ClinVar Miner

Variants from GeneDx with conflicting interpretations

Location: United States — Primary collection method: clinical testing
Minimum review status of the submission from GeneDx: Collection method of the submission from GeneDx:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
81310 23000 115 10275 7396 177 1245 17559

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
GeneDx pathogenic likely pathogenic uncertain significance likely benign benign affects association drug response protective risk factor other
pathogenic 3 737 294 24 17 2 5 20 2 37 16
likely pathogenic 530 0 567 21 13 0 0 4 1 1 3
uncertain significance 110 201 52 1485 425 0 0 7 1 8 4
likely benign 13 25 4613 11 4111 0 1 21 1 4 21
benign 13 12 1050 4900 49 0 3 21 2 19 8
risk factor 1 1 1 1 0 0 0 0 0 0 0

Submitter to submitter summary #

Total submitters: 194
Download table as spreadsheet
Submitter Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
EGL Genetic Diagnostics, Eurofins Clinical Diagnostics 0 6447 0 1394 2725 40 223 4379
Invitae 0 6238 6 1940 729 1 173 2847
Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine 0 5058 0 1281 749 1 131 2162
Genetic Services Laboratory, University of Chicago 0 1745 0 1658 481 1 18 2157
CeGaT Praxis fuer Humangenetik Tuebingen 0 2822 0 706 1136 1 148 1989
Integrated Genetics/Laboratory Corporation of America 0 4194 0 1123 777 1 79 1980
Ambry Genetics 0 4097 0 1201 472 0 78 1750
Athena Diagnostics Inc 0 3287 0 1048 301 0 35 1382
PreventionGenetics, PreventionGenetics 0 5582 0 1090 141 1 15 1247
Illumina Clinical Services Laboratory,Illumina 0 795 0 432 454 0 64 945
ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories 0 3077 0 583 268 2 40 892
Quest Diagnostics Nichols Institute San Juan Capistrano 0 2773 0 538 306 1 24 867
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 0 752 0 403 118 1 26 547
Biesecker Lab/Clinical Genomics Section,National Institutes of Health 0 577 100 100 281 1 5 487
Mayo Clinic Laboratories, Mayo Clinic 0 928 0 287 85 0 26 396
Department of Pathology and Laboratory Medicine,Sinai Health System 0 564 0 95 180 0 86 359
Stanford Center for Inherited Cardiovascular Disease, Stanford University 0 329 0 100 75 0 55 230
OMIM 0 167 0 18 7 93 26 144
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics,Children's Hospital of Philadelphia 0 123 0 46 41 0 7 94
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute 0 216 0 63 23 0 7 93
Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen 0 456 0 68 0 0 25 93
Blueprint Genetics 0 216 0 34 16 0 30 80
Leiden Open Variation Database 0 88 0 29 36 0 5 70
Clinical Genetics Karolinska University Hospital,Karolinska University Hospital 0 249 0 51 0 0 8 59
CHEO Genetics Diagnostic Laboratory,Children's Hospital of Eastern Ontario 0 122 0 35 20 0 2 57
Foulkes Cancer Genetics LDI, Lady Davis Institute for Medical Research 0 112 0 13 29 0 7 49
PharmGKB 0 0 0 0 0 47 0 47
CSER _CC_NCGL, University of Washington 0 41 0 5 24 0 8 37
NIHR Bioresource Rare Diseases, University of Cambridge 0 22 0 24 3 0 8 33
RettBASE 0 51 0 28 4 0 0 32
Developmental Genetics Unit,King Faisal Specialist Hospital & Research Centre 0 5 0 15 1 0 15 30
Centre for Mendelian Genomics,University Medical Centre Ljubljana 0 77 0 12 6 1 10 28
Genomic Research Center, Shahid Beheshti University of Medical Sciences 0 24 0 7 5 0 15 27
Color Health, Inc 0 13 0 25 0 0 1 26
Counsyl 0 122 0 14 9 0 0 23
King Laboratory,University of Washington 0 4 0 2 18 0 2 22
Gharavi Laboratory,Columbia University 0 55 0 12 3 0 6 21
Research Molecular Genetics Laboratory,Women's College Hospital, University of Toronto 0 21 0 6 7 0 7 20
Greenwood Genetic Center Diagnostic Laboratories,Greenwood Genetic Center 0 56 0 6 8 1 3 18
Department of Ophthalmology and Visual Sciences Kyoto University 0 0 4 12 0 0 1 17
Clinical Molecular Genetics Laboratory,Johns Hopkins All Children's Hospital 0 35 0 3 8 0 5 16
Mendelics 0 66 0 9 7 0 0 16
University of Washington Center for Mendelian Genomics, University of Washington 0 9 0 9 1 0 5 14
Institute for Genomic Medicine (IGM) Clinical Laboratory,Nationwide Children's Hospital 0 18 0 11 3 0 0 14
Department of Vascular Biology,Beijing Anzhen Hospital 0 6 0 9 2 0 3 14
Practice for Gait Abnormalities, David Pomarino,Competency Network Toe Walking c/o Practice Pomarino 0 5 0 1 8 0 5 14
Department of Pathology and Molecular Medicine,Queen's University 0 16 0 3 9 0 0 12
Bruce Budowle Laboratory,University of North Texas Health Science Center 0 0 0 0 0 12 0 12
New York Genome Center 0 36 0 3 8 0 2 12
Fulgent Genetics,Fulgent Genetics 0 246 0 5 6 0 0 11
Molecular Diagnostics Lab,Nemours Alfred I. duPont Hospital for Children 0 24 0 6 2 0 2 10
Institute of Human Genetics,Friedrich-Alexander-Universität Erlangen-Nürnberg 0 24 0 10 0 0 0 10
Laboratory of Molecular Genetics (Pr. Bezieau's lab), CHU de Nantes 0 48 0 5 0 0 5 10
CZECANCA consortium 0 79 0 5 0 0 5 10
GeneReviews 0 6 4 3 2 0 0 9
Forensic Genetics Laboratory,Harris County Institute of Forensic Sciences 0 2 0 0 0 0 9 9
Cancer Genetics and Genomics Laboratory,British Columbia Cancer Agency 0 37 0 7 2 0 0 9
Inherited Neuropathy Consortium 0 4 0 2 5 0 2 9
Broad Institute Rare Disease Group, Broad Institute 0 9 0 3 3 0 3 9
Knight Diagnostic Laboratories, Oregon Health and Sciences University 0 29 0 3 5 0 0 8
Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago 0 11 0 1 5 0 2 8
Medical Genetics Laboratory, Kennedy Center,Juliane Marie Center, Rigshospitalet 0 9 0 5 1 0 1 7
Natera, Inc. 0 97 0 3 4 0 0 7
Service de Génétique Moléculaire,Hôpital Robert Debré 0 8 0 5 1 0 1 7
GeneKor MSA 0 64 0 7 0 0 0 7
Lupski Lab, Baylor-Hopkins CMG, Baylor College of Medicine 0 5 0 3 1 0 5 7
Equipe Genetique des Anomalies du Developpement, Université de Bourgogne 0 2 0 4 0 1 3 7
Laboratoire de Génétique Moléculaire, CHU Bordeaux 0 10 0 5 0 0 2 7
Medical Genetics Summaries 0 0 0 0 0 7 0 7
St. Jude Clinical Genomics Lab, St. Jude Children's Research Hospital 0 7 0 1 4 0 2 7
University of Washington Department of Laboratory Medicine, University of Washington 0 18 0 1 5 0 1 7
Genetics Laboratory, UDIAT-Centre Diagnòstic, Hospital Universitari Parc Tauli 0 18 0 6 0 0 1 7
Center for Genetic Medicine Research,Children's National Medical Center 0 4 0 0 4 0 2 6
Research and Development, ARUP Laboratories 0 5 0 1 4 0 1 6
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego 0 10 0 6 1 0 1 6
ClinGen RASopathy Variant Curation Expert Panel 0 5 5 1 0 0 0 6
Laboratory of Molecular Genetics,CHU RENNES 0 0 0 4 0 0 1 5
Rare Disease Group, Clinical Genetics,Karolinska Institutet 0 1 0 2 1 0 4 5
3DMed Clinical Laboratory Inc 0 9 0 0 5 0 0 5
CFTR-France 0 1 0 0 0 0 5 5
SNPedia 0 25 0 4 0 0 0 4
Agnes Ginges Centre for Molecular Cardiology,Centenary Institute 0 5 0 1 3 0 0 4
Génétique et pathophysiologie de maladies neurodéveloppementales et épileptogènes, Institut de génétique et de biologie moléculaire et cellulaire 0 0 0 4 0 0 0 4
Albrecht-Kossel-Institute,Medical University Rostock 0 0 0 0 0 4 0 4
Neurogenetics Laboratory - MEYER,AOU Meyer 0 10 0 3 0 0 2 4
Undiagnosed Diseases Network,NIH 0 7 0 3 1 0 2 4
Center for Advanced Laboratory Medicine, UC San Diego Health,University of California San Diego 0 11 0 4 0 0 0 4
Constitutional Genetics Lab,Leon Berard Cancer Center 0 37 0 2 0 0 2 4
Baylor Genetics 0 11 0 2 0 0 2 3
Claritas Genomics 0 13 0 3 0 0 0 3
GeneDx 121828 38 0 2 1 0 2 3
Elsea Laboratory,Baylor College of Medicine 0 1 0 1 0 0 3 3
Molecular Genetics Laboratory,BC Children's and BC Women's Hospitals 0 6 0 2 0 0 1 3
UniProtKB/Swiss-Prot 0 43 0 1 2 0 0 3
GenMed Metabolism Lab 0 9 0 2 0 0 1 3
Wellcome Centre for Mitochondrial Research,Newcastle University 0 10 0 3 0 0 0 3
Northcott Neuroscience Laboratory, ANZAC Research Institute 0 0 0 0 2 0 1 3
ISCA site 1 0 2 0 0 0 0 3 3
Genome Sciences Centre,British Columbia Cancer Agency 0 0 0 3 0 0 1 3
Human Genetics - Radboudumc,Radboudumc 0 1 0 1 0 0 2 3
Yale Center for Mendelian Genomics,Yale University 0 4 0 3 0 0 0 3
Geisinger Autism and Developmental Medicine Institute,Geisinger Health System 0 4 0 1 1 0 3 3
Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde,Academisch Medisch Centrum 0 2 0 1 0 0 2 3
True Health Diagnostics 0 0 0 3 0 0 0 3
Pediatric Immunology Service,The Chaim Sheba Medical Center at Tel HaShomer 0 1 0 2 0 0 1 3
Ocular Genomics Institute, Massachusetts Eye and Ear 0 3 0 0 0 0 3 3
Department of Genetics, Rouen University Hospital, Normandy Center for Genomic and Personalized Medicine 0 5 0 1 2 0 0 3
Faculty of Health Sciences,Beirut Arab University 0 6 0 2 0 0 1 3
Sydney Children's Hospital, SCHN 0 3 0 1 0 0 1 2
Chan Lab,Boston Children's Hospital 0 0 0 1 0 0 1 2
Division of Human Genetics,Children's Hospital of Philadelphia 0 3 0 0 1 0 1 2
HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology 0 1 0 2 1 0 1 2
Center of Genomic medicine, Geneva,University Hospital of Geneva 0 5 0 0 1 0 1 2
Petrovsky National Research Centre of Surgery, The Federal Agency for Scientific Organizations 0 6 0 0 0 0 2 2
Clinical Pharmacogenetics Implementation Consortium 0 0 0 0 0 2 0 2
Oxford Haemato-Oncology Service,Oxford University Hospitals NHS Foundation Trust 0 0 0 0 0 2 0 2
Institute of Human Genetics, University of Leipzig Medical Center 0 3 0 2 0 0 0 2
Molecular Oncology Laboratory,Hospital Clínico San Carlos 0 2 0 1 1 0 0 2
Snyder Lab, Genetics Department,Stanford University 0 0 0 2 0 0 0 2
Sharon lab,Hadassah-Hebrew University Medical Center 0 6 0 2 0 0 0 2
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen 0 3 0 1 1 0 0 2
Lab. Molecular Oncology,VUB, Free University of Brussels 0 2 0 0 2 0 0 2
Center for Reproductive Medicine,Shandong Provincial Hospital Affiliated to Shandong University 0 1 0 1 0 0 1 2
Clinical Genomics Program, Stanford Medicine 0 1 0 2 0 0 0 2
Suna and Inan Kirac Foundation Neurodegeneration Research Laboratory, Koc University 0 2 0 2 0 0 1 2
Paris Brain Institute,Inserm - ICM 0 1 0 1 1 0 0 2
Molecular Genetics Laboratory,Children's Mercy Hospital and Clinics 0 2 0 1 0 0 0 1
FirmaLab,FirmaLab 0 0 0 0 0 0 1 1
Genome Diagnostics Laboratory,University Medical Center Utrecht 0 2 0 1 0 0 0 1
Centogene AG - the Rare Disease Company 0 3 0 1 0 0 0 1
Institute of Medical Molecular Genetics, University of Zurich 0 0 0 1 0 0 0 1
Bristol Genetics Laboratory - North Bristol NHS Trust,Southmead Hospital - Pathology Sciences 0 1 0 1 0 0 0 1
MyeliNeuroGene Lab,McGill University Health Center Research Institute 0 0 0 0 0 0 1 1
Martin Pollak Laboratory, Beth Israel Deaconess Medical Center 0 0 1 0 0 0 0 1
Eye Genetics Research Group,Children's Medical Research Institute 0 1 0 1 0 0 0 1
Department of Psychiatry,Nagoya University 0 0 0 1 0 0 1 1
Department of Prosthodontics,Peking University School and Hospital of Stomatology 0 1 0 0 0 0 1 1
TilsonLab,Columbia University 0 0 0 0 0 0 1 1
ISCA site 4 0 3 0 1 0 0 1 1
ISCA site 15 0 1 0 0 1 0 1 1
Center for Medical Genetics Ghent,University of Ghent 0 0 0 1 0 0 1 1
Bone Marrow Failure laboratory,Queen Mary University London 0 0 0 1 0 0 0 1
Vavilov Institute of General Genetics RAS, Laboratory of Evolutional Genomics 0 0 0 0 0 1 0 1
Lyon Laboratory, Cold Spring Harbor Laboratory 0 0 0 0 1 0 1 1
Hadassah Hebrew University Medical Center 0 0 0 1 0 0 0 1
Laboratory of Genetics and Molecular Cardiology, University of São Paulo 0 0 0 1 0 0 0 1
Aziz Sancar Institute of Experimental Medicine,Istanbul University 0 0 0 0 0 1 0 1
Laboratory of Prof. Karen Avraham,Tel Aviv University 0 0 0 1 0 0 0 1
Institute for Medical Genetics and Human Genetics, Charité - Universitätsmedizin Berlin 0 0 0 0 0 0 1 1
Institute for Genomic Medicine, Columbia University,Columbia University Medical Center 0 0 0 1 0 0 0 1
Soonchunhyang University Bucheon Hospital,Soonchunhyang University Medical Center 0 0 0 0 0 0 1 1
Institute for Biomarker Research,Medical Diagnostic Laboratories, L.L.C. 0 0 0 1 0 0 0 1
Department of Ophthalmology,Flinders University 0 0 0 1 0 0 0 1
Pediatric Highly Intensive Care Unit,Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico 0 0 0 1 0 0 1 1
Daryl Scott Lab,Baylor College of Medicine 0 0 0 1 0 0 1 1
Groupe Hospitalier Pitie Salpetriere, UF Genomique du Developpement,Assistance Publique Hopitaux de Paris 0 0 0 1 0 0 0 1
Embryology Laboratory,Victor Chang Cardiac Research Institute 0 1 0 1 0 0 0 1
Area of Clinical and Molecular Genetics,Hospital Universitario Vall de Hebron 0 1 0 1 0 0 0 1
Endocrine oncology group, Uppsala University 0 0 0 1 0 0 0 1
Neurogenetics Research Program, University of Adelaide 0 3 0 0 1 0 0 1
CHLA Center for Personalized Medicine,Children's Hospital, Los Angeles 0 4 0 0 1 0 0 1
Institute of Cellular and Molecular Medicine,Copenhagen University 0 0 0 1 0 0 1 1
Flegel Lab,National Institutes of Health 0 0 0 1 0 0 1 1
Kariminejad - Najmabadi Pathology & Genetics Center 0 1 0 1 0 0 0 1
Department of Human Genetics, University Hospital Magdeburg 0 1 0 0 0 0 1 1
Molecular Medicine,University of Leeds 0 2 0 1 0 0 0 1
Tartaglia Lab, Genetics and Rare Diseases Research Division,Bambino Gesu' Children's Hospital 0 0 0 1 0 0 0 1
Pediatric Genomics Discovery Program,Yale University 0 1 0 0 0 0 1 1
Biochemical Molecular Genetic Laboratory,King Abdulaziz Medical City 0 5 0 0 0 0 1 1
Laboratoire de Genetique Moleculaire,Centre Hospitalier Universitaire de Bordeaux 0 0 0 0 1 0 1 1
Medical Genetics Lab,Policlinico S. Orsola.Malpighi 0 0 0 1 1 0 1 1
Génétique des Maladies du Développement, Hospices Civils de Lyon 0 20 0 1 0 0 0 1
Medical Cytogenetics and Molecular Genetics Laboratory,IRCCS Istituto Auxologico Italiano 0 0 0 0 1 0 1 1
UNC Molecular Genetics Laboratory,University of North Carolina at Chapel Hill 0 4 0 1 0 0 0 1
Genomic Medicine Lab, University of California San Francisco 0 4 0 1 0 0 0 1
Michaelson Lab,University of Iowa 0 0 0 0 1 0 1 1
Pathology and Clinical Laboratory Medicine,King Fahad Medical City 0 1 0 0 0 0 1 1
Molecular Pathology Diagnostics Labratory,University of Iowa Hospitals & Clinics 0 0 0 1 0 0 1 1
Biochemistry Laboratory of CDMU,Chengde Medical University 0 0 0 1 0 0 1 1
Institute for Genomic Statistics and Bioinformatics, University Hospital Bonn 0 0 0 1 0 0 0 1
Genesis Genome Database 0 1 0 0 1 0 0 1
UT Southwestern Medical Center, UT Southwestern Medical Center 0 0 0 0 0 1 0 1
Stankiewicz Research Laboratory, Baylor College of Medicine 0 0 0 1 0 0 0 1
Department of Pediatrics, Graduate School of Medical Sciences,Kyushu University 0 0 0 1 0 0 0 1
Diagnostics Lab (ASPIRE), CSIR - Centre for Cellular and Molecular Biology 0 0 0 0 0 0 1 1
Autoinflammatory diseases unit,CHU de Montpellier 0 2 0 1 0 0 0 1
Epilepsy Neurogenetics Initiative, Children's Hospital of Philadelphia 0 3 0 0 0 0 1 1
Central Laboratory,The First Hospital of Lanzhou University 0 0 0 1 0 0 1 1
MAGI's Lab - Research,MAGI Group 0 8 0 0 0 0 1 1
Genetics and Prenatal Diagnosis Center,The First Affiliated Hospital of Zhengzhou University 0 1 0 1 0 0 1 1
Molecular Genetics of Inherited Kidney Disorders Laboratory,Garvan Institute of Medical Research 0 2 0 0 0 0 1 1
Sydney Genome Diagnostics,Children's Hospital Westmead 0 0 0 0 0 0 1 1
