (p.Thr301=) rs6426553
NM_000448.2(RAG1):c.2880A>G (p.Ala960=) rs1980131
NM_000448.2(RAG1):c.303G>A (p.Ala101=) rs4151025
NM_000448.2(RAG1):c.906C>A (p.Asp302Glu) rs4151030
NM_000451.3(SHOX):c.63C>T (p.Gly21=) rs142306835
NM_000451.3(SHOX):c.870G>A (p.Leu290=) rs746391025
NM_000453.3(SLC5A5):c.1326A>C (p.Thr442=) rs73520743
NM_000453.3(SLC5A5):c.1330-15C>T rs77947605
NM_000453.3(SLC5A5):c.1652-9G>A rs4808708
NM_000455.4(STK11):c.*8C>T rs587782259
NM_000455.4(STK11):c.-2G>T rs774072752
NM_000455.4(STK11):c.1062C>G (p.Phe354Leu) rs59912467
NM_000455.4(STK11):c.1109-4C>T rs1407794756
NM_000455.4(STK11):c.1185A>G (p.Thr395=) rs370207155
NM_000455.4(STK11):c.1194G>A (p.Ala398=) rs184271025
NM_000455.4(STK11):c.1211C>T (p.Ser404Phe) rs200078204
NM_000455.4(STK11):c.1226G>A (p.Arg409Gln) rs587782364
NM_000455.4(STK11):c.264C>A (p.Ile88=) rs56354945
NM_000455.4(STK11):c.369G>A (p.Gln123=) rs140112347
NM_000455.4(STK11):c.374+11C>T rs368923696
NM_000455.4(STK11):c.375-7G>A rs587781176
NM_000455.4(STK11):c.426C>T (p.Ser142=) rs758448869
NM_000455.4(STK11):c.464+20delG rs730881960
NM_000455.4(STK11):c.464+4C>T rs373167735
NM_000455.4(STK11):c.465-18G>T rs587781177
NM_000455.4(STK11):c.465-4G>A rs587780009
NM_000455.4(STK11):c.597+14del rs536282050
NM_000455.4(STK11):c.795G>A (p.Glu265=) rs730881963
NM_000455.4(STK11):c.816C>T (p.Tyr272=) rs9282859
NM_000455.4(STK11):c.894C>A (p.Phe298Leu) rs199681533
NM_000455.4(STK11):c.920+7G>A rs2075607
NM_000455.4(STK11):c.921-9C>T rs761688641
NM_000457.4(HNF4A):c.116-5C>T rs745975
NM_000458.4(HNF1B):c.1413C>T (p.Pro471=) rs140781855
NM_000458.4(HNF1B):c.684C>G (p.Asn228Lys) rs202151409
NM_000458.4(HNF1B):c.750C>T (p.Tyr250=) rs144249535
NM_000460.4(THPO):c.1030A>G (p.Thr344Ala) rs35794435
NM_000460.4(THPO):c.229-17_229-14dup rs55827759
NM_000465.3(BARD1):c.1518_1519invTG (p.Val507Met)
NM_000465.4(BARD1):c.1028C>T (p.Thr343Ile) rs201032007
NM_000465.4(BARD1):c.1053G>C (p.Thr351=) rs2070096
NM_000465.4(BARD1):c.1075_1095del (p.Leu359_Pro365del) rs28997575
NM_000465.4(BARD1):c.1134G>C (p.Arg378Ser) rs2229571
NM_000465.4(BARD1):c.1203T>C (p.Ser401=) rs370553043
NM_000465.4(BARD1):c.1518T>C (p.His506=) rs2070093
NM_000465.4(BARD1):c.1519G>A (p.Val507Met) rs2070094
NM_000465.4(BARD1):c.1568+14C>T rs5031011
NM_000465.4(BARD1):c.1613G>A (p.Ser538Asn) rs370771157
NM_000465.4(BARD1):c.1670G>C (p.Cys557Ser) rs28997576
NM_000465.4(BARD1):c.1738G>A (p.Glu580Lys) rs35306212
NM_000465.4(BARD1):c.1933T>C (p.Cys645Arg) rs2228456
NM_000465.4(BARD1):c.1972C>T (p.Arg658Cys) rs3738888
NM_000465.4(BARD1):c.1977A>G (p.Arg659=) rs147215925
NM_000465.4(BARD1):c.2179G>A (p.Asp727Asn) rs730881424
NM_000465.4(BARD1):c.2191C>G (p.Arg731Gly) rs76744638
NM_000465.4(BARD1):c.2212A>G (p.Ile738Val) rs61754118
NM_000465.4(BARD1):c.2282G>A (p.Ser761Asn) rs142155101
NM_000465.4(BARD1):c.253G>T (p.Val85Leu) rs370359540
NM_000465.4(BARD1):c.33G>T (p.Gln11His) rs143914387
NM_000465.4(BARD1):c.568G>A (p.Asp190Asn) rs369561166
NM_000465.4(BARD1):c.609A>C (p.Gly203=) rs28997574
NM_000465.4(BARD1):c.620A>G (p.Lys207Arg) rs34969857
NM_000465.4(BARD1):c.70C>T (p.Pro24Ser) rs1048108
NM_000466.2(PEX1):c.-137T>C rs12386601
NM_000466.3(PEX1):c.-53C>G rs12386703
NM_000466.3(PEX1):c.130-9T>C rs377337949
NM_000466.3(PEX1):c.1671-7T>C rs74519968
NM_000466.3(PEX1):c.2088A>G (p.Ile696Met) rs35996821
NM_000466.3(PEX1):c.2331C>A (p.Gly777=) rs10278857
NM_000466.3(PEX1):c.3439-14_3439-13del rs150005994
NM_000466.3(PEX1):c.358-11G>C rs113104510
NM_000466.3(PEX1):c.3720C>T (p.His1240=) rs34825053
NM_000474.4(TWIST1):c.259_276del (p.Ala87_Gly92del) rs544465774
