ClinVar Miner

Variants from ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories with conflicting interpretations

Location: United States — Primary collection method: clinical testing
Minimum review status of the submission from ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories: Collection method of the submission from ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
5526 4737 96 2572 1446 175 300 4038

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories pathogenic likely pathogenic uncertain significance likely benign benign association drug response protective risk factor other
pathogenic 10 172 67 13 8 0 14 0 12 39
likely pathogenic 123 0 71 5 3 1 0 0 2 9
uncertain significance 55 70 7 529 170 0 3 1 3 30
likely benign 7 2 491 4 730 0 0 0 2 34
benign 20 9 341 1547 75 3 3 1 13 10
risk factor 1 0 1 1 2 0 1 0 0 1

Submitter to submitter summary #

Total submitters: 146
Download table as spreadsheet
Submitter Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
GeneDx 0 3077 0 583 268 2 40 892
Illumina Clinical Services Laboratory,Illumina 0 829 0 365 210 1 22 597
Invitae 0 1595 0 294 217 5 43 559
EGL Genetic Diagnostics, Eurofins Clinical Diagnostics 0 1740 0 252 255 11 35 551
Integrated Genetics/Laboratory Corporation of America 0 1057 0 272 149 0 30 451
CeGaT Praxis fuer Humangenetik Tuebingen 0 533 0 209 178 1 27 414
Genetic Services Laboratory, University of Chicago 0 266 0 318 68 1 1 388
Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine 0 1467 0 190 143 1 20 354
PreventionGenetics, PreventionGenetics 0 1697 0 260 37 0 4 301
Ambry Genetics 0 826 0 210 77 0 4 291
Athena Diagnostics Inc 0 777 0 173 75 0 3 251
Quest Diagnostics Nichols Institute San Juan Capistrano 0 578 0 129 82 0 19 230
Biesecker Lab/Clinical Genomics Section,National Institutes of Health 0 164 81 62 72 0 2 217
OMIM 0 147 0 11 6 143 31 190
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 0 210 0 122 21 0 10 153
Mayo Clinic Laboratories, Mayo Clinic 0 265 0 89 20 0 4 113
Department of Pathology and Laboratory Medicine,Sinai Health System 0 211 0 41 44 1 17 103
Counsyl 0 77 0 58 4 0 13 75
CHEO Genetics Diagnostic Laboratory,Children's Hospital of Eastern Ontario 0 68 0 33 5 0 0 38
Mendelics 0 56 0 17 13 0 2 32
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen 0 77 0 26 1 0 0 27
Natera, Inc. 0 196 0 15 10 1 0 26
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute 0 73 0 22 3 1 0 26
Leiden Open Variation Database 0 16 0 24 2 0 0 26
GeneReviews 0 31 10 3 1 1 9 24
Foulkes Cancer Genetics LDI, Lady Davis Institute for Medical Research 0 42 0 7 11 0 4 22
Stanford Center for Inherited Cardiovascular Disease, Stanford University 0 39 0 6 16 0 0 22
DNA and Cytogenetics Diagnostics Unit,Erasmus Medical Center 0 47 0 20 2 0 0 22
Blueprint Genetics 0 33 0 8 4 0 8 20
PharmGKB 0 0 0 0 0 19 0 19
NIHR Bioresource Rare Diseases, University of Cambridge 0 12 0 12 3 0 4 19
Genome Diagnostics Laboratory,University Medical Center Utrecht 0 58 0 15 3 0 0 18
Clinical Genetics Karolinska University Hospital,Karolinska University Hospital 0 118 0 10 0 0 8 18
Wong Mito Lab, Molecular and Human Genetics, Baylor College of Medicine 0 37 0 6 5 0 6 17
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics,Children's Hospital of Philadelphia 0 38 0 5 10 0 1 16
Centre for Mendelian Genomics,University Medical Centre Ljubljana 0 33 0 8 5 0 3 16
Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen 0 83 0 13 0 0 3 16
Baylor Genetics 0 32 0 8 0 0 4 12
Genomic Research Center, Shahid Beheshti University of Medical Sciences 0 10 0 3 3 0 6 12
CFTR-France 0 11 0 2 0 0 10 12
Fulgent Genetics,Fulgent Genetics 0 102 0 8 3 0 0 11
CSER _CC_NCGL, University of Washington 0 10 0 5 6 0 0 11
Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago 0 7 0 2 7 0 0 9
Department of Ophthalmology and Visual Sciences Kyoto University 0 0 0 8 0 0 0 8
Medical Genetics Laboratory, Kennedy Center,Juliane Marie Center, Rigshospitalet 0 1 0 5 2 0 0 7
Research and Development, ARUP Laboratories 0 47 3 4 0 0 0 7
Broad Institute Rare Disease Group, Broad Institute 0 13 0 5 2 0 0 7
Practice for Gait Abnormalities, David Pomarino,Competency Network Toe Walking c/o Practice Pomarino 0 3 0 0 4 0 3 7
Center for Human Genetics, Inc,Center for Human Genetics, Inc 0 5 0 3 3 0 0 6
Developmental Genetics Unit,King Faisal Specialist Hospital & Research Centre 0 1 0 1 0 0 5 6
Northcott Neuroscience Laboratory, ANZAC Research Institute 0 0 3 1 1 0 1 6
Research Molecular Genetics Laboratory,Women's College Hospital, University of Toronto 0 15 0 4 2 0 0 6
Institute for Genomic Medicine (IGM) Clinical Laboratory,Nationwide Children's Hospital 0 7 0 6 0 0 0 6
Cancer Genetics and Genomics Laboratory,British Columbia Cancer Agency 0 67 0 5 0 0 0 5
Department of Pathology and Molecular Medicine,Queen's University 0 14 0 3 2 0 0 5
Genome Diagnostics Laboratory,VU University Medical Center Amsterdam 0 16 0 5 0 0 0 5
Cavalleri Lab, Royal College of Surgeons in Ireland 0 2 0 1 0 0 4 5
Myriad Women's Health, Inc. 0 17 0 5 0 0 0 5
Department of Vascular Biology,Beijing Anzhen Hospital 0 0 0 5 0 0 0 5
King Laboratory,University of Washington 0 1 0 2 2 0 0 4
Knight Diagnostic Laboratories, Oregon Health and Sciences University 0 17 0 1 2 0 1 4
Institute of Human Genetics, University of Leipzig Medical Center 0 11 0 1 3 0 0 4
SIB Swiss Institute of Bioinformatics 0 6 0 2 2 0 0 4
Gharavi Laboratory,Columbia University 0 11 0 2 0 0 2 4
Claritas Genomics 0 6 0 3 0 0 0 3
Molecular Diagnostics Lab,Nemours Alfred I. duPont Hospital for Children 0 11 0 1 0 0 2 3
Elsea Laboratory,Baylor College of Medicine 0 0 0 0 0 0 3 3
University of Washington Center for Mendelian Genomics, University of Washington 0 2 0 2 0 0 1 3
Equipe Genetique des Anomalies du Developpement, Université de Bourgogne 0 1 0 2 0 0 1 3
Inherited Neuropathy Consortium 0 2 0 0 2 0 1 3
Greenwood Genetic Center Diagnostic Laboratories,Greenwood Genetic Center 0 27 0 0 1 0 1 2
Clinical Molecular Genetics Laboratory,Johns Hopkins All Children's Hospital 0 11 0 0 2 0 0 2
Wellcome Centre for Mitochondrial Research,Newcastle University 0 4 0 2 0 0 0 2
Agnes Ginges Centre for Molecular Cardiology,Centenary Institute 0 1 0 2 0 0 0 2
HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology 0 3 0 1 0 0 1 2
Lupski Lab, Baylor-Hopkins CMG, Baylor College of Medicine 0 1 0 0 0 0 2 2
Genome Sciences Centre,British Columbia Cancer Agency 0 0 0 1 0 0 1 2
Baylor-Hopkins Center for Mendelian Genomics,Johns Hopkins University 0 0 0 1 1 0 0 2
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego 0 3 0 1 0 0 1 2
SingHealth Duke-NUS Institute of Precision Medicine 0 0 0 0 1 0 1 2
Medical Genetics Summaries 0 0 0 0 0 2 0 2
UNC Molecular Genetics Laboratory,University of North Carolina at Chapel Hill 0 7 0 1 1 0 0 2
University of Washington Department of Laboratory Medicine, University of Washington 0 4 0 0 0 1 1 2
Center for Advanced Laboratory Medicine, UC San Diego Health,University of California San Diego 0 2 0 2 0 0 0 2
HLA Laboratory, Instituto Nacional de Enfermedades Respiratorias Ismael Cosio Villegas 0 0 0 0 2 0 0 2
MAGI's Lab - Research,MAGI Group 0 6 0 0 0 0 2 2
Paris Brain Institute,Inserm - ICM 0 0 0 0 2 0 0 2
Molecular Genetics Laboratory,BC Children's and BC Women's Hospitals 0 3 0 1 0 0 0 1
FirmaLab,FirmaLab 0 0 0 0 0 1 0 1
Centogene AG - the Rare Disease Company 0 5 0 1 0 0 0 1
Versiti Diagnostic Laboratories,Versiti, Inc 0 0 0 0 0 0 1 1
Richard Lifton Laboratory, Yale University School of Medicine 0 0 1 0 0 0 0 1
Eye Genetics Research Group,Children's Medical Research Institute 0 0 0 0 1 0 0 1
GenMed Metabolism Lab 0 2 0 1 0 0 0 1
Department of Psychiatry,Nagoya University 0 0 0 0 0 0 1 1
Center for Genetic Medicine Research,Children's National Medical Center 0 0 0 0 1 0 0 1
Center for Medical Genetics Ghent,University of Ghent 0 0 0 0 0 0 1 1
Vavilov Institute of General Genetics RAS, Laboratory of Evolutional Genomics 0 0 0 0 0 1 0 1
Division of Human Genetics,Children's Hospital of Philadelphia 0 6 0 0 0 0 1 1
Foundation Medicine, Inc. 0 0 0 0 1 0 0 1
Foundation for Research in Genetics and Endocrinology, FRIGE's Institute of Human Genetics 0 0 0 0 1 0 0 1
Laboratory of Genetics and Molecular Cardiology, University of São Paulo 0 0 0 1 0 0 0 1
National Institute on Deafness and Communication Disorders,National Institutes of Health 0 0 0 0 1 0 0 1
Forensic Genetics Laboratory,Harris County Institute of Forensic Sciences 0 0 0 0 0 0 1 1
Soonchunhyang University Bucheon Hospital,Soonchunhyang University Medical Center 0 1 0 0 1 0 0 1
Bioscientia Institut fuer Medizinische Diagnostik GmbH,Sonic Healthcare 0 2 0 0 0 0 1 1
Pediatric Highly Intensive Care Unit,Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico 0 0 0 0 0 0 1 1
Daryl Scott Lab,Baylor College of Medicine 0 0 0 0 0 0 1 1
Neurogenetics Laboratory - MEYER,AOU Meyer 0 0 0 0 0 0 1 1
Undiagnosed Diseases Network,NIH 0 0 0 0 0 0 1 1
Endocrine oncology group, Uppsala University 0 0 0 1 0 0 0 1
Laboratoire de Génétique Moléculaire, CHU Bordeaux 0 1 0 1 0 0 0 1
Geisinger Autism and Developmental Medicine Institute,Geisinger Health System 0 0 0 0 1 0 1 1
Rare Disease Group, Clinical Genetics,Karolinska Institutet 0 1 0 0 1 0 1 1
Snyder Lab, Genetics Department,Stanford University 0 0 0 1 0 0 0 1
Institute of Cellular and Molecular Medicine,Copenhagen University 0 0 0 0 0 0 1 1
Flegel Lab,National Institutes of Health 0 0 0 0 0 0 1 1
Institute for Genomic Medicine, Nationwide Children's Hospital 0 1 0 0 0 0 1 1
Biochemical Molecular Genetic Laboratory,King Abdulaziz Medical City 0 4 0 1 0 0 0 1
Medical Genetics Lab,Policlinico S. Orsola.Malpighi 0 0 0 0 0 0 1 1
Medical Cytogenetics and Molecular Genetics Laboratory,IRCCS Istituto Auxologico Italiano 0 0 0 0 1 0 0 1
3DMed Clinical Laboratory Inc 0 3 0 0 1 0 0 1
Molecular Diagnostics Laboratory, M Health Fairview: University of Minnesota 0 2 0 1 0 0 0 1
Department of Genetics,Sultan Qaboos University Hospital, Oman 0 0 0 0 0 0 1 1
St. Jude Clinical Genomics Lab, St. Jude Children's Research Hospital 0 5 0 0 1 0 0 1
ClinGen Hearing Loss Variant Curation Expert Panel 0 1 0 0 0 0 1 1
Molecular Pathology Diagnostics Labratory,University of Iowa Hospitals & Clinics 0 0 0 0 0 0 1 1
Center for Reproductive Medicine,Shandong Provincial Hospital Affiliated to Shandong University 0 0 0 0 0 0 1 1
University of Iowa Renal Genetics Clinic,University of Iowa 0 0 0 0 1 0 0 1
Biochemistry Laboratory of CDMU,Chengde Medical University 0 0 0 0 0 0 1 1
Institute for Genomic Statistics and Bioinformatics, University Hospital Bonn 0 0 0 1 0 0 0 1
Reproductive Health Research and Development,BGI Genomics 0 5 0 0 1 0 0 1
CZECANCA consortium 0 24 0 0 0 0 1 1
UT Southwestern Medical Center, UT Southwestern Medical Center 0 0 0 0 0 1 0 1
Swedish Neurofibromatosis Center,Swedish Medical Center 0 0 0 0 0 0 1 1
Central Laboratory,The First Hospital of Lanzhou University 0 0 0 0 0 0 1 1
Suna and Inan Kirac Foundation Neurodegeneration Research Laboratory, Koc University 0 0 0 0 0 0 1 1
New York Genome Center 0 6 0 0 0 0 1 1
Genetics and Prenatal Diagnosis Center,The First Affiliated Hospital of Zhengzhou University 0 0 0 0 0 0 1 1
Nilou-Genome Lab 0 1 0 0 1 0 0 1
Molecular Biology Laboratory, Fundació Puigvert 0 4 0 1 0 0 0 1
Pars Genome Lab 0 2 0 1 0 0 0 1
Faculty of Health Sciences,Beirut Arab University 0 0 0 1 0 0 0 1
Dept. Genetics and Cancer, Menzies Institute for Medical Research,University of Tasmania 0 0 0 0 1 0 0 1
Wilkie Group, Clinical Genetics Lab, WIMM,University of Oxford 0 0 0 0 0 0 1 1
Center for Genomic Medicine,King Faisal Specialist Hospital and Research Center 0 0 0 0 0 0 1 1

All variants with conflicting interpretations #

Total variants: 4038
Download table as spreadsheet
HGVS dbSNP
NC_000011.10:g.5225460A>C rs560643693
NC_000011.9:g.5248383C>A
NC_012920.1:m.14484T>C rs199476104
NM_000016.5(ACADM):c.*77C>T rs143911981
NM_000016.5(ACADM):c.1052C>T (p.Thr351Ile) rs766140986
NM_000016.5(ACADM):c.118+18T>A rs755405418
NM_000016.5(ACADM):c.1189T>A (p.Tyr397Asn) rs759158371
NM_000016.5(ACADM):c.1221_1222del (p.Arg408fs) rs875989860
NM_000016.5(ACADM):c.127G>A (p.Glu43Lys) rs147559466
NM_000016.5(ACADM):c.157C>T (p.Arg53Cys) rs398123072
NM_000016.5(ACADM):c.158G>A (p.Arg53His) rs754938068
NM_000016.5(ACADM):c.250C>T (p.Leu84Phe) rs762114560
NM_000016.5(ACADM):c.347G>A (p.Cys116Tyr) rs875989859
NM_000016.5(ACADM):c.362C>T (p.Thr121Ile) rs121434283
NM_000016.5(ACADM):c.387+1del rs786204424
NM_000016.5(ACADM):c.388-3T>G rs764942250
NM_000016.5(ACADM):c.395C>G (p.Pro132Arg) rs875989854
NM_000016.5(ACADM):c.443G>A (p.Arg148Lys) rs778906552
NM_000016.5(ACADM):c.447G>T (p.Met149Ile) rs121434277
NM_000016.5(ACADM):c.469-9A>G rs181322317
NM_000016.5(ACADM):c.526G>T (p.Ala176Ser) rs200754053
NM_000016.5(ACADM):c.558T>A (p.Asn186Lys) rs754359356
NM_000016.5(ACADM):c.580A>G (p.Asn194Asp) rs773677327
NM_000016.5(ACADM):c.583G>A (p.Gly195Arg) rs121434278
NM_000016.5(ACADM):c.600-18G>A rs370523609
NM_000016.5(ACADM):c.609A>C (p.Leu203Phe) rs751829413
NM_000016.5(ACADM):c.616C>T (p.Arg206Cys) rs373715782
NM_000016.5(ACADM):c.678A>G (p.Ala226=) rs2229249
NM_000016.5(ACADM):c.683C>A (p.Thr228Asn) rs149678400
NM_000016.5(ACADM):c.755T>G (p.Phe252Cys) rs780510026
NM_000016.5(ACADM):c.757G>A (p.Glu253Lys) rs768884003
NM_000016.5(ACADM):c.797A>G (p.Asp266Gly) rs201375579
NM_000016.5(ACADM):c.799G>A (p.Gly267Arg) rs121434274
NM_000016.5(ACADM):c.817_829del (p.Ala273fs) rs875989872
NM_000016.5(ACADM):c.881G>C (p.Arg294Thr) rs779759347
NM_000016.5(ACADM):c.926dup (p.Gly310fs) rs875989864
NM_000016.5(ACADM):c.928G>A (p.Gly310Arg) rs747268471
NM_000016.5(ACADM):c.984del (p.Met328fs) rs747610156
NM_000016.6(ACADM):c.199T>C (p.Tyr67His) rs121434280
NM_000016.6(ACADM):c.201T>A (p.Tyr67Ter) rs754833969
NM_000016.6(ACADM):c.424AAG[2] (p.Lys144del) rs875989857
NM_000016.6(ACADM):c.985A>G (p.Lys329Glu) rs77931234
NM_000017.4(ACADS):c.511C>T (p.Arg171Trp) rs1800556
NM_000017.4(ACADS):c.625G>A (p.Gly209Ser) rs1799958
NM_000018.4(ACADVL):c.1001T>G (p.Met334Arg) rs398123079
NM_000018.4(ACADVL):c.1066A>G (p.Ile356Val) rs150140386
NM_000018.4(ACADVL):c.1096C>T (p.Arg366Cys) rs771874163
NM_000018.4(ACADVL):c.1097G>A (p.Arg366His) rs112406105
NM_000018.4(ACADVL):c.1103A>C (p.Gln368Pro) rs776063244
NM_000018.4(ACADVL):c.1153C>T (p.Arg385Trp) rs745832866
NM_000018.4(ACADVL):c.1182+17C>A rs191276923
NM_000018.4(ACADVL):c.1182+1G>A rs113690956
NM_000018.4(ACADVL):c.1226C>T (p.Thr409Met)
NM_000018.4(ACADVL):c.1273G>A (p.Ala425Thr) rs138834083
NM_000018.4(ACADVL):c.1316G>A (p.Gly439Asp) rs533055438
NM_000018.4(ACADVL):c.1328T>G (p.Met443Arg) rs886043236
NM_000018.4(ACADVL):c.1349G>A (p.Arg450His) rs118204016
NM_000018.4(ACADVL):c.1376G>A (p.Arg459Gln) rs751995154
NM_000018.4(ACADVL):c.1388G>A (p.Gly463Glu) rs200366828
NM_000018.4(ACADVL):c.1405C>T (p.Arg469Trp) rs113994170
NM_000018.4(ACADVL):c.1434+14T>A rs202217537
NM_000018.4(ACADVL):c.1473A>G (p.Leu491=) rs150518187
NM_000018.4(ACADVL):c.1531C>T (p.Arg511Trp) rs771025937
NM_000018.4(ACADVL):c.1600G>A (p.Glu534Lys) rs2230180
NM_000018.4(ACADVL):c.1678+15C>T rs371402802
NM_000018.4(ACADVL):c.1679-6G>A rs113994171
NM_000018.4(ACADVL):c.1700G>A (p.Arg567Gln) rs398123084
NM_000018.4(ACADVL):c.1748C>T (p.Ser583Leu) rs1085307648
NM_000018.4(ACADVL):c.1837C>T (p.Arg613Trp) rs118204014
NM_000018.4(ACADVL):c.1844G>A (p.Arg615Gln) rs148584617
NM_000018.4(ACADVL):c.1878G>A (p.Trp626Ter) rs1555529186
NM_000018.4(ACADVL):c.1882del (p.Gln628fs) rs1597541142
NM_000018.4(ACADVL):c.308A>G (p.Lys103Arg) rs140566084
NM_000018.4(ACADVL):c.364A>G (p.Asn122Asp) rs1057520088