Dept. Genetics and Cancer, Menzies Institute for Medical Research,University of Tasmania 0 0 0 0 1 0 1 1
Wilkie Group, Clinical Genetics Lab, WIMM,University of Oxford 0 0 0 1 0 0 1 1

All variants with conflicting interpretations #

Total variants: 17559
Download table as spreadsheet
HGVS dbSNP
CYP2C19*17 rs12248560
CYP2C19*4A rs28399504
CYP2C9*11 rs28371685
CYP2C9*2 rs1799853
CYP2D6*10 rs1065852
CYP2D6*17 rs28371706
CYP2D6*4 rs3892097
CYP2D6*41 rs28371725
CYP2D6*6 rs5030655
GRCh38/hg38 10q11.22-11.23(chr10:45999930-49937908)x1
GRCh38/hg38 1q21.1(chr1:146987841-148234205)x1
GRCh38/hg38 7q11.1-11.21(chr7:61006478-62410831)x3
MYH11:c.503-14_503-12del rs141564071
NC_000019.9:g.39743165T>G rs8099917
NM_000016.5(ACADM):c.351A>C (p.Thr117=) rs74090726
NM_000016.5(ACADM):c.388-5G>A rs759254037
NM_000016.5(ACADM):c.443G>A (p.Arg148Lys) rs778906552
NM_000016.5(ACADM):c.558T>A (p.Asn186Lys) rs754359356
NM_000016.5(ACADM):c.616C>T (p.Arg206Cys) rs373715782
NM_000016.5(ACADM):c.678A>G (p.Ala226=) rs2229249
NM_000016.5(ACADM):c.734C>T (p.Ser245Leu) rs121434281
NM_000016.5(ACADM):c.797A>G (p.Asp266Gly) rs201375579
NM_000016.5(ACADM):c.994C>T (p.Leu332=) rs138098371
NM_000018.4(ACADVL):c.1066A>G (p.Ile356Val) rs150140386
NM_000018.4(ACADVL):c.1316G>A (p.Gly439Asp) rs533055438
NM_000018.4(ACADVL):c.1434+14T>A rs202217537
NM_000018.4(ACADVL):c.1473A>G (p.Leu491=) rs150518187
NM_000018.4(ACADVL):c.1844G>A (p.Arg615Gln) rs148584617
NM_000018.4(ACADVL):c.194C>T (p.Pro65Leu) rs28934585
NM_000018.4(ACADVL):c.520G>A (p.Val174Met) rs369560930
NM_000018.4(ACADVL):c.538G>A (p.Ala180Thr) rs727503791
NM_000018.4(ACADVL):c.678C>A (p.Ala226=) rs372114185
NM_000018.4(ACADVL):c.829_831del (p.Glu277del) rs796051913
NM_000018.4(ACADVL):c.881G>A (p.Gly294Glu) rs200573371
NM_000020.2(ACVRL1):c.1135G>A (p.Glu379Lys) rs1131691686
NM_000020.2(ACVRL1):c.1219G>A (p.Glu407Lys) rs1057521203
NM_000020.2(ACVRL1):c.1377+45T>C rs706815
NM_000020.3(ACVRL1):c.1445C>T (p.Ala482Val) rs139142865
NM_000023.4(SGCA):c.100C>T (p.Arg34Cys) rs758647756
NM_000023.4(SGCA):c.1120C>T (p.Arg374Cys) rs35495899
NM_000023.4(SGCA):c.189C>T (p.His63=) rs373770886
NM_000023.4(SGCA):c.292C>T (p.Arg98Cys) rs138945081
NM_000023.4(SGCA):c.366G>A (p.Leu122=) rs147739328
NM_000023.4(SGCA):c.408C>T (p.Ala136=) rs143551687
NM_000023.4(SGCA):c.528C>T (p.Thr176=) rs1801190
NM_000023.4(SGCA):c.541C>A (p.Arg181Ser) rs574376340
NM_000023.4(SGCA):c.690G>C (p.Leu230=) rs139454982
NM_000023.4(SGCA):c.861G>A (p.Leu287=) rs1555569293
NM_000026.4(ADSL):c.124C>T (p.Leu42=) rs2228415
NM_000026.4(ADSL):c.1291G>A (p.Ala431Thr) rs200814886
NM_000026.4(ADSL):c.1342T>C (p.Ser448Pro) rs771121666
NM_000026.4(ADSL):c.153+1G>T rs1555903969
NM_000026.4(ADSL):c.357+6C>T rs181628906
NM_000026.4(ADSL):c.357+7G>A rs199993991
NM_000026.4(ADSL):c.358-4G>A rs113199851
NM_000026.4(ADSL):c.403-4G>A rs373652667
NM_000026.4(ADSL):c.440A>T (p.Lys147Met) rs11089991
NM_000026.4(ADSL):c.616G>T (p.Ala206Ser) rs148411623
NM_000026.4(ADSL):c.649C>G (p.His217Asp) rs199761158
NM_000026.4(ADSL):c.702-7T>C rs201509960
NM_000026.4(ADSL):c.735A>T (p.Arg245=) rs143977255
NM_000027.4(AGA):c.436T>G (p.Leu146Val) rs146381591
NM_000029.4(AGT):c.803T>C (p.Met268Thr) rs699
NM_000030.3(AGXT):c.508G>A (p.Gly170Arg) rs121908529
NM_000031.6(ALAD):c.36C>G (p.Phe12Leu) rs121912984
NM_000032.5(ALAS2):c.1559C>T (p.Pro520Leu) rs201062903
NM_000032.5(ALAS2):c.1560C>A (p.Pro520=) rs150055592
NM_000032.5(ALAS2):c.1676G>A (p.Arg559His) rs145704441
NM_000032.5(ALAS2):c.828C>T (p.Cys276=) rs73214617
NM_000033.4(ABCD1):c.1771C>T (p.Arg591Trp) rs398123106
NM_000033.4(ABCD1):c.1866-10G>A rs398123108
NM_000033.4(ABCD1):c.565C>T (p.Arg189Trp) rs1131691916
NM_000033.4(ABCD1):c.823C>T (p.Arg275Trp) rs782083931
NM_000033.4(ABCD1):c.880G>A (p.Ala294Thr) rs1131691954
NM_000035.4(ALDOB):c.1000-3T>C rs369238799
NM_000035.4(ALDOB):c.156T>G (p.Thr52=) rs149671008
NM_000035.4(ALDOB):c.488C>T (p.Ala163Val) rs202210810
NM_000035.4(ALDOB):c.525C>T (p.Ala175=) rs144196914
NM_000035.4(ALDOB):c.681C>T (p.Thr227=) rs61757689
NM_000035.4(ALDOB):c.759C>T (p.Thr253=) rs146360505
NM_000035.4(ALDOB):c.799+6G>A rs141888548
NM_000036.2(AMPD1):c.1261C>T (p.Arg421Trp) rs35859650
NM_000036.2(AMPD1):c.133C>T (p.Gln45Ter) rs17602729
NM_000036.2(AMPD1):c.567G>T (p.Gln189His) rs139582106
NM_000038.6(APC):c.1005A>G (p.Leu335=) rs3797704
NM_000038.6(APC):c.1050T>G (p.Ser350=) rs760345157
NM_000038.6(APC):c.1139G>A (p.Arg380Gln) rs587782886
NM_000038.6(APC):c.120G>A (p.Glu40=) rs142720069
NM_000038.6(APC):c.1240C>T (p.Arg414Cys) rs137854567
NM_000038.6(APC):c.1312+12A>G rs372970635
NM_000038.6(APC):c.1312+3A>G rs863225311
NM_000038.6(APC):c.1405C>T (p.Leu469=) rs746293695
NM_000038.6(APC):c.1419G>A (p.Gln473=) rs141579422
NM_000038.6(APC):c.1549-13A>T rs587781267
NM_000038.6(APC):c.1554G>A (p.Thr518=) rs546568052
NM_000038.6(APC):c.1596A>G (p.Gln532=) rs1331131200
NM_000038.6(APC):c.1604C>T (p.Ser535Phe) rs75870842
NM_000038.6(APC):c.1606G>A (p.Glu536Lys) rs138098808
NM_000038.6(APC):c.1626+4C>A rs1202435147
NM_000038.6(APC):c.1631T>C (p.Ile544Thr) rs144056494
NM_000038.6(APC):c.1686G>A (p.Thr562=) rs770256026
NM_000038.6(APC):c.1690C>T (p.Arg564Ter) rs137854574
NM_000038.6(APC):c.1713A>G (p.Ala571=) rs529306174
NM_000038.6(APC):c.1722A>G (p.Glu574=) rs786201277
NM_000038.6(APC):c.1743+6T>C rs766973462
NM_000038.6(APC):c.1761C>T (p.Ser587=) rs370783137
NM_000038.6(APC):c.1825G>A (p.Val609Ile) rs147863331
NM_000038.6(APC):c.1867C>T (p.Arg623Trp) rs730881238
NM_000038.6(APC):c.1958+10G>T rs375175370
NM_000038.6(APC):c.1959G>A (p.Arg653=) rs72541809
NM_000038.6(APC):c.220+124C>G rs76552546
NM_000038.6(APC):c.220+2T>A rs587781809
NM_000038.6(APC):c.2204C>T (p.Ala735Val) rs147655929
NM_000038.6(APC):c.2205G>A (p.Ala735=) rs141001261
NM_000038.6(APC):c.221-5T>C rs1057524155
NM_000038.6(APC):c.2232T>G (p.Ser744=) rs145751759
NM_000038.6(APC):c.2250A>T (p.Pro750=) rs376526724
NM_000038.6(APC):c.2262T>G (p.Val754=) rs148987776
NM_000038.6(APC):c.2297C>T (p.Ala766Val) rs200339830
NM_000038.6(APC):c.2322C>T (p.Asp774=) rs145792879
NM_000038.6(APC):c.2395dup (p.Tyr799fs) rs879254110
NM_000038.6(APC):c.2438A>G (p.Asn813Ser) rs201522866
NM_000038.6(APC):c.2476T>G (p.Leu826Val) rs145245264
NM_000038.6(APC):c.2547T>C (p.Asp849=) rs766086010
NM_000038.6(APC):c.2586C>G (p.Asn862Lys) rs147972247
NM_000038.6(APC):c.2593C>T (p.Pro865Ser) rs192620988
NM_000038.6(APC):c.259C>T (p.Leu87=) rs569640184
NM_000038.6(APC):c.2608C>T (p.Pro870Ser) rs33974176
NM_000038.6(APC):c.2627G>A (p.Arg876Gln) rs373428732
NM_000038.6(APC):c.2640C>T (p.Ile880=) rs200184105
NM_000038.6(APC):c.2778T>C (p.Ser926=) rs371526966
NM_000038.6(APC):c.2805C>A (p.Tyr935Ter) rs137854575
NM_000038.6(APC):c.2805C>T (p.Tyr935=) rs137854575
NM_000038.6(APC):c.2838A>G (p.Thr946=) rs142835322
NM_000038.6(APC):c.295C>T (p.Arg99Trp) rs139196838
NM_000038.6(APC):c.3006C>T (p.Ala1002=) rs72541810
NM_000038.6(APC):c.311C>G (p.Ser104Ter) rs74953290
NM_000038.6(APC):c.3165A>T (p.Ile1055=) rs61734287
NM_000038.6(APC):c.3173A>G (p.Asp1058Gly) rs148725540
NM_000038.6(APC):c.317G>A (p.Arg106His) rs201764637
NM_000038.6(APC):c.3249T>G (p.Asp1083Glu) rs201629780
NM_000038.6(APC):c.3264G>A (p.Lys1088=) rs114774495
NM_000038.6(APC):c.3352A>G (p.Asn1118Asp) rs140493115
NM_000038.6(APC):c.3374T>C (p.Val1125Ala) rs377278397
NM_000038.6(APC):c.3386T>C (p.Leu1129Ser) rs143638171
NM_000038.6(APC):c.3462AGA[2] (p.Glu1157del) rs386833391
NM_000038.6(APC):c.3471G>A (p.Glu1157=) rs143927847
NM_000038.6(APC):c.3479C>A (p.Thr1160Lys) rs201004111
NM_000038.6(APC):c.3511C>T (p.Arg1171Cys) rs201830995
NM_000038.6(APC):c.3529A>G (p.Ile1177Val) rs369834416
NM_000038.6(APC):c.3624C>T (p.Thr1208=) rs730882125
NM_000038.6(APC):c.3632T>G (p.Met1211Arg) rs575268622
NM_000038.6(APC):c.3650A>C (p.Asn1217Thr) rs138933660
NM_000038.6(APC):c.3711G>A (p.Gln1237=) rs756939805
NM_000038.6(APC):c.3739G>A (p.Ala1247Thr) rs148223181
NM_000038.6(APC):c.3786T>C (p.Tyr1262=) rs147411334
NM_000038.6(APC):c.379A>G (p.Ser127Gly) rs200089324
NM_000038.6(APC):c.3815C>G (p.Ser1272Ter) rs863225348
NM_000038.6(APC):c.385G>C (p.Glu129Gln) rs376628500
NM_000038.6(APC):c.3875C>T (p.Thr1292Met) rs371113837
NM_000038.6(APC):c.388A>G (p.Ser130Gly) rs150973053
NM_000038.6(APC):c.3909A>G (p.Gln1303=) rs746289994
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000038.6(APC):c.3949G>C (p.Glu1317Gln) rs1801166
NM_000038.6(APC):c.4074G>A (p.Ala1358=) rs149782464
NM_000038.6(APC):c.4212C>T (p.Ser1404=) rs144655979
NM_000038.6(APC):c.423-4del rs730881230
NM_000038.6(APC):c.4237A>G (p.Met1413Val) rs141519952
NM_000038.6(APC):c.4333A>G (p.Thr1445Ala) rs587780597
NM_000038.6(APC):c.4336G>A (p.Ala1446Thr) rs146572883
NM_000038.6(APC):c.4360A>G (p.Lys1454Glu) rs111866410
NM_000038.6(APC):c.4372C>T (p.Pro1458Ser) rs143796828
NM_000038.6(APC):c.4375_4377del (p.Thr1459del) rs386833393
NM_000038.6(APC):c.4413A>G (p.Ala1471=) rs964029262
NM_000038.6(APC):c.4420G>A (p.Ala1474Thr) rs139387758
NM_000038.6(APC):c.450A>G (p.Lys150=) rs116020626
NM_000038.6(APC):c.4669A>G (p.Ile1557Val) rs763578917
NM_000038.6(APC):c.4732T>G (p.Cys1578Gly) rs138367627
NM_000038.6(APC):c.475dup (p.Tyr159fs) rs863225361
NM_000038.6(APC):c.4833G>A (p.Gln1611=) rs762030106
NM_000038.6(APC):c.487C>T (p.Gln163Ter) rs863225362
NM_000038.6(APC):c.4893T>C (p.Ser1631=) rs35634377
NM_000038.6(APC):c.4905G>A (p.Gly1635=) rs137988845
NM_000038.6(APC):c.5009C>T (p.Ala1670Val) rs202228932
NM_000038.6(APC):c.5025T>G (p.Val1675=) rs876658169
NM_000038.6(APC):c.5026A>G (p.Arg1676Gly) rs370560998
NM_000038.6(APC):c.5027G>C (p.Arg1676Thr) rs143674116
NM_000038.6(APC):c.5140G>A (p.Asp1714Asn) rs148275069
NM_000038.6(APC):c.5145del (p.Asp1715fs) rs863225363
NM_000038.6(APC):c.5225G>A (p.Arg1742His) rs199775075
NM_000038.6(APC):c.5265G>A (p.Ala1755=) rs34506289
NM_000038.6(APC):c.5271T>C (p.Ser1757=) rs752875511
NM_000038.6(APC):c.5304G>A (p.Lys1768=) rs863224285
NM_000038.6(APC):c.532-32T>C rs112108777
NM_000038.6(APC):c.5363G>A (p.Arg1788His) rs201472075
NM_000038.6(APC):c.5392A>G (p.Asn1798Asp) rs200794097
NM_000038.6(APC):c.5430T>G (p.Asp1810Glu) rs149828124
NM_000038.6(APC):c.5506G>A (p.Gly1836Arg) rs766739164
NM_000038.6(APC):c.5690A>C (p.His1897Pro) rs112610898
NM_000038.6(APC):c.5790A>G (p.Gln1930=) rs141152252
NM_000038.6(APC):c.5801C>T (p.Pro1934Leu) rs587780600
NM_000038.6(APC):c.5804dup (p.Ser1936fs) rs863225367
NM_000038.6(APC):c.5805G>A (p.Gln1935=) rs377040690
NM_000038.6(APC):c.5952T>C (p.Asn1984=) rs142019870
NM_000038.6(APC):c.607C>G (p.Gln203Glu) rs141576417
NM_000038.6(APC):c.6135C>T (p.Ser2045=) rs187297940
NM_000038.6(APC):c.6219T>G (p.Gly2073=) rs766559927
NM_000038.6(APC):c.6354TGC[5] (p.Ala2122dup) rs587780602
NM_000038.6(APC):c.645+1G>A rs863225370
NM_000038.6(APC):c.647G>A (p.Arg216Gln) rs76685252
NM_000038.6(APC):c.6492C>T (p.Gly2164=) rs765332758
NM_000038.6(APC):c.6510A>C (p.Pro2170=) rs138571760
NM_000038.6(APC):c.6510del (p.Glu2172fs) rs1554087474
NM_000038.6(APC):c.6525A>G (p.Thr2175=) rs200151646
NM_000038.6(APC):c.6526T>C (p.Leu2176=) rs183468041
NM_000038.6(APC):c.6609T>C (p.Val2203=) rs149328018
NM_000038.6(APC):c.6624A>G (p.Glu2208=) rs886059798
NM_000038.6(APC):c.6669A>G (p.Ser2223=) rs372680843
NM_000038.6(APC):c.6679G>T (p.Gly2227Cys) rs367905430
NM_000038.6(APC):c.6724A>G (p.Ser2242Gly) rs201375478
NM_000038.6(APC):c.6821C>T (p.Ala2274Val) rs34919187
NM_000038.6(APC):c.6873A>T (p.Gln2291His) rs148878262
NM_000038.6(APC):c.6921G>A (p.Ser2307=) rs2229993
NM_000038.6(APC):c.695G>A (p.Arg232Gln) rs201727026
NM_000038.6(APC):c.6985A>G (p.Ile2329Val) rs146048493
NM_000038.6(APC):c.7036C>T (p.Pro2346Ser) rs200756935
NM_000038.6(APC):c.705A>G (p.Leu235=) rs147036141
NM_000038.6(APC):c.7095A>G (p.Ser2365=) rs747844776
NM_000038.6(APC):c.7109G>T (p.Gly2370Val) rs140079759
NM_000038.6(APC):c.721G>A (p.Glu241Lys) rs777603154
NM_000038.6(APC):c.7395T>C (p.Leu2465=) rs369906346
NM_000038.6(APC):c.7399C>A (p.Pro2467Thr) rs372305287
NM_000038.6(APC):c.7415C>T (p.Ala2472Val) rs200399245
NM_000038.6(APC):c.7490C>T (p.Ser2497Leu) rs141010008
NM_000038.6(APC):c.7504G>A (p.Gly2502Ser) rs2229995
NM_000038.6(APC):c.7514G>A (p.Arg2505Gln) rs147549623
NM_000038.6(APC):c.7533C>T (p.Leu2511=) rs1057522957
NM_000038.6(APC):c.7574G>A (p.Arg2525His) rs762034315
NM_000038.6(APC):c.7625A>G (p.Asn2542Ser) rs151163793
NM_000038.6(APC):c.7717A>G (p.Ile2573Val) rs145444830
NM_000038.6(APC):c.7731A>G (p.Ser2577=) rs537187449
NM_000038.6(APC):c.7766A>G (p.Glu2589Gly) rs200406572
NM_000038.6(APC):c.777G>T (p.Arg259=) rs147704593
NM_000038.6(APC):c.7781C>G (p.Ser2594Cys) rs543396310
NM_000038.6(APC):c.7786T>G (p.Ser2596Ala) rs138137162
NM_000038.6(APC):c.7878T>G (p.Thr2626=) rs757020188
NM_000038.6(APC):c.7888G>A (p.Val2630Ile) rs199688874
NM_000038.6(APC):c.7929A>G (p.Leu2643=) rs138796072
NM_000038.6(APC):c.8042C>T (p.Pro2681Leu) rs182456139
NM_000038.6(APC):c.8061A>G (p.Ser2687=) rs746180965
NM_000038.6(APC):c.8100T>C (p.Asn2700=) rs761326128
NM_000038.6(APC):c.8199A>G (p.Gln2733=) rs372365378
NM_000038.6(APC):c.8261G>A (p.Ser2754Asn) rs369721828
NM_000038.6(APC):c.8266A>G (p.Ile2756Val) rs146115809
NM_000038.6(APC):c.841A>G (p.Thr281Ala) rs769727966
NM_000038.6(APC):c.8462A>G (p.Asp2821Gly) rs780049836
NM_000038.6(APC):c.848G>A (p.Arg283Gln) rs149154604
NM_000038.6(APC):c.904C>T (p.Arg302Ter) rs137854568
NM_000038.6(APC):c.933+5C>A rs573528468
NM_000038.6(APC):c.933+5C>T rs573528468
NM_000038.6(APC):c.935dup (p.Glu313fs) rs587781451
NM_000038.6(APC):c.993G>A (p.Ser331=) rs148343173
NM_000040.3(APOC3):c.55C>T (p.Arg19Ter) rs76353203
NM_000041.4(APOE):c.137T>C (p.Leu46Pro) rs769452
NM_000043.6(FAS):c.369G>A (p.Gln123=) rs28362318
NM_000044.6(AR):c.171GCA[31] (p.Gln73_Gln80dup) rs3032358
NM_000044.6(AR):c.1937C>A (p.Ala646Asp) rs1800053
NM_000044.6(AR):c.2659A>G (p.Met887Val) rs755226547
NM_000046.5(ARSB):c.1325C>T (p.Thr442Met) rs1057520739
NM_000047.2(ARSL):c.1743G>A (p.Trp581Ter) rs80338714
NM_000047.3(ARSL):c.-14GA[3] rs200332753
NM_000048.4(ASL):c.1135C>T (p.Arg379Cys) rs28940287
NM_000048.4(ASL):c.1164C>T (p.His388=) rs75300185
NM_000048.4(ASL):c.162C>T (p.Leu54=) rs140221164
NM_000048.4(ASL):c.332G>A (p.Arg111Gln) rs561367199
NM_000048.4(ASL):c.35G>A (p.Arg12Gln) rs145138923
NM_000048.4(ASL):c.556C>A (p.Arg186=) rs111407265
NM_000048.4(ASL):c.576G>A (p.Lys192=) rs115468878
NM_000051.3(ATM):c.1009C>T (p.Arg337Cys) rs138398778
NM_000051.3(ATM):c.1073A>G (p.Asn358Ser) rs149636614
NM_000051.3(ATM):c.1229T>C (p.Val410Ala) rs56128736
NM_000051.3(ATM):c.1236-3dup rs34325032
NM_000051.3(ATM):c.1272T>C (p.Pro424=) rs35578748
NM_000051.3(ATM):c.1380G>C (p.Thr460=) rs145333518
NM_000051.3(ATM):c.162T>C (p.Tyr54=) rs3218690
NM_000051.3(ATM):c.1695A>G (p.Glu565=) rs780932013
NM_000051.3(ATM):c.1744T>C (p.Phe582Leu) rs2235006
NM_000051.3(ATM):c.1773T>C (p.Asn591=) rs61734356
NM_000051.3(ATM):c.186A>G (p.Arg62=) rs876658224
NM_000051.3(ATM):c.1898+2T>G rs587782124
NM_000051.3(ATM):c.1905C>T (p.His635=) rs1020808836
NM_000051.3(ATM):c.1953A>G (p.Leu651=) rs730881283
NM_000051.3(ATM):c.1986T>C (p.Phe662=) rs1800055
NM_000051.3(ATM):c.2040C>T (p.Phe680=) rs587780855
NM_000051.3(ATM):c.2096A>G (p.Glu699Gly) rs147934285