NM_000478.6(ALPL):c.1189+19G>T rs61778393
NM_000478.6(ALPL):c.1542G>T (p.Ala514=) rs3200256
NM_000478.6(ALPL):c.1565T>C (p.Val522Ala) rs34605986
NM_000478.6(ALPL):c.455G>A (p.Arg152His) rs149344982
NM_000481.3(AMT):c.354G>A (p.Leu118=) rs145194293
NM_000486.5(AQP2):c.342G>A (p.Gly114=) rs35400945
NM_000486.5(AQP2):c.345C>T (p.Asp115=) rs60629501
NM_000486.5(AQP2):c.39G>A (p.Val13=) rs61733029
NM_000487.6(ARSA):c.*96A>G rs6151429
NM_000487.6(ARSA):c.1055A>G (p.Asn352Ser) rs2071421
NM_000487.6(ARSA):c.1149C>T (p.Asp383=) rs6151425
NM_000487.6(ARSA):c.1178C>G (p.Thr393Ser) rs743616
NM_000487.6(ARSA):c.1493G>A (p.Arg498His) rs6151428
NM_000487.6(ARSA):c.459C>T (p.His153=) rs6151412
NM_000487.6(ARSA):c.585G>T (p.Trp195Cys) rs6151415
NM_000487.6(ARSA):c.624T>C (p.His208=) rs113990230
NM_000487.6(ARSA):c.636C>T (p.Ala212=) rs200182983
NM_000488.3(SERPINC1):c.1011A>G (p.Gln337=) rs5878
NM_000488.3(SERPINC1):c.1246G>T (p.Ala416Ser) rs121909548
NM_000488.3(SERPINC1):c.981A>G (p.Val327=) rs5877
NM_000489.5(ATRX):c.4659T>C (p.His1553=) rs25641
NM_000492.3(CFTR):c.-8G>C rs1800501
NM_000492.3(CFTR):c.1365G>A (p.Ala455=) rs79074685
NM_000492.3(CFTR):c.1408G>A (p.Val470Met) rs213950
NM_000492.3(CFTR):c.1516A>G (p.Ile506Val) rs1800091
NM_000492.3(CFTR):c.1523T>G (p.Phe508Cys) rs74571530
NM_000492.3(CFTR):c.1581A>G (p.Glu527=) rs1800094
NM_000492.3(CFTR):c.1584+12T>C rs193922502
NM_000492.3(CFTR):c.1920T>C (p.Phe640=) rs145877746
NM_000492.3(CFTR):c.2245C>T (p.Leu749=) rs151235408
NM_000492.3(CFTR):c.224G>A (p.Arg75Gln) rs1800076
NM_000492.3(CFTR):c.2260G>A (p.Val754Met) rs150157202
NM_000492.3(CFTR):c.2562T>G (p.Thr854=) rs1042077
NM_000492.3(CFTR):c.2620-15C>G rs139379077
NM_000492.3(CFTR):c.274-6T>C rs371315549
NM_000492.3(CFTR):c.2898G>A (p.Thr966=) rs1800109
NM_000492.3(CFTR):c.2991G>C (p.Leu997Phe) rs1800111
NM_000492.3(CFTR):c.3080T>C (p.Ile1027Thr) rs1800112
NM_000492.3(CFTR):c.3285A>T (p.Thr1095=) rs1800118
NM_000492.3(CFTR):c.3469-17T>C rs199630678
NM_000492.3(CFTR):c.3485G>T (p.Arg1162Leu) rs1800120
NM_000492.3(CFTR):c.3558A>G (p.Gln1186=) rs1800121
NM_000492.3(CFTR):c.3705T>G (p.Ser1235Arg) rs34911792
NM_000492.3(CFTR):c.3870A>G (p.Pro1290=) rs1800130
NM_000492.3(CFTR):c.3897A>G (p.Thr1299=) rs1800131
NM_000492.3(CFTR):c.4242+13A>G rs76179227
NM_000492.3(CFTR):c.4243-5C>T rs114402068
NM_000492.3(CFTR):c.4272C>T (p.Tyr1424=) rs1800135
NM_000492.3(CFTR):c.4389G>A (p.Gln1463=) rs1800136
NM_000492.3(CFTR):c.443T>C (p.Ile148Thr) rs35516286
NM_000492.3(CFTR):c.744-33GATT[8] rs1805171
NM_000492.3(CFTR):c.869+11C>T rs1800503
NM_000492.3(CFTR):c.91C>T (p.Arg31Cys) rs1800073
NM_000494.4(COL17A1):c.1267+13C>T rs11191910
NM_000495.5(COL4A5):c.1289C>A (p.Ala430Asp) rs142883891
NM_000500.9(CYP21A2):c.308G>A (p.Arg103Lys) rs6474
NM_000500.9(CYP21A2):c.327C>G (p.Ser109=) rs193922545
NM_000500.9(CYP21A2):c.342C>T (p.Ser114=) rs193922546
NM_000500.9(CYP21A2):c.552C>G (p.Asp184Glu) rs397515531
NM_000500.9(CYP21A2):c.806G>C (p.Ser269Thr) rs6472
NM_000501.4(ELN):c.427+8C>T rs55868272
NM_000506.4(F2):c.1233G>A (p.Pro411=) rs5898
NM_000506.4(F2):c.1602G>A (p.Pro534=) rs5900
NM_000506.4(F2):c.1824C>T (p.Arg608=) rs3136532
NM_000506.4(F2):c.423-7G>C rs2070852
NM_000506.4(F2):c.480C>T (p.Pro160=) rs3136452
NM_000506.4(F2):c.494C>T (p.Thr165Met) rs5896
NM_000507.4(FBP1):c.*21C>T rs9695
NM_000507.4(FBP1):c.276G>T (p.Thr92=) rs16910744
NM_000507.4(FBP1):c.426+7C>T rs8192689
NM_000507.4(FBP1):c.651C>T (p.Ala217=) rs1042144
NM_000507.4(FBP1):c.705+14C>T rs2297084
NM_000510.3(FSHB):c.228C>T (p.Tyr76=) rs6169
NM_000512.5(GALNS):c.1177G>T (p.Ala393Ser) rs2303269
NM_000512.5(GALNS):c.318C>T (p.Asn106=) rs34278797
