ClinVar Miner

Variants from OMIM with conflicting interpretations

Location: United States — Primary collection method: literature only
Minimum review status of the submission from OMIM: Collection method of the submission from OMIM:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
22151 4232 929 1905 91 532 1194 4338

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
OMIM pathogenic likely pathogenic uncertain significance likely benign benign affects association confers sensitivity drug response protective risk factor other
pathogenic 925 1886 963 155 163 8 4 0 7 3 21 29
uncertain significance 23 9 1 49 53 0 0 0 1 0 0 1
benign 8 2 10 19 3 0 1 2 10 1 8 7
affects 8 2 5 3 8 0 3 0 0 0 4 2
association 8 1 2 8 16 3 0 1 3 1 7 1
drug response 1 0 0 9 5 0 0 0 0 0 3 10
protective 4 1 2 3 10 0 1 0 1 0 1 0
risk factor 95 22 62 46 74 5 7 0 12 2 0 4
other 74 20 77 38 8 0 0 0 1 0 0 0

Submitter to submitter summary #

Total submitters: 284
Download table as spreadsheet
Submitter Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
GeneReviews 0 875 923 8 0 15 21 967
Invitae 0 1563 0 166 27 61 315 569
Illumina Clinical Services Laboratory,Illumina 0 306 0 72 31 53 254 408
Counsyl 0 275 0 287 6 7 88 388
SIB Swiss Institute of Bioinformatics 0 111 0 286 0 0 79 365
ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories 0 147 0 11 6 143 31 190
Mendelics 0 184 0 21 15 7 121 164
GeneDx 0 167 0 18 7 93 26 144
EGL Genetic Diagnostics, Eurofins Clinical Diagnostics 0 106 0 4 5 104 28 140
Baylor Genetics 0 523 0 52 0 4 66 122
Quest Diagnostics Nichols Institute San Juan Capistrano 0 59 0 4 3 93 8 108
Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine 0 181 0 43 4 35 18 98
Institute of Human Genetics, University of Leipzig Medical Center 0 161 0 52 3 3 37 95
Genomic Research Center, Shahid Beheshti University of Medical Sciences 0 69 0 31 3 4 43 80
Integrated Genetics/Laboratory Corporation of America 0 534 0 23 4 34 19 79
Centre for Mendelian Genomics,University Medical Centre Ljubljana 0 137 0 39 0 9 28 75
PreventionGenetics, PreventionGenetics 0 22 0 1 1 60 9 71
OMIM 30395 259 0 0 0 63 5 67
Genetic Services Laboratory, University of Chicago 0 203 0 37 3 17 8 65
CeGaT Praxis fuer Humangenetik Tuebingen 0 65 0 4 5 41 15 64
Reproductive Health Research and Development,BGI Genomics 0 55 0 18 0 4 42 64
Broad Institute Rare Disease Group, Broad Institute 0 59 0 20 6 5 23 54
Fulgent Genetics,Fulgent Genetics 0 238 0 30 2 11 10 53
University of Washington Center for Mendelian Genomics, University of Washington 0 41 0 46 0 3 3 52
Biochemical Molecular Genetic Laboratory,King Abdulaziz Medical City 0 87 0 39 0 0 7 46
Department of Pathology and Laboratory Medicine,Sinai Health System 0 18 0 0 3 24 15 41
NIHR Bioresource Rare Diseases, University of Cambridge 0 25 0 25 0 7 8 40
Soonchunhyang University Bucheon Hospital,Soonchunhyang University Medical Center 0 10 0 20 0 3 16 39
Equipe Genetique des Anomalies du Developpement, Université de Bourgogne 0 77 0 22 0 2 13 37
Natera, Inc. 0 356 0 14 6 1 15 36