NM_000051.3(ATM):c.2119T>C (p.Ser707Pro) rs4986761
NM_000051.3(ATM):c.2181C>T (p.Gly727=) rs876658836
NM_000051.3(ATM):c.2187C>T (p.Tyr729=) rs373430058
NM_000051.3(ATM):c.2251-10T>G rs730881346
NM_000051.3(ATM):c.2346A>G (p.Leu782=) rs730881285
NM_000051.3(ATM):c.2362A>C (p.Ser788Arg) rs641252
NM_000051.3(ATM):c.2396C>T (p.Ala799Val) rs199954262
NM_000051.3(ATM):c.2466+7A>G rs55812024
NM_000051.3(ATM):c.2467-7C>T rs768850329
NM_000051.3(ATM):c.2522A>C (p.Asp841Ala) rs587781812
NM_000051.3(ATM):c.2572T>C (p.Phe858Leu) rs1800056
NM_000051.3(ATM):c.2577C>T (p.Asn859=) rs730881286
NM_000051.3(ATM):c.2598T>G (p.Val866=) rs730881350
NM_000051.3(ATM):c.2608A>G (p.Asn870Asp) rs61734354
NM_000051.3(ATM):c.2638+2T>C rs587779826
NM_000051.3(ATM):c.2805G>C (p.Thr935=) rs55934812
NM_000051.3(ATM):c.2805G>T (p.Thr935=) rs55934812
NM_000051.3(ATM):c.2839-4T>C rs1057522619
NM_000051.3(ATM):c.2967T>C (p.Thr989=) rs144145128
NM_000051.3(ATM):c.3014A>G (p.Asn1005Ser) rs146531614
NM_000051.3(ATM):c.3077+4G>A rs201222237
NM_000051.3(ATM):c.3118A>G (p.Met1040Val) rs3092857
NM_000051.3(ATM):c.3154-4G>A rs199543313
NM_000051.3(ATM):c.3284+7G>C rs371629629
NM_000051.3(ATM):c.3285-15C>T rs770928986
NM_000051.3(ATM):c.332-3T>C rs376116157
NM_000051.3(ATM):c.3342G>A (p.Lys1114=) rs138393322
NM_000051.3(ATM):c.3383A>G (p.Gln1128Arg) rs2229020
NM_000051.3(ATM):c.3417G>A (p.Glu1139=) rs879254069
NM_000051.3(ATM):c.3517T>C (p.Leu1173=) rs141460670
NM_000051.3(ATM):c.3577-12del rs730881288
NM_000051.3(ATM):c.3577-6G>A rs56006345
NM_000051.3(ATM):c.3577-7C>T rs558667657
NM_000051.3(ATM):c.370A>G (p.Ile124Val) rs148590073
NM_000051.3(ATM):c.3963G>A (p.Met1321Ile) rs35184530
NM_000051.3(ATM):c.3G>A (p.Met1Ile) rs781404312
NM_000051.3(ATM):c.4109+6T>C rs368606937
NM_000051.3(ATM):c.4167A>G (p.Thr1389=) rs183214437
NM_000051.3(ATM):c.4258C>T (p.Leu1420Phe) rs1800058
NM_000051.3(ATM):c.4437-7A>G rs370354306
NM_000051.3(ATM):c.4437-9C>T rs766003804
NM_000051.3(ATM):c.4473C>T (p.Phe1491=) rs4988008
NM_000051.3(ATM):c.4611+9C>G rs760704159
NM_000051.3(ATM):c.4626G>A (p.Leu1542=) rs786202784
NM_000051.3(ATM):c.4665C>T (p.Leu1555=) rs374431061
NM_000051.3(ATM):c.4735C>T (p.Gln1579Ter) rs869312755
NM_000051.3(ATM):c.4777-10dup rs1398289633
NM_000051.3(ATM):c.4949A>G (p.Asn1650Ser) rs55870064
NM_000051.3(ATM):c.4980C>T (p.Asn1660=) rs144338238
NM_000051.3(ATM):c.5005+7_5005+8del rs587780626
NM_000051.3(ATM):c.5005+9C>T rs730881291
NM_000051.3(ATM):c.5009C>T (p.Ala1670Val) rs375131360
NM_000051.3(ATM):c.5063T>C (p.Ile1688Thr) rs199836342
NM_000051.3(ATM):c.5228C>T (p.Thr1743Ile) rs587779844
NM_000051.3(ATM):c.5352C>T (p.Asn1784=) rs140641762
NM_000051.3(ATM):c.5414G>A (p.Trp1805Ter) rs879254171
NM_000051.3(ATM):c.5558A>T (p.Asp1853Val) rs1801673
NM_000051.3(ATM):c.5675-4T>A rs56075338
NM_000051.3(ATM):c.6095+6T>C rs1057522992
NM_000051.3(ATM):c.6096-9_6096-5del rs879254095
NM_000051.3(ATM):c.609C>T (p.Asp203=) rs144709948
NM_000051.3(ATM):c.610G>A (p.Gly204Arg) rs147915571
NM_000051.3(ATM):c.6154G>A (p.Glu2052Lys) rs202206540
NM_000051.3(ATM):c.6234C>T (p.Ser2078=) rs569483748
NM_000051.3(ATM):c.6382T>C (p.Leu2128=) rs753646931
NM_000051.3(ATM):c.6465G>A (p.Val2155=) rs140423883
NM_000051.3(ATM):c.6572+4T>C rs587780636
NM_000051.3(ATM):c.6919C>T (p.Leu2307Phe) rs56009889
NM_000051.3(ATM):c.6976-10_6989del rs587779859
NM_000051.3(ATM):c.6995T>C (p.Leu2332Pro) rs4988111
NM_000051.3(ATM):c.6998C>A (p.Thr2333Lys) rs150503164
NM_000051.3(ATM):c.6998C>T (p.Thr2333Ile) rs150503164
NM_000051.3(ATM):c.7044G>A (p.Thr2348=) rs140104789
NM_000051.3(ATM):c.7181C>T (p.Ser2394Leu) rs587779861
NM_000051.3(ATM):c.7224G>A (p.Ser2408=) rs145747513
NM_000051.3(ATM):c.7271T>G (p.Val2424Gly) rs28904921
NM_000051.3(ATM):c.7359T>G (p.Arg2453=) rs786201541
NM_000051.3(ATM):c.7390T>C (p.Cys2464Arg) rs55801750
NM_000051.3(ATM):c.7456C>T (p.Arg2486Ter) rs587779865
NM_000051.3(ATM):c.7463G>A (p.Cys2488Tyr) rs774281788
NM_000051.3(ATM):c.7494T>C (p.Ser2498=) rs34393781
NM_000051.3(ATM):c.7516-9del rs573494809
NM_000051.3(ATM):c.7516-9dup rs573494809
NM_000051.3(ATM):c.7566A>G (p.Gln2522=) rs775621333
NM_000051.3(ATM):c.7592T>C (p.Met2531Thr) rs587781365
NM_000051.3(ATM):c.7630-17T>C rs116047570
NM_000051.3(ATM):c.7788+7G>A rs749610251
NM_000051.3(ATM):c.7788+8G>T rs112775908
NM_000051.3(ATM):c.7927+13dup rs587781324
NM_000051.3(ATM):c.7928-10T>C rs188404773
NM_000051.3(ATM):c.7983T>C (p.Asp2661=) rs143972422
NM_000051.3(ATM):c.8011-6T>G rs762092284
NM_000051.3(ATM):c.8151+11C>T rs555381912
NM_000051.3(ATM):c.8152-6C>T rs200389039
NM_000051.3(ATM):c.8495G>T (p.Arg2832Leu) rs529296539
NM_000051.3(ATM):c.8532T>C (p.Ile2844=) rs730881278
NM_000051.3(ATM):c.8584+10T>C rs373321041
NM_000051.3(ATM):c.8592C>T (p.Tyr2864=) rs56025670
NM_000051.3(ATM):c.8671+9T>G rs200190537
NM_000051.3(ATM):c.8730C>G (p.Leu2910=) rs551041839
NM_000051.3(ATM):c.876G>A (p.Pro292=) rs755860432
NM_000051.3(ATM):c.8850+5A>C rs1057522186
NM_000051.3(ATM):c.8922G>A (p.Pro2974=) rs527248759
NM_000051.3(ATM):c.8987+3G>A rs56360226
NM_000051.3(ATM):c.9006C>T (p.Phe3002=) rs540172506
NM_000051.3(ATM):c.998C>T (p.Ser333Phe) rs28904919
NM_000051.4(ATM):c.1066-6T>G rs201686625
NM_000051.4(ATM):c.146C>G rs1800054
NM_000051.4(ATM):c.1595G>A (p.Cys532Tyr) rs35963548
NM_000051.4(ATM):c.1703G>T (p.Arg568Ile) rs200381392
NM_000051.4(ATM):c.1810C>T (p.Pro604Ser) rs2227922
NM_000051.4(ATM):c.2289T>A (p.Phe763Leu) rs34231402
NM_000051.4(ATM):c.2494C>T (p.Arg832Cys) rs2229022
NM_000051.4(ATM):c.2735A>G (p.Gln912Arg) rs730881353
NM_000051.4(ATM):c.2932T>C (p.Ser978Pro) rs139552233
NM_000051.4(ATM):c.295A>G (p.Ser99Gly) rs137882485
NM_000051.4(ATM):c.320G>A (p.Cys107Tyr) rs142358238
NM_000051.4(ATM):c.334G>A (p.Ala112Thr) rs146382972
NM_000051.4(ATM):c.3925G>A (p.Ala1309Thr) rs149711770
NM_000051.4(ATM):c.4060C>A (p.Pro1354Thr) rs145119475
NM_000051.4(ATM):c.4388T>G (p.Phe1463Cys) rs138327406
NM_000051.4(ATM):c.4424A>G (p.Tyr1475Cys) rs34640941
NM_000051.4(ATM):c.496+4T>C rs587781375
NM_000051.4(ATM):c.5071A>C (p.Ser1691Arg) rs1800059
NM_000051.4(ATM):c.5793T>C (p.Ala1931=) rs3092910
NM_000051.4(ATM):c.5821G>C (p.Val1941Leu) rs147187700
NM_000051.4(ATM):c.5975A>C (p.Lys1992Thr) rs150757822
NM_000051.4(ATM):c.6067G>A (p.Gly2023Arg) rs11212587
NM_000051.4(ATM):c.6176C>T (p.Thr2059Ile) rs144761622
NM_000051.4(ATM):c.6543G>T (p.Glu2181Asp) rs138828590
NM_000051.4(ATM):c.6795C>T rs3218699
NM_000051.4(ATM):c.6820G>A (p.Ala2274Thr) rs567060474
NM_000051.4(ATM):c.6860G>C (p.Gly2287Ala) rs1800061
NM_000051.4(ATM):c.6988C>G (p.Leu2330Val) rs148432863
NM_000051.4(ATM):c.7313C>T (p.Thr2438Ile) rs147604227
NM_000051.4(ATM):c.749G>A (p.Arg250Gln) rs56123940
NM_000051.4(ATM):c.7630-2A>C rs587779866
NM_000051.4(ATM):c.7740A>C (p.Arg2580Ser) rs199915459
NM_000051.4(ATM):c.7983TGT[2] (p.Val2664del) rs876660743
NM_000051.4(ATM):c.8545C>T rs587778080
NM_000051.4(ATM):c.8977C>T (p.Arg2993Ter) rs770641163
NM_000052.7(ATP7A):c.1516A>G (p.Ile506Val) rs143907597
NM_000052.7(ATP7A):c.1737A>G (p.Val579=) rs189353691
NM_000052.7(ATP7A):c.1955G>A (p.Arg652Gln) rs143214563
NM_000052.7(ATP7A):c.2070A>G (p.Glu690=) rs146692150
NM_000052.7(ATP7A):c.3589A>G (p.Asn1197Asp) rs148765730
NM_000052.7(ATP7A):c.3883C>T (p.Arg1295Trp) rs372489000
NM_000052.7(ATP7A):c.3931A>G (p.Met1311Val) rs139781067
NM_000052.7(ATP7A):c.4006A>G (p.Asn1336Asp) rs146651049
NM_000052.7(ATP7A):c.4226+11T>C rs200009243
NM_000052.7(ATP7A):c.4389T>C (p.Ser1463=) rs371939448
NM_000052.7(ATP7A):c.880A>T (p.Asn294Tyr) rs150526992
NM_000053.4(ATP7B):c.1216T>G (p.Ser406Ala) rs1801243
NM_000053.4(ATP7B):c.1278C>T (p.Val426=) rs143556945
NM_000053.4(ATP7B):c.1366G>C (p.Val456Leu) rs1801244
NM_000053.4(ATP7B):c.1543+13C>T rs200171850
NM_000053.4(ATP7B):c.1607T>C (p.Val536Ala) rs138427376
NM_000053.4(ATP7B):c.1620C>T (p.Leu540=) rs145798966
NM_000053.4(ATP7B):c.1877G>C (p.Gly626Ala) rs587783299
NM_000053.4(ATP7B):c.1947-4C>T rs74904335
NM_000053.4(ATP7B):c.1995G>A (p.Met665Ile) rs72552259
NM_000053.4(ATP7B):c.19_20del (p.Gln7fs) rs749363958
NM_000053.4(ATP7B):c.2175G>A (p.Arg725=) rs61733684
NM_000053.4(ATP7B):c.2310C>G (p.Leu770=) rs398123136
NM_000053.4(ATP7B):c.2355+13T>G rs139211339
NM_000053.4(ATP7B):c.2448-11G>A rs200450017
NM_000053.4(ATP7B):c.2495A>G (p.Lys832Arg) rs1061472
NM_000053.4(ATP7B):c.2785A>G (p.Ile929Val) rs534960245
NM_000053.4(ATP7B):c.2855G>A (p.Arg952Lys) rs732774
NM_000053.4(ATP7B):c.2955C>T (p.Cys985=) rs116587608
NM_000053.4(ATP7B):c.2972C>T (p.Thr991Met) rs41292782
NM_000053.4(ATP7B):c.2976C>A (p.Pro992=) rs746358240
NM_000053.4(ATP7B):c.3015C>T (p.Asn1005=) rs74085888
NM_000053.4(ATP7B):c.3101A>G (p.His1034Arg) rs74085882
NM_000053.4(ATP7B):c.3369G>A (p.Pro1123=) rs61733679
NM_000053.4(ATP7B):c.3396C>T (p.Ser1132=) rs370947152
NM_000053.4(ATP7B):c.3403G>A (p.Ala1135Thr) rs187200982
NM_000053.4(ATP7B):c.3405A>G (p.Ala1135=) rs373081328
NM_000053.4(ATP7B):c.3419T>C (p.Val1140Ala) rs1801249
NM_000053.4(ATP7B):c.3557-6C>T rs140708492
NM_000053.4(ATP7B):c.3620A>G (p.His1207Arg) rs7334118
NM_000053.4(ATP7B):c.3889G>A (p.Val1297Ile) rs148399850
NM_000053.4(ATP7B):c.3891C>T (p.Val1297=) rs114771537
NM_000053.4(ATP7B):c.3903+6C>T rs2282057
NM_000053.4(ATP7B):c.4022-19C>T rs369736734
NM_000053.4(ATP7B):c.4058G>A (p.Trp1353Ter) rs193922110
NM_000053.4(ATP7B):c.4302G>A (p.Thr1434=) rs116091486
NM_000053.4(ATP7B):c.4311G>A (p.Lys1437=) rs73202048
NM_000053.4(ATP7B):c.865C>T (p.Gln289Ter) rs121907999
NM_000057.4(BLM):c.1601A>G (p.Asn534Ser) rs35224686
NM_000057.4(BLM):c.1722A>G (p.Leu574=) rs28385011
NM_000057.4(BLM):c.1928G>A (p.Arg643His) rs12720097
NM_000057.4(BLM):c.2268A>G (p.Lys756=) rs146013879
NM_000057.4(BLM):c.254G>C (p.Arg85Thr) rs141503266
NM_000057.4(BLM):c.3625T>A (p.Ser1209Thr) rs1801256
NM_000057.4(BLM):c.3798T>G (p.Val1266=) rs138831180
NM_000057.4(BLM):c.4076+4T>G rs183176301
NM_000057.4(BLM):c.4077-10C>T rs145310008
NM_000057.4(BLM):c.410A>G (p.Lys137Arg) rs28384988
NM_000059.3(BRCA2):c.*14C>T rs373436334
NM_000059.3(BRCA2):c.-175C>T rs55880202
NM_000059.3(BRCA2):c.-51C>T rs1057521841
NM_000059.3(BRCA2):c.10024G>A (p.Glu3342Lys) rs28897761
NM_000059.3(BRCA2):c.10024G>T (p.Glu3342Ter) rs28897761
NM_000059.3(BRCA2):c.10087A>G (p.Ile3363Val) rs55881945
NM_000059.3(BRCA2):c.10089A>G (p.Ile3363Met) rs80358390
NM_000059.3(BRCA2):c.10102T>C (p.Ser3368Pro) rs786205482
NM_000059.3(BRCA2):c.10111A>G (p.Thr3371Ala) rs80358393
NM_000059.3(BRCA2):c.10160C>G (p.Thr3387Ser) rs863224584
NM_000059.3(BRCA2):c.10176del (p.Glu3393fs) rs80359258
NM_000059.3(BRCA2):c.10187G>A (p.Ser3396Asn) rs889208749
NM_000059.3(BRCA2):c.1021T>C (p.Cys341Arg) rs55833327
NM_000059.3(BRCA2):c.10220A>G (p.Asn3407Ser) rs80358401
NM_000059.3(BRCA2):c.10222A>T (p.Lys3408Ter) rs80358402
NM_000059.3(BRCA2):c.1022G>T (p.Cys341Phe) rs80358403
NM_000059.3(BRCA2):c.10240A>G (p.Thr3414Ala) rs80358405
NM_000059.3(BRCA2):c.10249T>C (p.Tyr3417His) rs535952730
NM_000059.3(BRCA2):c.10250A>G (p.Tyr3417Cys) rs730881600
NM_000059.3(BRCA2):c.1040A>G (p.Gln347Arg) rs55800493
NM_000059.3(BRCA2):c.1054T>C (p.Tyr352His) rs542343726
NM_000059.3(BRCA2):c.1059A>G (p.Ser353=) rs730881585
NM_000059.3(BRCA2):c.1096T>G (p.Leu366Val) rs587779357
NM_000059.3(BRCA2):c.1123C>T (p.Pro375Ser) rs80358408
NM_000059.3(BRCA2):c.1124C>T (p.Pro375Leu) rs80358409
NM_000059.3(BRCA2):c.1127T>G (p.Phe376Cys) rs80358410
NM_000059.3(BRCA2):c.1166C>A (p.Pro389Gln) rs397507263
NM_000059.3(BRCA2):c.1166C>T (p.Pro389Leu) rs397507263
NM_000059.3(BRCA2):c.1167G>A (p.Pro389=) rs148607710
NM_000059.3(BRCA2):c.1247T>G (p.Ile416Ser) rs80358418
NM_000059.3(BRCA2):c.1275A>G (p.Glu425=) rs34355306
NM_000059.3(BRCA2):c.1359A>T (p.Pro453=) rs730881586
NM_000059.3(BRCA2):c.1447G>C (p.Ala483Pro) rs80358432
NM_000059.3(BRCA2):c.1568A>G (p.His523Arg) rs80358443
NM_000059.3(BRCA2):c.1584C>T (p.Asn528=) rs730881587
NM_000059.3(BRCA2):c.1749G>A (p.Leu583=) rs780324598
NM_000059.3(BRCA2):c.1810A>G (p.Lys604Glu) rs80358467
NM_000059.3(BRCA2):c.1814T>C (p.Ile605Thr) rs80358468
NM_000059.3(BRCA2):c.1838T>G (p.Leu613Arg) rs587780646
NM_000059.3(BRCA2):c.1865C>T (p.Ala622Val) rs80358477
NM_000059.3(BRCA2):c.1889C>T (p.Thr630Ile) rs80358479
NM_000059.3(BRCA2):c.1909+1G>A rs587781629
NM_000059.3(BRCA2):c.1911T>C (p.Gly637=) rs11571652
NM_000059.3(BRCA2):c.1964del (p.Pro655fs) rs1555282375
NM_000059.3(BRCA2):c.2025A>G (p.Thr675=) rs147381487
NM_000059.3(BRCA2):c.2094A>G (p.Leu698=) rs28897714
NM_000059.3(BRCA2):c.2095C>T (p.Gln699Ter) rs878853559
NM_000059.3(BRCA2):c.2109C>T (p.Thr703=) rs762499878
NM_000059.3(BRCA2):c.2133C>T (p.Cys711=) rs535547513
NM_000059.3(BRCA2):c.2138A>T (p.Gln713Leu) rs55816687
NM_000059.3(BRCA2):c.2145A>G (p.Gly715=) rs112566179
NM_000059.3(BRCA2):c.2208A>G (p.Ala736=) rs144984153
NM_000059.3(BRCA2):c.2254_2257del (p.Asp752fs) rs80359326
NM_000059.3(BRCA2):c.2320A>G (p.Thr774Ala) rs55968715
NM_000059.3(BRCA2):c.2412A>G (p.Glu804=) rs587780866
NM_000059.3(BRCA2):c.2459A>G (p.Asp820Gly) rs80358511
NM_000059.3(BRCA2):c.2484T>C (p.Tyr828=) rs45619134
NM_000059.3(BRCA2):c.2601T>G (p.Thr867=) rs730881589
NM_000059.3(BRCA2):c.267G>A (p.Pro89=) rs587780648
NM_000059.3(BRCA2):c.2680G>A (p.Val894Ile) rs28897715
NM_000059.3(BRCA2):c.2739C>T (p.Asp913=) rs276174829
NM_000059.3(BRCA2):c.2779A>G (p.Met927Val) rs786201837
NM_000059.3(BRCA2):c.2803G>C (p.Asp935His) rs28897716
NM_000059.3(BRCA2):c.2817C>T (p.Thr939=) rs367921107
NM_000059.3(BRCA2):c.2819A>G (p.Gln940Arg) rs1057520249
NM_000059.3(BRCA2):c.28A>G (p.Thr10Ala) rs786203080
NM_000059.3(BRCA2):c.2944A>C (p.Ile982Leu) rs28897717
NM_000059.3(BRCA2):c.2946A>G (p.Ile982Met) rs80358541
NM_000059.3(BRCA2):c.3054G>A (p.Lys1018=) rs368404583
NM_000059.3(BRCA2):c.316+12A>G rs186419778
NM_000059.3(BRCA2):c.316+13A>G rs773097109
NM_000059.3(BRCA2):c.316+18G>A rs760439858
NM_000059.3(BRCA2):c.3173A>G (p.Lys1058Arg) rs431825302
NM_000059.3(BRCA2):c.3201del (p.Val1068fs) rs864622672
NM_000059.3(BRCA2):c.3218A>G (p.Gln1073Arg) rs80358566
NM_000059.3(BRCA2):c.3254A>G (p.His1085Arg) rs80358570
NM_000059.3(BRCA2):c.3262C>T (p.Pro1088Ser) rs80358572
NM_000059.3(BRCA2):c.3304A>T (p.Asn1102Tyr) rs28897719
NM_000059.3(BRCA2):c.3326C>T (p.Ala1109Val) rs41293479
NM_000059.3(BRCA2):c.3417G>A (p.Lys1139=) rs145625991
NM_000059.3(BRCA2):c.3420T>C (p.Ser1140=) rs118093942
NM_000059.3(BRCA2):c.3445A>G (p.Met1149Val) rs80358589
NM_000059.3(BRCA2):c.3453C>G (p.Ile1151Met) rs80358592
NM_000059.3(BRCA2):c.3495T>C (p.His1165=) rs776655838
NM_000059.3(BRCA2):c.3539A>G (p.Lys1180Arg) rs28897720
NM_000059.3(BRCA2):c.3562A>G (p.Ile1188Val) rs202230438
NM_000059.3(BRCA2):c.3568C>T (p.Arg1190Trp) rs80358604
NM_000059.3(BRCA2):c.3569G>A (p.Arg1190Gln) rs80358605
NM_000059.3(BRCA2):c.3575T>G (p.Phe1192Cys) rs80358606
NM_000059.3(BRCA2):c.3578C>T (p.Ala1193Val) rs431825310
NM_000059.3(BRCA2):c.3661T>C (p.Ser1221Pro) rs80358611
NM_000059.3(BRCA2):c.3682A>G (p.Asn1228Asp) rs28897722
NM_000059.3(BRCA2):c.375T>A (p.Asp125Glu) rs80358616
NM_000059.3(BRCA2):c.3785C>G (p.Ser1262Ter) rs80358620
NM_000059.3(BRCA2):c.3814A>G (p.Met1272Val) rs80358624
NM_000059.3(BRCA2):c.3874C>T (p.Leu1292=) rs587780867
NM_000059.3(BRCA2):c.3880T>C (p.Leu1294=) rs786201236
NM_000059.3(BRCA2):c.3916G>A (p.Val1306Ile) rs80358636