NM_000512.5(GALNS):c.510T>C (p.Tyr170=) rs3743544
NM_000512.5(GALNS):c.633+22T>C rs201579340
NM_000512.5(GALNS):c.692C>G (p.Ala231Gly) rs34745339
NM_000512.5(GALNS):c.723C>T (p.Ala241=) rs117053987
NM_000512.5(GALNS):c.846C>T (p.Phe282=) rs35232749
NM_000512.5(GALNS):c.858G>A (p.Thr286=) rs140299014
NM_000514.4(GDNF):c.429G>A (p.Arg143=) rs36010631
NM_000514.4(GDNF):c.448G>A (p.Asp150Asn) rs76466003
NM_000518.5(HBB):c.315+16G>C rs10768683
NM_000518.5(HBB):c.316-238C>T rs558554234
NM_000520.5(HEXA):c.739C>T (p.Arg247Trp) rs121907970
NM_000520.6(HEXA):c.1195A>G (p.Asn399Asp) rs1800430
NM_000520.6(HEXA):c.1306A>G (p.Ile436Val) rs1800431
NM_000520.6(HEXA):c.1518A>G (p.Glu506=) rs4777502
NM_000520.6(HEXA):c.1527-6T>C rs199914308
NM_000520.6(HEXA):c.672+30T>G rs117160567
NM_000520.6(HEXA):c.759G>A (p.Val253=) rs117513345
NM_000520.6(HEXA):c.9C>T (p.Ser3=) rs1800428
NM_000521.4(HEXB):c.1258A>G (p.Ile420Val) rs77499935
NM_000521.4(HEXB):c.1614-14C>A rs201448394
NM_000521.4(HEXB):c.362A>G (p.Lys121Arg) rs11556045
NM_000521.4(HEXB):c.445+1G>C rs761197472
NM_000521.4(HEXB):c.619A>G (p.Ile207Val) rs10805890
NM_000521.4(HEXB):c.772-4A>G rs17561000
NM_000525.3(KCNJ11):c.1009G>A (p.Val337Ile) rs5215
NM_000525.3(KCNJ11):c.1089A>G (p.Ser363=) rs5214
NM_000525.3(KCNJ11):c.108G>A (p.Val36=) rs112070496
NM_000525.3(KCNJ11):c.1095C>T (p.Arg365=) rs143276279
NM_000525.3(KCNJ11):c.1143G>A (p.Lys381=) rs8175351
NM_000525.3(KCNJ11):c.1154C>G (p.Ser385Cys) rs41282930
NM_000525.3(KCNJ11):c.570C>T (p.Ala190=) rs5218
NM_000525.3(KCNJ11):c.67A>G (p.Lys23Glu) rs5219
NM_000525.3(KCNJ11):c.801C>G (p.Leu267=) rs5216
NM_000525.3(KCNJ11):c.808C>G (p.Leu270Val) rs1800467
NM_000525.3(KCNJ11):c.843C>T (p.Leu281=) rs116392938
NM_000526.5(KRT14):c.202G>A (p.Gly68Ser) rs142137272
NM_000527.4(LDLR):c.1060+10G>C rs12710260
NM_000527.4(LDLR):c.1060+7T>C rs2738442
NM_000527.4(LDLR):c.1167G>A (p.Thr389=) rs139066906
NM_000527.4(LDLR):c.1171G>A (p.Ala391Thr) rs11669576
NM_000527.4(LDLR):c.1413A>G (p.Arg471=) rs5930
NM_000527.4(LDLR):c.1617C>T (p.Pro539=) rs5929
NM_000527.4(LDLR):c.1725C>T (p.Leu575=) rs1799898
NM_000527.4(LDLR):c.1773C>T (p.Asn591=) rs688
NM_000527.4(LDLR):c.1959T>C (p.Val653=) rs5925
NM_000527.4(LDLR):c.2177C>T (p.Thr726Ile) rs45508991
NM_000527.4(LDLR):c.2232A>G (p.Arg744=) rs5927
NM_000527.4(LDLR):c.324G>T (p.Thr108=) rs146517429
NM_000527.4(LDLR):c.81C>T (p.Cys27=) rs2228671
NM_000528.4(MAN2B1):c.1010G>A (p.Arg337Gln) rs1133330
NM_000528.4(MAN2B1):c.1238A>G (p.Asn413Ser) rs35836657
NM_000528.4(MAN2B1):c.832C>G (p.Leu278Val) rs1054486
NM_000528.4(MAN2B1):c.935C>T (p.Thr312Ile) rs1054487
NM_000531.6(OTC):c.137A>G (p.Lys46Arg) rs1800321
NM_000531.6(OTC):c.809A>G (p.Gln270Arg) rs1800328
NM_000533.5(PLP1):c.609T>C (p.Asp203=) rs1126707
NM_000535.7(PMS2):c.*17G>C rs556089649
NM_000535.7(PMS2):c.1004A>G (p.Asn335Ser) rs200513014
NM_000535.7(PMS2):c.1209C>T (p.Ser403=) rs147399413
NM_000535.7(PMS2):c.1266G>A (p.Glu422=) rs138049175
NM_000535.7(PMS2):c.1408C>T (p.Pro470Ser) rs1805321
NM_000535.7(PMS2):c.1437C>G (p.His479Gln) rs63750685
NM_000535.7(PMS2):c.1454C>A (p.Thr485Lys) rs1805323
NM_000535.7(PMS2):c.1488C>T (p.His496=) rs1805320
NM_000535.7(PMS2):c.1531A>G (p.Thr511Ala) rs2228007
NM_000535.7(PMS2):c.1532C>T (p.Thr511Met) rs74902811
NM_000535.7(PMS2):c.1557T>C (p.Tyr519=) rs6972869
NM_000535.7(PMS2):c.1567T>A (p.Ser523Thr) rs63751132
NM_000535.7(PMS2):c.1569C>G (p.Ser523=) rs141458772
NM_000535.7(PMS2):c.1609G>A (p.Glu537Lys) rs115052399
NM_000535.7(PMS2):c.1688G>T (p.Arg563Leu) rs63750668
NM_000535.7(PMS2):c.1688_1689delinsAG (p.Arg563Gln) rs587780725