Juha Muilu Group; Institute for Molecular Medicine Finland (FIMM) 0 6 0 36 0 0 0 36
LDLR-LOVD, British Heart Foundation 0 20 0 34 0 0 0 34
Myriad Women's Health, Inc. 0 239 0 33 0 0 0 33
Athena Diagnostics Inc 0 56 0 4 5 15 8 31
Lupski Lab, Baylor-Hopkins CMG, Baylor College of Medicine 0 84 0 26 0 0 5 31
ClinVar Staff, National Center for Biotechnology Information (NCBI) 0 19 0 20 0 0 7 27
Database of Curated Mutations (DoCM) 0 13 0 26 0 0 0 26
PharmGKB 0 7 0 0 0 25 0 25
Undiagnosed Diseases Network,NIH 0 52 0 11 0 2 12 25
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 0 19 0 1 4 11 9 24
Department of Genetics,Sultan Qaboos University Hospital, Oman 0 23 0 7 0 0 17 24
Mayo Clinic Laboratories, Mayo Clinic 0 30 0 2 0 11 8 21
Robarts Research Institute,Western University 0 1 0 21 0 0 0 21
Ambry Genetics 0 17 0 2 6 8 5 20
Institute of Medical Molecular Genetics, University of Zurich 0 2 0 19 0 0 1 20
HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology 0 86 0 16 0 3 1 20
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics,Children's Hospital of Philadelphia 0 61 0 5 1 8 5 19
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen 0 54 0 3 11 2 3 19
Knight Diagnostic Laboratories, Oregon Health and Sciences University 0 75 0 14 0 3 1 18
DNA and Cytogenetics Diagnostics Unit,Erasmus Medical Center 0 40 0 4 7 1 6 18
Molecular Biology Laboratory, Fundació Puigvert 0 9 0 16 0 1 0 17
Centre de Génétique Moléculaire et Chromosomique, Unité de génétique de l'Obésité et des Dyslipidémies,APHP, GH Hôpitaux Universitaires Pitié-Salpêtrière / Charles-Foix 0 12 0 15 0 0 1 16
Blueprint Genetics 0 35 0 8 0 5 1 14
UCLA Clinical Genomics Center, UCLA 0 14 0 14 0 0 0 14
Clinical Genetics Karolinska University Hospital,Karolinska University Hospital 0 23 0 0 0 13 1 14
UNC Molecular Genetics Laboratory,University of North Carolina at Chapel Hill 0 33 0 14 0 0 0 14
Johns Hopkins Genomics, Johns Hopkins University 0 57 0 8 0 2 4 14
Genome Diagnostics Laboratory,University Medical Center Utrecht 0 27 0 2 9 0 2 13
Center for Medical Genetics Ghent,University of Ghent 0 8 0 12 0 0 1 13
Laboratory of Genetics and Molecular Cardiology, University of São Paulo 0 14 0 12 0 0 1 13
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego 0 48 0 10 0 3 0 13
Human Genome Sequencing Center Clinical Lab, Baylor College of Medicine 0 51 0 7 0 5 0 12
Division of Human Genetics,Children's Hospital of Philadelphia 0 32 0 7 0 3 2 12
Wong Mito Lab, Molecular and Human Genetics, Baylor College of Medicine 0 25 0 10 0 0 2 12
Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen 0 25 0 2 0 10 0 12
Institute of Human Genetics, Klinikum rechts der Isar 0 258 0 10 0 1 0 11
CSER _CC_NCGL, University of Washington 0 2 0 2 2 1 6 11
Suna and Inan Kirac Foundation Neurodegeneration Research Laboratory, Koc University 0 2 0 9 0 0 2 11
NeuroMeGen,Hospital Clinico Santiago de Compostela 0 1 0 10 0 0 0 10
Molecular Genetics Laboratory,Centre for Cardiovascular Surgery and Transplantation 0 3 0 10 0 0 0 10
Molecular Diagnostics Laboratory, M Health Fairview: University of Minnesota 0 14 0 10 0 0 0 10