NM_000018.4(ACADVL):c.385GAG[1] (p.Glu130del) rs387906251
NM_000018.4(ACADVL):c.520G>A (p.Val174Met) rs369560930
NM_000018.4(ACADVL):c.538G>A (p.Ala180Thr) rs727503791
NM_000018.4(ACADVL):c.553G>A (p.Gly185Ser) rs545215807
NM_000018.4(ACADVL):c.62+9G>A rs369512281
NM_000018.4(ACADVL):c.63-35G>A rs774905326
NM_000018.4(ACADVL):c.636C>T (p.Ala212=) rs76547988
NM_000018.4(ACADVL):c.664G>A (p.Gly222Arg) rs398123091
NM_000018.4(ACADVL):c.779C>T (p.Thr260Met) rs113994168
NM_000018.4(ACADVL):c.865G>A (p.Gly289Arg) rs200788251
NM_000018.4(ACADVL):c.881G>A (p.Gly294Glu) rs200573371
NM_000018.4(ACADVL):c.889_891del (p.Glu297del) rs796051914
NM_000018.4(ACADVL):c.932del (p.Phe311fs) rs764488310
NM_000018.4(ACADVL):c.956C>A (p.Ser319Ter) rs149467828
NM_000020.2(ACVRL1):c.-52G>A rs573048639
NM_000020.2(ACVRL1):c.1135G>A (p.Glu379Lys) rs1131691686
NM_000020.2(ACVRL1):c.1219G>A (p.Glu407Lys) rs1057521203
NM_000020.2(ACVRL1):c.1231C>T (p.Arg411Trp) rs121909287
NM_000020.2(ACVRL1):c.632G>A (p.Gly211Asp) rs28936687
NM_000020.2(ACVRL1):c.706G>A (p.Glu236Lys) rs1592223490
NM_000020.3(ACVRL1):c.1132C>T (p.Pro378Ser) rs959973779
NM_000020.3(ACVRL1):c.1445C>T (p.Ala482Val) rs139142865
NM_000022.2(ADA):c.22G>A (p.Asp8Asn) rs73598374
NM_000023.4(SGCA):c.408C>T (p.Ala136=) rs143551687
NM_000023.4(SGCA):c.421C>A (p.Arg141Ser) rs35130237
NM_000033.4(ABCD1):c.1628C>T (p.Pro543Leu) rs1557054776
NM_000033.4(ABCD1):c.1771C>T (p.Arg591Trp) rs398123106
NM_000033.4(ABCD1):c.1866-10G>A rs398123108
NM_000033.4(ABCD1):c.258C>T (p.Val86=) rs200660869
NM_000033.4(ABCD1):c.757C>G (p.Leu253Val) rs150151955
NM_000033.4(ABCD1):c.823C>T (p.Arg275Trp) rs782083931
NM_000033.4(ABCD1):c.838C>T (p.Arg280Cys) rs193922098
NM_000037.4(ANK1):c.1153C>T (p.Arg385Cys) rs142626656
NM_000037.4(ANK1):c.2211C>G (p.Pro737=) rs34194642
NM_000037.4(ANK1):c.2403G>A (p.Lys801=) rs147130318
NM_000037.4(ANK1):c.3102C>T (p.Asn1034=) rs145169484
NM_000037.4(ANK1):c.3224C>T (p.Thr1075Ile) rs35213384
NM_000037.4(ANK1):c.3399C>T (p.Thr1133=) rs117516263
NM_000037.4(ANK1):c.4385C>T (p.Ala1462Val) rs34664882
NM_000037.4(ANK1):c.499G>C (p.Gly167Arg) rs201024919
NM_000037.4(ANK1):c.5544+91C>T rs72638959
NM_000037.4(ANK1):c.654C>A (p.Asn218Lys) rs61735313
NM_000038.6(APC):c.120G>A (p.Glu40=) rs142720069
NM_000038.6(APC):c.1604C>T (p.Ser535Phe) rs75870842
NM_000038.6(APC):c.1866C>A (p.Tyr622Ter) rs876658355
NM_000038.6(APC):c.1959G>A (p.Arg653=) rs72541809
NM_000038.6(APC):c.2232T>G (p.Ser744=) rs145751759
NM_000038.6(APC):c.2547_2550del (p.Asp849fs) rs398123118
NM_000038.6(APC):c.2593C>T (p.Pro865Ser) rs192620988
NM_000038.6(APC):c.2608C>T (p.Pro870Ser) rs33974176
NM_000038.6(APC):c.2805C>T (p.Tyr935=) rs137854575
NM_000038.6(APC):c.295C>T (p.Arg99Trp) rs139196838
NM_000038.6(APC):c.3006C>T (p.Ala1002=) rs72541810
NM_000038.6(APC):c.311C>G (p.Ser104Ter) rs74953290
NM_000038.6(APC):c.3165A>T (p.Ile1055=) rs61734287
NM_000038.6(APC):c.3374T>C (p.Val1125Ala) rs377278397
NM_000038.6(APC):c.3386T>C (p.Leu1129Ser) rs143638171
NM_000038.6(APC):c.3462AGA[2] (p.Glu1157del) rs386833391
NM_000038.6(APC):c.3471G>A (p.Glu1157=) rs143927847
NM_000038.6(APC):c.3511C>T (p.Arg1171Cys) rs201830995
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000038.6(APC):c.3949G>C (p.Glu1317Gln) rs1801166
NM_000038.6(APC):c.4326T>A (p.Pro1442=) rs67622085
NM_000038.6(APC):c.4420G>A (p.Ala1474Thr) rs139387758
NM_000038.6(APC):c.4732T>G (p.Cys1578Gly) rs138367627
NM_000038.6(APC):c.4905G>A (p.Gly1635=) rs137988845
NM_000038.6(APC):c.5265G>A (p.Ala1755=) rs34506289
NM_000038.6(APC):c.532-32T>C rs112108777
NM_000038.6(APC):c.5465T>A (p.Val1822Asp) rs459552
NM_000038.6(APC):c.6669A>G (p.Ser2223=) rs372680843
NM_000038.6(APC):c.6821C>T (p.Ala2274Val) rs34919187
NM_000038.6(APC):c.6921G>A (p.Ser2307=) rs2229993
NM_000038.6(APC):c.705A>G (p.Leu235=) rs147036141
NM_000038.6(APC):c.721G>A (p.Glu241Lys) rs777603154
NM_000038.6(APC):c.7415C>T (p.Ala2472Val) rs200399245
NM_000038.6(APC):c.7504G>A (p.Gly2502Ser) rs2229995
NM_000038.6(APC):c.7514G>A (p.Arg2505Gln) rs147549623
NM_000038.6(APC):c.7786T>G (p.Ser2596Ala) rs138137162
NM_000038.6(APC):c.7862C>G (p.Ser2621Cys) rs72541816
NM_000038.6(APC):c.933+30A>G rs145211300
NM_000047.3(ARSL):c.-14GA[3] rs200332753
NM_000051.3(ATM):c.1229T>C (p.Val410Ala) rs56128736
NM_000051.3(ATM):c.162T>C (p.Tyr54=) rs3218690
NM_000051.3(ATM):c.1986T>C (p.Phe662=) rs1800055
NM_000051.3(ATM):c.2119T>C (p.Ser707Pro) rs4986761
NM_000051.3(ATM):c.2251-10T>G rs730881346
NM_000051.3(ATM):c.2572T>C (p.Phe858Leu) rs1800056
NM_000051.3(ATM):c.2608A>G (p.Asn870Asp) rs61734354
NM_000051.3(ATM):c.3118A>G (p.Met1040Val) rs3092857
NM_000051.3(ATM):c.3383A>G (p.Gln1128Arg) rs2229020
NM_000051.3(ATM):c.370A>G (p.Ile124Val) rs148590073
NM_000051.3(ATM):c.378T>A (p.Asp126Glu) rs2234997
NM_000051.3(ATM):c.4138C>T (p.His1380Tyr) rs3092856
NM_000051.3(ATM):c.4258C>T (p.Leu1420Phe) rs1800058
NM_000051.3(ATM):c.5558A>T (p.Asp1853Val) rs1801673
NM_000051.3(ATM):c.6088A>G (p.Ile2030Val) rs145847315
NM_000051.3(ATM):c.609C>T (p.Asp203=) rs144709948
NM_000051.3(ATM):c.6382T>C (p.Leu2128=) rs753646931
NM_000051.3(ATM):c.6919C>T (p.Leu2307Phe) rs56009889
NM_000051.3(ATM):c.7271T>G (p.Val2424Gly) rs28904921
NM_000051.3(ATM):c.7390T>C (p.Cys2464Arg) rs55801750
NM_000051.3(ATM):c.7475T>G (p.Leu2492Arg) rs56399857
NM_000051.3(ATM):c.7592T>C (p.Met2531Thr) rs587781365
NM_000051.3(ATM):c.7630-17T>C rs116047570
NM_000051.3(ATM):c.7788+8G>T rs112775908
NM_000051.3(ATM):c.9006C>T (p.Phe3002=) rs540172506
NM_000051.3(ATM):c.998C>T (p.Ser333Phe) rs28904919
NM_000051.4(ATM):c.1066-6T>G rs201686625
NM_000051.4(ATM):c.146C>G rs1800054
NM_000051.4(ATM):c.1810C>T (p.Pro604Ser) rs2227922
NM_000051.4(ATM):c.2932T>C (p.Ser978Pro) rs139552233
NM_000051.4(ATM):c.3925G>A (p.Ala1309Thr) rs149711770
NM_000051.4(ATM):c.4388T>G (p.Phe1463Cys) rs138327406
NM_000051.4(ATM):c.4424A>G (p.Tyr1475Cys) rs34640941
NM_000051.4(ATM):c.4578C>T (p.Pro1526=) rs1800889
NM_000051.4(ATM):c.5071A>C (p.Ser1691Arg) rs1800059
NM_000051.4(ATM):c.5557G>A (p.Asp1853Asn) rs1801516
NM_000051.4(ATM):c.5793T>C (p.Ala1931=) rs3092910
NM_000051.4(ATM):c.5821G>C (p.Val1941Leu) rs147187700
NM_000051.4(ATM):c.6795C>T rs3218699
NM_000052.7(ATP7A):c.1737A>G (p.Val579=) rs189353691
NM_000052.7(ATP7A):c.2903A>G (p.Glu968Gly) rs138958687
NM_000052.7(ATP7A):c.4414C>T (p.Arg1472Cys) rs782062633
NM_000053.4(ATP7B):c.122A>G (p.Asn41Ser) rs201738967
NM_000053.4(ATP7B):c.1278C>T (p.Val426=) rs143556945
NM_000053.4(ATP7B):c.1620C>T (p.Leu540=) rs145798966
NM_000053.4(ATP7B):c.1707+2dup rs781531824
NM_000053.4(ATP7B):c.1922T>C (p.Leu641Ser) rs186924074
NM_000053.4(ATP7B):c.1934T>G (p.Met645Arg) rs121907998
NM_000053.4(ATP7B):c.1993A>G (p.Met665Val) rs146303208
NM_000053.4(ATP7B):c.1995G>A (p.Met665Ile) rs72552259
NM_000053.4(ATP7B):c.19_20del (p.Gln7fs) rs749363958
NM_000053.4(ATP7B):c.2029G>A (p.Glu677Lys)
NM_000053.4(ATP7B):c.2072G>T (p.Gly691Val) rs1555291801
NM_000053.4(ATP7B):c.2145C>T (p.Tyr715=) rs751202110
NM_000053.4(ATP7B):c.2175G>A (p.Arg725=) rs61733684
NM_000053.4(ATP7B):c.2294A>G (p.Asp765Gly) rs1555291147
NM_000053.4(ATP7B):c.2297C>T (p.Thr766Met) rs121907997
NM_000053.4(ATP7B):c.2305A>G (p.Met769Val) rs193922103
NM_000053.4(ATP7B):c.2355+13T>G rs139211339
NM_000053.4(ATP7B):c.2383C>T (p.Leu795Phe) rs751710854
NM_000053.4(ATP7B):c.2544C>T (p.Gly848=) rs200996053
NM_000053.4(ATP7B):c.2605G>A (p.Gly869Arg) rs191312027
NM_000053.4(ATP7B):c.2662A>C (p.Thr888Pro) rs1455758826
NM_000053.4(ATP7B):c.2681C>T (p.Thr894Ile) rs1340729837
NM_000053.4(ATP7B):c.2731-2A>G rs367956522
NM_000053.4(ATP7B):c.2804C>T (p.Thr935Met) rs750019452
NM_000053.4(ATP7B):c.2953T>C (p.Cys985Arg) rs193922104
NM_000053.4(ATP7B):c.2955C>T (p.Cys985=) rs116587608
NM_000053.4(ATP7B):c.2972C>T (p.Thr991Met) rs41292782
NM_000053.4(ATP7B):c.2976C>A (p.Pro992=) rs746358240
NM_000053.4(ATP7B):c.3007G>A (p.Ala1003Thr) rs201497300
NM_000053.4(ATP7B):c.3015C>T (p.Asn1005=) rs74085888
NM_000053.4(ATP7B):c.3045G>A (p.Leu1015=) rs1801248
NM_000053.4(ATP7B):c.3060+16G>T rs76163470
NM_000053.4(ATP7B):c.3101A>G (p.His1034Arg) rs74085882
NM_000053.4(ATP7B):c.314C>A (p.Ser105Ter) rs753236073
NM_000053.4(ATP7B):c.3191A>C (p.Glu1064Ala) rs374094065
NM_000053.4(ATP7B):c.3207C>A (p.His1069Gln) rs76151636
NM_000053.4(ATP7B):c.3263T>A (p.Leu1088Ter) rs753250853
NM_000053.4(ATP7B):c.3272G>A (p.Cys1091Tyr) rs778825095
NM_000053.4(ATP7B):c.3301G>A (p.Gly1101Arg) rs786204483
NM_000053.4(ATP7B):c.3369G>A (p.Pro1123=) rs61733679
NM_000053.4(ATP7B):c.3402C>T (p.Pro1134=) rs145887771
NM_000053.4(ATP7B):c.3403G>A (p.Ala1135Thr) rs187200982
NM_000053.4(ATP7B):c.3405A>G (p.Ala1135=) rs373081328
NM_000053.4(ATP7B):c.3556G>A (p.Gly1186Ser) rs786204547
NM_000053.4(ATP7B):c.3557-6C>T rs140708492
NM_000053.4(ATP7B):c.3620A>G (p.His1207Arg) rs7334118
NM_000053.4(ATP7B):c.3646G>A (p.Val1216Met) rs776280797
NM_000053.4(ATP7B):c.3649_3654del (p.Val1217_Leu1218del) rs781266802
NM_000053.4(ATP7B):c.3688A>G (p.Ile1230Val) rs200911496
NM_000053.4(ATP7B):c.3694A>C (p.Thr1232Pro) rs568009639
NM_000053.4(ATP7B):c.3786C>T (p.Val1262=) rs375007352
NM_000053.4(ATP7B):c.3889G>A (p.Val1297Ile) rs148399850
NM_000053.4(ATP7B):c.3891C>T (p.Val1297=) rs114771537
NM_000053.4(ATP7B):c.4213G>A (p.Gly1405Ser) rs189601972
NM_000053.4(ATP7B):c.4301C>T (p.Thr1434Met) rs60986317
NM_000053.4(ATP7B):c.4311G>A (p.Lys1437=) rs73202048
NM_000053.4(ATP7B):c.524_525del (p.Lys175fs) rs558037268
NM_000053.4(ATP7B):c.628A>G (p.Ile210Val) rs61733680
NM_000053.4(ATP7B):c.778dup (p.Gln260fs) rs786204570
NM_000059.3(BRCA2):c.*14C>T rs373436334
NM_000059.3(BRCA2):c.-11C>T rs76874770
NM_000059.3(BRCA2):c.10111A>G (p.Thr3371Ala) rs80358393
NM_000059.3(BRCA2):c.1021T>C (p.Cys341Arg) rs55833327
NM_000059.3(BRCA2):c.10240A>G (p.Thr3414Ala) rs80358405
NM_000059.3(BRCA2):c.1040A>G (p.Gln347Arg) rs55800493
NM_000059.3(BRCA2):c.1167G>A (p.Pro389=) rs148607710
NM_000059.3(BRCA2):c.1275A>G (p.Glu425=) rs34355306
NM_000059.3(BRCA2):c.1788T>C (p.Asp596=) rs11571642
NM_000059.3(BRCA2):c.1889C>T (p.Thr630Ile) rs80358479
NM_000059.3(BRCA2):c.1911T>C (p.Gly637=) rs11571652
NM_000059.3(BRCA2):c.2025A>G (p.Thr675=) rs147381487
NM_000059.3(BRCA2):c.2138A>T (p.Gln713Leu) rs55816687
NM_000059.3(BRCA2):c.2208A>G (p.Ala736=) rs144984153
NM_000059.3(BRCA2):c.2320A>G (p.Thr774Ala) rs55968715
NM_000059.3(BRCA2):c.2490C>T (p.Asn830=) rs56331088
NM_000059.3(BRCA2):c.2680G>A (p.Val894Ile) rs28897715
NM_000059.3(BRCA2):c.2803G>C (p.Asp935His) rs28897716
NM_000059.3(BRCA2):c.2817C>T (p.Thr939=) rs367921107
NM_000059.3(BRCA2):c.316+12A>G rs186419778
NM_000059.3(BRCA2):c.3326C>T (p.Ala1109Val) rs41293479
NM_000059.3(BRCA2):c.3417G>A (p.Lys1139=) rs145625991
NM_000059.3(BRCA2):c.3420T>C (p.Ser1140=) rs118093942
NM_000059.3(BRCA2):c.3539A>G (p.Lys1180Arg) rs28897720
NM_000059.3(BRCA2):c.3575T>G (p.Phe1192Cys) rs80358606
NM_000059.3(BRCA2):c.3661T>C (p.Ser1221Pro) rs80358611
NM_000059.3(BRCA2):c.3672C>T (p.Gly1224=) rs587780650
NM_000059.3(BRCA2):c.4061C>T (p.Thr1354Met) rs80358656
NM_000059.3(BRCA2):c.4090A>C (p.Ile1364Leu) rs56248502
NM_000059.3(BRCA2):c.4241C>T (p.Thr1414Met) rs70953664
NM_000059.3(BRCA2):c.425+33A>G rs200065709
NM_000059.3(BRCA2):c.426-37T>A rs81002859
NM_000059.3(BRCA2):c.4271C>G (p.Ser1424Cys) rs80358664
NM_000059.3(BRCA2):c.4314C>T (p.Val1438=) rs730881590
NM_000059.3(BRCA2):c.4584C>T (p.Ser1528=) rs80359788
NM_000059.3(BRCA2):c.4686A>G (p.Gln1562=) rs28897730
NM_000059.3(BRCA2):c.476-9dup rs276174849
NM_000059.3(BRCA2):c.4977C>T (p.Ser1659=) rs45484897
NM_000059.3(BRCA2):c.517-19C>T rs11571623
NM_000059.3(BRCA2):c.5414A>G (p.Asn1805Ser) rs80358765
NM_000059.3(BRCA2):c.5427C>T (p.Cys1809=) rs80359791
NM_000059.3(BRCA2):c.5455C>T (p.Pro1819Ser) rs80358768
NM_000059.3(BRCA2):c.5498A>G (p.Asn1833Ser) rs587782601
NM_000059.3(BRCA2):c.5552T>G (p.Ile1851Ser) rs80358776
NM_000059.3(BRCA2):c.5704G>A (p.Asp1902Asn) rs4987048
NM_000059.3(BRCA2):c.5710C>G (p.Leu1904Val) rs55875643
NM_000059.3(BRCA2):c.5879G>A (p.Cys1960Tyr) rs56157628
NM_000059.3(BRCA2):c.5896C>T (p.His1966Tyr) rs80358822
NM_000059.3(BRCA2):c.6057C>T (p.Asn2019=) rs147961615
NM_000059.3(BRCA2):c.6143A>T (p.Asn2048Ile) rs80358853
NM_000059.3(BRCA2):c.6323G>T (p.Arg2108Leu) rs35029074
NM_000059.3(BRCA2):c.6412G>T (p.Val2138Phe) rs11571659
NM_000059.3(BRCA2):c.6531T>A (p.Ile2177=) rs587780658
NM_000059.3(BRCA2):c.6675A>G (p.Thr2225=) rs28897741
NM_000059.3(BRCA2):c.67+62T>G rs11571574
NM_000059.3(BRCA2):c.6739A>G (p.Ser2247Gly) rs80358896
NM_000059.3(BRCA2):c.68-7dup rs276174878
NM_000059.3(BRCA2):c.6821G>T (p.Gly2274Val) rs55712212
NM_000059.3(BRCA2):c.6877T>C (p.Phe2293Leu) rs80358912
NM_000059.3(BRCA2):c.6921A>G (p.Ser2307=) rs181183366
NM_000059.3(BRCA2):c.6938-25_6938-19del rs762815401
NM_000059.3(BRCA2):c.6960G>A (p.Leu2320=) rs373134168
NM_000059.3(BRCA2):c.7007+18T>A rs377471435
NM_000059.3(BRCA2):c.7008-62A>G rs76584943
NM_000059.3(BRCA2):c.7052C>G (p.Ala2351Gly) rs80358932
NM_000059.3(BRCA2):c.7188G>T (p.Leu2396Phe) rs587780871
NM_000059.3(BRCA2):c.7317A>G (p.Gly2439=) rs587780660
NM_000059.3(BRCA2):c.7522G>A (p.Gly2508Ser) rs80358978
NM_000059.3(BRCA2):c.7630G>A (p.Gly2544Ser) rs587781485
NM_000059.3(BRCA2):c.7806-40A>G rs9590939
NM_000059.3(BRCA2):c.8124T>G (p.Thr2708=) rs587780662
NM_000059.3(BRCA2):c.8154T>C (p.Ile2718=) rs148880015
NM_000059.3(BRCA2):c.8352G>T (p.Arg2784=) rs747664806
NM_000059.3(BRCA2):c.8356G>A (p.Ala2786Thr) rs80359077
NM_000059.3(BRCA2):c.9253A>C (p.Thr3085Pro) rs397507423
NM_000059.3(BRCA2):c.9257-113T>G rs191553604
NM_000059.3(BRCA2):c.927A>G (p.Ser309=) rs80359806
NM_000059.3(BRCA2):c.9302T>G (p.Leu3101Arg) rs28897758
NM_000059.3(BRCA2):c.9411T>G (p.Thr3137=) rs1799968
NM_000059.3(BRCA2):c.9509A>G (p.Asp3170Gly) rs80359224
NM_000059.3(BRCA2):c.956A>C (p.Asn319Thr) rs55939572
NM_000059.3(BRCA2):c.9583A>G (p.Thr3195Ala) rs80359227
NM_000059.3(BRCA2):c.9592T>C (p.Cys3198Arg) rs80359229
NM_000059.3(BRCA2):c.9720T>C (p.Val3240=) rs80359810
NM_000059.3(BRCA2):c.9728C>T (p.Pro3243Leu) rs80359241
NM_000059.3(BRCA2):c.9738C>T (p.Ala3246=) rs80359811
NM_000059.3(BRCA2):c.9770A>G (p.Lys3257Arg) rs55847618
NM_000059.3(BRCA2):c.9924C>T (p.Tyr3308=) rs4987049
NM_000059.4(BRCA2):c.-15A>C rs138705202
NM_000059.4(BRCA2):c.10095delinsGAATTATATCT (p.Ser3366fs) rs276174803
NM_000059.4(BRCA2):c.10110G>A (p.Arg3370=) rs28897762
NM_000059.4(BRCA2):c.10202C>T (p.Thr3401Met) rs55853199
NM_000059.4(BRCA2):c.10203G>A (p.Thr3401=) rs147854265
NM_000059.4(BRCA2):c.10234A>G (p.Ile3412Val) rs1801426
NM_000059.4(BRCA2):c.1114A>C (p.Asn372His) rs144848
NM_000059.4(BRCA2):c.1151C>T (p.Ser384Phe) rs41293475
NM_000059.4(BRCA2):c.125A>G (p.Tyr42Cys) rs4987046
NM_000059.4(BRCA2):c.1362A>G (p.Lys454=) rs55919657
NM_000059.4(BRCA2):c.1395A>C (p.Val465=) rs11571641
NM_000059.4(BRCA2):c.1514T>C (p.Ile505Thr) rs28897708
NM_000059.4(BRCA2):c.1538A>G (p.Lys513Arg) rs28897709
NM_000059.4(BRCA2):c.1662T>G (p.Cys554Trp) rs80358451
NM_000059.4(BRCA2):c.175C>G (p.Pro59Ala) rs56091799
NM_000059.4(BRCA2):c.1786G>C (p.Asp596His) rs56328701
NM_000059.4(BRCA2):c.1792A>G (p.Thr598Ala) rs28897710
NM_000059.4(BRCA2):c.1798T>C (p.Tyr600His) rs75419644
NM_000059.4(BRCA2):c.179A>G (p.Asn60Ser) rs80358463
NM_000059.4(BRCA2):c.1909+22del rs276174816
NM_000059.4(BRCA2):c.1909+9_1909+10del rs527732001
NM_000059.4(BRCA2):c.1938C>T (p.Ser646=) rs28897711
NM_000059.4(BRCA2):c.1964C>G (p.Pro655Arg) rs28897712
NM_000059.4(BRCA2):c.223G>C (p.Ala75Pro) rs28897701
NM_000059.4(BRCA2):c.231T>G (p.Thr77=) rs114446594
NM_000059.4(BRCA2):c.2350A>G (p.Met784Val) rs11571653
NM_000059.4(BRCA2):c.2538A>C (p.Ser846=) rs11571654
NM_000059.4(BRCA2):c.2803G>A (p.Asp935Asn) rs28897716
NM_000059.4(BRCA2):c.2883G>A (p.Gln961=) rs11571655