NM_000535.7(PMS2):c.1711C>A (p.Leu571Ile) rs63750055
NM_000535.7(PMS2):c.1789A>T (p.Thr597Ser) rs1805318
NM_000535.7(PMS2):c.1866G>A (p.Met622Ile) rs1805324
NM_000535.7(PMS2):c.1936A>C (p.Arg646=) rs369582237
NM_000535.7(PMS2):c.2006+6G>A rs111905775
NM_000535.7(PMS2):c.2007-4G>A rs1805326
NM_000535.7(PMS2):c.2007-7C>T rs55954143
NM_000535.7(PMS2):c.2127C>T (p.Phe709=) rs199943748
NM_000535.7(PMS2):c.2149G>A (p.Val717Met) rs201671325
NM_000535.7(PMS2):c.2187C>G (p.Leu729=) rs373630535
NM_000535.7(PMS2):c.2253T>C (p.Phe751=) rs1805325
NM_000535.7(PMS2):c.23+10G>C rs192027828
NM_000535.7(PMS2):c.2324A>G (p.Asn775Ser) rs17420802
NM_000535.7(PMS2):c.2340C>T (p.Pro780=) rs142230276
NM_000535.7(PMS2):c.2356C>A (p.Leu786Met) rs576055272
NM_000535.7(PMS2):c.2466T>C (p.Leu822=) rs10000
NM_000535.7(PMS2):c.251-20T>G rs149343081
NM_000535.7(PMS2):c.255G>A (p.Leu85=) rs200491279
NM_000535.7(PMS2):c.2570G>C (p.Gly857Ala) rs1802683
NM_000535.7(PMS2):c.288C>T (p.Ala96=) rs12532895
NM_000535.7(PMS2):c.319C>T (p.Arg107Trp) rs188006077
NM_000535.7(PMS2):c.353+6A>G rs376449640
NM_000535.7(PMS2):c.353+9A>C rs139990791
NM_000535.7(PMS2):c.383C>T (p.Ser128Leu) rs116373169
NM_000535.7(PMS2):c.52A>G (p.Ile18Val) rs63750123
NM_000535.7(PMS2):c.59G>A (p.Arg20Gln) rs10254120
NM_000535.7(PMS2):c.682G>A (p.Gly228Ser) rs376258383
NM_000535.7(PMS2):c.705+17A>G rs62456182
NM_000535.7(PMS2):c.765C>T (p.Tyr255=) rs573125799
NM_000535.7(PMS2):c.780C>G (p.Ser260=) rs1805319
NM_000535.7(PMS2):c.86G>C (p.Gly29Ala) rs146176004
NM_000536.4(RAG2):c.878A>G (p.Glu293Gly) rs16929093
NM_000540.2(RYR1):c.10048C>A (p.Arg3350=) rs200355885
NM_000540.2(RYR1):c.10097G>A (p.Arg3366His) rs137932199
NM_000540.2(RYR1):c.10119G>A (p.Val3373=) rs140689610
NM_000540.2(RYR1):c.1021G>A (p.Gly341Arg) rs121918592
NM_000540.2(RYR1):c.10259+7G>A rs143752962
NM_000540.2(RYR1):c.10347+1G>A rs111436401
NM_000540.2(RYR1):c.10348-6C>G rs193922837
NM_000540.2(RYR1):c.10501dup (p.Asp3501fs) rs1568537774
NM_000540.2(RYR1):c.10578G>A (p.Ala3526=) rs368360689
NM_000540.2(RYR1):c.10616G>A (p.Arg3539His) rs143987857
NM_000540.2(RYR1):c.10627-1G>C rs1568539909
NM_000540.2(RYR1):c.10648C>T (p.Arg3550Trp) rs536304635
NM_000540.2(RYR1):c.10687-7C>T rs2960354
NM_000540.2(RYR1):c.10747G>C (p.Glu3583Gln) rs55876273
NM_000540.2(RYR1):c.10937+39G>A rs2945049
NM_000540.2(RYR1):c.10938-17A>G rs181147531
NM_000540.2(RYR1):c.10938-9C>T rs201976186
NM_000540.2(RYR1):c.10941C>G (p.His3647Gln) rs114351116
NM_000540.2(RYR1):c.11034+20G>T rs186460831
NM_000540.2(RYR1):c.11141+7A>G rs78350770
NM_000540.2(RYR1):c.1123-11C>T rs3745845
NM_000540.2(RYR1):c.11315G>A (p.Arg3772Gln) rs193922839
NM_000540.2(RYR1):c.11360-9T>A rs150187840
NM_000540.2(RYR1):c.11547G>A (p.Gln3849=) rs142518033
NM_000540.2(RYR1):c.11625G>A (p.Ala3875=) rs61729397
NM_000540.2(RYR1):c.11763C>A (p.Tyr3921Ter) rs377178986
NM_000540.2(RYR1):c.11798A>G (p.Tyr3933Cys) rs147136339
NM_000540.2(RYR1):c.11941C>T (p.His3981Tyr) rs148772854
NM_000540.2(RYR1):c.11958C>G (p.Asp3986Glu) rs193922842
NM_000540.2(RYR1):c.1201C>T (p.Arg401Cys) rs193922764
NM_000540.2(RYR1):c.12083C>T (p.Ser4028Leu) rs794728696
NM_000540.2(RYR1):c.12283-7C>T rs143861818
NM_000540.2(RYR1):c.122T>C (p.Phe41Ser) rs766407858
NM_000540.2(RYR1):c.12499G>T (p.Glu4167Ter) rs772494345
NM_000540.2(RYR1):c.12553G>A (p.Ala4185Thr) rs151119428
NM_000540.2(RYR1):c.12588C>T (p.Ile4196=) rs61739895
NM_000540.2(RYR1):c.12727G>A (p.Glu4243Lys) rs1555799628
NM_000540.2(RYR1):c.12741C>T (p.Ala4247=) rs80039127
NM_000540.2(RYR1):c.12869C>T (p.Ala4290Val) rs755065800
NM_000540.2(RYR1):c.12879G>C (p.Ala4293=) rs193922854