NM_000059.3(BRCA2):c.4061C>T (p.Thr1354Met) rs80358656
NM_000059.3(BRCA2):c.4071A>C (p.Leu1357=) rs140556653
NM_000059.3(BRCA2):c.4094G>A (p.Cys1365Tyr) rs80358657
NM_000059.3(BRCA2):c.4178C>T (p.Ala1393Val) rs398122776
NM_000059.3(BRCA2):c.4179G>A (p.Ala1393=) rs770531115
NM_000059.3(BRCA2):c.4271C>G (p.Ser1424Cys) rs80358664
NM_000059.3(BRCA2):c.4314C>T (p.Val1438=) rs730881590
NM_000059.3(BRCA2):c.441A>G (p.Gln147=) rs80358676
NM_000059.3(BRCA2):c.442T>C (p.Cys148Arg) rs80358677
NM_000059.3(BRCA2):c.4570T>G (p.Phe1524Val) rs56386506
NM_000059.3(BRCA2):c.4578A>G (p.Thr1526=) rs202022822
NM_000059.3(BRCA2):c.4584C>T (p.Ser1528=) rs80359788
NM_000059.3(BRCA2):c.4686A>G (p.Gln1562=) rs28897730
NM_000059.3(BRCA2):c.4698C>T (p.Thr1566=) rs750813972
NM_000059.3(BRCA2):c.4718G>A (p.Cys1573Tyr) rs56249050
NM_000059.3(BRCA2):c.476-3C>T rs371431745
NM_000059.3(BRCA2):c.476-9dup rs276174849
NM_000059.3(BRCA2):c.4779A>C (p.Glu1593Asp) rs80358703
NM_000059.3(BRCA2):c.4828G>A (p.Val1610Met) rs80358705
NM_000059.3(BRCA2):c.4977C>T (p.Ser1659=) rs45484897
NM_000059.3(BRCA2):c.502C>A (p.Pro168Thr) rs80358726
NM_000059.3(BRCA2):c.506A>G (p.Lys169Arg) rs80358730
NM_000059.3(BRCA2):c.5095G>A (p.Asp1699Asn) rs80358731
NM_000059.3(BRCA2):c.516+14C>T rs182828913
NM_000059.3(BRCA2):c.516+17G>C rs765435155
NM_000059.3(BRCA2):c.516+17G>T rs765435155
NM_000059.3(BRCA2):c.517-11T>C rs81002828
NM_000059.3(BRCA2):c.517-19C>T rs11571623
NM_000059.3(BRCA2):c.517-4C>G rs81002804
NM_000059.3(BRCA2):c.5171T>C (p.Ile1724Thr) rs80358743
NM_000059.3(BRCA2):c.5191C>A (p.His1731Asn) rs80358745
NM_000059.3(BRCA2):c.521G>A (p.Arg174His) rs80358747
NM_000059.3(BRCA2):c.5278T>G (p.Ser1760Ala) rs28897735
NM_000059.3(BRCA2):c.5319G>A (p.Glu1773=) rs376257217
NM_000059.3(BRCA2):c.5344C>A (p.Gln1782Lys) rs80358757
NM_000059.3(BRCA2):c.534A>G (p.Lys178=) rs28897703
NM_000059.3(BRCA2):c.5414A>G (p.Asn1805Ser) rs80358765
NM_000059.3(BRCA2):c.5423T>C (p.Ile1808Thr) rs397507350
NM_000059.3(BRCA2):c.5427C>T (p.Cys1809=) rs80359791
NM_000059.3(BRCA2):c.5455C>T (p.Pro1819Ser) rs80358768
NM_000059.3(BRCA2):c.5498A>G (p.Asn1833Ser) rs587782601
NM_000059.3(BRCA2):c.5529A>C (p.Ala1843=) rs372951842
NM_000059.3(BRCA2):c.5552T>G (p.Ile1851Ser) rs80358776
NM_000059.3(BRCA2):c.5631C>T (p.Asn1877=) rs374326934
NM_000059.3(BRCA2):c.5688A>G (p.Ala1896=) rs768907899
NM_000059.3(BRCA2):c.5700A>G (p.Ser1900=) rs730881591
NM_000059.3(BRCA2):c.5710C>G (p.Leu1904Val) rs55875643
NM_000059.3(BRCA2):c.5723_5724del (p.Leu1908fs) rs886040608
NM_000059.3(BRCA2):c.5737T>C (p.Cys1913Arg) rs80358799
NM_000059.3(BRCA2):c.575T>C (p.Met192Thr) rs80358805
NM_000059.3(BRCA2):c.5763T>G (p.Phe1921Leu) rs730881540
NM_000059.3(BRCA2):c.5879G>A (p.Cys1960Tyr) rs56157628
NM_000059.3(BRCA2):c.5882G>A (p.Ser1961Asn) rs80358820
NM_000059.3(BRCA2):c.5896C>T (p.His1966Tyr) rs80358822
NM_000059.3(BRCA2):c.5921C>T (p.Thr1974Ile) rs55730620
NM_000059.3(BRCA2):c.5969A>C (p.Asp1990Ala) rs148618542
NM_000059.3(BRCA2):c.5976A>G (p.Ser1992=) rs748854546
NM_000059.3(BRCA2):c.6057C>T (p.Asn2019=) rs147961615
NM_000059.3(BRCA2):c.6078A>G (p.Thr2026=) rs375649375
NM_000059.3(BRCA2):c.6131G>T (p.Gly2044Val) rs56191579
NM_000059.3(BRCA2):c.6143A>T (p.Asn2048Ile) rs80358853
NM_000059.3(BRCA2):c.6271A>C (p.Ser2091Arg) rs398122550
NM_000059.3(BRCA2):c.6273T>A (p.Ser2091Arg) rs966360777
NM_000059.3(BRCA2):c.627C>T (p.Leu209=) rs28897704
NM_000059.3(BRCA2):c.6288T>G (p.Pro2096=) rs372527810
NM_000059.3(BRCA2):c.632-13T>G rs775947267
NM_000059.3(BRCA2):c.6323G>T (p.Arg2108Leu) rs35029074
NM_000059.3(BRCA2):c.6325G>A (p.Val2109Ile) rs79456940
NM_000059.3(BRCA2):c.6338A>G (p.Asn2113Ser) rs80358874
NM_000059.3(BRCA2):c.6443C>A (p.Ser2148Tyr) rs80358880
NM_000059.3(BRCA2):c.6455C>A (p.Ser2152Tyr) rs80358881
NM_000059.3(BRCA2):c.6540G>C (p.Leu2180Phe) rs398122560
NM_000059.3(BRCA2):c.6541G>C (p.Gly2181Arg) rs371067421
NM_000059.3(BRCA2):c.6675A>G (p.Thr2225=) rs28897741
NM_000059.3(BRCA2):c.67+16A>T rs529148674
NM_000059.3(BRCA2):c.67+19T>C rs587780865
NM_000059.3(BRCA2):c.6739A>G (p.Ser2247Gly) rs80358896
NM_000059.3(BRCA2):c.6785T>G (p.Met2262Arg) rs80358904
NM_000059.3(BRCA2):c.6803G>A (p.Arg2268Lys) rs80358906
NM_000059.3(BRCA2):c.6821G>T (p.Gly2274Val) rs55712212
NM_000059.3(BRCA2):c.6841+11A>G rs730881592
NM_000059.3(BRCA2):c.6841+3A>T rs81002825
NM_000059.3(BRCA2):c.6842-20T>C rs81002811
NM_000059.3(BRCA2):c.6871A>G (p.Asn2291Asp) rs80358911
NM_000059.3(BRCA2):c.6892G>A (p.Glu2298Lys) rs80358914
NM_000059.3(BRCA2):c.6921A>G (p.Ser2307=) rs181183366
NM_000059.3(BRCA2):c.6935A>T (p.Asp2312Val) rs80358916
NM_000059.3(BRCA2):c.6937+13T>G rs587780868
NM_000059.3(BRCA2):c.6938-25_6938-19del rs762815401
NM_000059.3(BRCA2):c.6938-2A>G rs81002863
NM_000059.3(BRCA2):c.6943A>C (p.Ile2315Leu) rs80358918
NM_000059.3(BRCA2):c.6960G>A (p.Leu2320=) rs373134168
NM_000059.3(BRCA2):c.6986C>T (p.Pro2329Leu) rs80358925
NM_000059.3(BRCA2):c.7007+53G>A rs56014558
NM_000059.3(BRCA2):c.7007+7_7007+8del rs1555285373
NM_000059.3(BRCA2):c.7021C>T (p.Arg2341Cys) rs41293505
NM_000059.3(BRCA2):c.7050C>T (p.Thr2350=) rs587780870
NM_000059.3(BRCA2):c.7052C>G (p.Ala2351Gly) rs80358932
NM_000059.3(BRCA2):c.7096C>G (p.Leu2366Val) rs80358941
NM_000059.3(BRCA2):c.7102T>G (p.Leu2368Val) rs397507382
NM_000059.3(BRCA2):c.7137A>G (p.Gly2379=) rs730881593
NM_000059.3(BRCA2):c.7188G>A (p.Leu2396=) rs587780871
NM_000059.3(BRCA2):c.7188G>T (p.Leu2396Phe) rs587780871
NM_000059.3(BRCA2):c.7239A>G (p.Lys2413=) rs763727386
NM_000059.3(BRCA2):c.7252A>G (p.Arg2418Gly) rs80358953
NM_000059.3(BRCA2):c.7307A>T (p.Asn2436Ile) rs80358955
NM_000059.3(BRCA2):c.7313A>G (p.Asp2438Gly) rs80358957
NM_000059.3(BRCA2):c.7317A>G (p.Gly2439=) rs587780660
NM_000059.3(BRCA2):c.7354A>G (p.Asn2452Asp) rs398122580
NM_000059.3(BRCA2):c.7413A>G (p.Thr2471=) rs138067005
NM_000059.3(BRCA2):c.7466A>G (p.Asp2489Gly) rs80358970
NM_000059.3(BRCA2):c.7499G>C (p.Arg2500Thr) rs80358976
NM_000059.3(BRCA2):c.750G>A (p.Val250=) rs143214959
NM_000059.3(BRCA2):c.7522G>A (p.Gly2508Ser) rs80358978
NM_000059.3(BRCA2):c.7534C>T (p.Leu2512Phe) rs80358980
NM_000059.3(BRCA2):c.7559G>A (p.Arg2520Gln) rs80358982
NM_000059.3(BRCA2):c.7559G>C (p.Arg2520Pro) rs80358982
NM_000059.3(BRCA2):c.7565C>T (p.Ser2522Phe) rs80358985
NM_000059.3(BRCA2):c.7601C>T (p.Ala2534Val) rs74047012
NM_000059.3(BRCA2):c.7618-6G>T rs1057520251
NM_000059.3(BRCA2):c.7651A>C (p.Lys2551Gln) rs398122587
NM_000059.3(BRCA2):c.7958T>C (p.Leu2653Pro) rs80359022
NM_000059.3(BRCA2):c.796T>C (p.Phe266Leu) rs587782433
NM_000059.3(BRCA2):c.7975A>G (p.Arg2659Gly) rs80359026
NM_000059.3(BRCA2):c.8036A>G (p.Asp2679Gly) rs80359041
NM_000059.3(BRCA2):c.8084C>T (p.Ser2695Leu) rs80359048
NM_000059.3(BRCA2):c.8124T>G (p.Thr2708=) rs587780662
NM_000059.3(BRCA2):c.8154T>C (p.Ile2718=) rs148880015
NM_000059.3(BRCA2):c.8165C>G (p.Thr2722Arg) rs80359062
NM_000059.3(BRCA2):c.8166A>G (p.Thr2722=) rs786201640
NM_000059.3(BRCA2):c.8168A>T (p.Asp2723Val) rs41293513
NM_000059.3(BRCA2):c.8188G>C (p.Ala2730Pro) rs80359066
NM_000059.3(BRCA2):c.8215G>A (p.Val2739Ile) rs80359069
NM_000059.3(BRCA2):c.8298A>G (p.Thr2766=) rs730881594
NM_000059.3(BRCA2):c.8331+16C>G rs730881595
NM_000059.3(BRCA2):c.8331+16C>T rs730881595
NM_000059.3(BRCA2):c.8332-6G>T rs587780872
NM_000059.3(BRCA2):c.8350C>T (p.Arg2784Trp) rs80359075
NM_000059.3(BRCA2):c.8355T>C (p.Pro2785=) rs1057524419
NM_000059.3(BRCA2):c.8356G>A (p.Ala2786Thr) rs80359077
NM_000059.3(BRCA2):c.8359C>T (p.Arg2787Cys) rs41293517
NM_000059.3(BRCA2):c.8386C>T (p.Pro2796Ser) rs146120136
NM_000059.3(BRCA2):c.8417C>T (p.Ser2806Leu) rs587782785
NM_000059.3(BRCA2):c.8487+4T>C rs81002801
NM_000059.3(BRCA2):c.8487+8G>A rs81002838
NM_000059.3(BRCA2):c.8545A>G (p.Lys2849Glu) rs80359109
NM_000059.3(BRCA2):c.8573A>G (p.Gln2858Arg) rs80359114
NM_000059.3(BRCA2):c.8632+14T>C rs730881596
NM_000059.3(BRCA2):c.8632+6A>G rs81002894
NM_000059.3(BRCA2):c.8633-16C>G rs81002818
NM_000059.3(BRCA2):c.8633-19_8633-17del rs770871854
NM_000059.3(BRCA2):c.865A>G (p.Asn289Asp) rs766173
NM_000059.3(BRCA2):c.8687G>A (p.Arg2896His) rs80359128
NM_000059.3(BRCA2):c.8702G>A (p.Gly2901Asp) rs80359129
NM_000059.3(BRCA2):c.8754+1G>T rs397508006
NM_000059.3(BRCA2):c.8755-12A>G rs863224317
NM_000059.3(BRCA2):c.8755-19A>G rs398122713
NM_000059.3(BRCA2):c.8755-9T>C rs397507413
NM_000059.3(BRCA2):c.8764A>G (p.Ser2922Gly) rs80359132
NM_000059.3(BRCA2):c.8850G>A (p.Lys2950=) rs28897754
NM_000059.3(BRCA2):c.8918G>A (p.Arg2973His) rs80359143
NM_000059.3(BRCA2):c.8953+16C>T rs81002892
NM_000059.3(BRCA2):c.8991T>G (p.Tyr2997Ter) rs397508028
NM_000059.3(BRCA2):c.9076C>G (p.Gln3026Glu) rs80359159
NM_000059.3(BRCA2):c.9085G>A (p.Ala3029Thr) rs56179254
NM_000059.3(BRCA2):c.9087G>A (p.Ala3029=) rs368576266
NM_000059.3(BRCA2):c.9118-14T>C rs81002815
NM_000059.3(BRCA2):c.9118-6C>T rs81002890
NM_000059.3(BRCA2):c.9190G>A (p.Asp3064Asn) rs80359177
NM_000059.3(BRCA2):c.9234C>T (p.Val3078=) rs587782428
NM_000059.3(BRCA2):c.9253A>C (p.Thr3085Pro) rs397507423
NM_000059.3(BRCA2):c.9257-113T>G rs191553604
NM_000059.3(BRCA2):c.9257G>C (p.Gly3086Ala) rs574271678
NM_000059.3(BRCA2):c.9270C>T (p.Phe3090=) rs587780873
NM_000059.3(BRCA2):c.927A>G (p.Ser309=) rs80359806
NM_000059.3(BRCA2):c.9285C>T (p.Asp3095=) rs80359198
NM_000059.3(BRCA2):c.9302T>G (p.Leu3101Arg) rs28897758
NM_000059.3(BRCA2):c.9411T>G (p.Thr3137=) rs1799968
NM_000059.3(BRCA2):c.9433G>C (p.Val3145Leu) rs587776476
NM_000059.3(BRCA2):c.943T>A (p.Cys315Ser) rs79483201
NM_000059.3(BRCA2):c.9454G>A (p.Glu3152Lys) rs80359218
NM_000059.3(BRCA2):c.9501+4A>G rs81002848
NM_000059.3(BRCA2):c.9509A>G (p.Asp3170Gly) rs80359224
NM_000059.3(BRCA2):c.956A>C (p.Asn319Thr) rs55939572
NM_000059.3(BRCA2):c.9581C>A (p.Pro3194Gln) rs28897760
NM_000059.3(BRCA2):c.9583A>G (p.Thr3195Ala) rs80359227
NM_000059.3(BRCA2):c.9592T>C (p.Cys3198Arg) rs80359229
NM_000059.3(BRCA2):c.9605C>T (p.Pro3202Leu) rs397507432
NM_000059.3(BRCA2):c.9613_9614delinsCT (p.Ala3205Leu) rs276174926
NM_000059.3(BRCA2):c.9649-6dup rs276174929
NM_000059.3(BRCA2):c.9720T>C (p.Val3240=) rs80359810
NM_000059.3(BRCA2):c.9728C>T (p.Pro3243Leu) rs80359241
NM_000059.3(BRCA2):c.9738C>T (p.Ala3246=) rs80359811
NM_000059.3(BRCA2):c.9770A>G (p.Lys3257Arg) rs55847618
NM_000059.3(BRCA2):c.9837A>G (p.Leu3279=) rs730881598
NM_000059.3(BRCA2):c.9838C>T (p.Pro3280Ser) rs55835607
NM_000059.3(BRCA2):c.9839C>A (p.Pro3280His) rs80359246
NM_000059.3(BRCA2):c.9843A>G (p.Pro3281=) rs11571832
NM_000059.3(BRCA2):c.987G>A (p.Arg329=) rs561002197
NM_000059.3(BRCA2):c.9924C>T (p.Tyr3308=) rs4987049
NM_000059.3(BRCA2):c.9952A>C (p.Asn3318His) rs80359256
NM_000059.3(BRCA2):c.9997C>G (p.Leu3333Val) rs567476314
NM_000059.4(BRCA2):c.-15A>C rs138705202
NM_000059.4(BRCA2):c.10045A>G (p.Thr3349Ala) rs80358387
NM_000059.4(BRCA2):c.10110G>A (p.Arg3370=) rs28897762
NM_000059.4(BRCA2):c.1011C>T (p.Asn337=) rs41293473
NM_000059.4(BRCA2):c.10150C>T (p.Arg3384Ter) rs397507568
NM_000059.4(BRCA2):c.10154G>A (p.Arg3385His) rs80358398
NM_000059.4(BRCA2):c.10202C>T (p.Thr3401Met) rs55853199
NM_000059.4(BRCA2):c.10203G>A (p.Thr3401=) rs147854265
NM_000059.4(BRCA2):c.1144A>C (p.Lys382Gln) rs371454630
NM_000059.4(BRCA2):c.1151C>T (p.Ser384Phe) rs41293475
NM_000059.4(BRCA2):c.1181A>C (p.Glu394Ala) rs56016241
NM_000059.4(BRCA2):c.125A>G (p.Tyr42Cys) rs4987046
NM_000059.4(BRCA2):c.1385A>G (p.Glu462Gly) rs56403624
NM_000059.4(BRCA2):c.1395A>C (p.Val465=) rs11571641
NM_000059.4(BRCA2):c.1514T>C (p.Ile505Thr) rs28897708
NM_000059.4(BRCA2):c.1538A>G (p.Lys513Arg) rs28897709
NM_000059.4(BRCA2):c.1564G>C (p.Gly522Arg) rs80358442
NM_000059.4(BRCA2):c.162CAA[1] (p.Asn56del) rs11571587
NM_000059.4(BRCA2):c.1662T>G (p.Cys554Trp) rs80358451
NM_000059.4(BRCA2):c.1744A>C (p.Thr582Pro) rs80358457
NM_000059.4(BRCA2):c.175C>G (p.Pro59Ala) rs56091799
NM_000059.4(BRCA2):c.1773_1776del (p.Ile591fs) rs80359304
NM_000059.4(BRCA2):c.1786G>C (p.Asp596His) rs56328701
NM_000059.4(BRCA2):c.1792A>G (p.Thr598Ala) rs28897710
NM_000059.4(BRCA2):c.1798T>C (p.Tyr600His) rs75419644
NM_000059.4(BRCA2):c.179A>G (p.Asn60Ser) rs80358463
NM_000059.4(BRCA2):c.1804G>A (p.Gly602Arg) rs80358466
NM_000059.4(BRCA2):c.1909+9_1909+10del rs527732001
NM_000059.4(BRCA2):c.1938C>T (p.Ser646=) rs28897711
NM_000059.4(BRCA2):c.1964C>G (p.Pro655Arg) rs28897712
NM_000059.4(BRCA2):c.2233A>G (p.Lys745Glu) rs374691587
NM_000059.4(BRCA2):c.223G>C (p.Ala75Pro) rs28897701
NM_000059.4(BRCA2):c.2350A>G (p.Met784Val) rs11571653
NM_000059.4(BRCA2):c.2416G>C (p.Asp806His) rs56404215
NM_000059.4(BRCA2):c.2538A>C (p.Ser846=) rs11571654
NM_000059.4(BRCA2):c.2550A>G (p.Gln850=) rs80359785
NM_000059.4(BRCA2):c.2803G>A (p.Asp935Asn) rs28897716
NM_000059.4(BRCA2):c.2919G>A (p.Ser973=) rs45525041
NM_000059.4(BRCA2):c.2926_2927delinsAT (p.Ser976Ile) rs276174831
NM_000059.4(BRCA2):c.2957A>G (p.Asn986Ser) rs28897718
NM_000059.4(BRCA2):c.2971A>G (p.Asn991Asp) rs1799944
NM_000059.4(BRCA2):c.2987T>G (p.Leu996Arg) rs80358545
NM_000059.4(BRCA2):c.2999T>C (p.Ile1000Thr) rs374769365
NM_000059.4(BRCA2):c.3055C>G (p.Leu1019Val) rs55638633
NM_000059.4(BRCA2):c.3073A>G (p.Lys1025Glu) rs80358550
NM_000059.4(BRCA2):c.316+5G>A rs81002840
NM_000059.4(BRCA2):c.3225T>C (p.Ser1075=) rs779228375
NM_000059.4(BRCA2):c.322A>C (p.Asn108His) rs80358567
NM_000059.4(BRCA2):c.3256A>G (p.Ile1086Val) rs80358571
NM_000059.4(BRCA2):c.3509C>T (p.Ala1170Val) rs80358599
NM_000059.4(BRCA2):c.3515C>T (p.Ser1172Leu) rs80358600
NM_000059.4(BRCA2):c.353G>A (p.Arg118His) rs80358603
NM_000059.4(BRCA2):c.3581G>A (p.Gly1194Asp) rs28897721
NM_000059.4(BRCA2):c.3839A>T (p.Asp1280Val) rs56337919
NM_000059.4(BRCA2):c.3910A>G (p.Thr1304Ala) rs28897723
NM_000059.4(BRCA2):c.4143AGA[1] (p.Glu1382del) rs80359432
NM_000059.4(BRCA2):c.4187A>G (p.Gln1396Arg) rs55969723
NM_000059.4(BRCA2):c.4258G>T (p.Asp1420Tyr) rs28897727
NM_000059.4(BRCA2):c.430GTT[1] (p.Val145del) rs80359442
NM_000059.4(BRCA2):c.440A>G (p.Gln147Arg) rs80358674
NM_000059.4(BRCA2):c.4436G>C (p.Ser1479Thr) rs80358678
NM_000059.4(BRCA2):c.4464_4465del (p.His1488fs) rs397507720
NM_000059.4(BRCA2):c.4585G>A (p.Gly1529Arg) rs28897728
NM_000059.4(BRCA2):c.4614T>C (p.Ser1538=) rs45520945
NM_000059.4(BRCA2):c.4656T>C (p.Gly1552=) rs41293491
NM_000059.4(BRCA2):c.4670C>G (p.Thr1557Ser) rs80358698
NM_000059.4(BRCA2):c.467A>G (p.Asp156Gly) rs68071147
NM_000059.4(BRCA2):c.4850G>A (p.Ser1617Asn) rs397507341
NM_000059.4(BRCA2):c.4928T>C (p.Val1643Ala) rs28897731
NM_000059.4(BRCA2):c.5070A>C (p.Lys1690Asn) rs56087561
NM_000059.4(BRCA2):c.517G>C (p.Gly173Arg) rs397507768
NM_000059.4(BRCA2):c.5198C>T (p.Ser1733Phe) rs55639415
NM_000059.4(BRCA2):c.5199C>T (p.Ser1733=) rs28897734
NM_000059.4(BRCA2):c.5312G>A (p.Gly1771Asp) rs80358755
NM_000059.4(BRCA2):c.5612G>A (p.Ser1871Asn) rs80358782
NM_000059.4(BRCA2):c.5616_5620del (p.Lys1872fs) rs80359525
NM_000059.4(BRCA2):c.5634C>G (p.Asn1878Lys) rs80358784
NM_000059.4(BRCA2):c.5635G>A (p.Glu1879Lys) rs55996097
NM_000059.4(BRCA2):c.5640T>G (p.Asn1880Lys) rs11571657
NM_000059.4(BRCA2):c.5645C>A (p.Ser1882Ter) rs80358785
NM_000059.4(BRCA2):c.5744C>T (p.Thr1915Met) rs4987117
NM_000059.4(BRCA2):c.5752C>T (p.His1918Tyr) rs80358803
NM_000059.4(BRCA2):c.5785A>G (p.Ile1929Val) rs79538375
NM_000059.4(BRCA2):c.5813G>C (p.Gly1938Ala) rs41293499