NM_000059.4(BRCA2):c.2919G>A (p.Ser973=) rs45525041
NM_000059.4(BRCA2):c.2926_2927delinsAT (p.Ser976Ile) rs276174831
NM_000059.4(BRCA2):c.2957A>G (p.Asn986Ser) rs28897718
NM_000059.4(BRCA2):c.2971A>G (p.Asn991Asp) rs1799944
NM_000059.4(BRCA2):c.2987T>G (p.Leu996Arg) rs80358545
NM_000059.4(BRCA2):c.3055C>G (p.Leu1019Val) rs55638633
NM_000059.4(BRCA2):c.3264T>C (p.Pro1088=) rs36060526
NM_000059.4(BRCA2):c.3515C>T (p.Ser1172Leu) rs80358600
NM_000059.4(BRCA2):c.3516G>A (p.Ser1172=) rs1799952
NM_000059.4(BRCA2):c.3869G>A (p.Cys1290Tyr) rs41293485
NM_000059.4(BRCA2):c.4068G>A (p.Leu1356=) rs28897724
NM_000059.4(BRCA2):c.4143AGA[1] (p.Glu1382del) rs80359432
NM_000059.4(BRCA2):c.4187A>G (p.Gln1396Arg) rs55969723
NM_000059.4(BRCA2):c.4258G>T (p.Asp1420Tyr) rs28897727
NM_000059.4(BRCA2):c.440A>G (p.Gln147Arg) rs80358674
NM_000059.4(BRCA2):c.4464_4465del (p.His1488fs) rs397507720
NM_000059.4(BRCA2):c.4585G>A (p.Gly1529Arg) rs28897728
NM_000059.4(BRCA2):c.4614T>C (p.Ser1538=) rs45520945
NM_000059.4(BRCA2):c.4656T>C (p.Gly1552=) rs41293491
NM_000059.4(BRCA2):c.467A>G (p.Asp156Gly) rs68071147
NM_000059.4(BRCA2):c.5070A>C (p.Lys1690Asn) rs56087561
NM_000059.4(BRCA2):c.5198C>T (p.Ser1733Phe) rs55639415
NM_000059.4(BRCA2):c.5199C>T (p.Ser1733=) rs28897734
NM_000059.4(BRCA2):c.5312G>A (p.Gly1771Asp) rs80358755
NM_000059.4(BRCA2):c.5418A>G (p.Glu1806=) rs34351119
NM_000059.4(BRCA2):c.5612G>A (p.Ser1871Asn) rs80358782
NM_000059.4(BRCA2):c.5635G>A (p.Glu1879Lys) rs55996097
NM_000059.4(BRCA2):c.5640T>G (p.Asn1880Lys) rs11571657
NM_000059.4(BRCA2):c.5645C>A (p.Ser1882Ter) rs80358785
NM_000059.4(BRCA2):c.5744C>T (p.Thr1915Met) rs4987117
NM_000059.4(BRCA2):c.5785A>G (p.Ile1929Val) rs79538375
NM_000059.4(BRCA2):c.5869A>G (p.Ile1957Val) rs80358817
NM_000059.4(BRCA2):c.5946del (p.Ser1982fs) rs80359550
NM_000059.4(BRCA2):c.6100C>T (p.Arg2034Cys) rs1799954
NM_000059.4(BRCA2):c.6275_6276del rs11571658
NM_000059.4(BRCA2):c.6323G>A (p.Arg2108His) rs35029074
NM_000059.4(BRCA2):c.6347A>G (p.His2116Arg) rs55953736
NM_000059.4(BRCA2):c.658_659del rs80359604
NM_000059.4(BRCA2):c.68-7T>A rs81002830
NM_000059.4(BRCA2):c.6853A>G (p.Ile2285Val) rs56272235
NM_000059.4(BRCA2):c.7150C>A (p.Gln2384Lys) rs55977008
NM_000059.4(BRCA2):c.7319A>G (p.His2440Arg) rs4986860
NM_000059.4(BRCA2):c.7504C>T (p.Arg2502Cys) rs55716624
NM_000059.4(BRCA2):c.7544C>T (p.Thr2515Ile) rs28897744
NM_000059.4(BRCA2):c.8010G>A (p.Ser2670=) rs146430937
NM_000059.4(BRCA2):c.8092G>A (p.Ala2698Thr) rs80359052
NM_000059.4(BRCA2):c.8149G>T (p.Ala2717Ser) rs28897747
NM_000059.4(BRCA2):c.8182G>A (p.Val2728Ile) rs28897749
NM_000059.4(BRCA2):c.831T>G (p.Asn277Lys) rs28897705
NM_000059.4(BRCA2):c.8487+19A>G rs11571743
NM_000059.4(BRCA2):c.8503T>C (p.Ser2835Pro) rs11571746
NM_000059.4(BRCA2):c.8567A>C (p.Glu2856Ala) rs11571747
NM_000059.4(BRCA2):c.865A>C (p.Asn289His) rs766173
NM_000059.4(BRCA2):c.8830A>T (p.Ile2944Phe) rs4987047
NM_000059.4(BRCA2):c.8850G>T (p.Lys2950Asn) rs28897754
NM_000059.4(BRCA2):c.8851G>A (p.Ala2951Thr) rs11571769
NM_000059.4(BRCA2):c.8917C>T (p.Arg2973Cys) rs45469092
NM_000059.4(BRCA2):c.9038C>T (p.Thr3013Ile) rs28897755
NM_000059.4(BRCA2):c.9292T>C (p.Tyr3098His) rs41293521
NM_000059.4(BRCA2):c.9501+3A>T rs61757642
NM_000059.4(BRCA2):c.9586A>G (p.Lys3196Glu) rs80359228
NM_000059.4(BRCA2):c.9649-20C>T rs56177715
NM_000059.4(BRCA2):c.9699_9702del rs80359775
NM_000059.4(BRCA2):c.9730G>A (p.Val3244Ile) rs11571831
NM_000059.4(BRCA2):c.978C>A (p.Ser326Arg) rs28897706
NM_000059.4(BRCA2):c.9875C>T (p.Pro3292Leu) rs56121817
NM_000059.4(BRCA2):c.9976A>T (p.Lys3326Ter) rs11571833
NM_000059.4(BRCA2):c.9986A>G (p.Asn3329Ser) rs76635144
NM_000071.2(CBS):c.1059G>A (p.Thr353=) rs61735859
NM_000071.2(CBS):c.1257G>A (p.Leu419=) rs138432416
NM_000071.2(CBS):c.1266G>A (p.Pro422=) rs150146702
NM_000071.2(CBS):c.146C>T (p.Pro49Leu) rs148865119
NM_000071.2(CBS):c.215A>T (p.Lys72Ile) rs192232907
NM_000071.2(CBS):c.829-91G>A rs150181241
NM_000071.3(CBS):c.1080C>T (p.Ala360=) rs1801181
NM_000071.3(CBS):c.531+11G>A rs186114513
NM_000071.3(CBS):c.573G>A (p.Thr191=) rs73906420
NM_000074.2(CD40LG):c.-191A>C rs36206512
NM_000074.2(CD40LG):c.655G>A (p.Gly219Arg) rs148594123
NM_000077.4(CDKN2A):c.146T>C (p.Ile49Thr) rs199907548
NM_000077.4(CDKN2A):c.442G>A (p.Ala148Thr) rs3731249
NM_000088.3(COL1A1):c.1984-5C>A rs66592376
NM_000088.3(COL1A1):c.2115C>T (p.Asn705=) rs41316673
NM_000088.3(COL1A1):c.3099+7T>C rs201682029
NM_000088.3(COL1A1):c.3226G>A (p.Gly1076Ser) rs67394386
NM_000088.3(COL1A1):c.3479G>A (p.Gly1160Asp) rs886039726
NM_000088.3(COL1A1):c.3993C>T (p.Thr1331=) rs148659814
NM_000088.3(COL1A1):c.613C>G (p.Pro205Ala) rs72667032
NM_000088.3(COL1A1):c.904-9G>T rs141726413
NM_000089.3(COL1A2):c.1036-12A>G rs41316929
NM_000089.3(COL1A2):c.122G>A (p.Arg41His) rs139528613
NM_000089.3(COL1A2):c.2349+16G>C rs112603291
NM_000089.3(COL1A2):c.2904C>T (p.Pro968=) rs142352627
NM_000089.3(COL1A2):c.304C>T (p.Pro102Ser) rs189557655
NM_000089.3(COL1A2):c.3139G>A (p.Val1047Met) rs35820023
NM_000089.3(COL1A2):c.3313G>A (p.Gly1105Ser) rs139851311
NM_000089.3(COL1A2):c.3853A>C (p.Asn1285His) rs144797861
NM_000089.3(COL1A2):c.595-20C>T rs192022673
NM_000089.3(COL1A2):c.70+719_70+720del rs201691876
NM_000089.3(COL1A2):c.948C>T (p.Gly316=) rs34511999
NM_000089.3(COL1A2):c.96+10C>T rs185341110
NM_000089.4(COL1A2):c.594+5A>T rs200744314
NM_000090.3(COL3A1):c.1188C>T (p.Gly396=) rs745743884
NM_000090.3(COL3A1):c.1804C>A (p.Pro602Thr) rs35795890
NM_000090.3(COL3A1):c.1815+5G>A rs146652498
NM_000090.3(COL3A1):c.1927T>C (p.Leu643=) rs41263757
NM_000090.3(COL3A1):c.2002C>T (p.Pro668Ser) rs1801183
NM_000090.3(COL3A1):c.2035G>A (p.Ala679Thr) rs41263773
NM_000090.3(COL3A1):c.2056C>G (p.Pro686Ala) rs41263775
NM_000090.3(COL3A1):c.2498A>G (p.Lys833Arg) rs371344739
NM_000090.3(COL3A1):c.2805T>C (p.Pro935=) rs111567071
NM_000090.3(COL3A1):c.3777T>C (p.Ala1259=) rs34781844
NM_000090.3(COL3A1):c.812G>A (p.Arg271Gln) rs112185887
NM_000090.4(COL3A1):c.2002C>A (p.Pro668Thr) rs1801183
NM_000090.4(COL3A1):c.3133G>A (p.Ala1045Thr) rs149722210
NM_000090.4(COL3A1):c.3938A>G (p.Lys1313Arg) rs111840783
NM_000091.4(COL4A3):c.2083G>A (p.Gly695Arg) rs200287952
NM_000093.5(COL5A1):c.1588G>A (p.Gly530Ser) rs61735045
NM_000093.5(COL5A1):c.1882-5del rs1554793544
NM_000093.5(COL5A1):c.1889G>A (p.Arg630Gln) rs781667754
NM_000095.3(COMP):c.2227+8G>A rs116499541
NM_000098.3(CPT2):c.1602G>A (p.Glu534=) rs148110518
NM_000108.5(DLD):c.543A>T (p.Ile181=) rs61749952
NM_000109.4(DMD):c.1700T>C (p.Leu567Pro) rs370644567
NM_000109.4(DMD):c.7547G>A (p.Arg2516His) rs151244052
NM_000112.3(SLC26A2):c.2087A>G (p.Asn696Ser) rs34351171
NM_000112.3(SLC26A2):c.987T>C (p.Leu329=) rs116302615
NM_000117.3(EMD):c.272A>G (p.Asn91Ser) rs137977232
NM_000118.3(ENG):c.-9G>A rs368423516
NM_000118.3(ENG):c.1134G>A (p.Ala378=) rs1329127701
NM_000118.3(ENG):c.1374A>G (p.Pro458=) rs34828244
NM_000118.3(ENG):c.1452C>T (p.Ser484=) rs115450389
NM_000118.3(ENG):c.1455G>A (p.Glu485=) rs150456852
NM_000118.3(ENG):c.1510G>A (p.Val504Met) rs116330805
NM_000118.3(ENG):c.1586G>A (p.Arg529His) rs863223538
NM_000118.3(ENG):c.360+5G>A rs1060501417
NM_000118.3(ENG):c.523G>T (p.Ala175Ser) rs1588583488
NM_000118.3(ENG):c.524-15C>T rs201463582
NM_000118.3(ENG):c.991G>A (p.Gly331Ser) rs1060501410
NM_000119.3(EPB42):c.1408+4C>T rs45498491
NM_000119.3(EPB42):c.29C>T (p.Ser10Leu) rs77809780
NM_000119.3(EPB42):c.520+12C>T rs185794093
NM_000119.3(EPB42):c.744+7G>A rs72721553
NM_000132.3(F8):c.102C>T (p.Asp34=) rs1800283
NM_000132.3(F8):c.1094A>G (p.Tyr365Cys) rs375241473
NM_000132.3(F8):c.1508G>A (p.Arg503His) rs35383156
NM_000132.3(F8):c.2947G>A (p.Val983Ile) rs35295375
NM_000132.3(F8):c.2994T>G (p.His998Gln) rs149853218
NM_000132.3(F8):c.389-9C>T rs35621875
NM_000132.3(F8):c.5422C>T (p.Leu1808Phe) rs137852445
NM_000132.3(F8):c.5815G>C (p.Ala1939Pro) rs1603432979
NM_000132.3(F8):c.592T>G (p.Cys198Gly) rs137852475
NM_000132.3(F8):c.748A>G (p.Met250Val) rs781943293
NM_000132.4(F8):c.6304G>A (p.Gly2102Ser)
NM_000133.3(F9):c.580A>G (p.Thr194Ala) rs6048
NM_000133.3(F9):c.835G>A (p.Ala279Thr) rs137852247
NM_000135.4(FANCA):c.1874G>C (p.Cys625Ser) rs139235751
NM_000135.4(FANCA):c.3348+18A>G rs1800347
NM_000136.3(FANCC):c.1345G>A (p.Val449Met) rs1800367
NM_000138.4(FBN1):c.1027G>A (p.Gly343Arg) rs146726731
NM_000138.4(FBN1):c.1090C>T (p.Arg364Ter) rs794728165
NM_000138.4(FBN1):c.1960+30G>A rs25459
NM_000138.4(FBN1):c.2148A>G (p.Gly716=) rs141039922
NM_000138.4(FBN1):c.2581C>T (p.Arg861Ter) rs140583
NM_000138.4(FBN1):c.2934C>G (p.Asp978Glu) rs138438849
NM_000138.4(FBN1):c.3082+8del rs193922196
NM_000138.4(FBN1):c.4214T>G (p.Leu1405Arg) rs767606368
NM_000138.4(FBN1):c.4930C>T (p.Arg1644Ter) rs140630
NM_000138.4(FBN1):c.5296+14G>A rs140650
NM_000138.4(FBN1):c.5874C>A (p.Cys1958Ter) rs1555395750
NM_000138.4(FBN1):c.5964C>T (p.Thr1988=) rs113022801
NM_000138.4(FBN1):c.6388G>A (p.Glu2130Lys) rs794728334
NM_000138.4(FBN1):c.6487G>T (p.Glu2163Ter) rs1555395191
NM_000138.4(FBN1):c.6577G>A (p.Glu2193Lys) rs201361628
NM_000138.4(FBN1):c.6661T>C (p.Cys2221Arg) rs113543334
NM_000138.4(FBN1):c.6705A>C (p.Gly2235=) rs2229326
NM_000138.4(FBN1):c.6987C>G (p.Asp2329Glu) rs363831
NM_000138.4(FBN1):c.7072G>A (p.Val2358Ile) rs140537304
NM_000138.4(FBN1):c.7383C>G (p.Asn2461Lys) rs754047254
NM_000138.4(FBN1):c.7617C>T (p.Gly2539=) rs1388794275
NM_000138.4(FBN1):c.7656C>A (p.Cys2552Ter) rs1555394195
NM_000138.4(FBN1):c.7994A>G (p.Asn2665Ser) rs763173031
NM_000138.5(FBN1):c.1277C>T (p.Pro426Leu)
NM_000138.5(FBN1):c.1746C>T (p.Cys582=) rs112366266
NM_000138.5(FBN1):c.184C>T (p.Arg62Cys) rs25403
NM_000138.5(FBN1):c.1948C>T rs193922185
NM_000138.5(FBN1):c.2645C>T rs794728195
NM_000138.5(FBN1):c.2895G>A (p.Glu965=) rs140591
NM_000138.5(FBN1):c.2927G>A (p.Arg976His) rs140954477
NM_000138.5(FBN1):c.306C>T (p.Cys102=) rs25388
NM_000138.5(FBN1):c.3294C>T (p.Asp1098=) rs140587
NM_000138.5(FBN1):c.3509G>A (p.Arg1170His) rs137854475
NM_000138.5(FBN1):c.4243dup (p.Cys1415fs)
NM_000138.5(FBN1):c.4441A>G (p.Ser1481Gly) rs61730054
NM_000138.5(FBN1):c.4683C>T (p.Ser1561=) rs148024160
NM_000138.5(FBN1):c.4905C>G (p.Thr1635=) rs113115949
NM_000138.5(FBN1):c.5065+10A>G rs375945405
NM_000138.5(FBN1):c.510C>T (p.Tyr170=) rs111671429
NM_000138.5(FBN1):c.5343G>A (p.Val1781=) rs140649
NM_000138.5(FBN1):c.6288C>T (p.Cys2096=) rs144822241
NM_000138.5(FBN1):c.6453C>T rs794728251
NM_000138.5(FBN1):c.6594C>T (p.Pro2198=) rs111844882
NM_000138.5(FBN1):c.6658C>T (p.Arg2220Ter) rs113001196
NM_000138.5(FBN1):c.6681A>C (p.Ser2227=) rs363824
NM_000138.5(FBN1):c.6700G>A (p.Val2234Met) rs112084407
NM_000138.5(FBN1):c.6806T>C (p.Ile2269Thr) rs193922228
NM_000138.5(FBN1):c.7039_7040del (p.Met2347fs) rs794728319
NM_000138.5(FBN1):c.7346A>G (p.Asn2449Ser) rs146166400
NM_000138.5(FBN1):c.7754T>C (p.Ile2585Thr) rs727503054
NM_000138.5(FBN1):c.8502T>C (p.Thr2834=) rs363847
NM_000141.5(FGFR2):c.23T>G (p.Ile8Ser) rs147307031
NM_000142.4(FGFR3):c.1959+8C>T rs371666188
NM_000142.4(FGFR3):c.930+10C>T rs534857289
NM_000142.5(FGFR3):c.1150T>C (p.Phe384Leu) rs17881656
NM_000142.5(FGFR3):c.1345C>T (p.Pro449Ser) rs61735104
NM_000142.5(FGFR3):c.193G>A (p.Gly65Arg) rs2305178
NM_000142.5(FGFR3):c.2088C>T (p.Pro696=) rs142884145
NM_000142.5(FGFR3):c.272C>T (p.Pro91Leu) rs144995231
NM_000143.3(FH):c.53C>T (p.Pro18Leu) rs201887750
NM_000143.4(FH):c.1431_1433dup (p.Lys477dup) rs367543046
NM_000144.5(FXN):c.118C>T (p.Arg40Cys) rs145854903
NM_000144.5(FXN):c.54A>G (p.Pro18=) rs2481598
NM_000152.3(GAA):c.2065G>A (p.Glu689Lys) rs1800309
NM_000152.5(GAA):c.-32-13T>G rs386834236
NM_000152.5(GAA):c.1075+13C>T rs41292402
NM_000152.5(GAA):c.1356C>T (p.Ala452=) rs757893858
NM_000152.5(GAA):c.1552-13G>A rs111261964
NM_000152.5(GAA):c.1552-3C>G rs375470378
NM_000152.5(GAA):c.1726G>A (p.Gly576Ser) rs1800307
NM_000152.5(GAA):c.1799G>A (p.Arg600His) rs377544304
NM_000152.5(GAA):c.1830C>T (p.Ala610=) rs61736896
NM_000152.5(GAA):c.2238G>C (p.Trp746Cys) rs1800312
NM_000152.5(GAA):c.2571G>T (p.Leu857=) rs17853996
NM_000152.5(GAA):c.2580C>T (p.Asp860=) rs61736894
NM_000152.5(GAA):c.2647-8C>T rs139201641
NM_000152.5(GAA):c.271G>A (p.Asp91Asn) rs1800299
NM_000152.5(GAA):c.447G>A (p.Thr149=) rs2289536
NM_000152.5(GAA):c.525del (p.Glu176fs) rs386834235
NM_000152.5(GAA):c.852G>A (p.Ala284=) rs142626724
NM_000152.5(GAA):c.858+17_858+23del rs1555599723
NM_000152.5(GAA):c.915G>A (p.Gly305=) rs150343359
NM_000153.4(GALC):c.956A>G (p.Tyr319Cys) rs183105855
NM_000155.4(GALT):c.1030C>A (p.Gln344Lys) rs111033814
NM_000155.4(GALT):c.394C>T (p.His132Tyr) rs111033688
NM_000155.4(GALT):c.512T>C (p.Phe171Ser) rs111033715
NM_000155.4(GALT):c.563A>G (p.Gln188Arg) rs75391579
NM_000155.4(GALT):c.617A>G (p.Gln206Arg) rs1587239309
NM_000155.4(GALT):c.652C>T (p.Leu218=) rs2070075
NM_000155.4(GALT):c.772C>T (p.Arg258Cys) rs368166217
NM_000155.4(GALT):c.812A>G (p.Glu271Gly) rs111033765
NM_000155.4(GALT):c.940A>G (p.Asn314Asp) rs2070074
NM_000155.4(GALT):c.945T>C (p.His315=) rs61735982
NM_000155.4(GALT):c.997C>T (p.Arg333Trp) rs111033800
NM_000156.6(GAMT):c.503A>C (p.Tyr168Ser) rs1131691644
NM_000156.6(GAMT):c.626C>T (p.Thr209Met) rs17851582
NM_000157.4(GBA):c.1226A>G (p.Asn409Ser) rs76763715
NM_000166.6(GJB1):c.223C>T (p.Arg75Trp) rs116840819
NM_000168.6(GLI3):c.1243-40A>C rs77659679
NM_000168.6(GLI3):c.3208A>T (p.Thr1070Ser) rs150907867
NM_000169.3(GLA):c.427G>A (p.Ala143Thr) rs104894845
NM_000169.3(GLA):c.937G>T (p.Asp313Tyr) rs28935490
NM_000179.2(MSH6):c.-8C>T rs565211544
NM_000179.2(MSH6):c.1186C>G (p.Leu396Val) rs2020908
NM_000179.2(MSH6):c.1508C>G (p.Ser503Cys) rs63750897
NM_000179.2(MSH6):c.1665A>G (p.Ala555=) rs146785465
NM_000179.2(MSH6):c.2314C>A (p.Arg772=) rs63750138
NM_000179.2(MSH6):c.260+22C>G rs55927047
NM_000179.2(MSH6):c.2633T>C (p.Val878Ala) rs2020912
NM_000179.2(MSH6):c.3162C>T (p.Ile1054=) rs149605979
NM_000179.2(MSH6):c.3173-18T>A rs189672273
NM_000179.2(MSH6):c.3699_3702dup (p.Leu1235fs) rs193922343
NM_000179.2(MSH6):c.3727A>T (p.Thr1243Ser) rs147453999
NM_000179.2(MSH6):c.3801+17T>C rs3136365
NM_000179.2(MSH6):c.457+13A>G rs1800933
NM_000179.2(MSH6):c.628-7C>A rs373129248
NM_000179.2(MSH6):c.984C>T (p.Ser328=) rs138143769
NM_000179.3(MSH6):c.1164C>T (p.His388=) rs55708305
NM_000179.3(MSH6):c.116G>A (p.Gly39Glu) rs1042821
NM_000179.3(MSH6):c.1526T>C (p.Val509Ala) rs63751005
NM_000179.3(MSH6):c.2272C>T (p.Leu758=) rs56371757
NM_000179.3(MSH6):c.2398G>C (p.Val800Leu) rs61748083
NM_000179.3(MSH6):c.3246G>T (p.Pro1082=) rs3136351
NM_000179.3(MSH6):c.663A>C (p.Glu221Asp) rs41557217
NM_000180.4(GUCY2D):c.2101C>T (p.Pro701Ser) rs34598902
NM_000180.4(GUCY2D):c.61T>C (p.Trp21Arg) rs9905402
NM_000203.5(IDUA):c.1345C>A (p.His449Asn) rs532731688
NM_000208.4(INSR):c.1080C>T (p.Cys360=) rs56066516
NM_000218.3(KCNQ1):c.1179G>T (p.Lys393Asn) rs12720457
NM_000218.3(KCNQ1):c.1343C>G (p.Pro448Arg) rs12720449
NM_000218.3(KCNQ1):c.1860C>T (p.His620=) rs139893266
NM_000218.3(KCNQ1):c.1942G>A (p.Val648Ile) rs34150427
NM_000218.3(KCNQ1):c.1986C>T (p.Tyr662=) rs11601907
NM_000218.3(KCNQ1):c.459G>A (p.Thr153=) rs148121889
NM_000219.6(KCNE1):c.173C>T (p.Thr58Ile) rs747321794
NM_000219.6(KCNE1):c.226G>A (p.Asp76Asn) rs74315445
NM_000219.6(KCNE1):c.253G>A (p.Asp85Asn) rs1805128
NM_000219.6(KCNE1):c.84G>A (p.Ser28=) rs17173510
NM_000238.3(KCNH2):c.3140G>T (p.Arg1047Leu) rs36210421
NM_000238.4(KCNH2):c.1129-18C>T
NM_000238.4(KCNH2):c.1563C>T (p.Ile521=) rs143011005
NM_000243.2(MEFV):c.-15C>G rs11466015
NM_000243.2(MEFV):c.1016C>T (p.Ser339Phe) rs104895157
NM_000243.2(MEFV):c.1043G>A (p.Arg348His) rs104895198
NM_000243.2(MEFV):c.124C>T (p.Arg42Trp) rs61754767
NM_000243.2(MEFV):c.1261-11T>G rs77086855
NM_000243.2(MEFV):c.1437C>G (p.Phe479Leu) rs104895083