Biesecker Lab/Clinical Genomics Section,National Institutes of Health 0 5 3 0 3 2 1 9
Foundation for Research in Genetics and Endocrinology, FRIGE's Institute of Human Genetics 0 26 0 7 0 0 2 9
ClinGen PAH Variant Curation Expert Panel 0 33 0 8 0 0 1 9
Ocular Genomics Institute, Massachusetts Eye and Ear 0 34 0 9 0 0 0 9
Genomic Medicine Lab, University of California San Francisco 0 17 0 6 0 0 3 9
Centogene AG - the Rare Disease Company 0 63 0 5 0 3 0 8
Hadassah Hebrew University Medical Center 0 9 0 8 0 0 0 8
Leiden Open Variation Database 0 39 0 0 0 7 1 8
Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago 0 10 0 4 0 2 2 8
Department of Pediatrics, Gifu University 0 8 0 8 0 0 0 8
Genetic Testing Center for Deafness, Department of Otolaryngology Head & Neck Surgery,Institute of Otolaryngology, Chinese PLA General Hospital 0 8 0 8 0 0 0 8
Molecular Diagnostics Lab,Nemours Alfred I. duPont Hospital for Children 0 12 0 6 0 0 1 7
Bioscientia Institut fuer Medizinische Diagnostik GmbH,Sonic Healthcare 0 35 0 3 0 1 3 7
Laboratory of Diagnosis and Therapy of Lysosomal Disorders,University of Padova 0 4 0 5 0 0 2 7
Tartaglia Lab, Genetics and Rare Diseases Research Division,Bambino Gesu' Children's Hospital 0 5 0 7 0 0 0 7
Kids Research, The Children's Hospital at Westmead 0 7 0 7 0 0 0 7
Medical Genetics Laboratory, Kennedy Center,Juliane Marie Center, Rigshospitalet 0 4 0 5 0 1 0 6
Sharing Clinical Reports Project (SCRP) 0 34 0 3 2 0 1 6
Center for Human Disease Modeling,Duke University Medical Center 0 0 0 4 0 0 2 6
Human Genetics - Radboudumc,Radboudumc 0 11 0 4 0 0 2 6
Fundacion Hipercolesterolemia Familiar 0 15 0 4 0 0 2 6
SingHealth Duke-NUS Institute of Precision Medicine 0 4 0 4 0 0 2 6
Pathology and Clinical Laboratory Medicine,King Fahad Medical City 0 22 0 6 0 0 0 6
ClinGen CDH1 Variant Curation Expert Panel 0 4 0 3 0 0 3 6
ClinGen Platelet Disorders Variant Curation Expert Panel,ClinGen 0 3 0 5 0 0 1 6
ATS em Genética Clínica,Universidade Federal do Rio Grande do Sul 0 6 0 6 0 0 0 6
Center for Human Genetics, Inc,Center for Human Genetics, Inc 0 53 0 2 2 0 1 5
PXE International 0 16 0 4 0 0 1 5
Breast Cancer Information Core (BIC) (BRCA1) 0 29 0 0 0 0 5 5
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) 0 42 0 0 3 0 2 5
Centre for Genomic Medicine, Manchester,Central Manchester University Hospitals 0 18 0 5 0 0 0 5
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute 0 19 0 1 0 2 2 5
Color Health, Inc 0 19 0 2 1 0 2 5
Cardiovascular Research Group,Instituto Nacional de Saude Doutor Ricardo Jorge 0 19 0 5 0 0 0 5
Kasturba Medical College, Manipal University 0 6 0 3 0 0 2 5
Research and Development, ARUP Laboratories 0 45 5 0 0 0 0 5
Iberoamerican FH Network 0 9 0 3 0 0 2 5
Inherited Neuropathy Consortium 0 0 0 0 0 0 5 5
The Laboratory of Genetics and Metabolism, Hunan Children’s Hospital 0 3 0 0 0 5 0 5
CZECANCA consortium 0 0 0 0 0 5 0 5
Greenwood Genetic Center Diagnostic Laboratories,Greenwood Genetic Center 0 2 0 1 0 2 1 4