NM_000540.2(RYR1):c.12880A>G (p.Thr4294Ala) rs1003914966
NM_000540.2(RYR1):c.12881C>T (p.Thr4294Met) rs587784372
NM_000540.2(RYR1):c.12956G>A (p.Arg4319Gln) rs539194350
NM_000540.2(RYR1):c.12990C>T (p.Thr4330=) rs184450380
NM_000540.2(RYR1):c.130C>T (p.Arg44Cys) rs193922748
NM_000540.2(RYR1):c.131G>A (p.Arg44His) rs139161723
NM_000540.2(RYR1):c.13317C>T (p.Ala4439=) rs113579185
NM_000540.2(RYR1):c.13464G>A (p.Pro4488=) rs10405232
NM_000540.2(RYR1):c.13498G>A (p.Glu4500Lys) rs752192756
NM_000540.2(RYR1):c.13502C>T (p.Pro4501Leu) rs73933023
NM_000540.2(RYR1):c.13503G>A (p.Pro4501=) rs2960319
NM_000540.2(RYR1):c.13513G>C (p.Asp4505His) rs150396398
NM_000540.2(RYR1):c.13660-10T>C rs188836987
NM_000540.2(RYR1):c.13724A>C (p.Asn4575Thr) rs1568591803
NM_000540.2(RYR1):c.13863G>A (p.Glu4621=) rs140750876
NM_000540.2(RYR1):c.13900G>A (p.Glu4634Lys) rs118192133
NM_000540.2(RYR1):c.13909A>G (p.Thr4637Ala) rs118192166
NM_000540.2(RYR1):c.13913G>A (p.Gly4638Asp) rs118192135
NM_000540.2(RYR1):c.13919T>G (p.Met4640Arg) rs1568594068
NM_000540.2(RYR1):c.13934G>A (p.Arg4645Gln) rs193922860
NM_000540.2(RYR1):c.14061G>A (p.Leu4687=) rs201629205
NM_000540.2(RYR1):c.14126C>T (p.Thr4709Met) rs118192140
NM_000540.2(RYR1):c.14130-8C>G rs140808099
NM_000540.2(RYR1):c.14130-9T>G rs191894192
NM_000540.2(RYR1):c.14210G>A (p.Arg4737Gln) rs193922868
NM_000540.2(RYR1):c.14257G>A (p.Ala4753Thr) rs138156449
NM_000540.2(RYR1):c.14378T>C (p.Leu4793Pro) rs118192179
NM_000540.2(RYR1):c.1438G>A (p.Glu480Lys) rs878854375
NM_000540.2(RYR1):c.14416A>G (p.Asn4806Asp) rs886039586
NM_000540.2(RYR1):c.14471T>C (p.Leu4824Pro) rs193922874
NM_000540.2(RYR1):c.14477C>T (p.Thr4826Ile) rs121918595
NM_000540.2(RYR1):c.14505G>A (p.Gly4835=) rs118126378
NM_000540.2(RYR1):c.14524G>A rs193922879
NM_000540.2(RYR1):c.1453A>G (p.Met485Val) rs147723844
NM_000540.2(RYR1):c.14545G>A (p.Val4849Ile) rs118192168
NM_000540.2(RYR1):c.14555A>G (p.Tyr4852Cys) rs886042826
NM_000540.2(RYR1):c.14558C>T (p.Thr4853Ile) rs1555803922
NM_000540.2(RYR1):c.14581C>T (p.Arg4861Cys) rs118192181
NM_000540.2(RYR1):c.14582G>A (p.Arg4861His) rs63749869
NM_000540.2(RYR1):c.14589C>T (p.Phe4863=) rs146072491
NM_000540.2(RYR1):c.14642T>C (p.Met4881Thr) rs1568605367
NM_000540.2(RYR1):c.14645C>T rs193922884
NM_000540.2(RYR1):c.14659C>T (p.His4887Tyr) rs118192147
NM_000540.2(RYR1):c.14677C>T (p.Arg4893Trp) rs118192150
NM_000540.2(RYR1):c.14678G>A (p.Arg4893Gln) rs118192151
NM_000540.2(RYR1):c.14693T>C (p.Ile4898Thr) rs118192170
NM_000540.2(RYR1):c.14741G>C (p.Arg4914Thr) rs118192154
NM_000540.2(RYR1):c.14801A>G (p.Gln4934Arg) rs1568611775
NM_000540.2(RYR1):c.14814C>G (p.Ile4938Met) rs118192159
NM_000540.2(RYR1):c.14818G>A (p.Ala4940Thr) rs118192158
NM_000540.2(RYR1):c.14928C>G (p.Phe4976Leu) rs368874586
NM_000540.2(RYR1):c.15015G>A (p.Thr5005=) rs2229149
NM_000540.2(RYR1):c.15016G>A (p.Gly5006Ser) rs1568614042
NM_000540.2(RYR1):c.1577-6C>G rs61586345
NM_000540.2(RYR1):c.1589G>A (p.Arg530His) rs111888148
NM_000540.2(RYR1):c.1598G>A (p.Arg533His) rs144336148
NM_000540.2(RYR1):c.178G>A (p.Asp60Asn) rs118192160
NM_000540.2(RYR1):c.1840C>T (p.Arg614Cys) rs118192172
NM_000540.2(RYR1):c.1909A>G (p.Ile637Val) rs567084532
NM_000540.2(RYR1):c.1923C>G (p.Thr641=) rs116591968
NM_000540.2(RYR1):c.2004C>T (p.Asp668=) rs78835441
NM_000540.2(RYR1):c.2091C>T (p.Ala697=) rs138704724
NM_000540.2(RYR1):c.2121C>A (p.Gly707=) rs146104858
NM_000540.2(RYR1):c.2122G>A (p.Asp708Asn) rs138874610
NM_000540.2(RYR1):c.212C>A (p.Ser71Tyr) rs118192113
NM_000540.2(RYR1):c.216G>T (p.Leu72=) rs113389877
NM_000540.2(RYR1):c.2199G>C (p.Gly733=) rs749285937