NM_000243.2(MEFV):c.1467G>A (p.Gln489=) rs61732424
NM_000243.2(MEFV):c.1518C>T (p.Ile506=) rs104895099
NM_000243.2(MEFV):c.1587+18C>T rs11466030
NM_000243.2(MEFV):c.1587+33C>G rs146820856
NM_000243.2(MEFV):c.1760-30T>A rs1231123
NM_000243.2(MEFV):c.1760-4G>A rs79662406
NM_000243.2(MEFV):c.1772T>C (p.Ile591Thr) rs11466045
NM_000243.2(MEFV):c.195C>T (p.Tyr65=) rs104895077
NM_000243.2(MEFV):c.2084A>G rs104895094
NM_000243.2(MEFV):c.2230G>T rs61732874
NM_000243.2(MEFV):c.2292G>T (p.Gly764=) rs142352887
NM_000243.2(MEFV):c.297C>T (p.Asn99=) rs104895175
NM_000243.2(MEFV):c.306T>C (p.Asp102=) rs224225
NM_000243.2(MEFV):c.333G>A (p.Gly111=) rs61732425
NM_000243.2(MEFV):c.372C>T (p.Pro124=) rs104895078
NM_000243.2(MEFV):c.414A>G (p.Gly138=) rs224224
NM_000243.2(MEFV):c.42G>A (p.Glu14=) rs113314808
NM_000243.2(MEFV):c.495C>A (p.Ala165=) rs224223
NM_000243.2(MEFV):c.501G>C (p.Glu167Asp) rs104895079
NM_000243.2(MEFV):c.549G>A (p.Pro183=) rs587781035
NM_000243.2(MEFV):c.586G>T (p.Gly196Trp) rs104895179
NM_000243.2(MEFV):c.605G>A (p.Arg202Gln) rs224222
NM_000243.2(MEFV):c.800C>T (p.Thr267Ile) rs104895081
NM_000243.2(MEFV):c.910G>A (p.Gly304Arg) rs75977701
NM_000243.2(MEFV):c.942C>T (p.Arg314=) rs224213
NM_000243.2(MEFV):c.97G>T (p.Val33Leu) rs11466016
NM_000243.2(MEFV):c.986G>A (p.Arg329His) rs104895112
NM_000243.3(MEFV):c.1105C>T rs11466023
NM_000243.3(MEFV):c.1223G>A rs11466024
NM_000243.3(MEFV):c.2076_2078del (p.Ile692del) rs104895093
NM_000243.3(MEFV):c.2282G>A (p.Arg761His) rs104895097
NM_000243.3(MEFV):c.329T>C rs11466018
NM_000243.3(MEFV):c.442G>C rs3743930
NM_000243.3(MEFV):c.585G>A rs200766991
NM_000244.3(MEN1):c.1185G>A (p.Pro395=) rs587780841
NM_000244.3(MEN1):c.1311G>A (p.Leu437=) rs138770431
NM_000244.3(MEN1):c.1523G>A (p.Gly508Asp) rs375804228
NM_000244.3(MEN1):c.1636G>A (p.Ala546Thr) rs2959656
NM_000244.3(MEN1):c.1653G>A (p.Pro551=) rs368783097
NM_000244.3(MEN1):c.1A>G (p.Met1Val) rs386134250
NM_000244.3(MEN1):c.30G>T (p.Leu10=) rs371192390
NM_000244.3(MEN1):c.798+1G>A rs794728652
NM_000245.4(MET):c.-14-4G>A rs144126521
NM_000245.4(MET):c.1124A>G (p.Asn375Ser) rs33917957
NM_000245.4(MET):c.2908C>T (p.Arg970Cys) rs34589476
NM_000245.4(MET):c.2975C>T (p.Thr992Ile) rs56391007
NM_000245.4(MET):c.504G>T (p.Glu168Asp) rs55985569
NM_000245.4(MET):c.948A>G (p.Ile316Met) rs35225896
NM_000249.3(MLH1):c.1517T>C (p.Val506Ala) rs63749909
NM_000249.3(MLH1):c.1963A>G (p.Ile655Val) rs55907433
NM_000249.3(MLH1):c.207+2T>C rs267607722
NM_000249.3(MLH1):c.375A>G (p.Ala125=) rs1800144
NM_000249.3(MLH1):c.42A>C (p.Thr14=) rs369737664
NM_000249.3(MLH1):c.790+10A>G rs182733777
NM_000249.4(MLH1):c.1321G>A (p.Ala441Thr) rs63750365
NM_000249.4(MLH1):c.1360G>C (p.Gly454Arg) rs63750527
NM_000249.4(MLH1):c.1668-19A>G rs9876116
NM_000249.4(MLH1):c.2152C>T (p.His718Tyr) rs2020873
NM_000249.4(MLH1):c.637G>A (p.Val213Met) rs2308317
NM_000249.4(MLH1):c.655A>G (p.Ile219Val) rs1799977
NM_000249.4(MLH1):c.977T>C (p.Val326Ala) rs63751049
NM_000251.2(MSH2):c.1275A>G (p.Glu425=) rs63751650
NM_000251.2(MSH2):c.1277-8T>C rs145400590
NM_000251.2(MSH2):c.1387-8G>T rs187525243
NM_000251.2(MSH2):c.1666T>C (p.Leu556=) rs61756466
NM_000251.2(MSH2):c.1737A>G (p.Lys579=) rs61756467
NM_000251.2(MSH2):c.2006-4G>A rs369853630
NM_000251.2(MSH2):c.23C>T (p.Thr8Met) rs17217716
NM_000251.2(MSH2):c.4G>A (p.Ala2Thr) rs63750466
NM_000251.2(MSH2):c.965G>A (p.Gly322Asp) rs4987188
NM_000251.2(MSH2):c.984C>T (p.Ala328=) rs4987189
NM_000251.3(MSH2):c.1147C>T (p.Arg383Ter) rs63749849
NM_000251.3(MSH2):c.1511-41G>C rs202215396
NM_000251.3(MSH2):c.2038C>T (p.Arg680Ter) rs63749932
NM_000251.3(MSH2):c.339G>A (p.Lys113=) rs35898375
NM_000251.3(MSH2):c.380A>G (p.Asn127Ser) rs17217772
NM_000251.3(MSH2):c.382C>G (p.Leu128Val) rs145649774
NM_000251.3(MSH2):c.942+24_942+29del rs11309117
NM_000254.2(MTR):c.1033G>A (p.Val345Ile) rs145006491
NM_000254.2(MTR):c.1076-8C>T rs115186224
NM_000254.2(MTR):c.2756A>G (p.Asp919Gly) rs1805087
NM_000255.4(MMUT):c.1629C>T (p.Ser543=) rs150642856
NM_000256.3(MYBPC3):c.1144C>T (p.Arg382Trp) rs11570076
NM_000256.3(MYBPC3):c.1504C>T (p.Arg502Trp) rs375882485
NM_000256.3(MYBPC3):c.2497G>A (p.Ala833Thr) rs199865688
NM_000256.3(MYBPC3):c.2686G>A (p.Val896Met) rs35078470
NM_000256.3(MYBPC3):c.2870C>G (p.Thr957Ser) rs193922380
NM_000256.3(MYBPC3):c.2992C>G (p.Gln998Glu) rs11570112
NM_000256.3(MYBPC3):c.3004C>T (p.Arg1002Trp) rs3729799
NM_000256.3(MYBPC3):c.3102C>T (p.Ala1034=) rs200663253
NM_000256.3(MYBPC3):c.3285G>A (p.Thr1095=) rs367927327
NM_000256.3(MYBPC3):c.3392T>C (p.Ile1131Thr) rs370890951
NM_000256.3(MYBPC3):c.442G>A (p.Gly148Arg) rs397516050
NM_000256.3(MYBPC3):c.530G>A (p.Arg177His) rs201012766
NM_000257.4(MYH7):c.1002C>T (p.Asn334=) rs34803781
NM_000257.4(MYH7):c.1767C>T (p.Asn589=) rs3729816
NM_000257.4(MYH7):c.2183C>T (p.Ala728Val) rs121913644
NM_000257.4(MYH7):c.2358G>A (p.Thr786=) rs36211714
NM_000257.4(MYH7):c.2360G>A (p.Arg787His) rs376754645
NM_000257.4(MYH7):c.2514G>A (p.Pro838=) rs45560638
NM_000257.4(MYH7):c.2681A>G (p.Glu894Gly) rs397516161
NM_000257.4(MYH7):c.2890G>C (p.Val964Leu) rs45496496
NM_000257.4(MYH7):c.327C>T (p.Tyr109=) rs36211408
NM_000257.4(MYH7):c.3351G>A (p.Glu1117=) rs45554236
NM_000257.4(MYH7):c.3853+7C>T rs45467397
NM_000257.4(MYH7):c.3981C>A (p.Asn1327Lys) rs141764279
NM_000257.4(MYH7):c.4472C>G (p.Ser1491Cys) rs3729823
NM_000257.4(MYH7):c.4566T>C (p.Thr1522=) rs2754155
NM_000257.4(MYH7):c.4716C>T (p.Ile1572=) rs7140196
NM_000257.4(MYH7):c.480C>T (p.Asn160=) rs45500700
NM_000257.4(MYH7):c.5283+19C>T rs45582836
NM_000257.4(MYH7):c.597A>G (p.Ala199=) rs2069541
NM_000257.4(MYH7):c.732C>T (p.Phe244=) rs2069542
NM_000257.4(MYH7):c.740T>G (p.Phe247Cys) rs730880922
NM_000257.4(MYH7):c.975C>T (p.Asp325=) rs2231124
NM_000258.3(MYL3):c.130-14G>T rs192329378
NM_000258.3(MYL3):c.427G>A (p.Glu143Lys) rs104893750
NM_000260.4(MYO7A):c.2798G>A (p.Arg933His) rs201489714
NM_000260.4(MYO7A):c.2886G>C (p.Gln962His) rs200641606
NM_000260.4(MYO7A):c.4619C>T (p.Ala1540Val) rs111033511
NM_000260.4(MYO7A):c.47T>C (p.Leu16Ser) rs1052030
NM_000260.4(MYO7A):c.689C>T (p.Ala230Val) rs797044512
NM_000264.5(PTCH1):c.1913G>A (p.Arg638His) rs145766839
NM_000264.5(PTCH1):c.3583A>T (p.Thr1195Ser) rs2236405
NM_000264.5(PTCH1):c.3845C>T (p.Pro1282Leu) rs2227968
NM_000264.5(PTCH1):c.3944C>T (p.Pro1315Leu) rs357564
NM_000267.3(NF1):c.*4T>C rs201044568
NM_000267.3(NF1):c.1296G>A (p.Val432=) rs371599283
NM_000267.3(NF1):c.1846-12A>T rs188510882
NM_000267.3(NF1):c.2252-34T>C rs200937398
NM_000267.3(NF1):c.2540T>C (p.Leu847Pro) rs199474747
NM_000267.3(NF1):c.3468C>T (p.Asn1156=) rs147955381
NM_000267.3(NF1):c.4772+36T>C rs16972128
NM_000267.3(NF1):c.4986C>T (p.Asn1662=) rs140994965
NM_000267.3(NF1):c.655-29T>C rs182325576
NM_000267.3(NF1):c.731-6A>C rs369366499
NM_000267.3(NF1):c.7394+21A>G rs17881641
NM_000267.3(NF1):c.7491C>G (p.Ala2497=) rs141897690
NM_000267.3(NF1):c.7847G>A (p.Arg2616Gln) rs560262404
NM_000271.5(NPC1):c.665A>G (p.Asn222Ser) rs55680026
NM_000271.5(NPC1):c.709C>T (p.Pro237Ser) rs80358251
NM_000276.4(OCRL):c.561-7T>A rs376622194
NM_000282.4(PCCA):c.1423A>G (p.Ile475Val) rs35719359
NM_000282.4(PCCA):c.1429+7A>G rs16957276
NM_000283.3(PDE6B):c.655T>C (p.Tyr219His) rs62295357
NM_000288.4(PEX7):c.339+10A>G rs374668045
NM_000288.4(PEX7):c.377A>C (p.Gln126Pro) rs113268723
NM_000288.4(PEX7):c.748-5del rs563675060
NM_000289.6(PFKM):c.2087G>A (p.Arg696His) rs41291971
NM_000297.4(PKD2):c.1359A>G (p.Pro453=) rs17013754
NM_000297.4(PKD2):c.1445T>G (p.Phe482Cys) rs75762896
NM_000297.4(PKD2):c.2208_2213del (p.Leu736_Asn737del) rs778896252
NM_000297.4(PKD2):c.2295T>C (p.Asp765=) rs138982773
NM_000297.4(PKD2):c.2398A>C (p.Met800Leu) rs2234917
NM_000297.4(PKD2):c.2411G>A (p.Ser804Asn) rs145343957
NM_000297.4(PKD2):c.2420G>A (p.Arg807Gln) rs147654263
NM_000297.4(PKD2):c.570G>T (p.Ala190=) rs541702320
NM_000297.4(PKD2):c.964C>T (p.Arg322Trp) rs1553925453
NM_000298.6(PKLR):c.1456C>T (p.Arg486Trp) rs116100695
NM_000298.6(PKLR):c.1516G>A (p.Val506Ile) rs8177988
NM_000298.6(PKLR):c.829G>A (p.Glu277Lys) rs147689373
NM_000302.4(PLOD1):c.1141G>A (p.Val381Met) rs2230896
NM_000302.4(PLOD1):c.1203-3C>T rs376288573
NM_000302.4(PLOD1):c.1428G>A (p.Lys476=) rs139869965
NM_000302.4(PLOD1):c.1534C>T (p.Arg512Cys) rs138490756
NM_000302.4(PLOD1):c.1927G>A (p.Val643Ile) rs149425237
NM_000302.4(PLOD1):c.540G>A (p.Gln180=) rs35958757
NM_000302.4(PLOD1):c.555G>T (p.Lys185Asn) rs142978362
NM_000302.4(PLOD1):c.804C>T (p.Thr268=) rs140758113
NM_000304.4(PMP22):c.353C>T (p.Thr118Met) rs104894619
NM_000311.5(PRNP):c.372C>G (p.Gly124=) rs201423990
NM_000311.5(PRNP):c.385A>G (p.Met129Val) rs1799990
NM_000311.5(PRNP):c.655G>A (p.Glu219Lys) rs1800014
NM_000314.7(PTEN):c.132C>T (p.Gly44=) rs150651961
NM_000314.7(PTEN):c.802-51_802-14del rs557364463
NM_000314.7(PTEN):c.855A>G (p.Glu285=) rs751888926
NM_000314.8(PTEN):c.165-24TTTG[2] rs786204877
NM_000314.8(PTEN):c.78C>T (p.Thr26=) rs786201280
NM_000316.3(PTH1R):c.299G>A (p.Gly100Asp) rs41290646
NM_000316.3(PTH1R):c.313+4C>T rs200207404
NM_000316.3(PTH1R):c.357G>A (p.Pro119=) rs143692596
NM_000316.3(PTH1R):c.436C>A (p.Arg146=) rs143863124
NM_000321.2(RB1):c.1216-29A>G rs3092886
NM_000321.2(RB1):c.2521-11G>A rs4151624
NM_000321.2(RB1):c.380+10C>G rs187110786
NM_000321.2(RB1):c.411A>T (p.Glu137Asp) rs3092902
NM_000321.2(RB1):c.45_53del (p.Ala16_Ala18del) rs572454921
NM_000326.5(RLBP1):c.141+2T>C rs760650165
NM_000326.5(RLBP1):c.700C>T (p.Arg234Trp) rs28933990
NM_000326.5(RLBP1):c.9A>C (p.Glu3Asp) rs146844731
NM_000328.3(RPGR):c.141T>G (p.Ser47=) rs62638631
NM_000335.5(SCN5A):c.1441C>T (p.Arg481Trp) rs144511230
NM_000335.5(SCN5A):c.1479G>A (p.Arg493=) rs138870926
NM_000335.5(SCN5A):c.1587T>C (p.Ile529=) rs45624133
NM_000335.5(SCN5A):c.1681C>T (p.Leu561=) rs45522138
NM_000335.5(SCN5A):c.1743G>A (p.Ser581=) rs41313687
NM_000335.5(SCN5A):c.2074C>A (p.Gln692Lys) rs45553235
NM_000335.5(SCN5A):c.2437-5C>A rs72549411
NM_000335.5(SCN5A):c.3068G>A (p.Arg1023His) rs199473592
NM_000335.5(SCN5A):c.3305C>A (p.Ser1102Tyr) rs7626962
NM_000335.5(SCN5A):c.3575G>A (p.Arg1192Gln) rs41261344
NM_000335.5(SCN5A):c.4215G>A (p.Gly1405=) rs41311123
NM_000335.5(SCN5A):c.4299T>C (p.Tyr1433=) rs200556220
NM_000335.5(SCN5A):c.4506C>T (p.Ser1502=) rs45548237
NM_000335.5(SCN5A):c.4531C>T (p.Arg1511Trp) rs137854602
NM_000335.5(SCN5A):c.5848G>T (p.Val1950Leu) rs41315493
NM_000335.5(SCN5A):c.6013C>G (p.Pro2005Ala) rs45489199
NM_000335.5(SCN5A):c.630G>A (p.Val210=) rs193922727
NM_000335.5(SCN5A):c.647C>T (p.Ser216Leu) rs41276525
NM_000335.5(SCN5A):c.717C>T (p.Ile239=) rs41285129
NM_000337.5(SGCD):c.213G>A (p.Arg71=) rs74846539
NM_000337.5(SGCD):c.290G>A (p.Arg97Gln) rs45559835
NM_000337.5(SGCD):c.294+8T>C rs11748588
NM_000337.5(SGCD):c.543T>G (p.Pro181=) rs200451694
NM_000337.5(SGCD):c.699+13_699+15del rs397517924
NM_000341.4(SLC3A1):c.1136+3del rs796262035
NM_000341.4(SLC3A1):c.1400T>C (p.Met467Thr) rs121912691
NM_000341.4(SLC3A1):c.231T>A (p.Ser77=) rs146630359
NM_000341.4(SLC3A1):c.892-6C>G rs114640930
NM_000342.3(SLC4A1):c.118G>A (p.Glu40Lys) rs45562031
NM_000342.4(SLC4A1):c.166A>G (p.Lys56Glu) rs5036
NM_000342.4(SLC4A1):c.1937G>A (p.Arg646Gln) rs121912757
NM_000342.4(SLC4A1):c.2055C>T (p.Thr685=) rs375136281
NM_000342.4(SLC4A1):c.337G>A (p.Val113Ile) rs142757938
NM_000342.4(SLC4A1):c.539G>A (p.Arg180His) rs147390654
NM_000346.4(SOX9):c.685+8G>A rs117696751
NM_000350.2(ABCA4):c.2588G>C rs76157638
NM_000350.2(ABCA4):c.5882G>A rs1800553
NM_000350.3(ABCA4):c.1268A>G (p.His423Arg) rs3112831
NM_000350.3(ABCA4):c.1269C>T (p.His423=) rs4147831
NM_000350.3(ABCA4):c.1622T>C (p.Leu541Pro) rs61751392
NM_000350.3(ABCA4):c.1928T>G (p.Val643Gly) rs61754024
NM_000350.3(ABCA4):c.214G>A (p.Gly72Arg) rs61751412
NM_000350.3(ABCA4):c.2546T>C (p.Val849Ala) rs61749435
NM_000350.3(ABCA4):c.2646C>T (p.Gly882=) rs180921875
NM_000350.3(ABCA4):c.2828G>A (p.Arg943Gln) rs1801581
NM_000350.3(ABCA4):c.2964C>T (p.Leu988=) rs61754034
NM_000350.3(ABCA4):c.3113C>T (p.Ala1038Val) rs61751374
NM_000350.3(ABCA4):c.3899G>A (p.Arg1300Gln) rs61750129
NM_000350.3(ABCA4):c.4297G>A (p.Val1433Ile) rs56357060
NM_000350.3(ABCA4):c.455G>A (p.Arg152Gln) rs62646862
NM_000350.3(ABCA4):c.466A>G (p.Ile156Val) rs62646863
NM_000350.3(ABCA4):c.5196+1159G>A rs80110715
NM_000350.3(ABCA4):c.5461-10T>C rs1800728
NM_000350.3(ABCA4):c.5682G>C (p.Leu1894=) rs1801574
NM_000350.3(ABCA4):c.5814A>G (p.Leu1938=) rs4147857
NM_000350.3(ABCA4):c.5844A>G (p.Pro1948=) rs2275029
NM_000350.3(ABCA4):c.6089G>A (p.Arg2030Gln) rs61750641
NM_000350.3(ABCA4):c.6148G>C (p.Val2050Leu) rs41292677
NM_000350.3(ABCA4):c.6282+7G>A rs17110761
NM_000350.3(ABCA4):c.6320G>A (p.Arg2107His) rs62642564
NM_000350.3(ABCA4):c.635G>A (p.Arg212His) rs6657239
NM_000350.3(ABCA4):c.6529G>A (p.Asp2177Asn) rs1800555
NM_000350.3(ABCA4):c.6764G>T (p.Ser2255Ile) rs6666652
NM_000350.3(ABCA4):c.981C>T (p.Pro327=) rs61753057
NM_000355.4(TCN2):c.280G>A (p.Gly94Ser) rs11557600
NM_000363.5(TNNI3):c.-47C>T rs202159627
NM_000363.5(TNNI3):c.244C>T (p.Pro82Ser) rs77615401
NM_000368.4(TSC1):c.1921C>T (p.Pro641Ser) rs374222196
NM_000368.4(TSC1):c.1977G>A (p.Ala659=) rs35958226
NM_000368.4(TSC1):c.3303G>A (p.Glu1101=) rs118203751
NM_000368.5(TSC1):c.1335A>G (p.Glu445=) rs7862221
NM_000368.5(TSC1):c.2194C>T (p.His732Tyr) rs118203657
NM_000368.5(TSC1):c.2646C>T (p.Ala882=) rs118203720
NM_000368.5(TSC1):c.2829C>T (p.Ala943=) rs4962081
NM_000368.5(TSC1):c.2865C>T (p.Thr955=) rs45468995
NM_000368.5(TSC1):c.3184C>T (p.Arg1062Trp) rs118203745
NM_000368.5(TSC1):c.954GTT[1] (p.Leu320del) rs755655903
NM_000368.5(TSC1):c.965T>C (p.Met322Thr) rs1073123
NM_000371.3(TTR):c.379A>G (p.Ile127Val) rs121918089
NM_000371.4(TTR):c.238A>G (p.Thr80Ala) rs121918070
NM_000371.4(TTR):c.328C>A (p.His110Asn) rs121918074
NM_000371.4(TTR):c.416C>T (p.Thr139Met) rs28933981
NM_000371.4(TTR):c.417G>A (p.Thr139=) rs2276382
NM_000381.4(MID1):c.2000C>T (p.Pro667Leu) rs147106995
NM_000384.3(APOB):c.8148C>T (p.Ile2716=) rs6413458
NM_000393.5(COL5A2):c.1182G>A (p.Ala394=) rs148229627
NM_000393.5(COL5A2):c.1301C>T (p.Thr434Met) rs145850743
NM_000393.5(COL5A2):c.2423C>T (p.Pro808Leu) rs575864379
NM_000393.5(COL5A2):c.261G>A (p.Thr87=) rs142044596
NM_000393.5(COL5A2):c.75A>G (p.Lys25=) rs549894501
NM_000393.5(COL5A2):c.906+10A>T rs776578452
NM_000398.7(CYB5R3):c.890G>A (p.Arg297His) rs76458556
NM_000399.5(EGR2):c.1226G>A (p.Arg409Gln) rs864622273
NM_000399.5(EGR2):c.246C>G (p.Val82=) rs144217451
NM_000402.4(G6PD):c.1093G>A (p.Ala365Thr) rs5030869
NM_000402.4(G6PD):c.1114C>T (p.Leu372Phe) rs137852342
NM_000402.4(G6PD):c.1246A>G (p.Lys416Glu) rs137852320
NM_000402.4(G6PD):c.1268G>A (p.Arg423His) rs137852316
NM_000402.4(G6PD):c.1406G>C (p.Arg469Pro) rs137852337
NM_000402.4(G6PD):c.1466G>T (p.Arg489Leu) rs72554665
NM_000402.4(G6PD):c.1478G>A (p.Arg493His) rs72554664
NM_000402.4(G6PD):c.193_195delATC (p.Ile66del) rs137852338
NM_000402.4(G6PD):c.292G>A (p.Val98Met) rs1050828
NM_000402.4(G6PD):c.466A>G (p.Asn156Asp) rs1050829
NM_000402.4(G6PD):c.577G>A (p.Gly193Ser) rs137852314
NM_000402.4(G6PD):c.583A>G (p.Asn195Asp) rs137852331
NM_000402.4(G6PD):c.632A>T (p.Asp211Val) rs5030872
NM_000402.4(G6PD):c.653C>T (p.Ser218Phe) rs5030868
NM_000402.4(G6PD):c.770G>A (p.Arg257Gln) rs137852328
NM_000402.4(G6PD):c.934G>C (p.Asp312His) rs137852318
NM_000402.4(G6PD):c.961G>A (p.Val321Met) rs137852327
NM_000404.4(GLB1):c.1306C>T (p.Leu436Phe) rs34421970
NM_000414.4(HSD17B4):c.1280C>T (p.Ala427Val) rs28943590
NM_000414.4(HSD17B4):c.1317A>G (p.Val439=) rs771922933
NM_000414.4(HSD17B4):c.1471G>A (p.Ala491Thr) rs28943591
NM_000431.4(MVK):c.1129G>A (p.Val377Ile) rs28934897
NM_000431.4(MVK):c.155G>A (p.Ser52Asn) rs7957619
NM_000431.4(MVK):c.238G>A (p.Val80Ile) rs76914224
NM_000431.4(MVK):c.381G>A (p.Pro127=) rs140397628