Clinical Molecular Genetics Laboratory,Johns Hopkins All Children's Hospital 0 59 0 3 0 1 0 4
Michigan Medical Genetics Laboratories,University of Michigan 0 8 0 0 3 0 1 4
RettBASE 0 25 0 1 0 1 2 4
Department of Medical Genetics, Oslo University Hospital 0 35 0 4 0 0 0 4
Diagnostics Division,Centre for DNA Fingerprinting and Diagnostics 0 0 0 4 0 0 0 4
Baylor-Hopkins Center for Mendelian Genomics,Johns Hopkins University 0 39 0 2 0 1 1 4
Institute of Human Genetics, Univ. Regensburg,Univ. Regensburg 0 4 0 4 0 0 0 4
Department of Medical Genetics, Sanjay Gandhi Post Graduate Institute of Medical Sciences 0 7 0 4 0 0 0 4
Phosphorus, Inc. 0 4 0 1 3 0 0 4
Sharon lab,Hadassah-Hebrew University Medical Center 0 13 0 4 0 0 0 4
Beijing Key Laboratory for Genetic Research of Skeletal Deformity, Peking Union Medical College Hospital 0 12 0 4 0 0 0 4
Genome Diagnostics Laboratory,VU University Medical Center Amsterdam 0 7 0 1 3 0 0 4
Laboratory of Medical Genetics, National & Kapodistrian University of Athens 0 9 0 3 0 1 0 4
Gharavi Laboratory,Columbia University 0 0 0 0 0 4 0 4
National Institute of Sensory Organs,National Hospital Organization Tokyo Medical Center 0 1 0 0 0 4 0 4
Wessex Regional Genetics Laboratory,Salisbury District Hospital 0 8 0 4 0 0 0 4
Brunham Lab, Centre for Heart and Lung Innovation,University of British Columbia 0 12 0 4 0 0 0 4
Section for Clinical Neurogenetics,University of Tübingen 0 7 0 4 0 0 0 4
New York Genome Center 0 6 0 3 0 0 1 4
CHEO Genetics Diagnostic Laboratory,Children's Hospital of Eastern Ontario 0 0 0 0 0 3 0 3
Elsea Laboratory,Baylor College of Medicine 0 10 0 1 0 0 2 3
Institute of Human Genetics,Cologne University 0 14 0 3 0 0 0 3
Foulkes Cancer Genetics LDI, Lady Davis Institute for Medical Research 0 2 0 0 0 3 0 3
Center for Genetic Medicine Research,Children's National Medical Center 0 0 0 3 0 0 0 3
Pathway Genomics 0 18 0 0 1 0 2 3
University of British Columbia 0 0 0 2 0 0 1 3
CHU Sainte-Justine Research Center,University of Montreal 0 3 0 3 0 0 0 3
Deafness Gene Diagnosis,Xijing Hospital 0 0 0 3 0 0 0 3
Stanford Center for Inherited Cardiovascular Disease, Stanford University 0 6 0 0 0 1 3 3
Center of Genomic medicine, Geneva,University Hospital of Geneva 0 29 0 2 0 1 0 3
Centre de Biologie Pathologie Génétique, Centre Hospitalier Universitaire de Lille 0 9 0 3 0 0 0 3
Center for Human Genetics and Laboratory Diagnostics, Dr. Klein, Dr. Rost and Colleagues 0 9 0 1 0 0 2 3
Groupe Hospitalier Pitie Salpetriere, UF Genomique du Developpement,Assistance Publique Hopitaux de Paris 0 6 0 3 0 0 0 3
Center for Medical Genetics and Molecular Medicine,Haukeland University Hospital 0 4 0 3 0 0 0 3
RBHT Clinical Genetics and Genomics Laboratory,Royal Brompton and Harefield NHS Foundation Trust 0 0 0 3 0 0 0 3
Bruce Budowle Laboratory,University of North Texas Health Science Center 0 2 0 0 0 3 0 3
Cavalleri Lab, Royal College of Surgeons in Ireland 0 5 0 3 0 0 0 3
University of Washington Department of Laboratory Medicine, University of Washington 0 5 0 0 0 3 0 3
Nilou-Genome Lab 0 5 0 2 0 0 1 3