NM_000540.2(RYR1):c.2241G>A (p.Leu747=) rs34097444
NM_000540.2(RYR1):c.2319C>T (p.Asp773=) rs374924686
NM_000540.2(RYR1):c.2415T>C (p.Pro805=) rs141881325
NM_000540.2(RYR1):c.2545G>A (p.Asp849Asn) rs200893443
NM_000540.2(RYR1):c.2603G>A (p.Arg868His) rs750938678
NM_000540.2(RYR1):c.2622G>A (p.Ala874=) rs149381996
NM_000540.2(RYR1):c.2677G>A (p.Gly893Ser) rs147336515
NM_000540.2(RYR1):c.2682+7G>A rs201498416
NM_000540.2(RYR1):c.2682G>A (p.Pro894=) rs919322708
NM_000540.2(RYR1):c.271-7C>G rs192495718
NM_000540.2(RYR1):c.2797G>A (p.Ala933Thr) rs148623597
NM_000540.2(RYR1):c.2871-5C>T rs45585535
NM_000540.2(RYR1):c.2919C>T (p.His973=) rs139363830
NM_000540.2(RYR1):c.2933C>T (p.Pro978Leu) rs200124278
NM_000540.2(RYR1):c.297G>A (p.Thr99=) rs144241486
NM_000540.2(RYR1):c.2996G>A (p.Arg999His) rs180714609
NM_000540.2(RYR1):c.3042G>A (p.Ala1014=) rs2228074
NM_000540.2(RYR1):c.3111C>T (p.Ser1037=) rs145434723
NM_000540.2(RYR1):c.3127C>T (p.Arg1043Cys) rs111272095
NM_000540.2(RYR1):c.325C>T (p.Arg109Trp) rs118192173
NM_000540.2(RYR1):c.328C>T (p.His110Tyr) rs767777113
NM_000540.2(RYR1):c.3326G>A (p.Arg1109Lys) rs35719391
NM_000540.2(RYR1):c.3381C>T (p.Arg1127=) rs200780880
NM_000540.2(RYR1):c.3420C>T (p.Arg1140=) rs201599911
NM_000540.2(RYR1):c.3505A>C (p.Met1169Leu) rs139069946
NM_000540.2(RYR1):c.3557-6C>T rs139849689
NM_000540.2(RYR1):c.3800C>G (p.Pro1267Arg) rs150495044
NM_000540.2(RYR1):c.3876C>A (p.Leu1292=) rs143750836
NM_000540.2(RYR1):c.3924G>C (p.Pro1308=) rs144350050
NM_000540.2(RYR1):c.3972G>A (p.Ala1324=) rs200451188
NM_000540.2(RYR1):c.4055C>G (p.Ala1352Gly) rs112105381
NM_000540.2(RYR1):c.4071C>T (p.Pro1357=) rs375709463
NM_000540.2(RYR1):c.4088C>T (p.Ala1363Val) rs774603798
NM_000540.2(RYR1):c.4178A>G (p.Lys1393Arg) rs137933390
NM_000540.2(RYR1):c.4269C>T (p.Pro1423=) rs2229141
NM_000540.2(RYR1):c.4292C>T (p.Thr1431Met) rs191656849
NM_000540.2(RYR1):c.4294-4C>T rs368108496
NM_000540.2(RYR1):c.4443C>T (p.Asn1481=) rs141317474
NM_000540.2(RYR1):c.46-5C>T rs774388278
NM_000540.2(RYR1):c.4650C>T (p.Ala1550=) rs200600174
NM_000540.2(RYR1):c.4711A>G (p.Ile1571Val) rs146429605
NM_000540.2(RYR1):c.4719G>A (p.Pro1573=) rs35480887
NM_000540.2(RYR1):c.4729G>A (p.Ala1577Thr) rs118192120
NM_000540.2(RYR1):c.4747C>T (p.Arg1583Cys) rs754476250
NM_000540.2(RYR1):c.4758G>A (p.Pro1586=) rs374222028
NM_000540.2(RYR1):c.4878C>T (p.Ala1626=) rs369466056
NM_000540.2(RYR1):c.487C>T (p.Arg163Cys) rs118192161
NM_000540.2(RYR1):c.4894C>T (p.Pro1632Ser) rs76537615
NM_000540.2(RYR1):c.4911G>A (p.Ala1637=) rs370350821
NM_000540.2(RYR1):c.4971C>T (p.Asp1657=) rs141107290
NM_000540.2(RYR1):c.4980C>T (p.Arg1660=) rs374115286
NM_000540.2(RYR1):c.4999C>T (p.Arg1667Cys) rs144157950
NM_000540.2(RYR1):c.5036G>A (p.Arg1679His) rs146504767
NM_000540.2(RYR1):c.5037C>G (p.Arg1679=) rs34169029
NM_000540.2(RYR1):c.5120G>A (p.Arg1707His) rs371566475
NM_000540.2(RYR1):c.5183C>T (p.Ser1728Phe) rs193922781
NM_000540.2(RYR1):c.528G>T (p.Glu176Asp) rs1568436081
NM_000540.2(RYR1):c.5317C>T (p.Pro1773Ser) rs192863857
NM_000540.2(RYR1):c.5322G>A (p.Pro1774=) rs572516017
NM_000540.2(RYR1):c.5360C>T (p.Pro1787Leu) rs34934920
NM_000540.2(RYR1):c.5364T>G (p.Ala1788=) rs200950362
NM_000540.2(RYR1):c.5493G>T (p.Gly1831=) rs140004449
NM_000540.2(RYR1):c.5548-19C>G rs375020048
NM_000540.2(RYR1):c.5565C>T (p.Gly1855=) rs61750975
NM_000540.2(RYR1):c.5622A>G (p.Glu1874=) rs35021937
NM_000540.2(RYR1):c.5634G>C (p.Glu1878Asp) rs114203198
NM_000540.2(RYR1):c.573C>T (p.Asp191=) rs892054
NM_000540.2(RYR1):c.594A>G (p.Leu198=) rs2229139
NM_000540.2(RYR1):c.6127+1G>A rs1283302989
NM_000540.2(RYR1):c.6127+3A>G rs78851466