NM_000059.4(BRCA2):c.5869A>G (p.Ile1957Val) rs80358817
NM_000059.4(BRCA2):c.5897A>G (p.His1966Arg) rs80358823
NM_000059.4(BRCA2):c.5946del (p.Ser1982fs) rs80359550
NM_000059.4(BRCA2):c.5986G>A (p.Ala1996Thr) rs80358833
NM_000059.4(BRCA2):c.6100C>T (p.Arg2034Cys) rs1799954
NM_000059.4(BRCA2):c.6131G>C (p.Gly2044Ala) rs56191579
NM_000059.4(BRCA2):c.6275_6276del rs11571658
NM_000059.4(BRCA2):c.6290C>T (p.Thr2097Met) rs80358866
NM_000059.4(BRCA2):c.6317T>C (p.Leu2106Pro) rs56172926
NM_000059.4(BRCA2):c.6322C>T (p.Arg2108Cys) rs55794205
NM_000059.4(BRCA2):c.6323G>A (p.Arg2108His) rs35029074
NM_000059.4(BRCA2):c.6513G>T (p.Val2171=) rs206076
NM_000059.4(BRCA2):c.658_659del rs80359604
NM_000059.4(BRCA2):c.6738A>G (p.Pro2246=) rs760272304
NM_000059.4(BRCA2):c.6748A>G (p.Thr2250Ala) rs80358899
NM_000059.4(BRCA2):c.68-7T>A rs81002830
NM_000059.4(BRCA2):c.6953G>A (p.Arg2318Gln) rs80358921
NM_000059.4(BRCA2):c.7057G>C (p.Gly2353Arg) rs80358935
NM_000059.4(BRCA2):c.708T>C (p.His236=) rs185506536
NM_000059.4(BRCA2):c.7150C>A (p.Gln2384Lys) rs55977008
NM_000059.4(BRCA2):c.7435+6G>A rs81002852
NM_000059.4(BRCA2):c.7436-4A>G rs81002904
NM_000059.4(BRCA2):c.7448G>A (p.Ser2483Asn) rs80358967
NM_000059.4(BRCA2):c.7463G>A (p.Arg2488Lys) rs80358968
NM_000059.4(BRCA2):c.7504C>T (p.Arg2502Cys) rs55716624
NM_000059.4(BRCA2):c.7506C>T (p.Arg2502=) rs140693106
NM_000059.4(BRCA2):c.7521A>G (p.Pro2507=) rs759383358
NM_000059.4(BRCA2):c.7544C>T (p.Thr2515Ile) rs28897744
NM_000059.4(BRCA2):c.7805+13A>G rs149769332
NM_000059.4(BRCA2):c.7868A>G (p.His2623Arg) rs80359012
NM_000059.4(BRCA2):c.7878G>C (p.Trp2626Cys) rs80359013
NM_000059.4(BRCA2):c.7879A>T (p.Ile2627Phe) rs80359014
NM_000059.4(BRCA2):c.794-11T>C rs81002822
NM_000059.4(BRCA2):c.7994A>G (p.Asp2665Gly) rs28897745
NM_000059.4(BRCA2):c.8009C>T (p.Ser2670Leu) rs80359035
NM_000059.4(BRCA2):c.8010G>A (p.Ser2670=) rs146430937
NM_000059.4(BRCA2):c.8092G>A (p.Ala2698Thr) rs80359052
NM_000059.4(BRCA2):c.8149G>T (p.Ala2717Ser) rs28897747
NM_000059.4(BRCA2):c.8182G>A (p.Val2728Ile) rs28897749
NM_000059.4(BRCA2):c.8243G>A (p.Gly2748Asp) rs80359071
NM_000059.4(BRCA2):c.825A>T (p.Lys275Asn) rs397507399
NM_000059.4(BRCA2):c.831T>G (p.Asn277Lys) rs28897705
NM_000059.4(BRCA2):c.8377G>A (p.Gly2793Arg) rs80359082
NM_000059.4(BRCA2):c.8488-1G>A rs397507404
NM_000059.4(BRCA2):c.8503T>C (p.Ser2835Pro) rs11571746
NM_000059.4(BRCA2):c.8525G>A (p.Arg2842His) rs80359105
NM_000059.4(BRCA2):c.8567A>C (p.Glu2856Ala) rs11571747
NM_000059.4(BRCA2):c.865A>C (p.Asn289His) rs766173
NM_000059.4(BRCA2):c.8830A>T (p.Ile2944Phe) rs4987047
NM_000059.4(BRCA2):c.8850G>T (p.Lys2950Asn) rs28897754
NM_000059.4(BRCA2):c.8851G>A (p.Ala2951Thr) rs11571769
NM_000059.4(BRCA2):c.8917C>T (p.Arg2973Cys) rs45469092
NM_000059.4(BRCA2):c.8941G>A (p.Glu2981Lys) rs139052578
NM_000059.4(BRCA2):c.8972G>A (p.Arg2991His) rs80359150
NM_000059.4(BRCA2):c.9155G>A (p.Arg3052Gln) rs80359171
NM_000059.4(BRCA2):c.9242T>C (p.Val3081Ala) rs80359189
NM_000059.4(BRCA2):c.9271G>A (p.Val3091Ile) rs80359194
NM_000059.4(BRCA2):c.9285C>G (p.Asp3095Glu) rs80359198
NM_000059.4(BRCA2):c.9292T>C (p.Tyr3098His) rs41293521
NM_000059.4(BRCA2):c.9458G>C (p.Gly3153Ala) rs80359220
NM_000059.4(BRCA2):c.9501+3A>T rs61757642
NM_000059.4(BRCA2):c.9502-12T>G rs81002803
NM_000059.4(BRCA2):c.956A>G (p.Asn319Ser) rs55939572
NM_000059.4(BRCA2):c.9586A>G (p.Lys3196Glu) rs80359228
NM_000059.4(BRCA2):c.964A>C (p.Lys322Gln) rs11571640
NM_000059.4(BRCA2):c.9699_9702del rs80359775
NM_000059.4(BRCA2):c.9875C>T (p.Pro3292Leu) rs56121817
NM_000059.4(BRCA2):c.9925G>T (p.Glu3309Ter) rs80359251
NM_000059.4(BRCA2):c.9986A>G (p.Asn3329Ser) rs76635144
NM_000062.2(SERPING1):c.550G>A (p.Gly184Arg) rs281875170
NM_000062.2(SERPING1):c.849C>T (p.Ser283=) rs143760635
NM_000065.4(C6):c.2381+2T>C rs76202909
NM_000069.3(CACNA1S):c.1452C>T (p.Tyr484=) rs144206959
NM_000069.3(CACNA1S):c.1670G>A (p.Arg557His) rs4915212
NM_000069.3(CACNA1S):c.1711G>A (p.Val571Ile) rs114191482
NM_000069.3(CACNA1S):c.1817G>A (p.Ser606Asn) rs142356235
NM_000069.3(CACNA1S):c.2099C>T (p.Thr700Met) rs147112322
NM_000069.3(CACNA1S):c.2361-13C>T rs2182117
NM_000069.3(CACNA1S):c.2439C>T (p.Ser813=) rs376863448
NM_000069.3(CACNA1S):c.2440G>A (p.Ala814Thr) rs139956524
NM_000069.3(CACNA1S):c.2745+14C>T rs74138824
NM_000069.3(CACNA1S):c.345C>T (p.Asp115=) rs144218745
NM_000069.3(CACNA1S):c.3628G>A (p.Gly1210Arg) rs148870919
NM_000069.3(CACNA1S):c.3795+3G>A rs191758096
NM_000069.3(CACNA1S):c.383C>G (p.Thr128Ser) rs139491817
NM_000069.3(CACNA1S):c.394C>A (p.Leu132Met) rs377030324
NM_000069.3(CACNA1S):c.3953+7G>A rs141071505
NM_000069.3(CACNA1S):c.398+3G>A rs764710968
NM_000069.3(CACNA1S):c.4060A>T (p.Thr1354Ser) rs145910245
NM_000069.3(CACNA1S):c.4668+19T>C rs140742077
NM_000069.3(CACNA1S):c.5048+8C>T rs759622507
NM_000069.3(CACNA1S):c.5490_5497del (p.Leu1832fs) rs554596425
NM_000069.3(CACNA1S):c.773G>A (p.Gly258Asp) rs35534614
NM_000069.3(CACNA1S):c.895T>C (p.Tyr299His) rs35856559
NM_000070.3(CAPN3):c.-104G>C rs149698681
NM_000070.3(CAPN3):c.1017G>A (p.Thr339=) rs141934227
NM_000070.3(CAPN3):c.1029+3A>G rs28364442
NM_000070.3(CAPN3):c.1070G>A (p.Arg357Gln) rs988027905
NM_000070.3(CAPN3):c.1303G>A (p.Glu435Lys) rs149914792
NM_000070.3(CAPN3):c.1355-6G>A rs28364485
NM_000070.3(CAPN3):c.1505T>C (p.Ile502Thr) rs148044781
NM_000070.3(CAPN3):c.1668C>T (p.Ile556=) rs199884116
NM_000070.3(CAPN3):c.1746-20C>G rs201892814
NM_000070.3(CAPN3):c.1830C>T (p.Asn610=) rs202019404
NM_000070.3(CAPN3):c.2148G>T (p.Glu716Asp) rs770894443
NM_000070.3(CAPN3):c.2235C>T (p.Tyr745=) rs147774793
NM_000070.3(CAPN3):c.2264-11C>T rs28364537
NM_000070.3(CAPN3):c.2332G>A (p.Asp778Asn) rs115311625
NM_000070.3(CAPN3):c.2380+12del rs28364538
NM_000070.3(CAPN3):c.2381-12A>G rs73402734
NM_000070.3(CAPN3):c.2433T>C (p.Val811=) rs28364543
NM_000070.3(CAPN3):c.245C>T (p.Pro82Leu) rs886042478
NM_000070.3(CAPN3):c.318C>T (p.Cys106=) rs117609395
NM_000070.3(CAPN3):c.319G>A (p.Glu107Lys) rs1801505
NM_000070.3(CAPN3):c.338T>C (p.Ile113Thr) rs747026964
NM_000070.3(CAPN3):c.479C>G (p.Ala160Gly) rs17592
NM_000070.3(CAPN3):c.495C>T (p.Phe165=) rs1801324
NM_000070.3(CAPN3):c.525C>T (p.Asp175=) rs144383442
NM_000070.3(CAPN3):c.551C>T (p.Thr184Met) rs35889956
NM_000070.3(CAPN3):c.552G>A (p.Thr184=) rs147808529
NM_000070.3(CAPN3):c.606T>C (p.Ser202=) rs17593
NM_000070.3(CAPN3):c.62G>A (p.Gly21Glu) rs28364364
NM_000070.3(CAPN3):c.78G>A (p.Pro26=) rs62642519
NM_000070.3(CAPN3):c.930T>C (p.Asp310=) rs150356488
NM_000070.3(CAPN3):c.939G>A (p.Pro313=) rs78369269
NM_000070.3(CAPN3):c.956C>T (p.Pro319Leu) rs121434547
NM_000070.3(CAPN3):c.96T>C (p.Thr32=) rs1801496
NM_000070.3(CAPN3):c.984C>T (p.Cys328=) rs28364441
NM_000071.2(CBS):c.1059G>A (p.Thr353=) rs61735859
NM_000071.2(CBS):c.1257G>A (p.Leu419=) rs138432416
NM_000071.2(CBS):c.1266G>A (p.Pro422=) rs150146702
NM_000071.2(CBS):c.1280C>T (p.Pro427Leu) rs863223434
NM_000071.2(CBS):c.146C>T (p.Pro49Leu) rs148865119
NM_000071.2(CBS):c.1479G>A (p.Thr493=) rs143225442
NM_000071.2(CBS):c.1539C>T (p.His513=) rs187828882
NM_000071.2(CBS):c.1632C>T (p.Ala544=) rs566810122
NM_000071.2(CBS):c.215A>T (p.Lys72Ile) rs192232907
NM_000071.2(CBS):c.502G>A (p.Val168Met) rs121964970
NM_000071.2(CBS):c.52C>T (p.Arg18Cys) rs201827340
NM_000071.2(CBS):c.536_553del (p.Asp179_Leu184del) rs794727835
NM_000071.2(CBS):c.675C>T (p.Asn225=) rs145303290
NM_000071.2(CBS):c.829-91G>A rs150181241
NM_000071.2(CBS):c.939G>A (p.Thr313=) rs2228298
NM_000071.3(CBS):c.1080C>T (p.Ala360=) rs1801181
NM_000071.3(CBS):c.531+11G>A rs186114513
NM_000071.3(CBS):c.573G>A (p.Thr191=) rs73906420
NM_000075.4(CDK4):c.122A>G (p.Asn41Ser) rs144890720
NM_000075.4(CDK4):c.306A>G (p.Thr102=) rs201202764
NM_000075.4(CDK4):c.549C>T (p.Pro183=) rs778696237
NM_000075.4(CDK4):c.625C>T (p.Arg209Cys) rs140644696
NM_000075.4(CDK4):c.660C>T (p.Ala220=) rs773490152
NM_000075.4(CDK4):c.661G>A (p.Asp221Asn) rs587778187
NM_000075.4(CDK4):c.684-4A>T rs370609910
NM_000075.4(CDK4):c.762C>T (p.Pro254=) rs753908111
NM_000075.4(CDK4):c.764G>A (p.Arg255His) rs144657355
NM_000075.4(CDK4):c.776C>T (p.Ser259Leu) rs201617914
NM_000075.4(CDK4):c.777G>A (p.Ser259=) rs3211622
NM_000075.4(CDK4):c.834T>C (p.Phe278=) rs115576923
NM_000077.4(CDKN2A):c.*6C>G rs375628411
NM_000077.4(CDKN2A):c.-19413C>G rs528789830
NM_000077.4(CDKN2A):c.-25C>T rs144481587
NM_000077.4(CDKN2A):c.-2G>A rs191394143
NM_000077.4(CDKN2A):c.-34G>C rs1800586
NM_000077.4(CDKN2A):c.146T>C (p.Ile49Thr) rs199907548
NM_000077.4(CDKN2A):c.150+12G>A rs1057520264
NM_000077.4(CDKN2A):c.150+37G>C rs45456595
NM_000077.4(CDKN2A):c.170C>T (p.Ala57Val) rs372266620
NM_000077.4(CDKN2A):c.174A>C (p.Arg58=) rs201208890
NM_000077.4(CDKN2A):c.197A>G (p.His66Arg) rs756750256
NM_000077.4(CDKN2A):c.210C>T (p.Pro70=) rs864622570
NM_000077.4(CDKN2A):c.219C>G (p.Ala73=) rs730881679
NM_000077.4(CDKN2A):c.246G>C (p.Val82=) rs1060504181
NM_000077.4(CDKN2A):c.251A>C (p.Asp84Ala) rs587782792
NM_000077.4(CDKN2A):c.261G>A (p.Arg87=) rs546300971
NM_000077.4(CDKN2A):c.266G>A (p.Gly89Asp) rs137854599
NM_000077.4(CDKN2A):c.273G>A (p.Leu91=) rs4987127
NM_000077.4(CDKN2A):c.282G>A (p.Leu94=) rs1064793589
NM_000077.4(CDKN2A):c.298G>T (p.Ala100Ser) rs200863613
NM_000077.4(CDKN2A):c.318G>A (p.Val106=) rs199888003
NM_000077.4(CDKN2A):c.335_337dup (p.Arg112dup) rs768966657
NM_000077.4(CDKN2A):c.342C>G (p.Pro114=) rs878853648
NM_000077.4(CDKN2A):c.369T>A (p.His123Gln) rs6413463
NM_000077.4(CDKN2A):c.373G>C (p.Asp125His) rs146179135
NM_000077.4(CDKN2A):c.379G>T (p.Ala127Ser) rs6413464
NM_000077.4(CDKN2A):c.405G>A (p.Gly135=) rs751586391
NM_000077.4(CDKN2A):c.430C>T (p.Arg144Cys) rs116150891
NM_000077.4(CDKN2A):c.442G>A (p.Ala148Thr) rs3731249
NM_000077.4(CDKN2A):c.45G>T (p.Trp15Cys) rs138677674
NM_000077.4(CDKN2A):c.51C>A (p.Ala17=) rs764362225
NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[1] (p.Ala4_Pro11del) rs587780668
NM_000077.5(CDKN2A):c.307_308del (p.Arg103fs) rs886041162
NM_000080.4(CHRNE):c.1033-6C>T rs2075763
NM_000080.4(CHRNE):c.103T>C (p.Tyr35His) rs144169073
NM_000080.4(CHRNE):c.1220-45C>T rs75492003
NM_000080.4(CHRNE):c.1480_*48delinsC (p.Ter494LeuextTer?) rs1555546038
NM_000080.4(CHRNE):c.45C>T (p.Leu15=) rs34563587
NM_000080.4(CHRNE):c.488C>T (p.Ser163Leu) rs121909516
NM_000080.4(CHRNE):c.519C>T (p.Ala173=) rs33970119
NM_000082.4(ERCC8):c.839C>A rs61754098
NM_000083.3(CLCN1):c.1231G>T (p.Gly411Cys) rs756199349
NM_000083.3(CLCN1):c.1392C>T (p.Phe464=) rs201919331
NM_000083.3(CLCN1):c.1655A>G (p.Gln552Arg) rs80356696
NM_000083.3(CLCN1):c.1842G>C (p.Lys614Asn) rs140205115
NM_000083.3(CLCN1):c.2230C>A (p.Pro744Thr) rs149316679
NM_000083.3(CLCN1):c.2284+5C>T rs74824159
NM_000083.3(CLCN1):c.2364+10G>A rs201855153
NM_000083.3(CLCN1):c.2680C>T (p.Arg894Ter) rs55960271
NM_000083.3(CLCN1):c.2831dup (p.Gly945fs) rs755176513
NM_000083.3(CLCN1):c.501C>G (p.Phe167Leu) rs149729531
NM_000083.3(CLCN1):c.568_569delinsTC (p.Gly190Ser) rs797045032
NM_000083.3(CLCN1):c.651C>T (p.Val217=) rs144109732
NM_000083.3(CLCN1):c.803C>T (p.Thr268Met) rs80356687
NM_000083.3(CLCN1):c.86A>C (p.His29Pro) rs146160029
NM_000083.3(CLCN1):c.895G>C (p.Val299Leu) rs202179484
NM_000083.3(CLCN1):c.899G>A (p.Arg300Gln) rs118066140
NM_000085.4(CLCNKB):c.577-5C>T rs1889788
NM_000086.2(CLN3):c.1210C>A (p.His404Asn) rs146610181
NM_000086.2(CLN3):c.1211A>G (p.His404Arg) rs77595156
NM_000086.2(CLN3):c.1230G>A (p.Ala410=) rs201206239
NM_000086.2(CLN3):c.125+3G>A rs775577824
NM_000086.2(CLN3):c.174C>T (p.Ala58=) rs138433617
NM_000086.2(CLN3):c.240G>A (p.Thr80=) rs373911322
NM_000086.2(CLN3):c.264A>C (p.Ser88=) rs751321507
NM_000086.2(CLN3):c.313A>G (p.Ile105Val) rs11552531
NM_000086.2(CLN3):c.318C>T (p.Leu106=) rs148248159
NM_000086.2(CLN3):c.418G>A (p.Val140Ile) rs373034150
NM_000086.2(CLN3):c.537C>G (p.Ala179=) rs147667964
NM_000086.2(CLN3):c.677+8G>A rs368568189
NM_000086.2(CLN3):c.768C>T (p.Thr256=) rs145967477
NM_000086.2(CLN3):c.790+3A>C rs386833738
NM_000086.2(CLN3):c.831G>A (p.Val277=) rs1142183
NM_000088.3(COL1A1):c.1002+10G>T rs368316440
NM_000088.3(COL1A1):c.1638C>T (p.Ser546=) rs146450504
NM_000088.3(COL1A1):c.1873G>A (p.Ala625Thr) rs149561221
NM_000088.3(COL1A1):c.1983+9G>C rs201091992
NM_000088.3(COL1A1):c.1983+9G>T rs201091992
NM_000088.3(COL1A1):c.1984-5C>A rs66592376
NM_000088.3(COL1A1):c.2115C>T (p.Asn705=) rs41316673
NM_000088.3(COL1A1):c.2236-17C>G rs193922146
NM_000088.3(COL1A1):c.2613+13C>T rs368380161
NM_000088.3(COL1A1):c.2668-12A>G rs200355573
NM_000088.3(COL1A1):c.2838T>G (p.Pro946=) rs1555572418
NM_000088.3(COL1A1):c.299-15C>T rs199523510
NM_000088.3(COL1A1):c.299-9G>T rs373041336
NM_000088.3(COL1A1):c.3099+7T>C rs201682029
NM_000088.3(COL1A1):c.3123C>T (p.Pro1041=) rs145608939
NM_000088.3(COL1A1):c.334-5C>A rs115997082
NM_000088.3(COL1A1):c.3479G>A (p.Gly1160Asp) rs886039726
NM_000088.3(COL1A1):c.3978C>T (p.Phe1326=) rs200145743
NM_000088.3(COL1A1):c.3993C>T (p.Thr1331=) rs148659814
NM_000088.3(COL1A1):c.4018G>A (p.Gly1340Ser) rs147936946
NM_000088.3(COL1A1):c.627C>T (p.Gly209=) rs201136122
NM_000088.3(COL1A1):c.904-9G>T rs141726413
NM_000089.3(COL1A2):c.1036-12A>G rs41316929
NM_000089.3(COL1A2):c.122G>A (p.Arg41His) rs139528613
NM_000089.3(COL1A2):c.1866T>C (p.Gly622=) rs765470622
NM_000089.3(COL1A2):c.2349+16G>C rs112603291
NM_000089.3(COL1A2):c.2400C>T (p.Pro800=) rs139913150
NM_000089.3(COL1A2):c.2904C>T (p.Pro968=) rs142352627
NM_000089.3(COL1A2):c.2944-4A>T rs143220941
NM_000089.3(COL1A2):c.304C>T (p.Pro102Ser) rs189557655
NM_000089.3(COL1A2):c.3139G>A (p.Val1047Met) rs35820023
NM_000089.3(COL1A2):c.3313G>A (p.Gly1105Ser) rs139851311
NM_000089.3(COL1A2):c.3585T>C (p.Cys1195=) rs1800253
NM_000089.3(COL1A2):c.3613C>T (p.Arg1205Trp) rs150124840
NM_000089.3(COL1A2):c.3853A>C (p.Asn1285His) rs144797861
NM_000089.3(COL1A2):c.595-20C>T rs192022673
NM_000089.3(COL1A2):c.70+719_70+720del rs201691876
NM_000089.3(COL1A2):c.948C>T (p.Gly316=) rs34511999
NM_000089.3(COL1A2):c.96+10C>T rs185341110
NM_000089.4(COL1A2):c.594+5A>T rs200744314
NM_000090.3(COL3A1):c.1024G>A (p.Gly342Arg) rs794728040
NM_000090.3(COL3A1):c.114C>G (p.Ser38=) rs141241764
NM_000090.3(COL3A1):c.1188C>T (p.Gly396=) rs745743884
NM_000090.3(COL3A1):c.130G>A (p.Val44Ile) rs79632685
NM_000090.3(COL3A1):c.1424C>T (p.Ala475Val) rs770168441
NM_000090.3(COL3A1):c.1461C>T (p.Ala487=) rs747522483
NM_000090.3(COL3A1):c.1476A>C (p.Gly492=) rs111683983
NM_000090.3(COL3A1):c.1617C>T (p.Pro539=) rs141091206
NM_000090.3(COL3A1):c.1744G>A (p.Gly582Ser) rs121912923
NM_000090.3(COL3A1):c.1804C>A (p.Pro602Thr) rs35795890
NM_000090.3(COL3A1):c.1815+5G>A rs146652498
NM_000090.3(COL3A1):c.1927T>C (p.Leu643=) rs41263757
NM_000090.3(COL3A1):c.2002C>T (p.Pro668Ser) rs1801183
NM_000090.3(COL3A1):c.2035G>A (p.Ala679Thr) rs41263773
NM_000090.3(COL3A1):c.2056C>G (p.Pro686Ala) rs41263775
NM_000090.3(COL3A1):c.2445+19A>G rs776819930
NM_000090.3(COL3A1):c.2445T>G (p.Pro815=) rs199727625
NM_000090.3(COL3A1):c.2498A>G (p.Lys833Arg) rs371344739
NM_000090.3(COL3A1):c.2550T>C (p.Pro850=) rs794727586
NM_000090.3(COL3A1):c.2607T>A (p.Pro869=) rs376643618
NM_000090.3(COL3A1):c.2805T>C (p.Pro935=) rs111567071
NM_000090.3(COL3A1):c.3019G>A (p.Ala1007Thr) rs201220788
NM_000090.3(COL3A1):c.3228C>T (p.Pro1076=) rs200917999