Laboratory of Molecular Genetics and Genomics,Rennes University Hospital 0 0 0 3 0 0 0 3
Precision Medicine Center,Zhengzhou University 0 0 0 2 0 0 1 3
Pediatrics,All India Institute of Medical Sciences, New Delhi 0 0 0 0 0 3 0 3
Clinical Biochemistry Laboratory,Health Services Laboratory 0 22 0 0 2 0 0 2
Gleeson Lab,University of California San Diego - Department of Neuroscience 0 0 0 2 0 0 0 2
Centre for Inherited Metabolic Diseases, Karolinska University Hospital 0 17 0 2 0 0 0 2
Developmental Genetics Unit,King Faisal Specialist Hospital & Research Centre 0 1 0 2 0 0 0 2
Service de Génétique Moléculaire,Hôpital Robert Debré 0 19 0 2 0 0 0 2
Institute for Integrative and Experimental Genomics,University of Luebeck 0 0 0 2 0 0 0 2
Care4Rare-SOLVE, CHEO 0 0 0 0 0 0 2 2
GeneKor MSA 0 1 0 0 0 2 0 2
Department of Internal Medicine, University of Texas Health Science Center at Houston 0 1 0 0 0 2 0 2
Center for Human Genetics,University of Leuven 0 6 0 2 0 0 0 2
Gene Discovery Core-Manton Center,Boston Children's Hospital 0 0 0 1 0 0 1 2
Bioinformatics dept.,Datar Cancer Genetics Limited, India 0 5 0 2 0 0 0 2
Department of Medical Genetics, University Hospital of North Norway 0 0 0 1 1 0 0 2
Yale Center for Mendelian Genomics,Yale University 0 8 0 2 0 0 0 2
CHLA Center for Personalized Medicine,Children's Hospital, Los Angeles 0 2 0 0 0 1 1 2
Molecular Medicine,University of Leeds 0 0 0 2 0 0 0 2
Pediatric Metabolic Diseases,Hacettepe University 0 5 0 2 0 0 0 2
Pediatric Immunology Service,The Chaim Sheba Medical Center at Tel HaShomer 0 0 0 1 0 0 1 2
Medical Genetics Summaries 0 5 0 0 0 2 0 2
Hacettepe Genetic Diseases Diagnosis Center,Hacettepe University Faculty of Medicine 0 1 0 2 0 0 0 2
Génétique des Maladies du Développement, Hospices Civils de Lyon 0 31 0 1 0 0 1 2
Department of Molecular Diagnostics, Institute of Oncology Ljubljana 0 15 0 1 0 1 0 2
ClinGen Hearing Loss Variant Curation Expert Panel 0 1 0 0 1 0 1 2
Department of Pediatrics, Union Hospital,Tongji Medical College, Huazhong University of Science and Technology 0 0 0 1 0 0 1 2
Institute for Genomic Medicine (IGM) Clinical Laboratory,Nationwide Children's Hospital 0 11 0 2 0 0 0 2
Codex Genetics Limited 0 4 0 1 0 1 0 2
Difficult and Complicated Liver Diseases and Artificial Liver Center,Beijing You An Hospital, Capital Medical University 0 0 0 0 0 2 0 2
Myelin Disorders Clinic-Children's Medical Center/Medical Genetics Lab-Tarbiat Modares University, Children's Medical Center, Pediatrics Center of Excellence, 0 0 0 0 0 0 2 2
Institut de Recherche Interdisciplinaire en Biologie Humaine et Moleculaire,Universite Libre de Bruxelles 0 3 0 2 0 0 0 2
Clinical Genomics Program, Stanford Medicine 0 8 0 1 0 0 1 2
GenomeConnect - Simons Searchlight 0 15 0 2 0 0 0 2
Laboratory of Molecular Genetics,National Medical Research Center for Therapy and Preventive Medicine 0 0 0 1 0 0 1 2
Claritas Genomics 0 8 0 1 0 0 0 1
Center for Advanced Molecular Diagnostics, Cytogenetics Laboratory,Brigham and Women's Hospital 0 0 0 0 0 1 0 1