NM_000540.2(RYR1):c.6178G>T (p.Gly2060Cys) rs35364374
NM_000540.2(RYR1):c.6274+1G>A rs1226228092
NM_000540.2(RYR1):c.6302T>A (p.Met2101Lys) rs746818096
NM_000540.2(RYR1):c.6384C>T (p.Tyr2128=) rs75181912
NM_000540.2(RYR1):c.6487C>T (p.Arg2163Cys) rs118192175
NM_000540.2(RYR1):c.6488G>A (p.Arg2163His) rs118192163
NM_000540.2(RYR1):c.6498C>T (p.Leu2166=) rs151313865
NM_000540.2(RYR1):c.6502G>A (p.Val2168Met) rs118192176
NM_000540.2(RYR1):c.6546C>T (p.Ile2182=) rs768963605
NM_000540.2(RYR1):c.6599C>T (p.Ala2200Val) rs193922791
NM_000540.2(RYR1):c.6612C>T (p.His2204=) rs141646642
NM_000540.2(RYR1):c.6617C>T (p.Thr2206Met) rs118192177
NM_000540.2(RYR1):c.6654C>T (p.Gly2218=) rs149185729
NM_000540.2(RYR1):c.6721C>T rs200563280
NM_000540.2(RYR1):c.6732G>A (p.Arg2244=) rs78915828
NM_000540.2(RYR1):c.6797-50A>G rs34812626
NM_000540.2(RYR1):c.6838G>A (p.Val2280Ile) rs193922797
NM_000540.2(RYR1):c.6961A>G (p.Ile2321Val) rs34390345
NM_000540.2(RYR1):c.7007G>A (p.Arg2336His) rs112563513
NM_000540.2(RYR1):c.7025A>G (p.Asn2342Ser) rs147213895
NM_000540.2(RYR1):c.7026C>T (p.Asn2342=) rs202061237
NM_000540.2(RYR1):c.7048G>A (p.Ala2350Thr) rs193922802
NM_000540.2(RYR1):c.7099G>A (p.Ala2367Thr) rs146306934
NM_000540.2(RYR1):c.725+6G>A rs201679831
NM_000540.2(RYR1):c.7281C>T (p.Ala2427=) rs77310009
NM_000540.2(RYR1):c.7300G>A (p.Gly2434Arg) rs121918593
NM_000540.2(RYR1):c.7304G>A (p.Arg2435His) rs28933396
NM_000540.2(RYR1):c.7354C>T (p.Arg2452Trp) rs118192124
NM_000540.2(RYR1):c.7361G>A (p.Arg2454His) rs118192122
NM_000540.2(RYR1):c.7372C>T (p.Arg2458Cys) rs28933397
NM_000540.2(RYR1):c.742G>A (p.Gly248Arg) rs1801086
NM_000540.2(RYR1):c.7463_7475del (p.Pro2488fs) rs794727683
NM_000540.2(RYR1):c.7522C>G (p.Arg2508Gly) rs118192178
NM_000540.2(RYR1):c.7522C>T (p.Arg2508Cys) rs118192178
NM_000540.2(RYR1):c.7523G>A (p.Arg2508His) rs193922818
NM_000540.2(RYR1):c.7584C>G (p.Pro2528=) rs1465698
NM_000540.2(RYR1):c.7584C>T (p.Pro2528=) rs1465698
NM_000540.2(RYR1):c.7615-20G>A rs746763718
NM_000540.2(RYR1):c.7615-5C>T rs768008924
NM_000540.2(RYR1):c.7615-7G>A rs146159174
NM_000540.2(RYR1):c.7737G>A (p.Val2579=) rs114975624
NM_000540.2(RYR1):c.7835+7C>T rs114522234
NM_000540.2(RYR1):c.7836-17T>C rs142720065
NM_000540.2(RYR1):c.7860G>A (p.Gln2620=) rs147587000
NM_000540.2(RYR1):c.7923C>G (p.Leu2641=) rs142558977
NM_000540.2(RYR1):c.8068-14C>T rs57376136
NM_000540.2(RYR1):c.8073C>T (p.Tyr2691=) rs202160739
NM_000540.2(RYR1):c.821G>A (p.Arg274His) rs368711923
NM_000540.2(RYR1):c.8327C>T (p.Ser2776Phe) rs147707463
NM_000540.2(RYR1):c.8360C>G (p.Thr2787Ser) rs35180584
NM_000540.2(RYR1):c.8361C>T (p.Thr2787=) rs77216903
NM_000540.2(RYR1):c.8376G>A (p.Arg2792=) rs150388417
NM_000540.2(RYR1):c.8598C>T (p.Thr2866=) rs538250432
NM_000540.2(RYR1):c.8616+7G>A rs200023171
NM_000540.2(RYR1):c.8715G>C (p.Leu2905=) rs368684717
NM_000540.2(RYR1):c.873G>A (p.Ala291=) rs2229140
NM_000540.2(RYR1):c.8827G>A (p.Asp2943Asn) rs79294840
NM_000540.2(RYR1):c.8949T>C (p.Ser2983=) rs116537677
NM_000540.2(RYR1):c.897G>C (p.Val299=) rs76854339
NM_000540.2(RYR1):c.89A>T (p.Glu30Val) rs145771708
NM_000540.2(RYR1):c.9063G>A (p.Pro3021=) rs200068725
NM_000540.2(RYR1):c.906C>T (p.Asp302=) rs145943283
NM_000540.2(RYR1):c.9152G>A (p.Arg3051His) rs147303895
NM_000540.2(RYR1):c.9242T>C (p.Met3081Thr) rs147012990
NM_000540.2(RYR1):c.9261C>T (p.Ile3087=) rs56338790
NM_000540.2(RYR1):c.9262G>A (p.Val3088Met) rs145044872
NM_000540.2(RYR1):c.9310G>A (p.Glu3104Lys) rs193922832
NM_000540.2(RYR1):c.9353C>T (p.Ala3118Val) rs2915960
NM_000540.2(RYR1):c.9355C>T (p.Arg3119Cys) rs61739911