NM_000431.4(MVK):c.405G>A (p.Ser135=) rs34368092
NM_000431.4(MVK):c.510C>T (p.Asp170=) rs2287218
NM_000431.4(MVK):c.924C>T (p.Leu308=) rs72648042
NM_000435.3(NOTCH3):c.120C>G (p.Ala40=) rs146904189
NM_000435.3(NOTCH3):c.1364G>A (p.Cys455Tyr) rs886041513
NM_000435.3(NOTCH3):c.1607-5C>A rs372869012
NM_000435.3(NOTCH3):c.1630C>T (p.Arg544Cys) rs201118034
NM_000435.3(NOTCH3):c.1672C>T (p.Arg558Cys) rs75068032
NM_000435.3(NOTCH3):c.1816T>C (p.Cys606Arg) rs1568359346
NM_000435.3(NOTCH3):c.1819C>T (p.Arg607Cys) rs777751303
NM_000435.3(NOTCH3):c.1840+8C>T rs372100017
NM_000435.3(NOTCH3):c.194G>C (p.Cys65Ser) rs1555730176
NM_000435.3(NOTCH3):c.2175T>C (p.Ser725=) rs141993521
NM_000435.3(NOTCH3):c.2300G>A (p.Arg767His) rs75291244
NM_000435.3(NOTCH3):c.2411-4C>G rs190177286
NM_000435.3(NOTCH3):c.245G>T (p.Cys82Phe) rs1023306013
NM_000435.3(NOTCH3):c.2507C>T (p.Thr836Ile) rs34338511
NM_000435.3(NOTCH3):c.3062A>G (p.Tyr1021Cys) rs1167405466
NM_000435.3(NOTCH3):c.3356G>A (p.Cys1119Tyr) rs1266914122
NM_000435.3(NOTCH3):c.3658C>T (p.Arg1220Trp) rs115872852
NM_000435.3(NOTCH3):c.3691C>T (p.Arg1231Cys) rs201680145
NM_000435.3(NOTCH3):c.3704A>T (p.His1235Leu) rs55882518
NM_000435.3(NOTCH3):c.397C>T (p.Arg133Cys) rs137852642
NM_000435.3(NOTCH3):c.4025C>A (p.Ala1342Asp) rs888391580
NM_000435.3(NOTCH3):c.4044C>T (p.Gly1348=) rs78926093
NM_000435.3(NOTCH3):c.436T>C (p.Cys146Arg) rs1555729510
NM_000435.3(NOTCH3):c.4552C>A (p.Leu1518Met) rs141320511
NM_000435.3(NOTCH3):c.4679G>C (p.Arg1560Pro) rs78501403
NM_000435.3(NOTCH3):c.4728G>C (p.Glu1576Asp)
NM_000435.3(NOTCH3):c.4875A>C (p.Pro1625=) rs538466132
NM_000435.3(NOTCH3):c.505C>T (p.Arg169Cys) rs28933696
NM_000435.3(NOTCH3):c.509A>G (p.His170Arg) rs147373451
NM_000435.3(NOTCH3):c.5200-4C>A rs375036447
NM_000435.3(NOTCH3):c.6061G>A (p.Val2021Met) rs199620476
NM_000435.3(NOTCH3):c.6092G>A (p.Arg2031His)
NM_000435.3(NOTCH3):c.619C>T (p.Arg207Cys) rs775267348
NM_000435.3(NOTCH3):c.6237G>A (p.Gly2079=) rs376598183
NM_000435.3(NOTCH3):c.660C>T (p.Tyr220=) rs114457076
NM_000435.3(NOTCH3):c.6632A>G (p.Tyr2211Cys) rs369813654
NM_000436.4(OXCT1):c.112C>T (p.Arg38Cys) rs76956231
NM_000436.4(OXCT1):c.650G>T (p.Arg217Leu) rs142383658
NM_000436.4(OXCT1):c.79-11del rs748715820
NM_000441.1(SLC26A4):c.349C>T rs145254330
NM_000441.2(SLC26A4):c.1003T>C (p.Phe335Leu) rs111033212
NM_000441.2(SLC26A4):c.1061T>C (p.Phe354Ser) rs111033243
NM_000441.2(SLC26A4):c.1541A>G (p.Gln514Arg) rs111033316
NM_000441.2(SLC26A4):c.1545-5T>G rs77944876
NM_000441.2(SLC26A4):c.1614+8C>T rs370184422
NM_000441.2(SLC26A4):c.1790T>C (p.Leu597Ser) rs55638457
NM_000441.2(SLC26A4):c.17G>T (p.Gly6Val) rs111033423
NM_000441.2(SLC26A4):c.1826T>G (p.Val609Gly) rs17154335
NM_000441.2(SLC26A4):c.2218G>A (p.Gly740Ser) rs17154353
NM_000441.2(SLC26A4):c.706C>G (p.Leu236Val) rs111033242
NM_000441.2(SLC26A4):c.796G>A (p.Asp266Asn) rs138462416
NM_000455.4(STK11):c.1045G>A (p.Glu349Lys) rs553752236
NM_000455.4(STK11):c.1284G>A (p.Ser428=) rs369097329
NM_000455.4(STK11):c.1296G>A (p.Gln432=) rs587781179
NM_000455.4(STK11):c.357C>T (p.Asn119=) rs372511774
NM_000455.4(STK11):c.369G>A (p.Gln123=) rs140112347
NM_000455.4(STK11):c.825G>A (p.Pro275=) rs202011521
NM_000455.4(STK11):c.920+7G>C rs2075607
NM_000455.4(STK11):c.945G>A (p.Pro315=) rs376329042
NM_000455.5(STK11):c.1062C>G (p.Phe354Leu) rs59912467
NM_000455.5(STK11):c.1211C>T (p.Ser404Phe) rs200078204
NM_000459.4(TEK):c.1346A>G (p.Asn449Ser) rs149684174
NM_000465.4(BARD1):c.1075_1095del (p.Leu359_Pro365del) rs28997575
NM_000465.4(BARD1):c.1519G>A (p.Val507Met) rs2070094
NM_000465.4(BARD1):c.1738G>A (p.Glu580Lys) rs35306212
NM_000465.4(BARD1):c.1933T>C (p.Cys645Arg) rs2228456
NM_000465.4(BARD1):c.1972C>T (p.Arg658Cys) rs3738888
NM_000465.4(BARD1):c.1977A>G (p.Arg659=) rs147215925
NM_000465.4(BARD1):c.2212A>G (p.Ile738Val) rs61754118
NM_000465.4(BARD1):c.722C>G (p.Ser241Cys) rs3738885
NM_000465.4(BARD1):c.90T>A (p.Gly30=) rs150354152
NM_000478.6(ALPL):c.1381G>A (p.Val461Ile) rs34810399
NM_000478.6(ALPL):c.299C>T (p.Thr100Met) rs1201942473
NM_000478.6(ALPL):c.455G>A (p.Arg152His) rs149344982
NM_000478.6(ALPL):c.534C>T (p.Tyr178=) rs201250289
NM_000478.6(ALPL):c.668G>A (p.Arg223Gln) rs199665722
NM_000478.6(ALPL):c.978CTT[2] (p.Phe328del) rs753338851
NM_000492.3(CFTR):c.*2G>A rs150914702
NM_000492.3(CFTR):c.1001G>A (p.Arg334Gln) rs397508137
NM_000492.3(CFTR):c.1046C>T (p.Ala349Val) rs121909021
NM_000492.3(CFTR):c.1054C>T (p.Arg352Trp) rs193922497
NM_000492.3(CFTR):c.1210-12T[5] rs1805177
NM_000492.3(CFTR):c.1210-12T[9] rs1805177
NM_000492.3(CFTR):c.1521_1523delCTT (p.Phe508delPhe) rs113993960
NM_000492.3(CFTR):c.1666A>G (p.Ile556Val) rs75789129
NM_000492.3(CFTR):c.1684G>C (p.Val562Leu) rs1800097
NM_000492.3(CFTR):c.1920T>C (p.Phe640=) rs145877746
NM_000492.3(CFTR):c.2055A>G (p.Gln685=) rs1457520634
NM_000492.3(CFTR):c.2173G>A (p.Glu725Lys) rs199791061
NM_000492.3(CFTR):c.221G>A (p.Arg74Gln) rs142540482
NM_000492.3(CFTR):c.2245C>T (p.Leu749=) rs151235408
NM_000492.3(CFTR):c.2252G>T (p.Arg751Leu) rs397508357
NM_000492.3(CFTR):c.2280G>A (p.Thr760=) rs138634146
NM_000492.3(CFTR):c.2421A>G (p.Ile807Met) rs1800103
NM_000492.3(CFTR):c.2506G>T (p.Asp836Tyr) rs201386642
NM_000492.3(CFTR):c.2559T>C (p.Ile853=) rs1800104
NM_000492.3(CFTR):c.2620-15C>G rs139379077
NM_000492.3(CFTR):c.2620-26A>G rs201716473
NM_000492.3(CFTR):c.2735C>T (p.Ser912Leu) rs121909034
NM_000492.3(CFTR):c.2855T>C (p.Met952Thr) rs142773283
NM_000492.3(CFTR):c.2856G>C (p.Met952Ile) rs151048781
NM_000492.3(CFTR):c.2939T>A (p.Ile980Lys) rs397508463
NM_000492.3(CFTR):c.3080T>C (p.Ile1027Thr) rs1800112
NM_000492.3(CFTR):c.3095A>G (p.Tyr1032Cys) rs144055758
NM_000492.3(CFTR):c.3107C>A (p.Thr1036Asn) rs397508498
NM_000492.3(CFTR):c.3181G>C (p.Gly1061Arg) rs142394380
NM_000492.3(CFTR):c.3200C>T (p.Ala1067Val) rs1800114
NM_000492.3(CFTR):c.3205G>A (p.Gly1069Arg) rs200321110
NM_000492.3(CFTR):c.328G>T (p.Asp110Tyr) rs113993958
NM_000492.3(CFTR):c.332C>T (p.Pro111Leu) rs140502196
NM_000492.3(CFTR):c.3468+2dup rs1554392800
NM_000492.3(CFTR):c.3469-17T>C rs199630678
NM_000492.3(CFTR):c.3469-20T>C rs373002889
NM_000492.3(CFTR):c.3485G>T (p.Arg1162Leu) rs1800120
NM_000492.3(CFTR):c.349C>G (p.Arg117Gly) rs77834169
NM_000492.3(CFTR):c.3558A>G (p.Gln1186=) rs1800121
NM_000492.3(CFTR):c.360G>A (p.Ala120=) rs1800077
NM_000492.3(CFTR):c.3717+40A>G rs397508595
NM_000492.3(CFTR):c.3718-24G>A rs374013084
NM_000492.3(CFTR):c.374T>C (p.Ile125Thr) rs141723617
NM_000492.3(CFTR):c.4056G>C (p.Gln1352His) rs113857788
NM_000492.3(CFTR):c.4056G>T (p.Gln1352His) rs113857788
NM_000492.3(CFTR):c.4097T>C (p.Ile1366Thr) rs200955612
NM_000492.3(CFTR):c.4243-20A>G rs138025486
NM_000492.3(CFTR):c.4243-5C>T rs114402068
NM_000492.3(CFTR):c.4272C>T (p.Tyr1424=) rs1800135
NM_000492.3(CFTR):c.4296C>T (p.Asn1432=) rs761669740
NM_000492.3(CFTR):c.4357C>T (p.Arg1453Trp) rs4148725
NM_000492.3(CFTR):c.581G>T (p.Gly194Val) rs397508763
NM_000492.3(CFTR):c.663G>A (p.Ala221=) rs758147990
NM_000492.3(CFTR):c.91C>T (p.Arg31Cys) rs1800073
NM_000492.3(CFTR):c.935_937delTCT (p.Phe312del) rs121908768
NM_000492.3(CFTR):c.960A>G (p.Leu320=) rs56093012
NM_000492.4(CFTR):c.-4G>C rs369326781
NM_000492.4(CFTR):c.-8G>C rs1800501
NM_000492.4(CFTR):c.1040G>A (p.Arg347His) rs77932196
NM_000492.4(CFTR):c.1043T>A (p.Met348Lys) rs142920240
NM_000492.4(CFTR):c.1210-11T>G rs73715573
NM_000492.4(CFTR):c.1327G>T (p.Asp443Tyr) rs147422190
NM_000492.4(CFTR):c.1367T>C rs193922500
NM_000492.4(CFTR):c.1408G>A (p.Val470Met) rs213950
NM_000492.4(CFTR):c.1523T>G (p.Phe508Cys) rs74571530
NM_000492.4(CFTR):c.1581A>G (p.Glu527=) rs1800094
NM_000492.4(CFTR):c.1584G>A (p.Glu528=) rs1800095
NM_000492.4(CFTR):c.1624G>T (p.Gly542Ter) rs113993959
NM_000492.4(CFTR):c.1646G>A (p.Ser549Asn) rs121908755
NM_000492.4(CFTR):c.1652G>A (p.Gly551Asp) rs75527207
NM_000492.4(CFTR):c.1684G>A (p.Val562Ile) rs1800097
NM_000492.4(CFTR):c.1727G>C (p.Gly576Ala) rs1800098
NM_000492.4(CFTR):c.1853T>C (p.Ile618Thr) rs139468767
NM_000492.4(CFTR):c.2002C>T (p.Arg668Cys) rs1800100
NM_000492.4(CFTR):c.220C>T (p.Arg74Trp) rs115545701
NM_000492.4(CFTR):c.224G>A (p.Arg75Gln) rs1800076
NM_000492.4(CFTR):c.2260G>A (p.Val754Met) rs150157202
NM_000492.4(CFTR):c.2562T>G (p.Thr854=) rs1042077
NM_000492.4(CFTR):c.274-6T>C rs371315549
NM_000492.4(CFTR):c.2820T>G (p.Thr940=) rs60887846
NM_000492.4(CFTR):c.2834C>T (p.Ser945Leu) rs397508442
NM_000492.4(CFTR):c.2898G>A (p.Thr966=) rs1800109
NM_000492.4(CFTR):c.2900T>C (p.Leu967Ser) rs1800110
NM_000492.4(CFTR):c.2930C>T (p.Ser977Phe) rs141033578
NM_000492.4(CFTR):c.2991G>C (p.Leu997Phe) rs1800111
NM_000492.4(CFTR):c.3154T>G (p.Phe1052Val) rs150212784
NM_000492.4(CFTR):c.3209G>A (p.Arg1070Gln) rs78769542
NM_000492.4(CFTR):c.3222T>A (p.Phe1074Leu) rs186045772
NM_000492.4(CFTR):c.3285A>T (p.Thr1095=) rs1800118
NM_000492.4(CFTR):c.3454G>C (p.Asp1152His) rs75541969
NM_000492.4(CFTR):c.350G>A (p.Arg117His) rs78655421
NM_000492.4(CFTR):c.3705T>G (p.Ser1235Arg) rs34911792
NM_000492.4(CFTR):c.3846G>A (p.Trp1282Ter) rs77010898
NM_000492.4(CFTR):c.3870A>G (p.Pro1290=) rs1800130
NM_000492.4(CFTR):c.3897A>G (p.Thr1299=) rs1800131
NM_000492.4(CFTR):c.4242+13A>G rs76179227
NM_000492.4(CFTR):c.4243-35del rs193922527
NM_000492.4(CFTR):c.4333G>A (p.Asp1445Asn) rs148783445
NM_000492.4(CFTR):c.4389G>A (p.Gln1463=) rs1800136
NM_000492.4(CFTR):c.443T>C (p.Ile148Thr) rs35516286
NM_000492.4(CFTR):c.489+3A>G rs377729736
NM_000492.4(CFTR):c.509G>A (p.Arg170His) rs1800079
NM_000492.4(CFTR):c.571T>G (p.Phe191Val) rs141482808
NM_000492.4(CFTR):c.617T>G (p.Leu206Trp) rs121908752
NM_000492.4(CFTR):c.695T>A (p.Val232Asp) rs397508783
NM_000492.4(CFTR):c.890G>A (p.Arg297Gln) rs143486492
NM_000517.4(HBA2):c.-41C>G rs1188584832
NM_000517.4(HBA2):c.142G>C (p.Asp48His) rs281864834
NM_000517.4(HBA2):c.427T>C (p.Ter143Gln) rs41464951
NM_000517.4(HBA2):c.427T>G (p.Ter143Glu) rs41464951
NM_000517.4(HBA2):c.49A>G (p.Lys17Glu) rs281865555
NM_000517.6(HBA2):c.*103G>A rs1363099908
NM_000517.6(HBA2):c.*98T>C rs1455865276
NM_000517.6(HBA2):c.146T>G (p.Leu49Arg) rs41392146
NM_000517.6(HBA2):c.237C>A (p.Asn79Lys) rs281860607
NM_000517.6(HBA2):c.257A>T (p.Asp86Val) rs41331747
NM_000517.6(HBA2):c.300+64A>G rs111264741
NM_000517.6(HBA2):c.301-24delinsCTCGGCCC rs1596570272
NM_000517.6(HBA2):c.30C>G (p.Asn10Lys) rs111033604
NM_000517.6(HBA2):c.344C>T (p.Pro115Leu) rs267607269
NM_000517.6(HBA2):c.377T>C (p.Leu126Pro) rs41397847
NM_000517.6(HBA2):c.377T>G (p.Leu126Arg) rs41397847
NM_000517.6(HBA2):c.379G>A (p.Asp127Asn) rs33933481
NM_000517.6(HBA2):c.38C>A (p.Ala13Asp)
NM_000517.6(HBA2):c.40G>C (p.Ala14Pro) rs281860609
NM_000517.6(HBA2):c.420del (p.Lys140fs) rs63750520
NM_000517.6(HBA2):c.64G>C (p.Ala22Pro) rs281864817
NM_000517.6(HBA2):c.69C>T (p.Gly23=) rs63751457
NM_000517.6(HBA2):c.95+27C>T rs558457816
NM_000517.6(HBA2):c.95+39C>G rs1025977498
NM_000517.6(HBA2):c.98T>G (p.Met33Arg) rs1468615416
NM_000518.4(HBB):c.137T>C (p.Phe46Ser) rs33978338
NM_000518.4(HBB):c.142G>A (p.Asp48Asn) rs33932070
NM_000518.4(HBB):c.157G>A (p.Asp53Asn) rs33961886
NM_000518.4(HBB):c.157G>C (p.Asp53His) rs33961886
NM_000518.4(HBB):c.184A>G (p.Lys62Glu) rs33995148
NM_000518.4(HBB):c.194G>C (p.Gly65Ala) rs33922018
NM_000518.4(HBB):c.220G>A (p.Asp74Asn) rs33945705
NM_000518.4(HBB):c.232C>T (p.His78Tyr) rs33991294
NM_000518.4(HBB):c.238G>A (p.Asp80Asn) rs33990858
NM_000518.4(HBB):c.238G>C (p.Asp80His) rs33990858
NM_000518.4(HBB):c.238G>T (p.Asp80Tyr) rs33990858
NM_000518.4(HBB):c.23A>G (p.Glu8Gly) rs34387455
NM_000518.4(HBB):c.266T>C (p.Leu89Pro) rs33940204
NM_000518.4(HBB):c.271G>A (p.Glu91Lys) rs33913712
NM_000518.4(HBB):c.275T>C (p.Leu92Pro) rs33917785
NM_000518.4(HBB):c.29C>G (p.Ser10Cys) rs33918131
NM_000518.4(HBB):c.332T>C (p.Leu111Pro) rs35256489
NM_000518.4(HBB):c.34G>A (p.Val12Ile) rs33974228
NM_000518.4(HBB):c.364G>A (p.Glu122Lys) rs33946267
NM_000518.4(HBB):c.364G>C (p.Glu122Gln) rs33946267
NM_000518.4(HBB):c.371C>T (p.Thr124Ile) rs33935383
NM_000518.4(HBB):c.374C>T (p.Pro125Leu) rs33983276
NM_000518.4(HBB):c.410G>A (p.Gly137Asp) rs33949486
NM_000518.4(HBB):c.422C>A (p.Ala141Asp) rs33927093
NM_000518.4(HBB):c.430C>T (p.His144Tyr) rs33929415
NM_000518.4(HBB):c.67G>A (p.Glu23Lys) rs33959855
NM_000518.4(HBB):c.67G>C (p.Glu23Gln) rs33959855
NM_000518.4(HBB):c.68A>C (p.Glu23Ala) rs33936254
NM_000518.4(HBB):c.68A>G (p.Glu23Gly) rs33936254
NM_000518.4(HBB):c.8A>G (p.His3Arg) rs33983205
NM_000518.5(HBB):c.*56A>G rs537944366
NM_000518.5(HBB):c.*96T>C rs34029390
NM_000518.5(HBB):c.-137C>T rs33941377
NM_000518.5(HBB):c.-31C>T rs63750628
NM_000518.5(HBB):c.-50A>C rs34305195
NM_000518.5(HBB):c.-80T>A rs33980857
NM_000518.5(HBB):c.-92C>G rs397515291
NM_000518.5(HBB):c.122G>A (p.Arg41Lys) rs34831026
NM_000518.5(HBB):c.128T>C (p.Phe43Ser) rs34378160
NM_000518.5(HBB):c.131A>C (p.Glu44Ala) rs35262412
NM_000518.5(HBB):c.16C>T (p.Pro6Ser) rs33912272
NM_000518.5(HBB):c.170G>A (p.Gly57Asp) rs34439278
NM_000518.5(HBB):c.174C>A (p.Asn58Lys) rs35278874
NM_000518.5(HBB):c.179A>C (p.Lys60Thr) rs35537181
NM_000518.5(HBB):c.180G>C (p.Lys60Asn) rs34621955
NM_000518.5(HBB):c.186G>C (p.Lys62Asn) rs34446260
NM_000518.5(HBB):c.19GAG[1] (p.Glu8del) rs63750928
NM_000518.5(HBB):c.200A>C (p.Lys67Thr) rs35939489
NM_000518.5(HBB):c.205C>T (p.Leu69Phe) rs33961459
NM_000518.5(HBB):c.209G>A (p.Gly70Asp) rs34718174
NM_000518.5(HBB):c.20A>T (p.Glu7Val) rs334
NM_000518.5(HBB):c.246C>A (p.Leu82=) rs145669504
NM_000518.5(HBB):c.251G>A (p.Gly84Asp) rs1803195
NM_000518.5(HBB):c.262A>C (p.Thr88Pro) rs35553496
NM_000518.5(HBB):c.274C>T (p.Leu92=) rs769583496
NM_000518.5(HBB):c.286A>G (p.Lys96Glu) rs33914359
NM_000518.5(HBB):c.294C>T (p.His98=) rs34515413
NM_000518.5(HBB):c.314G>C (p.Arg105Thr) rs33911434
NM_000518.5(HBB):c.315+70G>C rs373152208
NM_000518.5(HBB):c.316-12T>C rs781604042
NM_000518.5(HBB):c.316-19T>A rs191535077
NM_000518.5(HBB):c.316-37G>T rs193922559
NM_000518.5(HBB):c.316-45G>C rs140033163
NM_000518.5(HBB):c.316-70C>G rs193922560
NM_000518.5(HBB):c.316-7C>A rs34483965
NM_000518.5(HBB):c.323dup (p.Asn109fs) rs35225141
NM_000518.5(HBB):c.324C>T (p.Gly108=) rs193922562
NM_000518.5(HBB):c.328G>A (p.Val110Met) rs33969677
NM_000518.5(HBB):c.33C>A (p.Ala11=) rs35799536
NM_000518.5(HBB):c.341T>A (p.Val114Glu) rs34484056
NM_000518.5(HBB):c.353A>G (p.His118Arg) rs33935673
NM_000518.5(HBB):c.359G>A (p.Gly120Asp) rs33947020
NM_000518.5(HBB):c.363A>C (p.Lys121Asn) rs34726542
NM_000518.5(HBB):c.380T>A (p.Val127Glu) rs33925391
NM_000518.5(HBB):c.380T>C (p.Val127Ala) rs33925391
NM_000518.5(HBB):c.380T>G (p.Val127Gly) rs33925391
NM_000518.5(HBB):c.389C>T (p.Ala130Val) rs111645889
NM_000518.5(HBB):c.394C>A (p.Gln132Lys) rs33910209
NM_000518.5(HBB):c.394C>G (p.Gln132Glu) rs33910209
NM_000518.5(HBB):c.397A>C (p.Lys133Gln) rs33953406
NM_000518.5(HBB):c.402G>C (p.Val134=) rs113082294
NM_000518.5(HBB):c.431A>C (p.His144Pro) rs33918338
NM_000518.5(HBB):c.431A>G (p.His144Arg) rs33918338
NM_000518.5(HBB):c.432C>T (p.His144=) rs36020563
NM_000518.5(HBB):c.435G>C (p.Lys145Asn) rs35020585
NM_000518.5(HBB):c.436T>C (p.Tyr146His) rs33949869
NM_000518.5(HBB):c.437A>G (p.Tyr146Cys) rs35117167
NM_000518.5(HBB):c.50G>A (p.Gly17Asp) rs33962676
NM_000518.5(HBB):c.59A>G (p.Asn20Ser) rs33972047
NM_000518.5(HBB):c.5T>C (p.Val2Ala) rs33949930
NM_000518.5(HBB):c.61G>A (p.Val21Met) rs35890959
NM_000518.5(HBB):c.75T>A (p.Gly25=) rs33951465
NM_000518.5(HBB):c.79G>A (p.Glu27Lys) rs33950507
NM_000518.5(HBB):c.82G>T (p.Ala28Ser) rs35424040
NM_000518.5(HBB):c.92+6T>C rs35724775
NM_000518.5(HBB):c.93-23T>C rs111851677
NM_000520.6(HEXA):c.1306A>G (p.Ile436Val) rs1800431
NM_000520.6(HEXA):c.1518A>G (p.Glu506=) rs4777502
NM_000520.6(HEXA):c.759G>A (p.Val253=) rs117513345