Molecular Genetics Laboratory,Institute for Ophthalmic Research 0 10 0 0 0 0 1 1
Molecular Genetics Laboratory,Edith Wolfson Medical Center 0 0 0 1 0 0 0 1
Molecular Genetics Laboratory,Children's Mercy Hospital and Clinics 0 5 0 1 0 0 0 1
Molecular Genetics Laboratory,BC Children's and BC Women's Hospitals 0 20 0 1 0 0 0 1
FirmaLab,FirmaLab 0 3 0 0 0 0 1 1
Division of Human Genetics,Medical University Innsbruck 0 11 0 1 0 0 0 1
Victorian Clinical Genetics Services,Murdoch Childrens Research Institute 0 35 0 1 0 0 0 1
Richard Lifton Laboratory, Yale University School of Medicine 0 0 0 1 0 0 0 1
Endocrinology Clinic, Seth G.S. Medical College 0 0 0 1 0 0 0 1
Department of Neuroscience, King Faisal Specialist Hospital 0 0 0 0 0 0 1 1
UniProtKB/Swiss-Prot 0 93 0 1 0 0 0 1
SNPedia 0 7 0 0 0 1 0 1
Breast Cancer Information Core (BIC) (BRCA2) 0 11 0 0 0 0 1 1
Department of Prosthodontics,Peking University School and Hospital of Stomatology 0 4 0 0 0 1 0 1
Shenzhen Institute of Pediatrics,Shenzhen Children's Hospital 0 0 0 1 0 0 0 1
ITMI 0 16 0 1 0 0 0 1
Institute of Human Genetics,Friedrich-Alexander-Universität Erlangen-Nürnberg 0 12 0 1 0 0 0 1
Northcott Neuroscience Laboratory, ANZAC Research Institute 0 2 0 0 0 1 0 1
Genomics and Pathology Services,Washington University in St.Louis 0 1 0 1 0 0 0 1
Institute of Human Genetics,University Medical Center Hamburg-Eppendorf 0 1 0 1 0 0 0 1
Department of Molecular and Human Genetics, Baylor College of Medicine 0 9 0 0 0 0 1 1
Chan Lab,Boston Children's Hospital 0 0 0 1 0 0 0 1
Centre for Translational Omics - GOSgene,University College London 0 0 0 1 0 0 0 1
Centre for Human Genetics 0 1 0 1 0 0 0 1
Centre of Medical Genetics, University of Antwerp 0 3 0 1 0 0 0 1
Molecular Genetics Pathology Laboratory, University Of Arkansas for Medical Sciences 0 1 0 0 0 0 1 1
Medical Genetics, University of Parma 0 6 0 0 0 0 1 1
Molecular and Medical Genetics Group,King's College London 0 2 0 1 0 0 0 1
Leeds Amelogenesis Imperfecta Research Group, University of Leeds 0 1 0 1 0 0 0 1
Donald Williams Parsons Laboratory,Baylor College of Medicine 0 5 0 0 0 1 0 1
Reutter Lab, Institute of Human Genetics, University Hospital Bonn 0 0 0 0 0 0 1 1
Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA), c/o University of Cambridge 0 39 0 0 0 0 1 1
Institute of Experimental Endocrinology,Slovak Academy of Sciences 0 1 0 0 0 0 1 1
Daryl Scott Lab,Baylor College of Medicine 0 2 0 0 0 0 1 1
Neurogenetics Laboratory - MEYER,AOU Meyer 0 1 0 1 0 0 0 1
Unité de Différenciation Epithéliale et Auto-Immunité Rhumatoïde,INSERM - Université Paul Sabatier 0 0 0 1 0 0 0 1
The Molecular Genetic Diagnosis Center, Children’s Hospital of Fudan University 0 7 0 1 0 0 0 1
UMR-S1161,Institut national de la santé et de la recherche médicale 0 0 0 0 0 1 0 1
TIDEX, University of British Columbia 0 3 0 1 0 0 0 1
Geisinger Autism and Developmental Medicine Institute,Geisinger Health System 0 3 0 0 0 1 0 1
Genetics Department, University Hospital of Toulouse 0 0 0 1 0 0 0 1
Cirak Lab,University Hospital Cologne 0 2 0 1 0 0 0 1