NM_000090.3(COL3A1):c.3642C>A (p.Gly1214=) rs184402915
NM_000090.3(COL3A1):c.3818A>G (p.Lys1273Arg) rs144614075
NM_000090.3(COL3A1):c.4011+34A>G rs41265549
NM_000090.3(COL3A1):c.4021G>A (p.Gly1341Ser) rs140646380
NM_000090.3(COL3A1):c.4086C>T (p.Ser1362=) rs779774302
NM_000090.3(COL3A1):c.560C>T (p.Thr187Ile) rs371583734
NM_000090.3(COL3A1):c.674G>C (p.Gly225Ala) rs587779533
NM_000090.3(COL3A1):c.745-7T>C rs776306752
NM_000090.3(COL3A1):c.812G>A (p.Arg271Gln) rs112185887
NM_000090.3(COL3A1):c.873C>T (p.Gly291=) rs138569287
NM_000090.4(COL3A1):c.1051-13G>A rs371934572
NM_000090.4(COL3A1):c.2002C>A (p.Pro668Thr) rs1801183
NM_000090.4(COL3A1):c.3133G>A (p.Ala1045Thr) rs149722210
NM_000090.4(COL3A1):c.3938A>G (p.Lys1313Arg) rs111840783
NM_000091.4(COL4A3):c.1184G>A (p.Gly395Glu) rs1131691738
NM_000091.4(COL4A3):c.222G>T (p.Pro74=) rs187950806
NM_000091.4(COL4A3):c.2501A>G (p.Lys834Arg) rs56226424
NM_000091.4(COL4A3):c.3031C>T (p.Arg1011Cys) rs73996408
NM_000091.4(COL4A3):c.3325C>T (p.Pro1109Ser) rs55816283
NM_000091.4(COL4A3):c.346C>A (p.Pro116Thr) rs115324397
NM_000091.4(COL4A3):c.3566-10T>C rs114719458
NM_000091.4(COL4A3):c.3566-9T>C rs147886850
NM_000091.4(COL4A3):c.3627G>A (p.Met1209Ile) rs200562865
NM_000091.4(COL4A3):c.3643C>T (p.Arg1215Ter) rs368434069
NM_000091.4(COL4A3):c.4421T>C (p.Leu1474Pro) rs200302125
NM_000091.4(COL4A3):c.4665G>A (p.Ala1555=) rs200858199
NM_000091.4(COL4A3):c.4707A>T (p.Pro1569=) rs113401495
NM_000091.4(COL4A3):c.4825C>A (p.Arg1609=) rs756231749
NM_000091.4(COL4A3):c.4893C>T (p.Phe1631=) rs183218622
NM_000091.5(COL4A3):c.1886C>T rs139361545
NM_000091.5(COL4A3):c.3258G>A (p.Gly1086=) rs147085074
NM_000091.5(COL4A3):c.4484A>G (p.Gln1495Arg) rs77964815
NM_000092.4(COL4A4):c.1353C>T (p.Gly451=) rs199511948
NM_000092.4(COL4A4):c.1781A>G (p.Glu594Gly) rs35998949
NM_000092.4(COL4A4):c.193-9C>G rs190570269
NM_000092.4(COL4A4):c.195T>C (p.Gly65=) rs201278620
NM_000092.4(COL4A4):c.198A>G (p.Pro66=) rs147947155
NM_000092.4(COL4A4):c.2367A>T (p.Gly789=) rs56247709
NM_000092.4(COL4A4):c.2420del (p.Gly807fs) rs786205640
NM_000092.4(COL4A4):c.2630G>A (p.Arg877Gln) rs150979437
NM_000092.4(COL4A4):c.2717-5A>T rs1800519
NM_000092.4(COL4A4):c.2907A>C (p.Ser969=) rs116354015
NM_000092.4(COL4A4):c.4082-8C>T rs139571413
NM_000092.4(COL4A4):c.4185G>A (p.Gly1395=) rs55978207
NM_000092.4(COL4A4):c.4195A>T (p.Met1399Leu) rs149117087
NM_000092.4(COL4A4):c.4760C>G (p.Pro1587Arg) rs190148408
NM_000092.4(COL4A4):c.5016A>G (p.Glu1672=) rs34761049
NM_000092.4(COL4A4):c.50A>G (p.Lys17Arg) rs114969026
NM_000092.4(COL4A4):c.675dup (p.Gly226fs) rs1553688335
NM_000092.4(COL4A4):c.81_86del (p.27_28IL[1]) rs771943519
NM_000092.5(COL4A4):c.2996G>A (p.Gly999Glu) rs13027659
NM_000092.5(COL4A4):c.3963T>C (p.Asp1321=) rs116124529
NM_000092.5(COL4A4):c.3979G>A (p.Val1327Met) rs2229813
NM_000093.5(COL5A1):c.1390-18CT[3] rs863223441
NM_000093.5(COL5A1):c.1588G>A (p.Gly530Ser) rs61735045
NM_000093.5(COL5A1):c.67CTG[7] (p.Leu28dup) rs773994971
NM_000094.3(COL7A1):c.3942dup (p.Asn1315fs) rs747912732
NM_000094.3(COL7A1):c.4373C>T (p.Pro1458Leu) rs79378857
NM_000094.3(COL7A1):c.5173G>A (p.Gly1725Arg) rs772195825
NM_000094.3(COL7A1):c.5532+1G>A rs767182886
NM_000094.3(COL7A1):c.5819C>T (p.Pro1940Leu) rs149267939
NM_000094.3(COL7A1):c.5910C>T (p.Phe1970=) rs141290741
NM_000094.3(COL7A1):c.6005G>A (p.Arg2002His) rs768326843
NM_000094.3(COL7A1):c.6262G>A (p.Gly2088Arg) rs573432153
NM_000094.3(COL7A1):c.6696C>A (p.Pro2232=) rs61729223
NM_000094.3(COL7A1):c.8530C>T (p.Arg2844Trp) rs138002006
NM_000094.4(COL7A1):c.7864C>T rs139318843
NM_000095.3(COMP):c.1502G>A (p.Gly501Asp) rs1555791425
NM_000097.7(CPOX):c.1210A>G (p.Lys404Glu) rs121917868
NM_000097.7(CPOX):c.995G>A (p.Arg332Gln) rs781627991
NM_000098.3(CPT2):c.1342T>C (p.Phe448Leu) rs74315297
NM_000098.3(CPT2):c.1422C>A (p.Ala474=) rs192779168
NM_000098.3(CPT2):c.371G>C (p.Arg124Pro) rs1131691925
NM_000098.3(CPT2):c.534_558delinsT (p.Leu178_Ile186delinsPhe) rs515726173
NM_000100.3(CSTB):c.*7C>G rs201576714
NM_000100.3(CSTB):c.121G>A (p.Val41Met) rs143153487
NM_000100.3(CSTB):c.15G>T (p.Ala5=) rs4533
NM_000100.3(CSTB):c.67-3T>C rs6383
NM_000101.4(CYBA):c.403G>A (p.Glu135Lys) rs114610092
NM_000101.4(CYBA):c.524CGG[3] (p.Ala176dup) rs760275837
NM_000102.4(CYP17A1):c.715C>T (p.Arg239Ter) rs104894136
NM_000103.4(CYP19A1):c.109T>C (p.Leu37=) rs58282176
NM_000103.4(CYP19A1):c.42C>G (p.Thr14=) rs61203654
NM_000104.3(CYP1B1):c.1103G>A (p.Arg368His) rs79204362
NM_000104.3(CYP1B1):c.241T>A (p.Tyr81Asn) rs9282671
NM_000106.5(CYP2D6):c.*264G>A (p.Gly169Arg) rs5030865
NM_000106.5(CYP2D6):c.124G>A (p.Gly42Arg) rs5030862
NM_000106.5(CYP2D6):c.505G>T (p.Gly169Ter) rs5030865
NM_000106.5(CYP2D6):c.775delA (p.Arg259Glyfs) rs35742686
NM_000106.5(CYP2D6):c.841_843delAAG (p.Lys281del) rs5030656
NM_000106.5(CYP2D6):c.971A>C (p.His324Pro) rs5030867
NM_000106.6(CYP2D6):c.1012G>A (p.Val338Met) rs59421388
NM_000106.6(CYP2D6):c.1457= (p.Ser486=) rs1135840
NM_000106.6(CYP2D6):c.1457G>C (p.Ser486Thr) rs1135840
NM_000106.6(CYP2D6):c.31G>A (p.Val11Met) rs769258
NM_000106.6(CYP2D6):c.709G>T (p.Ala237Ser) rs28371717
NM_000106.6(CYP2D6):c.886= (p.Arg296=) rs16947
NM_000108.5(DLD):c.249T>C (p.Val83=) rs2228664
NM_000108.5(DLD):c.34G>A (p.Ala12Thr) rs75077312
NM_000108.5(DLD):c.439-7T>C rs10263341
NM_000108.5(DLD):c.543A>T (p.Ile181=) rs61749952
NM_000108.5(DLD):c.777A>G (p.Lys259=) rs1065762
NM_000109.4(DMD):c.1294G>A (p.Glu432Lys) rs189143447
NM_000109.4(DMD):c.1700T>C (p.Leu567Pro) rs370644567
NM_000109.4(DMD):c.7+127911dup rs398123823
NM_000109.4(DMD):c.7547G>A (p.Arg2516His) rs151244052
NM_000110.4(DPYD):c.1601G>A (p.Ser534Asn) rs1801158
NM_000110.4(DPYD):c.1679T>G (p.Ile560Ser) rs55886062
NM_000110.4(DPYD):c.1905+1G>A rs3918290
NM_000111.2(SLC26A3):c.357C>A (p.Phe119Leu) rs73419912
NM_000112.3(SLC26A2):c.2087A>G (p.Asn696Ser) rs34351171
NM_000112.3(SLC26A2):c.987T>C (p.Leu329=) rs116302615
NM_000113.3(TOR1A):c.613T>A (p.Phe205Ile) rs267607134
NM_000116.5(TAFAZZIN):c.331C>T (p.His111Tyr) rs200405157
NM_000116.5(TAFAZZIN):c.634C>T (p.Leu212=) rs587781186
NM_000117.2(EMD):c.12C>T (p.Tyr4=) rs782011714
NM_000117.2(EMD):c.171C>T (p.Ser57=) rs900267221
NM_000117.2(EMD):c.428C>T (p.Ser143Phe) rs139983160
NM_000117.2(EMD):c.445G>C (p.Asp149His) rs2070818
NM_000117.2(EMD):c.466G>C (p.Gly156Arg) rs144594695
NM_000117.2(EMD):c.525C>T (p.Ser175=) rs782367505
NM_000117.2(EMD):c.537G>A (p.Leu179=) rs368661339
NM_000117.2(EMD):c.60del (p.Asn20fs) rs886041854
NM_000117.2(EMD):c.662G>T (p.Arg221Leu) rs782057378
NM_000117.3(EMD):c.144C>T (p.Leu48=) rs200537612
NM_000117.3(EMD):c.272A>G (p.Asn91Ser) rs137977232
NM_000117.3(EMD):c.396C>T (p.His132=) rs145985318
NM_000117.3(EMD):c.400-9C>T rs782061626
NM_000117.3(EMD):c.646G>A (p.Gly216Arg) rs147920229
NM_000118.3(ENG):c.1455G>A (p.Glu485=) rs150456852
NM_000118.3(ENG):c.1586G>A (p.Arg529His) rs863223538
NM_000124.4(ERCC6):c.1996C>T (p.Arg666Cys) rs61760163
NM_000124.4(ERCC6):c.2096C>T (p.Thr699Met) rs55698015
NM_000124.4(ERCC6):c.3122A>C (p.Gln1041Pro) rs139007661
NM_000124.4(ERCC6):c.3650T>G (p.Phe1217Cys) rs61760166
NM_000124.4(ERCC6):c.4393G>A (p.Val1465Ile) rs201813523
NM_000126.4(ETFA):c.186+7A>G rs184587113
NM_000126.4(ETFA):c.2T>C (p.Met1Thr) rs727503918
NM_000126.4(ETFA):c.533C>G (p.Thr178Arg) rs140169311
NM_000126.4(ETFA):c.6C>T (p.Phe2=) rs749929239
NM_000127.3(EXT1):c.1018C>T rs119103290
NM_000128.3(F11):c.400C>T (p.Gln134Ter) rs756908183
NM_000130.4(F5):c.1601G>A (p.Arg534Gln) rs6025
NM_000130.5(F5):c.1601= (p.Arg534=) rs6025
NM_000132.3(F8):c.599A>G (p.Glu200Gly) rs782158761
NM_000135.4(FANCA):c.1874G>C (p.Cys625Ser) rs139235751
NM_000135.4(FANCA):c.2574C>G (p.Ser858Arg) rs17233141
NM_000135.4(FANCA):c.3391A>G (p.Thr1131Ala) rs574034197
NM_000136.3(FANCC):c.*7C>T rs372511678
NM_000136.3(FANCC):c.-155A>C rs549658720
NM_000136.3(FANCC):c.1069C>T (p.Gln357Ter) rs759900071
NM_000136.3(FANCC):c.1156T>C (p.Ser386Pro) rs41281202
NM_000136.3(FANCC):c.1162G>T (p.Gly388Ter) rs371897078
NM_000136.3(FANCC):c.1394A>G (p.Gln465Arg) rs1800368
NM_000136.3(FANCC):c.1407G>A (p.Thr469=) rs79722116
NM_000136.3(FANCC):c.1414G>A (p.Gly472Arg) rs201063698
NM_000136.3(FANCC):c.1485G>A (p.Leu495=) rs56082100
NM_000136.3(FANCC):c.1534-5del rs748342368
NM_000136.3(FANCC):c.178G>A (p.Val60Ile) rs138629441
NM_000136.3(FANCC):c.345+4AG[2] rs755657969
NM_000136.3(FANCC):c.416G>A (p.Gly139Glu) rs1800362
NM_000136.3(FANCC):c.584A>T (p.Asp195Val) rs1800365
NM_000136.3(FANCC):c.632C>G (p.Pro211Arg) rs140781259
NM_000136.3(FANCC):c.672C>T (p.Asn224=) rs150647141
NM_000136.3(FANCC):c.705C>T (p.Pro235=) rs141828876
NM_000136.3(FANCC):c.77C>T (p.Ser26Phe) rs1800361
NM_000136.3(FANCC):c.816C>T (p.Ile272=) rs55719336
NM_000136.3(FANCC):c.934A>G (p.Ile312Val) rs1800366
NM_000136.3(FANCC):c.973G>A (p.Ala325Thr) rs201407189
NM_000137.3(FAH):c.1259G>A (p.Ter420=) rs61747586
NM_000137.3(FAH):c.243G>A (p.Ala81=) rs36122289
NM_000137.3(FAH):c.553+10C>T rs201051426
NM_000137.3(FAH):c.870C>T (p.Asp290=) rs377480457
NM_000137.4(FAH):c.1062+5G>A rs80338901
NM_000138.4(FBN1):c.1027G>A (p.Gly343Arg) rs146726731
NM_000138.4(FBN1):c.1090C>T (p.Arg364Ter) rs794728165
NM_000138.4(FBN1):c.1323A>G (p.Pro441=) rs202030761
NM_000138.4(FBN1):c.1530G>T (p.Ser510=) rs147511977
NM_000138.4(FBN1):c.1817C>A (p.Ser606Ter) rs794728176
NM_000138.4(FBN1):c.1960+30G>A rs25459
NM_000138.4(FBN1):c.1961-14T>C rs373918202
NM_000138.4(FBN1):c.2243G>A (p.Cys748Tyr) rs1064794282
NM_000138.4(FBN1):c.2581C>T (p.Arg861Ter) rs140583
NM_000138.4(FBN1):c.2639G>A (p.Gly880Asp) rs886038953
NM_000138.4(FBN1):c.266G>A (p.Cys89Tyr) rs112660651
NM_000138.4(FBN1):c.2678-3C>G rs747274959
NM_000138.4(FBN1):c.2746G>A (p.Val916Met) rs373644734
NM_000138.4(FBN1):c.287G>C (p.Arg96Thr) rs794728291
NM_000138.4(FBN1):c.2892C>T (p.Asp964=) rs116945525
NM_000138.4(FBN1):c.2926C>T (p.Arg976Cys) rs548296552
NM_000138.4(FBN1):c.2934C>G (p.Asp978Glu) rs138438849
NM_000138.4(FBN1):c.3020T>G (p.Leu1007Arg) rs794728200
NM_000138.4(FBN1):c.3077T>C (p.Phe1026Ser) rs200381100
NM_000138.4(FBN1):c.3083A>G (p.Asp1028Gly) rs1131691317
NM_000138.4(FBN1):c.3089A>G (p.Asn1030Ser) rs375996640
NM_000138.4(FBN1):c.3344A>G (p.Asp1115Gly) rs794728203
NM_000138.4(FBN1):c.3463G>A (p.Asp1155Asn) rs794728204
NM_000138.4(FBN1):c.3464-6C>T rs375596551
NM_000138.4(FBN1):c.3890A>G (p.Glu1297Gly) rs200342067
NM_000138.4(FBN1):c.4096G>A (p.Glu1366Lys) rs763449629
NM_000138.4(FBN1):c.4146T>A (p.Asn1382Lys) rs794728218
NM_000138.4(FBN1):c.4214T>G (p.Leu1405Arg) rs767606368
NM_000138.4(FBN1):c.4443C>T (p.Ser1481=) rs145040593
NM_000138.4(FBN1):c.4930C>T (p.Arg1644Ter) rs140630
NM_000138.4(FBN1):c.4998C>G (p.Thr1666=) rs141925790
NM_000138.4(FBN1):c.5015G>A (p.Cys1672Tyr) rs140627
NM_000138.4(FBN1):c.5097C>T (p.Tyr1699=) rs368979510
NM_000138.4(FBN1):c.5296+14G>A rs140650
NM_000138.4(FBN1):c.5358T>C (p.Val1786=) rs1057521207
NM_000138.4(FBN1):c.5371T>C (p.Cys1791Arg) rs1555396427
NM_000138.4(FBN1):c.538+4A>G rs375721252
NM_000138.4(FBN1):c.539-15del rs193922211
NM_000138.4(FBN1):c.5423-4G>A rs377036485
NM_000138.4(FBN1):c.5726T>C (p.Ile1909Thr) rs794728333
NM_000138.4(FBN1):c.6032G>A (p.Cys2011Tyr) rs886038967
NM_000138.4(FBN1):c.6037+1G>A rs1064796636
NM_000138.4(FBN1):c.6163+2dup rs794728315
NM_000138.4(FBN1):c.6164-3C>T rs571365493
NM_000138.4(FBN1):c.6302C>T (p.Thr2101Met) rs200816828
NM_000138.4(FBN1):c.6388G>A (p.Glu2130Lys) rs794728334
NM_000138.4(FBN1):c.6403G>A (p.Asp2135Asn) rs746167150
NM_000138.4(FBN1):c.6487G>T (p.Glu2163Ter) rs1555395191
NM_000138.4(FBN1):c.6541T>C (p.Cys2181Arg) rs1131691373
NM_000138.4(FBN1):c.6705A>C (p.Gly2235=) rs2229326
NM_000138.4(FBN1):c.6852T>C (p.Pro2284=) rs201226058
NM_000138.4(FBN1):c.6904T>A (p.Cys2302Ser) rs886039092
NM_000138.4(FBN1):c.6942C>T (p.Tyr2314=) rs372967546
NM_000138.4(FBN1):c.6987C>G (p.Asp2329Glu) rs363831
NM_000138.4(FBN1):c.7051G>A (p.Gly2351Ser) rs746127796
NM_000138.4(FBN1):c.7056C>T (p.Ser2352=) rs149697299
NM_000138.4(FBN1):c.7072G>A (p.Val2358Ile) rs140537304
NM_000138.4(FBN1):c.7204+7C>G rs371763964
NM_000138.4(FBN1):c.75G>A (p.Ala25=) rs543230518
NM_000138.4(FBN1):c.7708G>A (p.Glu2570Lys) rs886038786
NM_000138.4(FBN1):c.7775G>T (p.Cys2592Phe) rs112118237
NM_000138.4(FBN1):c.7902C>T (p.Pro2634=) rs138621371
NM_000138.4(FBN1):c.7964C>T (p.Ala2655Val) rs202240409
NM_000138.4(FBN1):c.7994A>G (p.Asn2665Ser) rs763173031
NM_000138.4(FBN1):c.8176C>T (p.Arg2726Trp) rs61746008
NM_000138.4(FBN1):c.8326C>T (p.Arg2776Ter) rs137854466
NM_000138.4(FBN1):c.8445C>T (p.Leu2815=) rs142304692
NM_000138.4(FBN1):c.8521G>T (p.Glu2841Ter) rs587782948
NM_000138.4(FBN1):c.902G>T (p.Gly301Val) rs142888621
NM_000138.5(FBN1):c.1148-2A>G rs397515756
NM_000138.5(FBN1):c.1583G>A rs794728170
NM_000138.5(FBN1):c.1746C>T (p.Cys582=) rs112366266
NM_000138.5(FBN1):c.1846G>A (p.Glu616Lys) rs397515764
NM_000138.5(FBN1):c.184C>T (p.Arg62Cys) rs25403
NM_000138.5(FBN1):c.1948C>T rs193922185
NM_000138.5(FBN1):c.2175T>C (p.Asn725=) rs140606
NM_000138.5(FBN1):c.2645C>T rs794728195
NM_000138.5(FBN1):c.2895G>A (p.Glu965=) rs140591
NM_000138.5(FBN1):c.2927G>A (p.Arg976His) rs140954477
NM_000138.5(FBN1):c.2956G>A (p.Ala986Thr) rs112287730
NM_000138.5(FBN1):c.3058A>G (p.Thr1020Ala) rs111801777
NM_000138.5(FBN1):c.306C>T (p.Cys102=) rs25388
NM_000138.5(FBN1):c.3294C>T (p.Asp1098=) rs140587
NM_000138.5(FBN1):c.3422C>T (p.Pro1141Leu) rs2228241
NM_000138.5(FBN1):c.3423G>A (p.Pro1141=) rs140396599
NM_000138.5(FBN1):c.3509G>A (p.Arg1170His) rs137854475
NM_000138.5(FBN1):c.3712G>A rs794728208
NM_000138.5(FBN1):c.4270C>G (p.Pro1424Ala) rs201273753
NM_000138.5(FBN1):c.4306G>A (p.Val1436Met) rs377338217
NM_000138.5(FBN1):c.4441A>G (p.Ser1481Gly) rs61730054
NM_000138.5(FBN1):c.4567C>T (p.Arg1523Ter) rs397515812
NM_000138.5(FBN1):c.4683C>T (p.Ser1561=) rs148024160
NM_000138.5(FBN1):c.4750G>A (p.Glu1584Lys) rs148888513
NM_000138.5(FBN1):c.4905C>G (p.Thr1635=) rs113115949
NM_000138.5(FBN1):c.493C>T (p.Arg165Ter) rs113905529
NM_000138.5(FBN1):c.5065+10A>G rs375945405
NM_000138.5(FBN1):c.510C>T (p.Tyr170=) rs111671429
NM_000138.5(FBN1):c.5343G>A (p.Val1781=) rs140649
NM_000138.5(FBN1):c.5442C>T (p.Asn1814=) rs397515822
NM_000138.5(FBN1):c.5788+10C>A rs371560107
NM_000138.5(FBN1):c.59A>G (p.Tyr20Cys) rs201309310
NM_000138.5(FBN1):c.6288C>T (p.Cys2096=) rs144822241
NM_000138.5(FBN1):c.6314-15G>A rs200841830
NM_000138.5(FBN1):c.6354C>T (p.Ile2118=) rs112989722
NM_000138.5(FBN1):c.6453C>T rs794728251
NM_000138.5(FBN1):c.6594C>T (p.Pro2198=) rs111844882
NM_000138.5(FBN1):c.6658C>T (p.Arg2220Ter) rs113001196
NM_000138.5(FBN1):c.6681A>C (p.Ser2227=) rs363824
NM_000138.5(FBN1):c.6700G>A (p.Val2234Met) rs112084407
NM_000138.5(FBN1):c.6806T>C (p.Ile2269Thr) rs193922228
NM_000138.5(FBN1):c.7039_7040del (p.Met2347fs) rs794728319
NM_000138.5(FBN1):c.7379A>G (p.Lys2460Arg) rs144189837
NM_000138.5(FBN1):c.7540G>A (p.Gly2514Arg) rs363811
NM_000138.5(FBN1):c.7754T>C (p.Ile2585Thr) rs727503054
NM_000138.5(FBN1):c.7950T>C (p.Asn2650=) rs143055643
NM_000138.5(FBN1):c.79G>A (p.Ala27Thr) rs25397
NM_000138.5(FBN1):c.8502T>C (p.Thr2834=) rs363847
NM_000141.5(FGFR2):c.-46G>A rs201606812
NM_000141.5(FGFR2):c.1362G>A (p.Thr454=) rs200183009
NM_000141.5(FGFR2):c.2190C>T (p.Asn730=) rs55637244