NM_000520.6(HEXA):c.806-7G>A rs770932296
NM_000520.6(HEXA):c.9C>T (p.Ser3=) rs1800428
NM_000527.5(LDLR):c.631C>T (p.His211Tyr) rs771917370
NM_000530.8(MPZ):c.200G>A (p.Arg67His) rs201720099
NM_000530.8(MPZ):c.418T>A (p.Ser140Thr) rs572010627
NM_000530.8(MPZ):c.504G>A (p.Val168=) rs145592910
NM_000530.8(MPZ):c.684C>T (p.Ser228=) rs34307129
NM_000531.6(OTC):c.167T>C (p.Met56Thr) rs72554320
NM_000531.6(OTC):c.809A>G (p.Gln270Arg) rs1800328
NM_000532.5(PCCB):c.815G>A (p.Arg272Gln) rs150555106
NM_000535.7(PMS2):c.1004A>G (p.Asn335Ser) rs200513014
NM_000535.7(PMS2):c.1144+1G>A rs373885654
NM_000535.7(PMS2):c.137G>T (p.Ser46Ile) rs121434629
NM_000535.7(PMS2):c.1408C>T (p.Pro470Ser) rs1805321
NM_000535.7(PMS2):c.1437C>G (p.His479Gln) rs63750685
NM_000535.7(PMS2):c.1454C>A (p.Thr485Lys) rs1805323
NM_000535.7(PMS2):c.1531A>G (p.Thr511Ala) rs2228007
NM_000535.7(PMS2):c.1532C>T (p.Thr511Met) rs74902811
NM_000535.7(PMS2):c.1556A>G (p.Tyr519Cys) rs63750649
NM_000535.7(PMS2):c.1559C>T (p.Ala520Val) rs63751300
NM_000535.7(PMS2):c.1569C>G (p.Ser523=) rs141458772
NM_000535.7(PMS2):c.1609G>A (p.Glu537Lys) rs115052399
NM_000535.7(PMS2):c.1621= (p.Lys541=) rs2228006
NM_000535.7(PMS2):c.1688G>T (p.Arg563Leu) rs63750668
NM_000535.7(PMS2):c.1711C>A (p.Leu571Ile) rs63750055
NM_000535.7(PMS2):c.1789A>T (p.Thr597Ser) rs1805318
NM_000535.7(PMS2):c.1866G>A (p.Met622Ile) rs1805324
NM_000535.7(PMS2):c.2149G>A (p.Val717Met) rs201671325
NM_000535.7(PMS2):c.23+10G>C rs192027828
NM_000535.7(PMS2):c.2521del (p.Trp841fs) rs886039646
NM_000535.7(PMS2):c.2570G>C (p.Gly857Ala) rs1802683
NM_000535.7(PMS2):c.379G>A (p.Ala127Thr) rs114090343
NM_000535.7(PMS2):c.383C>T (p.Ser128Leu) rs116373169
NM_000535.7(PMS2):c.52A>G (p.Ile18Val) rs63750123
NM_000535.7(PMS2):c.59G>A (p.Arg20Gln) rs10254120
NM_000535.7(PMS2):c.620G>A (p.Gly207Glu) rs374704824
NM_000535.7(PMS2):c.830C>A (p.Thr277Lys) rs1805322
NM_000535.7(PMS2):c.953A>G (p.Tyr318Cys) rs139438201
NM_000539.3(RHO):c.1020G>A (p.Thr340=) rs559747229
NM_000539.3(RHO):c.1021G>A (p.Glu341Lys) rs142322202
NM_000539.3(RHO):c.360C>T (p.Gly120=) rs79765751
NM_000539.3(RHO):c.563G>A (p.Gly188Glu) rs1424131846
NM_000541.5(SAG):c.1091C>T (p.Pro364Leu) rs112613526
NM_000541.5(SAG):c.511A>G (p.Lys171Glu) rs552862207
NM_000543.5(SMPD1):c.1550A>T (p.Glu517Val) rs142787001
NM_000545.6(HNF1A):c.92G>A (p.Gly31Asp) rs137853247
NM_000546.5(TP53):c.6G>A (p.Glu2=) rs143458271
NM_000546.5(TP53):c.74+38C>G rs1642785
NM_000546.5(TP53):c.845G>A (p.Arg282Gln) rs730882008
NM_000546.6(TP53):c.139C>T (p.Pro47Ser) rs1800371
NM_000546.6(TP53):c.215C>G (p.Pro72Arg) rs1042522
NM_000548.3(TSC2):c.4527_4529delCTT (p.Phe1510del) rs137854239
NM_000548.5(TSC2):c.1100G>A (p.Arg367Gln) rs1800725
NM_000548.5(TSC2):c.1276C>T (p.Leu426=) rs45478593
NM_000548.5(TSC2):c.1281C>A (p.Ile427=) rs45478892
NM_000548.5(TSC2):c.1318G>A (p.Gly440Ser) rs45484298
NM_000548.5(TSC2):c.1543C>T (p.Leu515=) rs35896166
NM_000548.5(TSC2):c.1578C>T (p.Ser526=) rs34012042
NM_000548.5(TSC2):c.1939G>A (p.Asp647Asn) rs45509392
NM_000548.5(TSC2):c.2031C>T (p.Pro677=) rs45517208
NM_000548.5(TSC2):c.2545+26G>A rs45517242
NM_000548.5(TSC2):c.275A>T (p.Glu92Val) rs137853994
NM_000548.5(TSC2):c.2986A>G (p.Thr996Ala) rs139753238
NM_000548.5(TSC2):c.3126G>C (p.Pro1042=) rs36078782
NM_000548.5(TSC2):c.3366T>C (p.Arg1122=) rs778352969
NM_000548.5(TSC2):c.3744C>T (p.Ala1248=) rs45517307
NM_000548.5(TSC2):c.3883+8C>G rs45517316
NM_000548.5(TSC2):c.3889G>A (p.Ala1297Thr) rs45517319
NM_000548.5(TSC2):c.3986G>A (p.Arg1329His) rs45517323
NM_000548.5(TSC2):c.4269G>A (p.Leu1423=) rs45438898
NM_000548.5(TSC2):c.4285G>T (p.Ala1429Ser) rs45474795
NM_000548.5(TSC2):c.4493+17C>T rs45517345
NM_000548.5(TSC2):c.4536C>T (p.Asp1512=) rs35986575
NM_000548.5(TSC2):c.482-3C>T rs1800720
NM_000548.5(TSC2):c.4983C>T (p.Thr1661=) rs35534817
NM_000548.5(TSC2):c.5161-10A>C rs1800718
NM_000548.5(TSC2):c.5202T>C (p.Asp1734=) rs1748
NM_000548.5(TSC2):c.5321G>C (p.Ser1774Thr) rs9209
NM_000548.5(TSC2):c.5383C>T (p.Arg1795Cys) rs45517423
NM_000548.5(TSC2):c.5397G>C (p.Ser1799=) rs1051771
NM_000548.5(TSC2):c.729C>G (p.Leu243=) rs45473698
NM_000548.5(TSC2):c.848+276C>G rs60154230
NM_000548.5(TSC2):c.849-8A>G rs765336852
NM_000551.3(VHL):c.183C>G (p.Pro61=) rs63650860
NM_000551.3(VHL):c.74C>T (p.Pro25Leu) rs35460768
NM_000551.4(VHL):c.340+5G>C rs61758376
NM_000551.4(VHL):c.500G>A (p.Arg167Gln) rs5030821
NM_000552.4(VWF):c.1548T>C (p.Tyr516=) rs1800379
NM_000552.4(VWF):c.2365A>G (p.Thr789Ala) rs1063856
NM_000552.4(VWF):c.2385T>C (p.Tyr795=) rs1063857
NM_000552.4(VWF):c.2451T>A (p.His817Gln) rs57950734
NM_000552.4(VWF):c.2561G>A (p.Arg854Gln) rs41276738
NM_000552.4(VWF):c.2771G>A (p.Arg924Gln) rs33978901
NM_000552.4(VWF):c.3686T>G (p.Val1229Gly) rs61749367
NM_000552.4(VWF):c.3719C>T (p.Pro1240Leu) rs150576611
NM_000552.4(VWF):c.3789G>A (p.Ser1263=) rs199831474
NM_000552.4(VWF):c.3797C>T (p.Pro1266Leu) rs61749370
NM_000552.4(VWF):c.3916C>T (p.Arg1306Trp) rs61749384
NM_000552.4(VWF):c.3922C>T (p.Arg1308Cys) rs61749387
NM_000552.4(VWF):c.4141A>G (p.Thr1381Ala) rs216311
NM_000552.4(VWF):c.4195C>T (p.Arg1399Cys) rs61750077
NM_000552.4(VWF):c.4443G>T (p.Gly1481=) rs144796763
NM_000552.4(VWF):c.4641T>C (p.Thr1547=) rs216310
NM_000552.4(VWF):c.4751A>G (p.Tyr1584Cys) rs1800386
NM_000552.4(VWF):c.4824C>T (p.Thr1608=) rs142635883
NM_000552.4(VWF):c.5278G>A (p.Val1760Ile) rs61750604
NM_000552.4(VWF):c.5312-19A>C rs200237834
NM_000552.4(VWF):c.5313G>T (p.Gly1771=) rs2229448
NM_000552.5(VWF):c.4196G>A rs1800382
NM_000554.6(CRX):c.196G>A (p.Val66Ile) rs61748438
NM_000554.6(CRX):c.365G>A (p.Gly122Asp) rs61748441
NM_000557.5(GDF5):c.349G>T (p.Ala117Ser) rs151149144
NM_000557.5(GDF5):c.652A>C (p.Arg218=) rs116467702
NM_000557.5(GDF5):c.979C>G (p.Leu327Val) rs181772082
NM_000558.3(HBA1):c.142G>A (p.Asp48Asn) rs34269448
NM_000558.3(HBA1):c.179G>A (p.Gly60Asp) rs28928878
NM_000558.3(HBA1):c.193G>C (p.Asp65His) rs33984024
NM_000558.3(HBA1):c.20A>G (p.Asp7Gly) rs33986902
NM_000558.3(HBA1):c.226G>T (p.Asp76Tyr) rs33977363
NM_000558.3(HBA1):c.270C>G (p.His90Gln) rs1061009
NM_000558.3(HBA1):c.287C>T (p.Pro96Leu) rs33931314
NM_000558.3(HBA1):c.341T>A (p.Leu114His) rs35654345
NM_000558.3(HBA1):c.349G>A (p.Glu117Lys) rs63749882
NM_000558.3(HBA1):c.389T>C (p.Leu130Pro) rs35993655
NM_000558.3(HBA1):c.49A>G (p.Lys17Glu) rs41407250
NM_000558.5(HBA1):c.*46C>A rs141514155
NM_000558.5(HBA1):c.-42C>T rs370305736
NM_000558.5(HBA1):c.-52C>T rs1276035978
NM_000558.5(HBA1):c.104T>G (p.Leu35Arg) rs35203445
NM_000558.5(HBA1):c.17C>A (p.Ala6Asp) rs34090856
NM_000558.5(HBA1):c.223G>C (p.Asp75His) rs28928875
NM_000558.5(HBA1):c.273G>C (p.Lys91Asn) rs33914470
NM_000558.5(HBA1):c.301-31_301-24delinsG
NM_000558.5(HBA1):c.337C>G (p.His113Asp) rs34830032
NM_000558.5(HBA1):c.350A>C (p.Glu117Ala) rs35932809
NM_000558.5(HBA1):c.362C>A (p.Ala121Glu) rs63749927
NM_000558.5(HBA1):c.364G>A (p.Val122Met) rs63751008
NM_000558.5(HBA1):c.396T>C (p.Ser132=) rs149264789
NM_000558.5(HBA1):c.47G>A (p.Gly16Asp) rs281865560
NM_000558.5(HBA1):c.84G>T (p.Glu28Asp) rs41530750
NM_000558.5(HBA1):c.91G>A (p.Glu31Lys) rs33993166
NM_000558.5(HBA1):c.96-1G>A rs34883113
NM_000637.5(GSR):c.1069A>G (p.Ile357Val) rs75673983
NM_000637.5(GSR):c.694G>A (p.Gly232Ser) rs8190976
NM_000709.4(BCKDHA):c.452C>T (p.Thr151Met) rs34442879
NM_000709.4(BCKDHA):c.639C>T (p.Ile213=) rs10404506
NM_000709.4(BCKDHA):c.648G>T (p.Ala216=) rs114716391
NM_000709.4(BCKDHA):c.975C>T (p.Leu325=) rs55940366
NM_000717.5(CA4):c.415A>T (p.Met139Leu) rs185658468
NM_000719.7(CACNA1C):c.1218-6C>T rs727503833
NM_000719.7(CACNA1C):c.1794C>T (p.Gly598=) rs116491041
NM_000719.7(CACNA1C):c.2449C>T (p.Pro817Ser) rs112532048
NM_000719.7(CACNA1C):c.3049-10C>T rs186741807
NM_000719.7(CACNA1C):c.3642C>T (p.Tyr1214=) rs56394008
NM_000719.7(CACNA1C):c.3780C>A (p.Gly1260=) rs201258230
NM_000719.7(CACNA1C):c.3829-614A>G rs114851656
NM_000719.7(CACNA1C):c.5593G>A (p.Glu1865Lys) rs200231105
NM_000719.7(CACNA1C):c.5649G>A (p.Pro1883=) rs56270948
NM_000719.7(CACNA1C):c.5665C>T (p.Arg1889Cys) rs185788586
NM_000744.7(CHRNA4):c.1360G>A (p.Gly454Ser) rs78306886
NM_000883.4(IMPDH1):c.1489C>T (p.Arg497Trp) rs72624967
NM_000883.4(IMPDH1):c.377T>C (p.Phe126Ser) rs367549284
NM_000891.2(KCNJ2):c.1200G>A (p.Thr400=) rs201253055
NM_000891.2(KCNJ2):c.1229A>G (p.Asn410Ser) rs141069645
NM_000941.3(POR):c.1521C>T (p.Gly507=) rs370823127
NM_000941.3(POR):c.1891G>A (p.Val631Ile) rs145782750
NM_000941.3(POR):c.1898+3G>A rs41301439
NM_000941.3(POR):c.517-4G>A rs41299496
NM_000941.3(POR):c.683C>T (p.Pro228Leu) rs17853284
NM_000941.3(POR):c.687C>T (p.Ala229=) rs72557906
NM_001003800.2(BICD2):c.1893C>T (p.Ile631=) rs141414055
NM_001003800.2(BICD2):c.2258+15G>C rs140501870
NM_001003800.2(BICD2):c.269A>G (p.Lys90Arg) rs61754130
NM_001005242.3(PKP2):c.1114G>C (p.Ala372Pro) rs200586695
NM_001005242.3(PKP2):c.1171-11T>C rs183414126
NM_001005242.3(PKP2):c.1445C>T (p.Thr482Met) rs146882581
NM_001005242.3(PKP2):c.1460T>G (p.Ile487Ser) rs147240502
NM_001005242.3(PKP2):c.1627G>A (p.Val543Ile) rs146102241
NM_001005242.3(PKP2):c.174G>T (p.Glu58Asp) rs146708884
NM_001005242.3(PKP2):c.2352C>T (p.Gly784=) rs727504509
NM_001005242.3(PKP2):c.419C>T (p.Ser140Phe) rs150821281
NM_001005242.3(PKP2):c.706G>T (p.Ala236Ser) rs62001015
NM_001005242.3(PKP2):c.76G>A (p.Asp26Asn) rs143004808
NM_001005360.2(DNM2):c.1782-5C>T rs200103145
NM_001005360.2(DNM2):c.1837G>A (p.Val613Met) rs748286191
NM_001005360.2(DNM2):c.1902C>T (p.Asn634=) rs2229919
NM_001005360.2(DNM2):c.235+6A>G rs113192269
NM_001005360.2(DNM2):c.236-8C>G rs143084059
NM_001005360.2(DNM2):c.238C>T (p.His80Tyr) rs148790687
NM_001005360.2(DNM2):c.2543+7C>G rs201979143
NM_001005360.2(DNM2):c.519T>C (p.Ala173=) rs77702567
NM_001005360.2(DNM2):c.958G>A (p.Asp320Asn) rs150613209
NM_001006658.2(CR2):c.2298G>A (p.Trp766Ter) rs151093663
NM_001006658.2(CR2):c.624C>A (p.Pro208=) rs61759494
NM_001006658.3(CR2):c.524C>T (p.Pro175Leu) rs75282758
NM_001007792.1(NTRK1):c.1144-6C>G
NM_001007792.1(NTRK1):c.123-3367G>A rs1007211
NM_001007792.1(NTRK1):c.123-3404C>T rs201472270
NM_001007792.1(NTRK1):c.1698-4del rs1799770
NM_001007792.1(NTRK1):c.1702C>T (p.His568Tyr) rs6336
NM_001007792.1(NTRK1):c.1730G>T (p.Gly577Val) rs6339
NM_001007792.1(NTRK1):c.1800G>A (p.Ala600=) rs17838192
NM_001007792.1(NTRK1):c.2231G>A (p.Arg744Gln) rs35669708
NM_001007792.1(NTRK1):c.338+12C>A rs41267425
NM_001007792.1(NTRK1):c.775C>A (p.Gln259Lys) rs137979116
NM_001007792.1(NTRK1):c.978C>T (p.Asn326=) rs145823996
NM_001009944.3(PKD1):c.10619G>C (p.Gly3540Ala) rs201409107
NM_001009944.3(PKD1):c.11015G>A (p.Arg3672Gln) rs201220835
NM_001009944.3(PKD1):c.11258G>A (p.Arg3753Gln) rs1555446330
NM_001009944.3(PKD1):c.11356G>C (p.Glu3786Gln) rs147992238
NM_001009944.3(PKD1):c.11717G>T (p.Cys3906Phe) rs369291413
NM_001009944.3(PKD1):c.12465T>G (p.Phe4155Leu)
NM_001009944.3(PKD1):c.12691C>T (p.Gln4231Ter) rs755496450
NM_001009944.3(PKD1):c.12826C>T (p.Arg4276Trp) rs114251396
NM_001009944.3(PKD1):c.1831C>T (p.Arg611Trp) rs1555458413
NM_001009944.3(PKD1):c.2180T>C (p.Leu727Pro) rs1616940
NM_001009944.3(PKD1):c.2655C>T (p.Cys885=) rs142606648
NM_001009944.3(PKD1):c.3496G>A (p.Gly1166Ser) rs573566419
NM_001009944.3(PKD1):c.5453C>T (p.Ala1818Val) rs746910149
NM_001009944.3(PKD1):c.5648C>T (p.Ala1883Val) rs779745348
NM_001009944.3(PKD1):c.5770G>A (p.Gly1924Ser) rs199947459
NM_001009944.3(PKD1):c.588C>T (p.Ser196=) rs776302294
NM_001009944.3(PKD1):c.6496C>T (p.Arg2166Cys) rs146096401
NM_001009944.3(PKD1):c.6749C>T (p.Thr2250Met) rs139971481
NM_001009944.3(PKD1):c.7430G>A (p.Arg2477His) rs556618384
NM_001009944.3(PKD1):c.7636C>T (p.His2546Tyr) rs200037070
NM_001009944.3(PKD1):c.8111C>T (p.Ala2704Val) rs200509641
NM_001009944.3(PKD1):c.8284_8295del (p.Ile2762_Arg2765del) rs1596527370
NM_001009944.3(PKD1):c.8293C>T (p.Arg2765Cys) rs144979397
NM_001009944.3(PKD1):c.8305C>T (p.Leu2769Phe) rs771382752
NM_001009944.3(PKD1):c.9499A>T (p.Ile3167Phe) rs139945204
NM_001009944.3(PKD1):c.971G>T (p.Arg324Leu) rs199476099
NM_001009944.3(PKD1):c.9898G>A (p.Gly3300Arg) rs777024498
NM_001013703.4(EIF2AK4):c.4007A>G (p.Lys1336Arg) rs35480871
NM_001018005.2(TPM1):c.180C>T (p.Tyr60=) rs17850194
NM_001024630.4(RUNX2):c.1531G>A (p.Gly511Ser) rs11498198
NM_001024630.4(RUNX2):c.225GGCGGCTGCGGCGGCGGC[1] (p.Ala84_Ala89del) rs11498192
NM_001024630.4(RUNX2):c.254C>T (p.Ala85Val) rs372138746
NM_001029835.2(CCM2):c.867-5C>T rs145003686
NM_001029883.3(PCARE):c.1297C>T (p.Pro433Ser) rs200696965
NM_001032283.3(TMPO):c.565+1105C>T rs138790561
NM_001032386.2(SUOX):c.629C>T (p.Pro210Leu) rs141735896
NM_001033855.3(DCLRE1C):c.1893C>T (p.Pro631=) rs41300676
NM_001033855.3(DCLRE1C):c.227G>C (p.Arg76Thr) rs41296438
NM_001033855.3(DCLRE1C):c.457G>A (p.Gly153Arg) rs41297018
NM_001033855.3(DCLRE1C):c.959C>G (p.Ser320Cys) rs41298896
NM_001034850.2(RETREG1):c.86C>T (p.Pro29Leu) rs528532732
NM_001035.3(RYR2):c.10017C>T (p.His3339=) rs376439588
NM_001035.3(RYR2):c.10230+20T>C rs74323916
NM_001035.3(RYR2):c.10231-4T>C rs117180147
NM_001035.3(RYR2):c.10941T>G (p.Pro3647=) rs370332882
NM_001035.3(RYR2):c.11246-11del rs397516503
NM_001035.3(RYR2):c.1134C>T (p.Asp378=) rs193922621
NM_001035.3(RYR2):c.11496C>T (p.Asp3832=) rs397516505
NM_001035.3(RYR2):c.12159G>A (p.Glu4053=) rs41267517
NM_001035.3(RYR2):c.13566C>T (p.Val4522=) rs57360419
NM_001035.3(RYR2):c.13782+20A>G
NM_001035.3(RYR2):c.14809-15C>G rs790897
NM_001035.3(RYR2):c.2396+17T>G rs376363428
NM_001035.3(RYR2):c.2630A>C (p.His877Pro) rs561321743
NM_001035.3(RYR2):c.3038G>A (p.Arg1013Gln) rs149514924
NM_001035.3(RYR2):c.3380A>G (p.Glu1127Gly) rs200525962
NM_001035.3(RYR2):c.3407C>T (p.Ala1136Val) rs72549415
NM_001035.3(RYR2):c.4596+12G>A rs148557427
NM_001035.3(RYR2):c.7161G>A (p.Ala2387=) rs371560909
NM_001035.3(RYR2):c.774-14G>T rs370114411
NM_001035.3(RYR2):c.8162T>C (p.Ile2721Thr) rs201500134
NM_001035.3(RYR2):c.9318T>A (p.Ser3106=) rs2797436
NM_001037.5(SCN1B):c.28G>A (p.Gly10Ser) rs72552027
NM_001037.5(SCN1B):c.351C>T (p.Gly117=) rs3746255
NM_001037.5(SCN1B):c.588T>C (p.Asn196=) rs77244433
NM_001037.5(SCN1B):c.632G>A (p.Cys211Tyr) rs150721582
NM_001039213.4(CEACAM16):c.781G>A (p.Glu261Lys) rs201188632
NM_001039803.2(CDK20):c.610T>C (p.Phe204Leu) rs745561217
NM_001040716.2(PC):c.1446C>T (p.Asp482=) rs145891535
NM_001040716.2(PC):c.616G>T (p.Val206Leu) rs147945506
NM_001042492.3(NF1):c.1810T>C (p.Leu604=) rs142712751
NM_001042492.3(NF1):c.2288T>C (p.Leu763Pro) rs199474762
NM_001042492.3(NF1):c.2985G>C (p.Leu995=) rs17881467
NM_001042492.3(NF1):c.5035A>G (p.Ile1679Val) rs147327414
NM_001042492.3(NF1):c.5235G>A (p.Lys1745=) rs17887014
NM_001042492.3(NF1):c.528T>A (p.Asp176Glu) rs112306990
NM_001042492.3(NF1):c.61-4del rs551568608
NM_001042492.3(NF1):c.6147+8C>G rs182709912
NM_001042492.3(NF1):c.6922-14_6922-13del rs146785663
NM_001042492.3(NF1):c.7190-33TTGT[3] rs149197458
NM_001042492.3(NF1):c.7461A>G (p.Thr2487=) rs149924365
NM_001042492.3(NF1):c.7971-8del rs564545012
NM_001042492.3(NF1):c.846G>A (p.Gln282=) rs138840528
NM_001042702.5(PJVK):c.86A>G (p.Asp29Gly) rs200502817
NM_001048171.1(MUTYH):c.1506G>A (p.Pro502=) rs143796254
NM_001048171.1(MUTYH):c.654C>T (p.Thr218=) rs780747266
NM_001048171.1(MUTYH):c.956-9C>T rs3219488
NM_001048174.2(MUTYH):c.1103G>A (p.Gly368Asp) rs36053993
NM_001048174.2(MUTYH):c.1192C>T (p.Arg398Cys) rs150792276
NM_001048174.2(MUTYH):c.11C>T (p.Pro4Leu) rs79777494
NM_001048174.2(MUTYH):c.1347G>C (p.Thr449=) rs74318065
NM_001048174.2(MUTYH):c.228C>T (p.Tyr76=) rs121908380
NM_001048174.2(MUTYH):c.32G>A (p.Gly11Asp) rs75321043
NM_001048174.2(MUTYH):c.850-2A>G rs77542170
NM_001048174.2(MUTYH):c.930G>C (p.Gln310His) rs3219489
NM_001065.4(TNFRSF1A):c.224C>T (p.Pro75Leu) rs4149637