NM_000540.2(RYR1):c.9414G>A (p.Pro3138=) rs116130182
NM_000540.2(RYR1):c.94C>T (p.Leu32Phe) rs138630815
NM_000540.2(RYR1):c.9555-7C>G rs376790946
NM_000540.2(RYR1):c.9555-9G>A rs149569999
NM_000540.2(RYR1):c.9571G>A (p.Gly3191Arg) rs756331568
NM_000540.2(RYR1):c.9605C>T (p.Pro3202Leu) rs754002399
NM_000540.2(RYR1):c.9685+16C>T rs45496799
NM_000540.2(RYR1):c.9758T>C (p.Ile3253Thr) rs375626634
NM_000540.2(RYR1):c.9771C>T (p.Ala3257=) rs75991872
NM_000540.2(RYR1):c.97A>G (p.Lys33Glu) rs193922746
NM_000540.2(RYR1):c.9882C>T (p.Ser3294=) rs142610625
NM_000543.5(SMPD1):c.1071C>T (p.Ala357=) rs72896268
NM_000543.5(SMPD1):c.107_112del (p.Val36_Leu37del) rs775860642
NM_000543.5(SMPD1):c.108_113GCTGGC[4] (p.38_39AL[4]) rs3838786
NM_000543.5(SMPD1):c.108_113GCTGGC[5] (p.38_39AL[5]) rs3838786
NM_000543.5(SMPD1):c.1522G>A (p.Gly508Arg) rs1050239
NM_000543.5(SMPD1):c.1749G>A (p.Ser583=) rs35098198
NM_000543.5(SMPD1):c.636T>C (p.Asp212=) rs7951904
NM_000545.6(HNF1A):c.1375C>T (p.Leu459=) rs2259820
NM_000545.6(HNF1A):c.1377G>A (p.Leu459=) rs118028009
NM_000545.6(HNF1A):c.1425G>A (p.Pro475=) rs145589373
NM_000545.6(HNF1A):c.1460G>A (p.Ser487Asn) rs2464196
NM_000545.6(HNF1A):c.1501+7G>A rs2464195
NM_000545.6(HNF1A):c.1502-14T>C rs765596650
NM_000545.6(HNF1A):c.1545G>A (p.Thr515=) rs55834942
NM_000545.6(HNF1A):c.1624-19G>A rs193922586
NM_000545.6(HNF1A):c.293C>T (p.Ala98Val) rs1800574
NM_000545.6(HNF1A):c.51C>G (p.Leu17=) rs1169289
NM_000545.6(HNF1A):c.79A>C (p.Ile27Leu) rs1169288
NM_000546.5(TP53):c.559+8G>A rs775915220
NM_000546.5(TP53):c.673-37C>T rs374907737
NM_000546.5(TP53):c.74+14T>C rs184743157
NM_000546.5(TP53):c.74+38C>G rs1642785
NM_000546.5(TP53):c.782+17C>T rs17880172
NM_000547.5(TPO):c.1117G>T (p.Ala373Ser) rs2280132
NM_000547.5(TPO):c.12C>G (p.Leu4=) rs9678281
NM_000547.5(TPO):c.1998C>T (p.Asp666=) rs1126797
NM_000547.5(TPO):c.2145C>T (p.Pro715=) rs732608
NM_000547.5(TPO):c.2173A>C (p.Thr725Pro) rs732609
NM_000547.5(TPO):c.660C>T (p.Val220=) rs151154074
NM_000547.5(TPO):c.769G>T (p.Ala257Ser) rs4927611
NM_000548.3(TSC2):c.4527_4529delCTT (p.Phe1510del) rs137854239
NM_000548.5(TSC2):c.*26G>A rs13332015
NM_000548.5(TSC2):c.1100G>A (p.Arg367Gln) rs1800725
NM_000548.5(TSC2):c.1110G>A (p.Gln370=) rs1800742
NM_000548.5(TSC2):c.1143G>A (p.Arg381=) rs45517155
NM_000548.5(TSC2):c.1276C>T (p.Leu426=) rs45478593
NM_000548.5(TSC2):c.1281C>A (p.Ile427=) rs45478892
NM_000548.5(TSC2):c.1292C>T (p.Ala431Val) rs202187148
NM_000548.5(TSC2):c.1318G>A (p.Gly440Ser) rs45484298
NM_000548.5(TSC2):c.1332C>T (p.Asn444=) rs535984356
NM_000548.5(TSC2):c.1362-4G>A rs397515145
NM_000548.5(TSC2):c.1387A>G (p.Ile463Val) rs45517171
NM_000548.5(TSC2):c.148A>G (p.Met50Val) rs140618379
NM_000548.5(TSC2):c.1574A>G (p.Asn525Ser) rs45457694
NM_000548.5(TSC2):c.1578C>T (p.Ser526=) rs34012042
NM_000548.5(TSC2):c.1593C>T (p.Ile531=) rs45517180
NM_000548.5(TSC2):c.1600-14C>T rs45517185
NM_000548.5(TSC2):c.1747G>A (p.Ala583Thr) rs1800729
NM_000548.5(TSC2):c.1821G>A (p.Ala607=) rs149543046
NM_000548.5(TSC2):c.1860G>A (p.Leu620=) rs45492397
NM_000548.5(TSC2):c.1869C>T (p.Ala623=) rs111244727
NM_000548.5(TSC2):c.2031C>T (p.Pro677=) rs45517208
NM_000548.5(TSC2):c.2032G>A (p.Ala678Thr) rs200494044
NM_000548.5(TSC2):c.2097+43A>G rs186681035
NM_000548.5(TSC2):c.2220+11C>T rs372555496
NM_000548.5(TSC2):c.2239C>T (p.Leu747=) rs45517221
NM_000548.5(TSC2):c.228C>T (p.His76=) rs45517097
NM_000548.5(TSC2):c.2427C>T (p.Ser809=) rs182849638
NM_000548.5(TSC2):c.2436C>T (p.Ser812=) rs767178958
NM_000548.5(TSC2):c.2451C>T (p.Asp817=) rs201442542
NM_000548.5(TSC2):c.2545+26G>A rs45517242
NM_000548.5(TSC2):c.255C>T (p.Val85=)