NM_000142.5(FGFR3):c.1150T>C (p.Phe384Leu) rs17881656
NM_000142.5(FGFR3):c.1345C>T (p.Pro449Ser) rs61735104
NM_000142.5(FGFR3):c.1497C>T (p.Ala499=) rs140594137
NM_000142.5(FGFR3):c.2088C>T (p.Pro696=) rs142884145
NM_000142.5(FGFR3):c.666C>T (p.Asp222=) rs201081464
NM_000143.3(FH):c.-11C>T rs200942733
NM_000143.3(FH):c.1154C>A (p.Ala385Asp) rs727503926
NM_000143.3(FH):c.1301G>A (p.Cys434Tyr) rs398123164
NM_000143.3(FH):c.208G>A (p.Ala70Thr) rs587782207
NM_000143.3(FH):c.53C>T (p.Pro18Leu) rs201887750
NM_000143.3(FH):c.892G>C (p.Ala298Pro) rs201395553
NM_000143.4(FH):c.1431_1433dup (p.Lys477dup) rs367543046
NM_000145.3(FSHR):c.603C>T (p.Ser201=) rs75552966
NM_000146.4(FTL):c.163T>C (p.Leu55=) rs2230267
NM_000147.4(FUCA1):c.29C>G (p.Pro10Arg) rs2070956
NM_000151.4(G6PC1):c.132C>T (p.Tyr44=) rs202190197
NM_000151.4(G6PC1):c.340+10C>A rs368450665
NM_000151.4(G6PC1):c.562+10G>A rs199505156
NM_000151.4(G6PC1):c.694G>A (p.Val232Ile) rs145172999
NM_000152.5(GAA):c.-2C>T rs560511228
NM_000152.5(GAA):c.1075+9T>C rs751918816
NM_000152.5(GAA):c.1083G>A (p.Pro361=) rs781379047
NM_000152.5(GAA):c.1195-15G>A rs373840229
NM_000152.5(GAA):c.1285C>G (p.Gln429Glu) rs528369909
NM_000152.5(GAA):c.1286A>G (p.Gln429Arg) rs200294882
NM_000152.5(GAA):c.1343G>C (p.Ser448Thr) rs145712232
NM_000152.5(GAA):c.1356C>T (p.Ala452=) rs757893858
NM_000152.5(GAA):c.1378G>A (p.Glu460Lys) rs771213237
NM_000152.5(GAA):c.1416C>T (p.Thr472=) rs368492669
NM_000152.5(GAA):c.1438-7_1438-5del rs764583466
NM_000152.5(GAA):c.1438-9G>A rs202211401
NM_000152.5(GAA):c.1482A>G (p.Thr494=) rs202064115
NM_000152.5(GAA):c.1536C>T (p.Phe512=) rs143491365
NM_000152.5(GAA):c.1552-13G>A rs111261964
NM_000152.5(GAA):c.1552-3C>G rs375470378
NM_000152.5(GAA):c.1593C>T (p.Asp531=) rs138732016
NM_000152.5(GAA):c.1629C>T (p.Tyr543=) rs372193105
NM_000152.5(GAA):c.1726G>A (p.Gly576Ser) rs1800307
NM_000152.5(GAA):c.1755-18T>C rs201399518
NM_000152.5(GAA):c.1842G>A (p.Thr614=) rs373955374
NM_000152.5(GAA):c.1888+10_1888+11insC rs748036956
NM_000152.5(GAA):c.1920T>G (p.Pro640=) rs144090460
NM_000152.5(GAA):c.2040+17G>A rs534129336
NM_000152.5(GAA):c.2052G>A (p.Pro684=) rs546463058
NM_000152.5(GAA):c.2064C>T (p.Ser688=) rs140996643
NM_000152.5(GAA):c.2105G>A (p.Arg702His) rs398123172
NM_000152.5(GAA):c.2109C>T (p.Tyr703=) rs150728610
NM_000152.5(GAA):c.2132C>G (p.Thr711Arg) rs759292700
NM_000152.5(GAA):c.2152G>A (p.Val718Ile) rs141017311
NM_000152.5(GAA):c.2157G>A (p.Ala719=) rs201523530
NM_000152.5(GAA):c.2190-4G>A rs759974338
NM_000152.5(GAA):c.2332-12A>T rs200965268
NM_000152.5(GAA):c.2400C>T (p.Ser800=) rs115705591
NM_000152.5(GAA):c.2415G>A (p.Val805=) rs150536507
NM_000152.5(GAA):c.2481+16G>A rs41292408
NM_000152.5(GAA):c.2561G>A (p.Arg854Gln) rs149968110
NM_000152.5(GAA):c.2571G>T (p.Leu857=) rs17853996
NM_000152.5(GAA):c.2580C>T (p.Asp860=) rs61736894
NM_000152.5(GAA):c.258C>A (p.Pro86=) rs146615896
NM_000152.5(GAA):c.2647-6G>A rs201525743
NM_000152.5(GAA):c.2647-8C>T rs139201641
NM_000152.5(GAA):c.2652G>A (p.Thr884=) rs143642048
NM_000152.5(GAA):c.2736G>A (p.Ala912=) rs142472738
NM_000152.5(GAA):c.2780C>T (p.Thr927Ile) rs1800315
NM_000152.5(GAA):c.2800-15CT[3] rs770227589
NM_000152.5(GAA):c.318C>T (p.Arg106=) rs762542246
NM_000152.5(GAA):c.32G>A (p.Arg11Gln) rs138812846
NM_000152.5(GAA):c.368G>A (p.Gly123Glu) rs138034915
NM_000152.5(GAA):c.546+18G>A rs190153982
NM_000152.5(GAA):c.664G>A (p.Val222Met) rs374569672
NM_000152.5(GAA):c.692+9T>C rs367661167
NM_000152.5(GAA):c.693-4G>T rs200088236
NM_000152.5(GAA):c.726G>A (p.Ala242=) rs148578399
NM_000152.5(GAA):c.834G>A (p.Leu278=) rs776314424
NM_000152.5(GAA):c.858+6GCGGCGG[3] rs1555599723
NM_000152.5(GAA):c.858+8G>A rs5822325
NM_000152.5(GAA):c.915G>A (p.Gly305=) rs150343359
NM_000152.5(GAA):c.917C>T (p.Ser306Leu) rs138097673
NM_000153.4(GALC):c.1162-4del rs11300320
NM_000153.4(GALC):c.1302C>T (p.Ser434=) rs3213918
NM_000153.4(GALC):c.195+19G>A rs189853941
NM_000153.4(GALC):c.266C>T (p.Pro89Leu) rs201422931
NM_000153.4(GALC):c.329-10_329-8del rs770389075
NM_000153.4(GALC):c.334A>G (p.Thr112Ala) rs147313927
NM_000153.4(GALC):c.956A>G (p.Tyr319Cys) rs183105855
NM_000155.2(GALT):c.-119_-116delGTCA rs111033640
NM_000155.4(GALT):c.1030C>A (p.Gln344Lys) rs111033814
NM_000155.4(GALT):c.329G>A (p.Gly110Glu) rs1057523885
NM_000155.4(GALT):c.563A>G (p.Gln188Arg) rs75391579
NM_000155.4(GALT):c.564+7G>A rs760189807
NM_000155.4(GALT):c.772C>T (p.Arg258Cys) rs368166217
NM_000155.4(GALT):c.893T>C (p.Met298Thr) rs886042064
NM_000155.4(GALT):c.940A>G (p.Asn314Asp) rs2070074
NM_000155.4(GALT):c.945T>C (p.His315=) rs61735982
NM_000156.6(GAMT):c.189G>C (p.Arg63=) rs568392459
NM_000156.6(GAMT):c.279C>T (p.Asp93=) rs144630886
NM_000156.6(GAMT):c.312A>G (p.Pro104=) rs779679242
NM_000156.6(GAMT):c.379G>A (p.Gly127Ser) rs570476209
NM_000156.6(GAMT):c.503A>C (p.Tyr168Ser) rs1131691644
NM_000156.6(GAMT):c.507_521dup (p.Cys169_Ser173dup) rs779931959
NM_000156.6(GAMT):c.571-6G>A rs2074899
NM_000156.6(GAMT):c.581T>C (p.Val194Ala) rs147739199
NM_000156.6(GAMT):c.626C>T (p.Thr209Met) rs17851582
NM_000156.6(GAMT):c.655G>A (p.Asp219Asn) rs753228876
NM_000156.6(GAMT):c.670G>A (p.Ala224Thr) rs141471799
NM_000156.6(GAMT):c.79T>C (p.Tyr27His) rs200833152
NM_000157.3(GBA):c.1448T>C rs421016
NM_000157.4(GBA):c.1226A>G (p.Asn409Ser) rs76763715
NM_000157.4(GBA):c.1448T>G (p.Leu483Arg) rs421016
NM_000157.4(GBA):c.1497G>C (p.Val499=) rs1135675
NM_000158.4(GBE1):c.1521T>C (p.Thr507=) rs372821643
NM_000158.4(GBE1):c.1544G>A (p.Arg515His) rs201958741
NM_000158.4(GBE1):c.2017G>A (p.Ala673Thr) rs193074572
NM_000158.4(GBE1):c.405C>T (p.Leu135=) rs139882066
NM_000158.4(GBE1):c.839G>A (p.Gly280Asp) rs28763902
NM_000159.4(GCDH):c.1143C>T (p.Ile381=) rs142553521
NM_000159.4(GCDH):c.1144G>A (p.Ala382Thr) rs567564095
NM_000159.4(GCDH):c.471C>T (p.Ser157=) rs146682905
NM_000159.4(GCDH):c.997C>G (p.Gln333Glu) rs794726972
NM_000161.3(GCH1):c.610G>A (p.Val204Ile) rs200891969
NM_000162.5(GCK):c.1019+18G>A rs150914617
NM_000162.5(GCK):c.106C>T (p.Arg36Trp) rs762263694
NM_000162.5(GCK):c.31G>A (p.Ala11Thr) rs116093166
NM_000162.5(GCK):c.333C>T (p.Pro111=) rs61736250
NM_000162.5(GCK):c.364-18A>G rs191255582
NM_000162.5(GCK):c.364-1G>A rs1057521094
NM_000162.5(GCK):c.483+14A>G rs74852379
NM_000162.5(GCK):c.540T>G (p.Asn180Lys) rs1554335444
NM_000162.5(GCK):c.618G>A (p.Thr206=) rs142817246
NM_000162.5(GCK):c.645C>T (p.Tyr215=) rs144723656
NM_000162.5(GCK):c.660C>T (p.Cys220=) rs142952813
NM_000162.5(GCK):c.730G>A (p.Val244Met) rs1240035630
NM_000162.5(GCK):c.9C>T (p.Asp3=) rs142553382
NM_000163.5(GHR):c.239G>T (p.Gly80Val) rs114025919
NM_000163.5(GHR):c.535C>T (p.Arg179Cys) rs121909362
NM_000163.5(GHR):c.686G>A (p.Arg229His) rs6177
NM_000165.5(GJA1):c.717G>A (p.Arg239=) rs57946868
NM_000166.6(GJB1):c.*15C>T rs1057520778
NM_000166.6(GJB1):c.-101C>T rs961829342
NM_000166.6(GJB1):c.-17G>A rs879254047
NM_000166.6(GJB1):c.-27C>T rs879254157
NM_000166.6(GJB1):c.-77G>A rs190676487
NM_000166.6(GJB1):c.113T>G (p.Val38Gly) rs863224612
NM_000166.6(GJB1):c.148T>C (p.Ser50Pro) rs913934445
NM_000166.6(GJB1):c.151T>C (p.Phe51Leu) rs876661269
NM_000166.6(GJB1):c.178T>C (p.Cys60Arg) rs1060501004
NM_000166.6(GJB1):c.208C>G (p.Pro70Ala) rs878853697
NM_000166.6(GJB1):c.235C>T (p.Leu79=) rs144717157
NM_000166.6(GJB1):c.239A>G (p.Gln80Arg) rs879254097
NM_000166.6(GJB1):c.297A>G (p.Gln99=) rs1213746899
NM_000166.6(GJB1):c.318A>G (p.Leu106=) rs754804402
NM_000166.6(GJB1):c.372G>C (p.Lys124Asn) rs876661119
NM_000166.6(GJB1):c.467T>G (p.Leu156Arg) rs104894818
NM_000166.6(GJB1):c.526_555dup (p.Thr176_Thr185dup) rs1555937221
NM_000166.6(GJB1):c.547C>T (p.Arg183Cys) rs863224471
NM_000166.6(GJB1):c.566T>G (p.Val189Gly) rs1064794244
NM_000166.6(GJB1):c.610C>A (p.Leu204Ile) rs1064795540
NM_000166.6(GJB1):c.644G>C (p.Arg215Pro) rs864622215
NM_000166.6(GJB1):c.688C>T (p.Arg230Cys) rs587781246
NM_000166.6(GJB1):c.704T>G (p.Phe235Cys) rs104894825
NM_000166.6(GJB1):c.83T>C (p.Ile28Thr) rs768834663
NM_000168.6(GLI3):c.1029-22dup rs559579130
NM_000168.6(GLI3):c.1357-17C>G rs190600888
NM_000168.6(GLI3):c.1393G>C (p.Gly465Arg) rs35488756
NM_000168.6(GLI3):c.2179G>A (p.Gly727Arg) rs121917710
NM_000168.6(GLI3):c.2245A>G (p.Ile749Val) rs140048578
NM_000168.6(GLI3):c.2373G>A (p.Pro791=) rs61754622
NM_000168.6(GLI3):c.2424A>G (p.Ile808Met) rs62622373
NM_000168.6(GLI3):c.280C>T (p.Leu94=) rs115137047
NM_000168.6(GLI3):c.3208A>T (p.Thr1070Ser) rs150907867
NM_000168.6(GLI3):c.341G>A (p.Arg114Lys) rs146458902
NM_000168.6(GLI3):c.3664C>T (p.Pro1222Ser) rs118149040
NM_000168.6(GLI3):c.3829C>G (p.Gln1277Glu) rs146582871
NM_000168.6(GLI3):c.444C>T (p.Tyr148=) rs142241970
NM_000168.6(GLI3):c.501G>A (p.Thr167=) rs149901929
NM_000169.2(GLA):c.1019_1020insA (p.Trp340Ter) rs398123197
NM_000169.2(GLA):c.1085C>T (p.Pro362Leu) rs730880441
NM_000169.2(GLA):c.123C>T (p.Thr41=) rs137902198
NM_000169.2(GLA):c.124A>C (p.Met42Leu) rs797044613
NM_000169.2(GLA):c.619T>C (p.Tyr207His) rs372416832
NM_000169.2(GLA):c.724A>G (p.Ile242Val) rs397515873
NM_000169.2(GLA):c.926C>T (p.Ala309Val) rs869312155
NM_000169.3(GLA):c.1102G>A (p.Ala368Thr) rs144994244
NM_000169.3(GLA):c.196G>C (p.Glu66Gln) rs104894833
NM_000169.3(GLA):c.352C>T (p.Arg118Cys) rs148158093
NM_000169.3(GLA):c.376A>G (p.Ser126Gly) rs149391489
NM_000169.3(GLA):c.639+6A>C rs200096940
NM_000169.3(GLA):c.865A>G (p.Ile289Val) rs140329381
NM_000169.3(GLA):c.8T>C (p.Leu3Pro) rs150547672
NM_000169.3(GLA):c.945C>T (p.Asp315=) rs151208856
NM_000179.2(MSH6):c.*17G>A rs876661000
NM_000179.2(MSH6):c.*4_*6dup rs1451012329
NM_000179.2(MSH6):c.-2G>T rs374748889
NM_000179.2(MSH6):c.-6G>T rs730881822
NM_000179.2(MSH6):c.-8C>T rs565211544
NM_000179.2(MSH6):c.1049C>T (p.Ala350Val) rs587782331
NM_000179.2(MSH6):c.1050C>T (p.Ala350=) rs730881802
NM_000179.2(MSH6):c.1063G>A (p.Gly355Ser) rs587778531
NM_000179.2(MSH6):c.1109T>C (p.Leu370Ser) rs587779204
NM_000179.2(MSH6):c.1132A>C (p.Arg378=) rs781572949
NM_000179.2(MSH6):c.115G>C (p.Gly39Arg) rs751838296
NM_000179.2(MSH6):c.1176T>C (p.Asp392=) rs587779912
NM_000179.2(MSH6):c.1186C>G (p.Leu396Val) rs2020908
NM_000179.2(MSH6):c.1295T>C (p.Phe432Ser) rs750528093
NM_000179.2(MSH6):c.1449G>T (p.Val483=) rs35590297
NM_000179.2(MSH6):c.1508C>G (p.Ser503Cys) rs63750897
NM_000179.2(MSH6):c.1509C>T (p.Ser503=) rs545020313
NM_000179.2(MSH6):c.1618C>A (p.Leu540Ile) rs201996928
NM_000179.2(MSH6):c.1665A>G (p.Ala555=) rs146785465
NM_000179.2(MSH6):c.1696G>A (p.Gly566Arg) rs63749973
NM_000179.2(MSH6):c.1714C>T (p.Gln572Ter) rs1064795256
NM_000179.2(MSH6):c.178T>C (p.Leu60=) rs35819209
NM_000179.2(MSH6):c.1827A>G (p.Leu609=) rs767064953
NM_000179.2(MSH6):c.1867C>G (p.Pro623Ala) rs3136334
NM_000179.2(MSH6):c.1869C>T (p.Pro623=) rs141242295
NM_000179.2(MSH6):c.1917G>A (p.Glu639=) rs368059229
NM_000179.2(MSH6):c.2057G>A (p.Gly686Asp) rs587779227
NM_000179.2(MSH6):c.2061T>A (p.Cys687Ter) rs267608068
NM_000179.2(MSH6):c.2187C>A (p.Ala729=) rs375610656
NM_000179.2(MSH6):c.2239C>T (p.Leu747=) rs63751305
NM_000179.2(MSH6):c.2314C>A (p.Arg772=) rs63750138
NM_000179.2(MSH6):c.2314C>T (p.Arg772Trp) rs63750138
NM_000179.2(MSH6):c.2319C>T (p.Leu773=) rs63749895
NM_000179.2(MSH6):c.2384T>C (p.Ile795Thr) rs202127474
NM_000179.2(MSH6):c.2418C>T (p.Ser806=) rs770992427
NM_000179.2(MSH6):c.260+7G>A rs774479750
NM_000179.2(MSH6):c.2633T>C (p.Val878Ala) rs2020912
NM_000179.2(MSH6):c.2765G>A (p.Arg922Gln) rs752839086
NM_000179.2(MSH6):c.2904C>G (p.Val968=) rs150683226
NM_000179.2(MSH6):c.2910G>A (p.Trp970Ter) rs765411990
NM_000179.2(MSH6):c.2932C>T (p.Gln978Ter) rs587781372
NM_000179.2(MSH6):c.2940A>G (p.Glu980=) rs730881818
NM_000179.2(MSH6):c.3024C>T (p.Thr1008=) rs587780675
NM_000179.2(MSH6):c.3151G>A (p.Val1051Ile) rs576269342
NM_000179.2(MSH6):c.3162C>T (p.Ile1054=) rs149605979
NM_000179.2(MSH6):c.3173-10C>T rs587780559
NM_000179.2(MSH6):c.3173-18T>A rs189672273
NM_000179.2(MSH6):c.3203G>A (p.Arg1068Gln) rs398123230
NM_000179.2(MSH6):c.3244C>T (p.Pro1082Ser) rs186240214
NM_000179.2(MSH6):c.3284G>A (p.Arg1095His) rs63750253
NM_000179.2(MSH6):c.3300G>A (p.Thr1100=) rs540252208
NM_000179.2(MSH6):c.3384T>C (p.Tyr1128=) rs544518097
NM_000179.2(MSH6):c.3399T>C (p.Thr1133=) rs61748084
NM_000179.2(MSH6):c.33C>G (p.Phe11Leu) rs747802641
NM_000179.2(MSH6):c.3438+11_3438+14del rs377746844
NM_000179.2(MSH6):c.3439-10T>A rs730881819
NM_000179.2(MSH6):c.3439-16C>T rs192614006
NM_000179.2(MSH6):c.3439-1G>T rs587779263
NM_000179.2(MSH6):c.3456A>G (p.Val1152=) rs750998416
NM_000179.2(MSH6):c.3476dup (p.Tyr1159Ter) rs587782111
NM_000179.2(MSH6):c.3513T>C (p.Asp1171=) rs63749834
NM_000179.2(MSH6):c.3528_3532del (p.Leu1177fs) rs863225408
NM_000179.2(MSH6):c.3557-7_3557-4del rs267608102
NM_000179.2(MSH6):c.3647-6T>A rs182871847
NM_000179.2(MSH6):c.364G>A (p.Glu122Lys) rs143036974
NM_000179.2(MSH6):c.3675G>A (p.Thr1225=) rs730881820
NM_000179.2(MSH6):c.3727A>T (p.Thr1243Ser) rs147453999
NM_000179.2(MSH6):c.3744_3773del (p.His1248_Ser1257del) rs863225412
NM_000179.2(MSH6):c.3801+17T>C rs3136365
NM_000179.2(MSH6):c.3832C>A (p.Pro1278Thr) rs587782109
NM_000179.2(MSH6):c.3833C>G (p.Pro1278Arg) rs201191389
NM_000179.2(MSH6):c.3850dup (p.Thr1284fs) rs1553333421
NM_000179.2(MSH6):c.3852G>A (p.Thr1284=) rs2229018
NM_000179.2(MSH6):c.3911G>A (p.Arg1304Lys) rs34625968
NM_000179.2(MSH6):c.393A>C (p.Val131=) rs752488540
NM_000179.2(MSH6):c.3960A>G (p.Ala1320=) rs373425206
NM_000179.2(MSH6):c.3980A>G (p.Asn1327Ser) rs780187989
NM_000179.2(MSH6):c.4001+11_4001+15dup rs587779302
NM_000179.2(MSH6):c.457+13A>G rs1800933
NM_000179.2(MSH6):c.457+7G>C rs781280171
NM_000179.2(MSH6):c.491A>C (p.His164Pro) rs146469162
NM_000179.2(MSH6):c.628-7C>T rs373129248
NM_000179.2(MSH6):c.660A>C (p.Glu220Asp) rs1800938
NM_000179.2(MSH6):c.694C>T (p.Gln232Ter) rs587779318
NM_000179.2(MSH6):c.867C>A (p.Gly289=) rs267608047
NM_000179.2(MSH6):c.926C>G (p.Ser309Cys) rs544222338
NM_000179.2(MSH6):c.957G>A (p.Thr319=) rs375210430
NM_000179.2(MSH6):c.984C>T (p.Ser328=) rs138143769
NM_000179.3(MSH6):c.1054G>A (p.Val352Ile) rs730881787
NM_000179.3(MSH6):c.107C>T (p.Ala36Val) rs61756469
NM_000179.3(MSH6):c.10C>T (p.Gln4Ter) rs786201042
NM_000179.3(MSH6):c.1135_1139del (p.Arg378_Arg379insTer) rs267608077
NM_000179.3(MSH6):c.1483C>T rs587779212
NM_000179.3(MSH6):c.1526T>C (p.Val509Ala) rs63751005
NM_000179.3(MSH6):c.1730G>A (p.Arg577His) rs376220212
NM_000179.3(MSH6):c.2398G>C (p.Val800Leu) rs61748083
NM_000179.3(MSH6):c.2555AGA[2] (p.Lys854del) rs587782858
NM_000179.3(MSH6):c.2561A>T (p.Lys854Met) rs34374438
NM_000179.3(MSH6):c.2667G>T (p.Gln889His) rs149945495
NM_000179.3(MSH6):c.3217C>T (p.Pro1073Ser) rs142254875
NM_000179.3(MSH6):c.3245C>T (p.Pro1082Leu) rs191109849
NM_000179.3(MSH6):c.3246G>T (p.Pro1082=) rs3136351
NM_000179.3(MSH6):c.3259C>T (p.Pro1087Ser) rs63750998
NM_000179.3(MSH6):c.3260C>G (p.Pro1087Arg) rs63750753
NM_000179.3(MSH6):c.3478G>A (p.Val1160Ile) rs376799914
NM_000179.3(MSH6):c.3488A>T (p.Glu1163Val) rs63750252
NM_000179.3(MSH6):c.3716_3717del (p.Ile1239fs) rs1064794384
NM_000179.3(MSH6):c.3724C>A (p.Arg1242Ser) rs587779285
NM_000179.3(MSH6):c.3724_3726del rs63749942
NM_000179.3(MSH6):c.3799_3800del (p.Met1267fs) rs267608114
NM_000179.3(MSH6):c.3851C>T (p.Thr1284Met) rs63750836