NM_001065.4(TNFRSF1A):c.362G>A (p.Arg121Gln) rs4149584
NM_001065.4(TNFRSF1A):c.36A>G (p.Pro12=) rs767455
NM_001065.4(TNFRSF1A):c.625+10A>G rs1800693
NM_001065.4(TNFRSF1A):c.935G>A (p.Arg312Lys) rs200900510
NM_001072.4(UGT1A6):c.1088C>T (p.Pro363Leu) rs34946978
NM_001072.4(UGT1A6):c.862-10021T>G rs4124874
NM_001072.4(UGT1A6):c.862-6061C>A rs35350960
NM_001072.4(UGT1A6):c.862-6073T>G rs35003977
NM_001077401.2(ACVRL1):c.1232G>A (p.Arg411Gln) rs121909284
NM_001079802.2(FKTN):c.1336A>G (p.Asn446Asp) rs41313301
NM_001079802.2(FKTN):c.166C>T (p.Arg56Cys) rs41277797
NM_001079802.2(FKTN):c.167G>A (p.Arg56His) rs146951171
NM_001079866.2(BCS1L):c.613G>A (p.Val205Ile) rs148278887
NM_001081.3(CUBN):c.2594G>A (p.Ser865Asn) rs138083522
NM_001081.3(CUBN):c.4268C>T (p.Thr1423Met) rs483352704
NM_001083603.1(PTCH1):c.163G>C (p.Asp55His) rs73527759
NM_001093.4(ACACB):c.134A>G (p.Gln45Arg) rs139767464
NM_001099857.5(IKBKG):c.337G>A (p.Asp113Asn) rs179363896
NM_001103.3(ACTN2):c.1383C>T (p.Ile461=) rs34827377
NM_001103.3(ACTN2):c.2649G>A (p.Ala883=) rs146426213
NM_001103.4(ACTN2):c.2076C>T (p.Ile692=) rs144122893
NM_001105206.3(LAMA4):c.195+144T>C rs147118520
NM_001105206.3(LAMA4):c.196-12T>C rs78871662
NM_001105206.3(LAMA4):c.2171G>A (p.Arg724Lys) rs146868519
NM_001105206.3(LAMA4):c.2403G>A (p.Thr801=) rs142559688
NM_001105206.3(LAMA4):c.2810A>G (p.Glu937Gly) rs35605307
NM_001105206.3(LAMA4):c.3239G>A (p.Arg1080Gln) rs41289902
NM_001105206.3(LAMA4):c.4065C>T (p.Phe1355=) rs34753919
NM_001105206.3(LAMA4):c.4173T>C (p.Tyr1391=) rs35042032
NM_001105206.3(LAMA4):c.888C>T (p.Ser296=) rs17073495
NM_001105206.3(LAMA4):c.924T>C (p.His308=) rs143580603
NM_001110556.2(FLNA):c.1029C>T (p.Ser343=) rs199853721
NM_001110556.2(FLNA):c.1044C>T (p.Pro348=) rs375821223
NM_001110556.2(FLNA):c.1176G>A (p.Glu392=) rs201173693
NM_001110556.2(FLNA):c.1191C>T (p.Ile397=) rs200048692
NM_001110556.2(FLNA):c.1286C>T (p.Thr429Met) rs36051194
NM_001110556.2(FLNA):c.1429+8C>T rs202181557
NM_001110556.2(FLNA):c.1579C>T (p.Arg527Cys) rs202029322
NM_001110556.2(FLNA):c.1813G>A (p.Asp605Asn) rs201093148
NM_001110556.2(FLNA):c.1875C>T (p.Asp625=) rs200660642
NM_001110556.2(FLNA):c.1968C>T (p.Leu656=) rs73638274
NM_001110556.2(FLNA):c.237G>C (p.Ala79=) rs200626788
NM_001110556.2(FLNA):c.2433C>T (p.Ala811=) rs35986650
NM_001110556.2(FLNA):c.2449C>T (p.Pro817Ser) rs200053635
NM_001110556.2(FLNA):c.3035C>T (p.Ser1012Leu) rs17091204
NM_001110556.2(FLNA):c.3045G>A (p.Ala1015=) rs370868704
NM_001110556.2(FLNA):c.3270C>T (p.Ile1090=) rs79391751
NM_001110556.2(FLNA):c.3690C>T (p.Thr1230=) rs35015603
NM_001110556.2(FLNA):c.3708C>T (p.Gly1236=) rs200363918
NM_001110556.2(FLNA):c.3805+16G>A rs201016252
NM_001110556.2(FLNA):c.3876C>T (p.His1292=) rs199917719
NM_001110556.2(FLNA):c.3877G>A (p.Val1293Ile) rs782265007
NM_001110556.2(FLNA):c.3915G>A (p.Thr1305=) rs201488545
NM_001110556.2(FLNA):c.4233G>A (p.Ser1411=) rs34439033
NM_001110556.2(FLNA):c.4420G>A (p.Asp1474Asn) rs782129236
NM_001110556.2(FLNA):c.4451A>G (p.Gln1484Arg) rs200130356
NM_001110556.2(FLNA):c.4737G>C (p.Leu1579=) rs201904661
NM_001110556.2(FLNA):c.4866C>T (p.Tyr1622=) rs200835571
NM_001110556.2(FLNA):c.5290G>A (p.Ala1764Thr) rs57108893
NM_001110556.2(FLNA):c.5589C>T (p.Val1863=) rs200787122
NM_001110556.2(FLNA):c.5850T>C (p.Ala1950=) rs2070825
NM_001110556.2(FLNA):c.5972C>T (p.Ser1991Leu) rs187029309
NM_001110556.2(FLNA):c.62_64dup (p.Val21dup) rs782721874
NM_001110556.2(FLNA):c.6350A>G (p.Asn2117Ser) rs375205247
NM_001110556.2(FLNA):c.6516G>A (p.Gln2172=) rs199802825
NM_001110556.2(FLNA):c.663C>T (p.Pro221=) rs2073470
NM_001110556.2(FLNA):c.6642G>C (p.Val2214=) rs1064822
NM_001110556.2(FLNA):c.6742C>T (p.Leu2248=) rs113510895
NM_001110556.2(FLNA):c.7013C>G (p.Ser2338Cys) rs781878646
NM_001110556.2(FLNA):c.7067G>A (p.Ser2356Asn) rs782739586
NM_001110556.2(FLNA):c.7222G>A (p.Gly2408Ser) rs201168500
NM_001110556.2(FLNA):c.7224C>T (p.Gly2408=) rs12008807
NM_001110556.2(FLNA):c.7267C>T (p.Pro2423Ser) rs200198847
NM_001110556.2(FLNA):c.7506C>T (p.Gly2502=) rs200195310
NM_001110556.2(FLNA):c.7649C>T (p.Pro2550Leu) rs371724771
NM_001110556.2(FLNA):c.861C>T (p.Tyr287=) rs375503410
NM_001110556.2(FLNA):c.942A>G (p.Gly314=) rs200763980
NM_001110792.2(MECP2):c.1233C>T (p.Pro411=) rs61753012
NM_001110792.2(MECP2):c.1241C>T (p.Pro414Leu) rs61753014
NM_001110792.2(MECP2):c.1351G>A (p.Ala451Thr) rs61753973
NM_001110792.2(MECP2):c.204C>T (p.Pro68=) rs61754435
NM_001110792.2(MECP2):c.433C>T (p.Arg145Cys) rs28934904
NM_001110792.2(MECP2):c.491C>G (p.Pro164Arg) rs61748404
NM_001110792.2(MECP2):c.784C>T (p.Arg262Cys) rs141382970
NM_001110792.2(MECP2):c.870C>T (p.Ala290=) rs61750248
NM_001113378.1(FANCI):c.3906T>C (p.Gly1302=) rs1138465
NM_001114753.3(ENG):c.1029C>T (p.Thr343=) rs3739817
NM_001114753.3(ENG):c.1060C>T (p.Leu354=) rs36092484
NM_001114753.3(ENG):c.1096G>C (p.Asp366His) rs1800956
NM_001114753.3(ENG):c.120C>T (p.Gly40=) rs41522944
NM_001114753.3(ENG):c.14C>T (p.Thr5Met) rs35400405
NM_001114753.3(ENG):c.1794T>C (p.Gly598=) rs41358947
NM_001114753.3(ENG):c.1844C>T (p.Ser615Leu) rs148002300
NM_001114753.3(ENG):c.1932C>T (p.Ile644=) rs181330955
NM_001114753.3(ENG):c.207G>A (p.Leu69=) rs11545664
NM_001114753.3(ENG):c.219+22C>T rs370257876
NM_001114753.3(ENG):c.572G>A (p.Gly191Asp) rs41322046
NM_001126049.2(KLLN):c.-898G>A rs538728843
NM_001126121.2(SLC25A19):c.483C>T (p.Ala161=) rs142281464
NM_001126131.2(POLG):c.1550G>T (p.Gly517Val) rs61752783
NM_001126131.2(POLG):c.1760C>T (p.Pro587Leu) rs113994096
NM_001126131.2(POLG):c.752C>T (p.Thr251Ile) rs113994094
NM_001127222.2(CACNA1A):c.4072C>T (p.Arg1358Trp) rs1555745461
NM_001127511.3(APC):c.-126dup rs565045828
NM_001127511.3(APC):c.-181C>T rs115658307
NM_001127671.2(LIFR):c.143-37GT[11] rs10637374
NM_001127671.2(LIFR):c.143-37GT[13] rs10637374
NM_001127671.2(LIFR):c.1937C>A (p.Thr646Asn) rs79040751
NM_001127671.2(LIFR):c.2302A>G (p.Arg768Gly) rs139848756
NM_001127671.2(LIFR):c.2670+6C>G rs898718526
NM_001127671.2(LIFR):c.420G>A (p.Glu140=) rs142475175
NM_001127671.2(LIFR):c.670A>G (p.Ile224Val) rs151282774
NM_001127671.2(LIFR):c.954C>T (p.Thr318=) rs61748202
NM_001127713.1(ATL1):c.669C>T (p.Tyr223=) rs146975855
NM_001128844.2(SMARCA4):c.2275-3C>A rs117611401
NM_001128849.2(SMARCA4):c.1114T>C (p.Tyr372His) rs140192268
NM_001128849.2(SMARCA4):c.2716C>T (p.Arg906Cys) rs898406635
NM_001128849.2(SMARCA4):c.4864+15G>C rs113131294
NM_001128849.2(SMARCA4):c.930C>A (p.Arg310=) rs146141457
NM_001130823.3(DNMT1):c.150C>T (p.His50=) rs146112081
NM_001130823.3(DNMT1):c.2693C>T (p.Thr898Ile) rs201213597
NM_001130823.3(DNMT1):c.4428T>G (p.His1476Gln) rs142647321
NM_001130823.3(DNMT1):c.4503C>T (p.Cys1501=) rs149271718
NM_001130823.3(DNMT1):c.4773+18C>T rs183300496
NM_001130823.3(DNMT1):c.731G>A (p.Gly244Glu) rs150999369
NM_001130823.3(DNMT1):c.891+8C>T rs117294281
NM_001134363.3(RBM20):c.1286T>C (p.Leu429Pro) rs61735272
NM_001134363.3(RBM20):c.1364C>T (p.Ser455Leu) rs189569984
NM_001134363.3(RBM20):c.1881-3C>T rs138436392
NM_001134363.3(RBM20):c.1914G>A (p.Pro638=) rs74339620
NM_001134363.3(RBM20):c.1922G>A (p.Arg641Gln) rs143785916
NM_001134363.3(RBM20):c.1992C>T (p.Pro664=) rs41292592
NM_001134363.3(RBM20):c.2655+15A>G rs187915202
NM_001134363.3(RBM20):c.2662G>A (p.Asp888Asn) rs201370621
NM_001134363.3(RBM20):c.3452-10C>T rs60618533
NM_001134363.3(RBM20):c.517C>A (p.Pro173Thr) rs7908490
NM_001134363.3(RBM20):c.695G>A (p.Gly232Asp) rs61735268
NM_001135599.3(TGFB2):c.703G>C (p.Val235Leu) rs10482810
NM_001135599.3(TGFB2):c.905dup (p.Asn302fs) rs863223796
NM_001142571.2(RAD51D):c.758A>G (p.Glu253Gly) rs28363284
NM_001142800.2(EYS):c.1596A>C (p.Lys532Asn) rs61753611
NM_001142800.2(EYS):c.1809C>T (p.Val603=) rs9345601
NM_001142800.2(EYS):c.4554A>C (p.Thr1518=) rs772339340
NM_001142800.2(EYS):c.6079-24TC[8] rs35395170
NM_001142800.2(EYS):c.8133_8137del (p.Phe2712fs) rs751629543
NM_001142800.2(EYS):c.8243dup (p.Leu2748fs) rs1240944758
NM_001142800.2(EYS):c.9299_9302del (p.Thr3100fs) rs769824975
NM_001142864.4(PIEZO1):c.1179C>G (p.Ser393=) rs780119372
NM_001142864.4(PIEZO1):c.1251C>T (p.His417=) rs183684596
NM_001142864.4(PIEZO1):c.1998-10C>T rs74033378
NM_001142864.4(PIEZO1):c.2344G>A (p.Gly782Ser) rs200970763
NM_001142864.4(PIEZO1):c.2423G>A (p.Arg808Gln) rs202103485
NM_001142864.4(PIEZO1):c.3456-10G>A rs188761308
NM_001142864.4(PIEZO1):c.3813C>T (p.Asp1271=) rs116683709
NM_001142864.4(PIEZO1):c.3935C>T (p.Ala1312Val) rs34246477
NM_001142864.4(PIEZO1):c.5883T>C (p.Tyr1961=) rs115213894
NM_001142864.4(PIEZO1):c.645C>G (p.His215Gln) rs559847737
NM_001142864.4(PIEZO1):c.6804G>A (p.Ala2268=) rs371847339
NM_001142864.4(PIEZO1):c.7130-5C>A rs1357808025
NM_001142864.4(PIEZO1):c.718A>G (p.Ile240Val) rs114403731
NM_001142864.4(PIEZO1):c.7240G>A (p.Asp2414Asn) rs58548913
NM_001142864.4(PIEZO1):c.7381G>A (p.Glu2461Lys) rs371391349
NM_001142864.4(PIEZO1):c.7426C>T (p.Arg2476Cys) rs144035770
NM_001142864.4(PIEZO1):c.7529C>T (p.Pro2510Leu) rs61745086
NM_001142864.4(PIEZO1):c.835G>A (p.Gly279Ser) rs188815734
NM_001143992.2(WRAP53):c.1223G>A (p.Gly408Asp) rs116535684
NM_001143992.2(WRAP53):c.31C>T (p.Pro11Ser) rs17880282
NM_001145308.4(LRTOMT):c.-149C>T rs145851613
NM_001145308.4(LRTOMT):c.-52G>C rs149637884
NM_001145661.2(GATA2):c.481C>G (p.Pro161Ala) rs34799090
NM_001145809.2(MYH14):c.1150G>T (p.Gly384Cys) rs119103280
NM_001145809.2(MYH14):c.3537C>T (p.Ala1179=) rs559356437
NM_001145809.2(MYH14):c.394G>A (p.Gly132Ser) rs199910006
NM_001145809.2(MYH14):c.4685G>A (p.Arg1562Gln) rs140118363
NM_001145809.2(MYH14):c.5573G>A (p.Arg1858His) rs11882073
NM_001145809.2(MYH14):c.820A>G (p.Ile274Val) rs200424400
NM_001145809.2(MYH14):c.826A>G (p.Ile276Val) rs55645295
NM_001146079.2(CLDN14):c.11C>T (p.Thr4Met) rs113831133
NM_001148.6(ANK2):c.10395G>A (p.Glu3465=) rs147423696
NM_001148.6(ANK2):c.10861C>G (p.Leu3621Val) rs45570339
NM_001148.6(ANK2):c.11218C>A (p.Leu3740Ile) rs35530544
NM_001148.6(ANK2):c.2249A>G (p.Gln750Arg) rs371787039
NM_001148.6(ANK2):c.231G>A (p.Val77=) rs149699185
NM_001148.6(ANK2):c.2377-8C>T rs139893914
NM_001148.6(ANK2):c.3074G>C (p.Gly1025Ala) rs773532854
NM_001148.6(ANK2):c.3543C>T (p.Ala1181=) rs76685232
NM_001148.6(ANK2):c.4152T>C (p.Asp1384=) rs116128106
NM_001148.6(ANK2):c.4372-7C>T rs370720661
NM_001148.6(ANK2):c.6648C>G (p.Gly2216=) rs140926982
NM_001148.6(ANK2):c.7059A>G (p.Gln2353=) rs145782226
NM_001148.6(ANK2):c.7488A>G (p.Thr2496=) rs143161930
NM_001148.6(ANK2):c.7902G>A (p.Val2634=) rs150878494
NM_001148.6(ANK2):c.9061G>A (p.Ala3021Thr) rs74348333
NM_001148.6(ANK2):c.9454A>G (p.Thr3152Ala) rs61741040
NM_001148.6(ANK2):c.962G>A (p.Arg321Gln) rs150226540
NM_001148.6(ANK2):c.9854T>C (p.Ile3285Thr) rs36210417
NM_001151.4(SLC25A4):c.567T>C (p.Ala189=) rs149101873
NM_001159287.1(TPI1):c.66G>A (p.Pro22=) rs1800201
NM_001159773.2(CANT1):c.1172G>A (p.Gly391Glu) rs34082669
NM_001163817.2(DHCR7):c.1341C>T (p.Asp447=) rs139721775
NM_001167617.2(MLH1):c.1852G>A (p.Val618Met) rs35831931
NM_001172477.1(RRM2B):c.647C>T (p.Thr216Ile) rs515726189
NM_001184.4(ATR):c.5987T>C (p.Met1996Thr) rs150339560
NM_001184.4(ATR):c.891G>C (p.Lys297Asn) rs2229033
NM_001184.4(ATR):c.992A>G (p.Asp331Gly) rs150008448
NM_001184880.2(PCDH19):c.1683G>A (p.Pro561=) rs192354176
NM_001191061.2(SLC25A22):c.570C>T (p.Leu190=) rs145322467
NM_001191061.2(SLC25A22):c.585C>T (p.Leu195=) rs147840220
NM_001191061.2(SLC25A22):c.876G>A (p.Ala292=) rs146300431
NM_001195248.2(APTX):c.18G>T (p.Trp6Cys) rs144076460
NM_001195248.2(APTX):c.513G>A (p.Leu171=) rs140888559
NM_001204.7(BMPR2):c.545G>A (p.Gly182Asp) rs137852754
NM_001204.7(BMPR2):c.621+37C>G rs78779412
NM_001232.4(CASQ2):c.1132GAT[5] (p.Asp383del) rs72554069
NM_001232.4(CASQ2):c.731A>G (p.His244Arg) rs28730716
NM_001235.4(SERPINH1):c.744C>T (p.Asp248=) rs61733248
NM_001235.5(SERPINH1):c.97G>C (p.Ala33Pro)
NM_001243133.2(NLRP3):c.1020C>T (p.Pro340=) rs41311573
NM_001243133.2(NLRP3):c.1920C>T (p.Phe640=) rs34698071
NM_001243133.2(NLRP3):c.2107C>A (p.Gln703Lys) rs35829419
NM_001243133.2(NLRP3):c.3005+25C>T rs61841189
NM_001243133.2(NLRP3):c.789C>T (p.Ser263=) rs146442638
NM_001243279.3(ACSF3):c.1411C>T (p.Arg471Trp) rs138680796
NM_001244008.2(KIF1A):c.2721GGA[9] (p.Glu916_Glu917del) rs10594016
NM_001244008.2(KIF1A):c.865-24CT[2] rs140674901
NM_001256317.3(TMPRSS3):c.268G>A (p.Ala90Thr) rs45598239
NM_001256317.3(TMPRSS3):c.432A>G (p.Gln144=) rs61731564
NM_001267550.2(TTN):c.100094G>A (p.Arg33365Gln) rs55742743
NM_001267550.2(TTN):c.100172-17dup rs397517782
NM_001267550.2(TTN):c.10100G>A (p.Arg3367Gln) rs34819099
NM_001267550.2(TTN):c.101064T>C (p.Asp33688=) rs368168812
NM_001267550.2(TTN):c.101212C>T (p.Arg33738Cys) rs56273463
NM_001267550.2(TTN):c.101406C>G (p.Val33802=) rs55802460
NM_001267550.2(TTN):c.101665G>A (p.Val33889Ile) rs34924609
NM_001267550.2(TTN):c.101766G>C (p.Gln33922His) rs55886356
NM_001267550.2(TTN):c.101803A>G (p.Ile33935Val) rs56376197
NM_001267550.2(TTN):c.101891G>A (p.Arg33964His) rs55669553
NM_001267550.2(TTN):c.10242C>T (p.Tyr3414=) rs45447891
NM_001267550.2(TTN):c.102595A>G (p.Ile34199Val) rs56347248
NM_001267550.2(TTN):c.103292C>T (p.Thr34431Met) rs192001910
NM_001267550.2(TTN):c.103688T>C (p.Val34563Ala) rs55945684
NM_001267550.2(TTN):c.104261C>T (p.Ala34754Val) rs727505020
NM_001267550.2(TTN):c.104377A>C (p.Met34793Leu) rs72629787
NM_001267550.2(TTN):c.104560G>C (p.Val34854Leu) rs55866005
NM_001267550.2(TTN):c.105468G>A (p.Pro35156=) rs55806007
NM_001267550.2(TTN):c.105719G>A (p.Arg35240Gln) rs530537991
NM_001267550.2(TTN):c.105769G>A (p.Glu35257Lys) rs56324595
NM_001267550.2(TTN):c.105787G>T (p.Ala35263Ser) rs67254537
NM_001267550.2(TTN):c.105788C>T (p.Ala35263Val) rs66961115
NM_001267550.2(TTN):c.106619T>C (p.Ile35540Thr) rs55880440
NM_001267550.2(TTN):c.106857C>T (p.Asn35619=) rs116604145
NM_001267550.2(TTN):c.106955G>A (p.Arg35652Gln) rs200497615
NM_001267550.2(TTN):c.107397C>T (p.Ser35799=) rs371480338
NM_001267550.2(TTN):c.107700A>G (p.Glu35900=) rs55832587
NM_001267550.2(TTN):c.1079G>C (p.Arg360Thr) rs56128843
NM_001267550.2(TTN):c.11183dup (p.Leu3729fs) rs778172350
NM_001267550.2(TTN):c.11311+1641C>T rs140804168
NM_001267550.2(TTN):c.11311+2573T>C rs72647897
NM_001267550.2(TTN):c.11311+4672C>T rs149748934
NM_001267550.2(TTN):c.11311+5216G>A rs150615457
NM_001267550.2(TTN):c.11311+5536A>G rs145581345
NM_001267550.2(TTN):c.11312-4319G>A rs72648913
NM_001267550.2(TTN):c.1137A>G (p.Arg379=) rs55972547
NM_001267550.2(TTN):c.12580A>T (p.Ile4194Phe) rs34618570
NM_001267550.2(TTN):c.13859G>A (p.Gly4620Asp) rs55857742
NM_001267550.2(TTN):c.13884C>T (p.Ser4628=) rs183328495
NM_001267550.2(TTN):c.14232C>A (p.Asp4744Glu) rs55906845
NM_001267550.2(TTN):c.14424G>C (p.Val4808=) rs374479775
NM_001267550.2(TTN):c.14535C>T (p.Asp4845=) rs184307461
NM_001267550.2(TTN):c.14698G>A (p.Ala4900Thr) rs72648923
NM_001267550.2(TTN):c.14765G>A (p.Ser4922Asn) rs184740744
NM_001267550.2(TTN):c.14788C>A (p.Pro4930Thr) rs201744218
NM_001267550.2(TTN):c.14870C>G (p.Thr4957Ser) rs72648925
NM_001267550.2(TTN):c.1492G>A (p.Val498Ile) rs72647851
NM_001267550.2(TTN):c.14935+9C>T rs544241749
NM_001267550.2(TTN):c.14984C>G (p.Pro4995Arg) rs72648927
NM_001267550.2(TTN):c.16303G>A (p.Val5435Met) rs72648937
NM_001267550.2(TTN):c.16546G>T (p.Asp5516Tyr) rs72648940
NM_001267550.2(TTN):c.17048A>G (p.Tyr5683Cys) rs72648942
NM_001267550.2(TTN):c.17888A>G (p.Glu5963Gly) rs146983095
NM_001267550.2(TTN):c.178G>T (p.Asp60Tyr) rs35683768
NM_001267550.2(TTN):c.17989G>A (p.Ala5997Thr) rs72648946
NM_001267550.2(TTN):c.18659G>C (p.Cys6220Ser) rs191692293
NM_001267550.2(TTN):c.18824A>G (p.Asn6275Ser) rs184412722
NM_001267550.2(TTN):c.19063G>T (p.Asp6355Tyr) rs188878341
NM_001267550.2(TTN):c.19150C>A (p.Pro6384Thr) rs72648953
NM_001267550.2(TTN):c.19204A>G (p.Met6402Val) rs72648954