NM_000179.3(MSH6):c.3961A>G (p.Arg1321Gly) rs41295278
NM_000179.3(MSH6):c.3986C>T (p.Ser1329Leu) rs199594809
NM_000179.3(MSH6):c.3991C>T (p.Arg1331Ter) rs267608094
NM_000179.3(MSH6):c.4001+2TAAC[2] rs267608132
NM_000179.3(MSH6):c.4001+2TAAC[4] rs267608132
NM_000179.3(MSH6):c.4001+4_4001+8dup rs587782853
NM_000179.3(MSH6):c.4001G>A (p.Arg1334Gln) rs267608122
NM_000179.3(MSH6):c.4002-10T>A rs545466048
NM_000179.3(MSH6):c.4004A>C (p.Glu1335Ala) rs564434147
NM_000179.3(MSH6):c.4068_4071dup (p.Lys1358delinsAspTer) rs55740729
NM_000179.3(MSH6):c.431G>T (p.Ser144Ile) rs3211299
NM_000179.3(MSH6):c.59C>T (p.Ala20Val) rs63750664
NM_000179.3(MSH6):c.663A>C (p.Glu221Asp) rs41557217
NM_000179.3(MSH6):c.73G>T (p.Ala25Ser) rs267608026
NM_000179.3(MSH6):c.866_867delinsAA (p.Gly289Glu) rs267608079
NM_000179.3(MSH6):c.884A>G (p.Lys295Arg) rs267608051
NM_000180.3(GUCY2D):c.129_134delTCTGCT (p.Leu44_Leu45del) rs552184470
NM_000182.5(HADHA):c.-1G>T rs72809666
NM_000182.5(HADHA):c.1212G>C (p.Val404=) rs116396996
NM_000182.5(HADHA):c.1981C>T (p.Leu661=) rs142348718
NM_000182.5(HADHA):c.2107G>A (p.Gly703Arg) rs200438844
NM_000182.5(HADHA):c.2175C>T (p.Gly725=) rs375399631
NM_000183.3(HADHB):c.246A>G (p.Ala82=) rs151302743
NM_000188.3(HK1):c.1370C>T (p.Thr457Met) rs1057517928
NM_000190.4(HMBS):c.500G>A (p.Arg167Gln) rs118204095
NM_000190.4(HMBS):c.601C>T (p.Arg201Trp) rs118204109
NM_000192.3(TBX5):c.1234G>A (p.Val412Ile) rs114124210
NM_000192.3(TBX5):c.331G>T (p.Asp111Tyr) rs77357563
NM_000192.3(TBX5):c.836G>A (p.Arg279Gln) rs115178276
NM_000193.4(SHH):c.1078C>T (p.Leu360=) rs191903572
NM_000193.4(SHH):c.876G>A (p.Gly292=) rs112055654
NM_000199.5(SGSH):c.1139A>G (p.Gln380Arg) rs144143780
NM_000199.5(SGSH):c.1339G>A (p.Glu447Lys) rs104894639
NM_000199.5(SGSH):c.220C>T (p.Arg74Cys) rs104894636
NM_000203.5(IDUA):c.246C>G (p.His82Gln) rs148775298
NM_000204.4(CFI):c.355G>A (p.Gly119Arg) rs141853578
NM_000204.5(CFI):c.1534+5G>T rs114013791
NM_000209.4(PDX1):c.165C>A (p.Gly55=) rs530567443
NM_000209.4(PDX1):c.226G>A (p.Asp76Asn) rs137852783
NM_000209.4(PDX1):c.336C>G (p.Pro112=) rs149275902
NM_000209.4(PDX1):c.6C>T (p.Asn2=) rs146936598
NM_000209.4(PDX1):c.725C>T (p.Pro242Leu) rs193922358
NM_000209.4(PDX1):c.97C>A (p.Pro33Thr) rs192902098
NM_000213.5(ITGB4):c.3861C>T (p.Asn1287=) rs145351926
NM_000214.3(JAG1):c.1043G>A (p.Arg348Lys) rs200227737
NM_000214.3(JAG1):c.1146C>T (p.Asn382=) rs200133928
NM_000214.3(JAG1):c.1339T>C (p.Cys447Arg) rs863223651
NM_000214.3(JAG1):c.1628G>A (p.Arg543His) rs544877858
NM_000214.3(JAG1):c.1826C>T (p.Ser609Leu) rs199505265
NM_000214.3(JAG1):c.2329C>T (p.Pro777Ser) rs202063628
NM_000214.3(JAG1):c.2344+15C>G rs200139177
NM_000214.3(JAG1):c.2810G>A (p.Arg937Gln) rs145895196
NM_000214.3(JAG1):c.3329A>C (p.Asn1110Thr) rs150811951
NM_000214.3(JAG1):c.3333C>T (p.Thr1111=) rs141439542
NM_000214.3(JAG1):c.3507G>C (p.Arg1169=) rs138452567
NM_000214.3(JAG1):c.388-4G>C rs567027490
NM_000214.3(JAG1):c.399G>A (p.Thr133=) rs763154396
NM_000214.3(JAG1):c.526G>A (p.Val176Ile) rs199674138
NM_000214.3(JAG1):c.82G>C (p.Val28Leu) rs142855305
NM_000214.3(JAG1):c.894T>C (p.Asn298=) rs149897344
NM_000215.3(JAK3):c.2773C>A (p.Arg925Ser) rs149452625
NM_000215.4(JAK3):c.452C>G (p.Pro151Arg) rs55778349
NM_000216.4(ANOS1):c.555G>C (p.Lys185Asn) rs140670828
NM_000218.2(KCNQ1):c.160_168dup (p.Ile54_Pro56dup) rs397515877
NM_000218.2(KCNQ1):c.31G>A (p.Glu11Lys) rs959449103
NM_000218.2(KCNQ1):c.386+14C>T rs370023636
NM_000218.3(KCNQ1):c.-5T>C rs532941548
NM_000218.3(KCNQ1):c.1096C>T (p.Arg366Trp) rs199473411
NM_000218.3(KCNQ1):c.1110G>A (p.Ala370=) rs1805118
NM_000218.3(KCNQ1):c.1129-8G>A rs200612600
NM_000218.3(KCNQ1):c.1179G>T (p.Lys393Asn) rs12720457
NM_000218.3(KCNQ1):c.1394-8C>T rs371488379
NM_000218.3(KCNQ1):c.1514+7G>T rs372593469
NM_000218.3(KCNQ1):c.1590+14T>C rs11024034
NM_000218.3(KCNQ1):c.1726G>A (p.Val576Ile) rs750409379
NM_000218.3(KCNQ1):c.1781G>A (p.Arg594Gln) rs199472815
NM_000218.3(KCNQ1):c.1860C>T (p.His620=) rs139893266
NM_000218.3(KCNQ1):c.1986C>T (p.Tyr662=) rs11601907
NM_000218.3(KCNQ1):c.207G>T (p.Ala69=) rs587781009
NM_000218.3(KCNQ1):c.225T>C (p.Val75=) rs367817352
NM_000218.3(KCNQ1):c.328G>A (p.Val110Ile) rs199472677
NM_000218.3(KCNQ1):c.437A>G (p.Glu146Gly) rs914460959
NM_000218.3(KCNQ1):c.447C>T (p.Ala149=) rs146436765
NM_000218.3(KCNQ1):c.459G>A (p.Thr153=) rs148121889
NM_000218.3(KCNQ1):c.573_577del (p.Arg192fs) rs397508118
NM_000218.3(KCNQ1):c.605-11G>A rs200828849
NM_000218.3(KCNQ1):c.811C>T (p.Leu271=) rs189991547
NM_000218.3(KCNQ1):c.820A>G (p.Ile274Val) rs199472728
NM_000219.6(KCNE1):c.173C>T (p.Thr58Ile) rs747321794
NM_000219.6(KCNE1):c.199C>T (p.Arg67Cys) rs199473645
NM_000219.6(KCNE1):c.206A>G (p.Lys69Arg) rs149338401
NM_000219.6(KCNE1):c.226G>A (p.Asp76Asn) rs74315445
NM_000219.6(KCNE1):c.24G>A (p.Ala8=) rs144094344
NM_000219.6(KCNE1):c.29C>T (p.Thr10Met) rs144917638
NM_000219.6(KCNE1):c.374C>T (p.Thr125Met) rs142511345
NM_000231.2(SGCG):c.*10G>A rs139369964
NM_000231.2(SGCG):c.-6T>C rs141771521
NM_000231.2(SGCG):c.1-8C>T rs745599370
NM_000231.2(SGCG):c.267A>G (p.Pro89=) rs149595403
NM_000231.2(SGCG):c.414A>G (p.Gln138=) rs770596449
NM_000231.2(SGCG):c.435C>T (p.Asn145=) rs35628352
NM_000231.2(SGCG):c.506-7T>G rs774582375
NM_000231.2(SGCG):c.507G>T (p.Gly169=) rs199905729
NM_000231.2(SGCG):c.579-21_579-20del rs769893030
NM_000231.2(SGCG):c.579-22G>T rs111358030
NM_000231.3(SGCG):c.*13C>T rs9510701
NM_000231.3(SGCG):c.228T>C (p.Asp76=) rs1800350
NM_000231.3(SGCG):c.347G>A (p.Arg116His) rs17314986
NM_000232.4(SGCB):c.768C>T (p.Ile256=) rs149121189
NM_000232.4(SGCB):c.799C>T (p.Arg267Cys) rs200761715
NM_000232.4(SGCB):c.943G>A (p.Gly315Arg) rs150395645
NM_000232.4(SGCB):c.9_14dup (p.Ala8_Ala9dup) rs886044103
NM_000232.5(SGCB):c.341C>T rs150518260
NM_000233.4(LHCGR):c.458+3A>G rs76210637
NM_000235.4(LIPA):c.754A>T (p.Ile252Leu) rs147493628
NM_000238.3(KCNH2):c.2660G>A (p.Arg887His) rs199473432
NM_000238.3(KCNH2):c.3164G>A (p.Arg1055Gln) rs41307270
NM_000238.4(KCNH2):c.1039C>T (p.Pro347Ser) rs138776684
NM_000238.4(KCNH2):c.1750G>A (p.Gly584Ser) rs199473428
NM_000238.4(KCNH2):c.2246G>T (p.Gly749Val) rs199472989
NM_000238.4(KCNH2):c.2254C>T (p.Arg752Trp) rs199472990
NM_000238.4(KCNH2):c.2414T>G (p.Phe805Cys) rs199472999
NM_000238.4(KCNH2):c.2454G>A (p.Ser818=) rs72549418
NM_000238.4(KCNH2):c.2674C>T (p.Arg892Cys) rs201627778
NM_000238.4(KCNH2):c.2738C>T (p.Ala913Val) rs77331749
NM_000238.4(KCNH2):c.2750C>T (p.Pro917Leu) rs76420733
NM_000238.4(KCNH2):c.2771G>A (p.Gly924Glu) rs199473009
NM_000238.4(KCNH2):c.2843G>A (p.Arg948His) rs199473011
NM_000238.4(KCNH2):c.2860C>T (p.Arg954Cys) rs141401803
NM_000238.4(KCNH2):c.2904G>A (p.Pro968=) rs75005975
NM_000238.4(KCNH2):c.3111C>T (p.Asp1037=) rs200799870
NM_000238.4(KCNH2):c.3348G>A (p.Ala1116=) rs376180501
NM_000238.4(KCNH2):c.422C>T (p.Pro141Leu) rs199472864
NM_000238.4(KCNH2):c.442C>T (p.Arg148Trp) rs139544114
NM_000238.4(KCNH2):c.551GCGCGGGCG[1] (p.184GAG[1]) rs551056698
NM_000243.2(MEFV):c.-15C>G rs11466015
NM_000243.2(MEFV):c.1016C>T (p.Ser339Phe) rs104895157
NM_000243.2(MEFV):c.1043G>A (p.Arg348His) rs104895198
NM_000243.2(MEFV):c.124C>T (p.Arg42Trp) rs61754767
NM_000243.2(MEFV):c.1261-11T>G rs77086855
NM_000243.2(MEFV):c.1459G>C (p.Val487Leu) rs104895100
NM_000243.2(MEFV):c.1467G>A (p.Gln489=) rs61732424
NM_000243.2(MEFV):c.1518C>T (p.Ile506=) rs104895099
NM_000243.2(MEFV):c.1587+33C>G rs146820856
NM_000243.2(MEFV):c.1760-4G>A rs79662406
NM_000243.2(MEFV):c.1772T>C (p.Ile591Thr) rs11466045
NM_000243.2(MEFV):c.1958G>A (p.Arg653His) rs104895085
NM_000243.2(MEFV):c.2084A>G rs104895094
NM_000243.2(MEFV):c.2230G>T rs61732874
NM_000243.2(MEFV):c.2292G>T (p.Gly764=) rs142352887
NM_000243.2(MEFV):c.414A>G (p.Gly138=) rs224224
NM_000243.2(MEFV):c.42G>A (p.Glu14=) rs113314808
NM_000243.2(MEFV):c.549G>A (p.Pro183=) rs587781035
NM_000243.2(MEFV):c.586G>T (p.Gly196Trp) rs104895179
NM_000243.2(MEFV):c.605G>A (p.Arg202Gln) rs224222
NM_000243.2(MEFV):c.910G>A (p.Gly304Arg) rs75977701
NM_000243.2(MEFV):c.911-12G>A rs372016564
NM_000243.2(MEFV):c.932C>T (p.Ala311Val) rs74346519
NM_000243.2(MEFV):c.97G>T (p.Val33Leu) rs11466016
NM_000243.2(MEFV):c.986G>A (p.Arg329His) rs104895112
NM_000243.3(MEFV):c.1105C>T rs11466023
NM_000243.3(MEFV):c.1223G>A rs11466024
NM_000243.3(MEFV):c.2076_2078del (p.Ile692del) rs104895093
NM_000243.3(MEFV):c.2282G>A (p.Arg761His) rs104895097
NM_000243.3(MEFV):c.329T>C rs11466018
NM_000243.3(MEFV):c.374AGGGGAACG[3] (p.125EGN[3]) rs104895121
NM_000243.3(MEFV):c.442G>C rs3743930
NM_000244.3(MEN1):c.-20G>A rs386134244
NM_000244.3(MEN1):c.1311G>A (p.Leu437=) rs138770431
NM_000244.3(MEN1):c.1424C>T (p.Pro475Leu) rs750112288
NM_000244.3(MEN1):c.1594C>T (p.Arg532Ter) rs104894261
NM_000244.3(MEN1):c.1653G>A (p.Pro551=) rs368783097
NM_000244.3(MEN1):c.1A>G (p.Met1Val) rs386134250
NM_000244.3(MEN1):c.30G>T (p.Leu10=) rs371192390
NM_000244.3(MEN1):c.65T>G (p.Leu22Arg) rs104894256
NM_000244.3(MEN1):c.669+18C>T rs180737290
NM_000244.3(MEN1):c.76G>A (p.Glu26Lys) rs28931612
NM_000244.3(MEN1):c.789G>C (p.Gln263His) rs374659656
NM_000245.4(MET):c.-14-4G>A rs144126521
NM_000245.4(MET):c.110T>C (p.Val37Ala) rs201315884
NM_000245.4(MET):c.1124A>G (p.Asn375Ser) rs33917957
NM_000245.4(MET):c.1932C>T (p.His644=) rs45520237
NM_000245.4(MET):c.2584-7del rs587780736
NM_000245.4(MET):c.2908C>T (p.Arg970Cys) rs34589476
NM_000245.4(MET):c.2975C>T (p.Thr992Ile) rs56391007
NM_000245.4(MET):c.4105T>C (p.Leu1369=) rs45575438
NM_000245.4(MET):c.504G>T (p.Glu168Asp) rs55985569
NM_000245.4(MET):c.607T>A (p.Ser203Thr) rs200861145
NM_000245.4(MET):c.654G>A (p.Arg218=) rs35284565
NM_000245.4(MET):c.948A>G (p.Ile316Met) rs35225896
NM_000245.4(MET):c.967A>G (p.Ser323Gly) rs201467281
NM_000249.3(MLH1):c.-27C>A rs587779001
NM_000249.3(MLH1):c.1020C>G (p.Ser340=) rs374770981
NM_000249.3(MLH1):c.1039-8_1039-7insTA rs535965616
NM_000249.3(MLH1):c.1050A>G (p.Pro350=) rs137937003
NM_000249.3(MLH1):c.1104G>A (p.Ser368=) rs769364808
NM_000249.3(MLH1):c.1128T>C (p.Asp376=) rs267607824
NM_000249.3(MLH1):c.116+8G>A rs904872305
NM_000249.3(MLH1):c.116G>A (p.Cys39Tyr) rs63751701
NM_000249.3(MLH1):c.117-10G>A rs576724240
NM_000249.3(MLH1):c.1266C>T (p.Gly422=) rs63750791
NM_000249.3(MLH1):c.1269G>A (p.Arg423=) rs373076967
NM_000249.3(MLH1):c.1409+1G>A rs267607825
NM_000249.3(MLH1):c.1517T>C (p.Val506Ala) rs63749909
NM_000249.3(MLH1):c.1558+10C>T rs765913871
NM_000249.3(MLH1):c.1558+4C>T rs531873434
NM_000249.3(MLH1):c.1569G>T (p.Glu523Asp) rs63751680
NM_000249.3(MLH1):c.1731+8T>C rs370108219
NM_000249.3(MLH1):c.1731G>A (p.Ser577=) rs63751657
NM_000249.3(MLH1):c.1744C>T (p.Leu582Phe) rs63751713
NM_000249.3(MLH1):c.1808C>G (p.Pro603Arg) rs63750876
NM_000249.3(MLH1):c.1896+7C>T rs863224339
NM_000249.3(MLH1):c.1896G>A (p.Glu632=) rs63751632
NM_000249.3(MLH1):c.1963A>G (p.Ile655Val) rs55907433
NM_000249.3(MLH1):c.1964T>C (p.Ile655Thr) rs63751225
NM_000249.3(MLH1):c.1975C>T (p.Arg659Ter) rs63751310
NM_000249.3(MLH1):c.198C>T (p.Thr66=) rs61751642
NM_000249.3(MLH1):c.1990-6G>A rs117221851
NM_000249.3(MLH1):c.2001C>T (p.Asp667=) rs63750014
NM_000249.3(MLH1):c.2041G>A (p.Ala681Thr) rs63750217
NM_000249.3(MLH1):c.207+1G>A rs267607718
NM_000249.3(MLH1):c.2070C>T (p.Tyr690=) rs550890395
NM_000249.3(MLH1):c.2101C>A (p.Gln701Lys) rs63750114
NM_000249.3(MLH1):c.2174G>A (p.Arg725His) rs566928243
NM_000249.3(MLH1):c.222T>C (p.Asp74=) rs755073786
NM_000249.3(MLH1):c.2252A>G (p.Lys751Arg) rs140195825
NM_000249.3(MLH1):c.24T>A (p.Ile8=) rs748406142
NM_000249.3(MLH1):c.277A>G (p.Ser93Gly) rs41295282
NM_000249.3(MLH1):c.301G>A (p.Gly101Ser) rs267607726
NM_000249.3(MLH1):c.303T>G (p.Gly101=) rs4647220
NM_000249.3(MLH1):c.304G>A (p.Glu102Lys) rs63750453
NM_000249.3(MLH1):c.307-29C>A rs139620056
NM_000249.3(MLH1):c.30G>T (p.Arg10=) rs876660759
NM_000249.3(MLH1):c.350C>G (p.Thr117Arg) rs63750781
NM_000249.3(MLH1):c.375A>G (p.Ala125=) rs1800144
NM_000249.3(MLH1):c.380+10T>C rs1553641403
NM_000249.3(MLH1):c.381-1G>A rs267607744
NM_000249.3(MLH1):c.42A>C (p.Thr14=) rs369737664
NM_000249.3(MLH1):c.453+20G>T rs759417195
NM_000249.3(MLH1):c.545+19G>T rs41285099
NM_000249.3(MLH1):c.579A>G (p.Ser193=) rs587781038
NM_000249.3(MLH1):c.583A>T (p.Lys195Ter) rs863225383
NM_000249.3(MLH1):c.589-8T>C rs1017112753
NM_000249.3(MLH1):c.676C>T (p.Arg226Ter) rs63751615
NM_000249.3(MLH1):c.702G>A (p.Glu234=) rs35908749
NM_000249.3(MLH1):c.790+10A>G rs182733777
NM_000249.3(MLH1):c.843A>C (p.Ala281=) rs146796765
NM_000249.3(MLH1):c.884+16A>G rs377598055
NM_000249.3(MLH1):c.885-2A>G rs267607805
NM_000249.3(MLH1):c.954C>T (p.His318=) rs146777069
NM_000249.3(MLH1):c.974G>A (p.Arg325Gln) rs63750268
NM_000249.4(MLH1):c.-28A>G rs56198082
NM_000249.4(MLH1):c.-7C>T rs104894994
NM_000249.4(MLH1):c.1013A>G (p.Asn338Ser) rs63751467
NM_000249.4(MLH1):c.1040C>A (p.Thr347Asn) rs201541505
NM_000249.4(MLH1):c.1151T>A (p.Val384Asp) rs63750447
NM_000249.4(MLH1):c.1166G>A (p.Arg389Gln) rs63750361
NM_000249.4(MLH1):c.1217G>A (p.Ser406Asn) rs41294980
NM_000249.4(MLH1):c.1321G>A (p.Ala441Thr) rs63750365
NM_000249.4(MLH1):c.1360G>C (p.Gly454Arg) rs63750527
NM_000249.4(MLH1):c.1379A>C (p.Glu460Ala) rs202038499
NM_000249.4(MLH1):c.1565G>A (p.Arg522Gln) rs63751630
NM_000249.4(MLH1):c.1733A>G (p.Glu578Gly) rs63751612
NM_000249.4(MLH1):c.1742C>T (p.Pro581Leu) rs63751684
NM_000249.4(MLH1):c.1820T>A (p.Leu607His) rs41295284
NM_000249.4(MLH1):c.191A>G (p.Asn64Ser) rs63750952
NM_000249.4(MLH1):c.2066A>G (p.Gln689Arg) rs63750702
NM_000249.4(MLH1):c.2152C>T (p.His718Tyr) rs2020873
NM_000249.4(MLH1):c.394G>C (p.Asp132His) rs28930073
NM_000249.4(MLH1):c.637G>A (p.Val213Met) rs2308317
NM_000249.4(MLH1):c.649C>T (p.Arg217Cys) rs4986984
NM_000249.4(MLH1):c.677G>T (p.Arg226Leu) rs63751711
NM_000249.4(MLH1):c.793C>T (p.Arg265Cys) rs63751194
NM_000249.4(MLH1):c.803A>G (p.Glu268Gly) rs63750650
NM_000249.4(MLH1):c.885-21TC[2] rs267607804
NM_000249.4(MLH1):c.977T>C (p.Val326Ala) rs63751049
NM_000250.2(MPO):c.1555_1568del (p.Met519fs) rs536522394
NM_000250.2(MPO):c.1705C>T (p.Arg569Trp) rs119468010
NM_000251.2(MSH2):c.-9G>A rs547444746
NM_000251.2(MSH2):c.-9G>C rs547444746
NM_000251.2(MSH2):c.1076+12G>C rs755616171
NM_000251.2(MSH2):c.1077-7A>G rs370807334
NM_000251.2(MSH2):c.1121A>G (p.Gln374Arg) rs749660228
NM_000251.2(MSH2):c.115C>A (p.Arg39=) rs786202334
NM_000251.2(MSH2):c.1217G>A (p.Arg406Gln) rs146567853
NM_000251.2(MSH2):c.1229del (p.Gly410fs) rs1553356700
NM_000251.2(MSH2):c.1255C>A (p.Gln419Lys) rs63750006
NM_000251.2(MSH2):c.1275A>G (p.Glu425=) rs63751650
NM_000251.2(MSH2):c.1276+16G>A rs368120695
NM_000251.2(MSH2):c.1276+2T>C rs267607953
NM_000251.2(MSH2):c.1276+7A>G rs748554540
NM_000251.2(MSH2):c.1277-16T>C rs368653974
NM_000251.2(MSH2):c.1277-8T>C rs145400590
NM_000251.2(MSH2):c.1294T>C (p.Leu432=) rs937218360
NM_000251.2(MSH2):c.1311G>T (p.Val437=) rs730881781
NM_000251.2(MSH2):c.1386+104C>T rs17224444
NM_000251.2(MSH2):c.1387-8G>T rs187525243
NM_000251.2(MSH2):c.1418C>T (p.Ser473Leu) rs63751403
NM_000251.2(MSH2):c.1488A>G (p.Leu496=) rs267607960
NM_000251.2(MSH2):c.1560A>G (p.Gly520=) rs63750820
NM_000251.2(MSH2):c.1638G>A (p.Lys546=) rs372350768
NM_000251.2(MSH2):c.1666T>C (p.Leu556=) rs61756466
NM_000251.2(MSH2):c.1680T>C (p.Asn560=) rs200056411