NM_001267550.2(TTN):c.19383T>C (p.Asn6461=) rs76771282
NM_001267550.2(TTN):c.19976C>T (p.Thr6659Met) rs16866475
NM_001267550.2(TTN):c.20147T>A (p.Met6716Lys) rs28626194
NM_001267550.2(TTN):c.20175A>G (p.Ile6725Met) rs146627500
NM_001267550.2(TTN):c.20335A>T (p.Ser6779Cys) rs149470241
NM_001267550.2(TTN):c.20602G>A (p.Gly6868Arg) rs17355460
NM_001267550.2(TTN):c.20630T>C (p.Ile6877Thr) rs142794598
NM_001267550.2(TTN):c.21019A>T (p.Ile7007Phe) rs114626713
NM_001267550.2(TTN):c.21106G>A (p.Asp7036Asn) rs72648962
NM_001267550.2(TTN):c.21548G>A (p.Cys7183Tyr) rs189951108
NM_001267550.2(TTN):c.21993T>C (p.Pro7331=) rs373223049
NM_001267550.2(TTN):c.22074A>G (p.Lys7358=) rs34562585
NM_001267550.2(TTN):c.22575T>A (p.Asp7525Glu) rs200061856
NM_001267550.2(TTN):c.22611T>C (p.His7537=) rs16866469
NM_001267550.2(TTN):c.22692A>T (p.Thr7564=) rs187182557
NM_001267550.2(TTN):c.2270C>T (p.Pro757Leu) rs116307796
NM_001267550.2(TTN):c.22786G>C (p.Asp7596His) rs72648970
NM_001267550.2(TTN):c.23001G>A (p.Thr7667=) rs16866467
NM_001267550.2(TTN):c.23301C>T (p.Ser7767=) rs73038337
NM_001267550.2(TTN):c.23538C>G (p.Phe7846Leu) rs149523263
NM_001267550.2(TTN):c.23853C>A (p.Ala7951=) rs201766927
NM_001267550.2(TTN):c.24820G>A (p.Glu8274Lys) rs72648981
NM_001267550.2(TTN):c.24880A>G (p.Arg8294Gly) rs72648982
NM_001267550.2(TTN):c.24909G>A (p.Lys8303=) rs72648983
NM_001267550.2(TTN):c.24964G>T (p.Val8322Leu) rs201571580
NM_001267550.2(TTN):c.25398T>A (p.Asp8466Glu) rs72648986
NM_001267550.2(TTN):c.25490G>A (p.Arg8497His) rs149855485
NM_001267550.2(TTN):c.25563C>T (p.Gly8521=) rs556205722
NM_001267550.2(TTN):c.25921+20G>A rs148460010
NM_001267550.2(TTN):c.26201-11dup rs727503644
NM_001267550.2(TTN):c.26245G>A (p.Val8749Ile) rs16866457
NM_001267550.2(TTN):c.26466C>G (p.Ala8822=) rs140003804
NM_001267550.2(TTN):c.26849A>G (p.Tyr8950Cys) rs199557654
NM_001267550.2(TTN):c.28924A>G (p.Ser9642Gly) rs367888853
NM_001267550.2(TTN):c.29128G>A (p.Val9710Ile) rs72649002
NM_001267550.2(TTN):c.29178C>A (p.Ile9726=) rs72650003
NM_001267550.2(TTN):c.29938G>A (p.Ala9980Thr) rs189286381
NM_001267550.2(TTN):c.29963-13A>G rs72650008
NM_001267550.2(TTN):c.30274C>T (p.His10092Tyr) rs72650011
NM_001267550.2(TTN):c.30718G>T (p.Val10240Phe) rs111671438
NM_001267550.2(TTN):c.3100G>A (p.Val1034Met) rs142951505
NM_001267550.2(TTN):c.31070A>G (p.His10357Arg) rs1343660563
NM_001267550.2(TTN):c.31156G>A (p.Glu10386Lys) rs772195716
NM_001267550.2(TTN):c.3133G>A (p.Val1045Met) rs72647868
NM_001267550.2(TTN):c.31399G>A (p.Val10467Ile) rs72650019
NM_001267550.2(TTN):c.31847-17A>G rs72650025
NM_001267550.2(TTN):c.32624C>T (p.Pro10875Leu) rs72650031
NM_001267550.2(TTN):c.32648G>A (p.Arg10883Lys) rs116676813
NM_001267550.2(TTN):c.32722+9G>A rs148231130
NM_001267550.2(TTN):c.32731G>A (p.Glu10911Lys) rs199620003
NM_001267550.2(TTN):c.33063A>G (p.Glu11021=) rs115744476
NM_001267550.2(TTN):c.34129GTTCTACCTGAAGAAGAGGAA[1] (p.11363VLPEEEE[3]) rs587780487
NM_001267550.2(TTN):c.34474C>A (p.Pro11492Thr) rs182428755
NM_001267550.2(TTN):c.34505G>T (p.Gly11502Val) rs190209925
NM_001267550.2(TTN):c.34566A>C (p.Glu11522Asp) rs140640738
NM_001267550.2(TTN):c.34601T>C (p.Leu11534Pro) rs376836503
NM_001267550.2(TTN):c.34769A>G (p.Glu11590Gly) rs201167067
NM_001267550.2(TTN):c.34845C>T (p.Pro11615=) rs368781863
NM_001267550.2(TTN):c.34856-17A>G rs188686309
NM_001267550.2(TTN):c.34970G>A (p.Arg11657His) rs59887778
NM_001267550.2(TTN):c.36405G>A (p.Val12135=) rs373815877
NM_001267550.2(TTN):c.36489G>A (p.Ala12163=) rs115493456
NM_001267550.2(TTN):c.36509A>T (p.Glu12170Val) rs200840285
NM_001267550.2(TTN):c.38708-4T>C rs200819643
NM_001267550.2(TTN):c.39082G>A (p.Val13028Met) rs73038314
NM_001267550.2(TTN):c.39183T>A (p.Pro13061=) rs12474306
NM_001267550.2(TTN):c.39301G>A (p.Glu13101Lys) rs201035457
NM_001267550.2(TTN):c.39466C>A (p.Pro13156Thr) rs72650064
NM_001267550.2(TTN):c.39709+6C>T rs72650067
NM_001267550.2(TTN):c.39731TTGCTCCTGAAGAGGAAA[1] (p.13244IAPEEE[1]) rs139512154
NM_001267550.2(TTN):c.40498G>T (p.Val13500Phe) rs201944202
NM_001267550.2(TTN):c.41010T>C (p.Asp13670=) rs193191368
NM_001267550.2(TTN):c.41103C>T (p.Gly13701=) rs72650077
NM_001267550.2(TTN):c.4246C>T (p.Arg1416Cys) rs72647875
NM_001267550.2(TTN):c.426C>T (p.Ala142=) rs56137037
NM_001267550.2(TTN):c.4328T>C (p.Leu1443Pro) rs142317580
NM_001267550.2(TTN):c.4359A>T (p.Arg1453Ser) rs376857956
NM_001267550.2(TTN):c.43690T>A (p.Ser14564Thr) rs181189778
NM_001267550.2(TTN):c.4396T>C (p.Phe1466Leu) rs151310601
NM_001267550.2(TTN):c.44281C>T (p.Pro14761Ser) rs192766485
NM_001267550.2(TTN):c.44323G>A (p.Val14775Met) rs540115992
NM_001267550.2(TTN):c.45083-10A>G rs72677222
NM_001267550.2(TTN):c.45174C>T (p.Gly15058=) rs372609980
NM_001267550.2(TTN):c.45175G>A (p.Ala15059Thr) rs144668626
NM_001267550.2(TTN):c.45206A>T (p.Glu15069Val) rs114331773
NM_001267550.2(TTN):c.45408G>T (p.Lys15136Asn) rs72677225
NM_001267550.2(TTN):c.45526C>T (p.Leu15176=) rs61004744
NM_001267550.2(TTN):c.4671G>A (p.Met1557Ile) rs139192633
NM_001267550.2(TTN):c.46928A>G (p.His15643Arg) rs368502650
NM_001267550.2(TTN):c.47077G>A (p.Val15693Ile) rs201717871
NM_001267550.2(TTN):c.47191C>T (p.Arg15731Cys) rs72677231
NM_001267550.2(TTN):c.47196G>C (p.Val15732=) rs369979598
NM_001267550.2(TTN):c.47248G>A (p.Val15750Ile) rs72677232
NM_001267550.2(TTN):c.47271T>C (p.Asp15757=) rs76081119
NM_001267550.2(TTN):c.4739C>T (p.Thr1580Met) rs73973147
NM_001267550.2(TTN):c.47513G>A (p.Arg15838Gln) rs199640194
NM_001267550.2(TTN):c.47545C>A (p.Pro15849Thr) rs146181477
NM_001267550.2(TTN):c.47723G>A (p.Arg15908His) rs72677237
NM_001267550.2(TTN):c.48727C>T (p.Pro16243Ser) rs72677242
NM_001267550.2(TTN):c.49172G>A (p.Arg16391Gln) rs200944827
NM_001267550.2(TTN):c.49919G>C (p.Ser16640Thr) rs55663050
NM_001267550.2(TTN):c.49985A>C (p.Asn16662Thr) rs36043230
NM_001267550.2(TTN):c.50714G>A (p.Arg16905His) rs191539637
NM_001267550.2(TTN):c.51527G>C (p.Gly17176Ala) rs768961892
NM_001267550.2(TTN):c.51739+14C>A rs727505018
NM_001267550.2(TTN):c.51809G>T (p.Ser17270Ile) rs200650668
NM_001267550.2(TTN):c.52199A>C (p.Glu17400Ala) rs773027240
NM_001267550.2(TTN):c.52409C>A (p.Pro17470Gln) rs372618781
NM_001267550.2(TTN):c.52852C>T (p.Arg17618Cys) rs201213901
NM_001267550.2(TTN):c.52917T>C (p.Asp17639=) rs73036398
NM_001267550.2(TTN):c.53096G>A (p.Arg17699His) rs72646808
NM_001267550.2(TTN):c.53100T>G (p.Pro17700=) rs373140387
NM_001267550.2(TTN):c.53192T>C (p.Ile17731Thr) rs72646809
NM_001267550.2(TTN):c.54160G>C (p.Val18054Leu) rs200968679
NM_001267550.2(TTN):c.54189T>C (p.Tyr18063=) rs2303834
NM_001267550.2(TTN):c.54208A>C (p.Arg18070=) rs138240658
NM_001267550.2(TTN):c.542G>A (p.Ser181Asn) rs72647843
NM_001267550.2(TTN):c.54812-5A>G rs375343798
NM_001267550.2(TTN):c.55029G>A (p.Arg18343=) rs62178963
NM_001267550.2(TTN):c.55354T>C (p.Ser18452Pro) rs372541479
NM_001267550.2(TTN):c.57462G>A (p.Gln19154=) rs72646832
NM_001267550.2(TTN):c.57464G>A (p.Arg19155Lys) rs72646833
NM_001267550.2(TTN):c.57683G>A (p.Arg19228His) rs114711705
NM_001267550.2(TTN):c.583+5G>A rs397517663
NM_001267550.2(TTN):c.58419A>G (p.Gln19473=) rs186563991
NM_001267550.2(TTN):c.58869A>G (p.Lys19623=) rs191066933
NM_001267550.2(TTN):c.59319G>A (p.Glu19773=) rs367622770
NM_001267550.2(TTN):c.59926C>T (p.His19976Tyr) rs727503588
NM_001267550.2(TTN):c.61322A>G (p.Asn20441Ser) rs147580753
NM_001267550.2(TTN):c.61922G>A (p.Arg20641Gln) rs199895260
NM_001267550.2(TTN):c.63023C>T (p.Thr21008Ile) rs72646850
NM_001267550.2(TTN):c.63273T>C (p.Asp21091=) rs374168580
NM_001267550.2(TTN):c.63942G>A (p.Ser21314=) rs201285872
NM_001267550.2(TTN):c.64032C>T (p.Asn21344=) rs72646857
NM_001267550.2(TTN):c.64789G>A (p.Val21597Met) rs150661999
NM_001267550.2(TTN):c.65575+10T>C rs72646864
NM_001267550.2(TTN):c.65604T>C (p.Ala21868=) rs200825430
NM_001267550.2(TTN):c.65672C>T (p.Pro21891Leu) rs397517662
NM_001267550.2(TTN):c.65743C>A (p.Gln21915Lys) rs62618736
NM_001267550.2(TTN):c.66614G>A (p.Arg22205Lys) rs72646869
NM_001267550.2(TTN):c.67104A>C (p.Lys22368Asn) rs727503577
NM_001267550.2(TTN):c.68079G>A (p.Thr22693=) rs11904444
NM_001267550.2(TTN):c.68458G>C (p.Ala22820Pro) rs72646880
NM_001267550.2(TTN):c.69130C>T (p.Pro23044Ser) rs55980498
NM_001267550.2(TTN):c.69676A>G (p.Ser23226Gly) rs72646885
NM_001267550.2(TTN):c.69716-5C>G rs72646886
NM_001267550.2(TTN):c.69821G>A (p.Gly23274Asp) rs201043950
NM_001267550.2(TTN):c.7020C>T (p.Ile2340=) rs587780986
NM_001267550.2(TTN):c.70677T>C (p.Asp23559=) rs72646890
NM_001267550.2(TTN):c.70696G>C (p.Gly23566Arg) rs55801134
NM_001267550.2(TTN):c.70815G>A (p.Val23605=) rs55847238
NM_001267550.2(TTN):c.70832C>T (p.Ala23611Val) rs72646891
NM_001267550.2(TTN):c.70952T>G (p.Ile23651Ser) rs149075285
NM_001267550.2(TTN):c.71705T>C (p.Ile23902Thr) rs55837610
NM_001267550.2(TTN):c.72146T>C (p.Leu24049Pro) rs56399205
NM_001267550.2(TTN):c.72931A>G (p.Thr24311Ala) rs56201325
NM_001267550.2(TTN):c.73336C>T (p.Leu24446=) rs189768015
NM_001267550.2(TTN):c.74895A>C (p.Gln24965His) rs201512527
NM_001267550.2(TTN):c.74972T>C (p.Ile24991Thr) rs744427
NM_001267550.2(TTN):c.75441A>G (p.Lys25147=) rs56151652
NM_001267550.2(TTN):c.75914C>T (p.Pro25305Leu) rs142453163
NM_001267550.2(TTN):c.77166T>C (p.Pro25722=) rs757252494
NM_001267550.2(TTN):c.78855T>C (p.Asp26285=) rs139953862
NM_001267550.2(TTN):c.79318C>T (p.Arg26440Cys) rs55861600
NM_001267550.2(TTN):c.79319G>A (p.Arg26440His) rs56044609
NM_001267550.2(TTN):c.79546G>A (p.Gly26516Ser) rs776256093
NM_001267550.2(TTN):c.79783G>C (p.Asp26595His) rs56307213
NM_001267550.2(TTN):c.79863G>A (p.Thr26621=) rs186402008
NM_001267550.2(TTN):c.80635C>A (p.Gln26879Lys) rs79926414
NM_001267550.2(TTN):c.80983G>A (p.Glu26995Lys) rs397517719
NM_001267550.2(TTN):c.81472C>G (p.Pro27158Ala) rs200771189
NM_001267550.2(TTN):c.81558T>C (p.Asn27186=) rs56181243
NM_001267550.2(TTN):c.81958G>A (p.Ala27320Thr) rs56365600
NM_001267550.2(TTN):c.82103A>G (p.Asp27368Gly) rs145373396
NM_001267550.2(TTN):c.82235C>A (p.Thr27412Lys) rs201489661
NM_001267550.2(TTN):c.82385C>A (p.Thr27462Lys) rs55933739
NM_001267550.2(TTN):c.82489G>A (p.Gly27497Arg) rs201158906
NM_001267550.2(TTN):c.82560C>A (p.Asn27520Lys) rs56264840
NM_001267550.2(TTN):c.82740G>A (p.Thr27580=) rs56345408
NM_001267550.2(TTN):c.83056G>A (p.Val27686Ile) rs56309296
NM_001267550.2(TTN):c.83281G>A (p.Val27761Ile) rs371788070
NM_001267550.2(TTN):c.84352C>T (p.Arg28118Cys) rs56057221
NM_001267550.2(TTN):c.84453A>G (p.Pro28151=) rs73036373
NM_001267550.2(TTN):c.8467G>T (p.Val2823Phe) rs33917087
NM_001267550.2(TTN):c.85691A>T (p.Lys28564Ile) rs199859344
NM_001267550.2(TTN):c.86301G>A (p.Lys28767=) rs56310931
NM_001267550.2(TTN):c.86811A>G (p.Val28937=) rs55972010
NM_001267550.2(TTN):c.87600G>C (p.Met29200Ile) rs750362675
NM_001267550.2(TTN):c.87669T>C (p.His29223=) rs72648229
NM_001267550.2(TTN):c.87707-4G>T rs201770959
NM_001267550.2(TTN):c.87771C>A (p.Gly29257=) rs72648230
NM_001267550.2(TTN):c.88394C>T (p.Ser29465Phe) rs146181116
NM_001267550.2(TTN):c.88476C>G (p.Thr29492=) rs190406444
NM_001267550.2(TTN):c.88984G>A (p.Gly29662Ser) rs187460377
NM_001267550.2(TTN):c.89386G>A (p.Val29796Met) rs72648237
NM_001267550.2(TTN):c.8938G>A (p.Ala2980Thr) rs72647885
NM_001267550.2(TTN):c.90536G>A (p.Arg30179His) rs149567378
NM_001267550.2(TTN):c.90624T>C (p.Asn30208=) rs370479059
NM_001267550.2(TTN):c.90638T>C (p.Ile30213Thr) rs114026724
NM_001267550.2(TTN):c.90826T>G (p.Cys30276Gly) rs150430592
NM_001267550.2(TTN):c.91347T>C (p.Asp30449=) rs193022702
NM_001267550.2(TTN):c.91573A>G (p.Ile30525Val) rs72648244
NM_001267550.2(TTN):c.91601A>T (p.Asp30534Val) rs182549226
NM_001267550.2(TTN):c.91749C>T (p.Ser30583=) rs886044458
NM_001267550.2(TTN):c.91765G>A (p.Ala30589Thr) rs148617456
NM_001267550.2(TTN):c.91884A>T (p.Arg30628Ser) rs144922355
NM_001267550.2(TTN):c.92782G>C (p.Asp30928His) rs397517756
NM_001267550.2(TTN):c.92901C>T (p.Ser30967=) rs11694623
NM_001267550.2(TTN):c.9359G>A (p.Arg3120Gln) rs72647894
NM_001267550.2(TTN):c.94851T>A (p.Asp31617Glu) rs72648256
NM_001267550.2(TTN):c.95035G>A (p.Asp31679Asn) rs116567963
NM_001267550.2(TTN):c.95297C>T (p.Ser31766Phe) rs191484894
NM_001267550.2(TTN):c.95553C>T (p.Ser31851=) rs72648260
NM_001267550.2(TTN):c.95555T>C (p.Leu31852Pro) rs62621206
NM_001267550.2(TTN):c.96108G>A (p.Val32036=) rs372773283
NM_001267550.2(TTN):c.96944C>T (p.Thr32315Ile) rs56027402
NM_001267550.2(TTN):c.97386C>T (p.Thr32462=) rs376810671
NM_001267550.2(TTN):c.97760G>A (p.Arg32587His) rs55704830
NM_001267550.2(TTN):c.98242C>T (p.Arg32748Cys) rs72648272
NM_001267550.2(TTN):c.98294C>G (p.Ala32765Gly) rs72648273
NM_001267550.2(TTN):c.98299_98300del (p.Arg32767fs) rs397517776
NM_001267550.2(TTN):c.98390A>G (p.Asn32797Ser) rs149001703
NM_001267550.2(TTN):c.98439G>A (p.Val32813=) rs368487246
NM_001267550.2(TTN):c.98726T>C (p.Val32909Ala) rs368877793
NM_001267550.2(TTN):c.98866A>G (p.Met32956Val) rs727503538
NM_001267550.2(TTN):c.99340T>C (p.Leu33114=) rs371656672
NM_001267550.2(TTN):c.99901G>A (p.Glu33301Lys) rs72648278
NM_001276345.2(TNNT2):c.163+12G>A rs45580032
NM_001276345.2(TNNT2):c.294+7G>A rs45490292
NM_001276345.2(TNNT2):c.42-20G>A rs45561443
NM_001276345.2(TNNT2):c.53-11_53-7del rs45533739
NM_001276345.2(TNNT2):c.720-13_720-11del rs397516480
NM_001276345.2(TNNT2):c.862C>T (p.Arg288Cys) rs121964857
NM_001278074.1(COL5A1):c.1158C>T (p.Ser386=) rs61729497
NM_001278074.1(COL5A1):c.126C>T (p.Leu42=) rs149369116
NM_001278074.1(COL5A1):c.2096C>T (p.Thr699Met) rs142313124
NM_001278074.1(COL5A1):c.278C>T (p.Ala93Val) rs41306397
NM_001278074.1(COL5A1):c.3855C>T (p.Gly1285=) rs139544503
NM_001278074.1(COL5A1):c.3983C>G (p.Pro1328Arg) rs140797509
NM_001278074.1(COL5A1):c.4068G>A (p.Ala1356=) rs863223452
NM_001278074.1(COL5A1):c.4683A>C (p.Gly1561=) rs149959668
NM_001278074.1(COL5A1):c.4748C>T (p.Thr1583Met) rs375076580
NM_001278074.1(COL5A1):c.5250G>A (p.Val1750=) rs200348547
NM_001278074.1(COL5A1):c.5350G>A (p.Ala1784Thr) rs143859495
NM_001278074.1(COL5A1):c.574G>A (p.Asp192Asn) rs138579182
NM_001278074.1(COL5A1):c.61C>T (p.Pro21Ser) rs548525119
NM_001278074.1(COL5A1):c.805G>A (p.Glu269Lys) rs761079177
NM_001278074.1(COL5A1):c.850G>A (p.Glu284Lys) rs75648697
NM_001278074.1(COL5A1):c.996C>T (p.Asp332=) rs144763302
NM_001282426.2(PIK3CG):c.1722G>A (p.Leu574=) rs144082858
NM_001286042.1(ACADM):c.10+3660_10+3666dup rs875989875
NM_001289808.2(CRYAB):c.152C>T (p.Pro51Leu) rs2234704
NM_001289808.2(CRYAB):c.460G>A (p.Gly154Ser) rs150516929
NM_001291867.2(NHS):c.211C>T (p.Pro71Ser) rs398124605
NM_001297.5(CNGB1):c.2853C>A (p.Asp951Glu) rs7190978
NM_001297.5(CNGB1):c.634A>T (p.Thr212Ser) rs192628905
NM_001303.4(COX10):c.1291C>T (p.Arg431Trp) rs113058506
NM_001303256.3(MORC2):c.63A>G (p.Thr21=) rs73156742
NM_001322934.2(NFKB2):c.2145G>A (p.Ser715=) rs200006038
NM_001329943.3(KIAA0586):c.94dup (p.His32fs) rs555421894
NM_001330.5(CTF1):c.280C>T (p.Leu94=) rs397516648
NM_001351834.2(ATM):c.381del (p.Thr127_Val128insTer) rs587781831
NM_001354630.1(MLH1):c.1732-878_1732-877delinsGC rs35502531
NM_001354689.3(RAF1):c.122G>A (p.Arg41Gln) rs145611571
NM_001354689.3(RAF1):c.1728+19G>T rs5746245
NM_001354689.3(RAF1):c.1890A>G (p.Gln630=) rs141791080
NM_001354689.3(RAF1):c.983C>T (p.Pro328Leu) rs5746220
NM_001355436.2(SPTB):c.1269G>A (p.Leu423=) rs229586
NM_001355436.2(SPTB):c.1316G>A (p.Ser439Asn) rs229587
NM_001355436.2(SPTB):c.1512C>T (p.Asp504=) rs150968094
NM_001355436.2(SPTB):c.1707G>A (p.Lys569=) rs139116435
NM_001355436.2(SPTB):c.177C>T (p.Thr59=) rs2277503
NM_001355436.2(SPTB):c.204G>A (p.Leu68=) rs145077630
NM_001355436.2(SPTB):c.2154A>C (p.Ile718=) rs229591
NM_001355436.2(SPTB):c.2934G>A (p.Glu978=) rs72724498
NM_001355436.2(SPTB):c.300+7T>C rs229581