Centre for Arab Genomic Studies,Sheikh Hamdan Award for Medical Sciences 0 3 0 1 0 0 0 1
Medical Genetics Laboratory,Bambino Gesù Children's Hospital 0 0 0 1 0 0 0 1
Human Genomics Unit,Institute for molecular medicine Finland (FIMM) 0 0 0 0 0 1 0 1
New Leaf Center 0 0 0 0 1 0 0 1
Institute for Genomic Medicine, Nationwide Children's Hospital 0 1 0 1 0 0 0 1
Department of Human Genetics, University Hospital Magdeburg 0 2 0 0 1 0 0 1
Pediatric Genomics Discovery Program,Yale University 0 0 0 1 0 0 0 1
Clinical Genetics Laboratory,Harran University 0 0 0 1 0 0 0 1
Center for Precision Medicine,Vanderbilt University Medical Center 0 2 0 0 0 1 0 1
Institute for Biomedicine,Eurac Research 0 0 0 1 0 0 0 1
The Danek Gertner Institute of Human Genetics,Sheba Medical Center 0 0 0 1 0 0 0 1
MK Azim Lab,Mohammad Ali Jinnah University 0 0 0 0 0 0 1 1
CIViC knowledgebase,Washington University School of Medicine 0 2 0 0 0 1 0 1
Cancer Diagnostics Division,Gene Solutions 0 0 0 1 0 0 0 1
Consultorio y Laboratorio de Neurogenética,Hospital JM Ramos Mejia 0 2 0 0 0 0 1 1
Marseille Medical Genetics, U1251,Aix Marseille University, Inserm 0 0 0 1 0 0 0 1
St. Jude Clinical Genomics Lab, St. Jude Children's Research Hospital 0 3 0 0 0 1 0 1
Institute of Neurogenomics,Technical University of Munich 0 0 0 0 0 0 1 1
Cole/Wambach Lab,Washington University in St. Louis 0 4 0 1 0 0 0 1
Institute of Clinical Molecular Biology,Kiel University 0 0 0 0 0 0 1 1
Myelin Disorders Clinic,Children's Medical Center 0 0 0 1 0 0 0 1
Sadaf Naz Human Genetics Laboratory,University of the Punjab 0 0 0 0 0 0 1 1
Molecular Dermatology Lab,Tel Aviv Sourasky Medical Center 0 0 0 0 0 0 1 1
Genetic Diseases Diagnostic Center,Koc University Hospital 0 0 0 1 0 0 0 1
Department of Pediatrics,University of Ottawa 0 0 0 0 0 0 1 1
University of Iowa Renal Genetics Clinic,University of Iowa 0 0 0 0 0 0 1 1
Medical Genetics Department,Assistance Publique Hopitaux de Marseille 0 0 0 1 0 0 0 1
Department of Genetics, Rouen University Hospital, Normandy Center for Genomic and Personalized Medicine 0 5 0 1 0 0 0 1
Institute for Genomic Statistics and Bioinformatics, University Hospital Bonn 0 29 0 1 0 0 0 1
Bioinformatics Institute,Agency for Science, Technology and Research 0 0 0 0 0 1 0 1
Laboratory of Clinical and Experimental Pathology,Xuzhou Medical University 0 0 0 0 0 1 0 1
ClinGen Myeloid Malignancy Variant Curation Expert Panel 0 7 0 1 0 0 0 1
CFTR-France 0 75 0 0 0 1 0 1
SavaGenome Genetic Health Clinic 0 0 0 0 0 0 1 1
Neuromuscular Department, Shariati Hospital, Tehran University of Medical Sciences 0 2 0 1 0 0 0 1
Swedish Neurofibromatosis Center,Swedish Medical Center 0 0 0 1 0 0 0 1
Autoinflammatory diseases unit,CHU de Montpellier 0 4 0 1 0 0 0 1
Division of Genomic Medicine, Department of Advanced Medicine, Medical Research Institute,Kanazawa Medical University 0 7 0 1 0 0 0 1
Genetics Institute, Tel Aviv Sourasky Medical Center 0 2 0 1 0 0 0 1
Medical Genetics Laboratory,Tarbiat Modares University 0 1 0 1 0 0 0 1
Institute of Medical Sciences, Banaras Hindu University 0 0 0 0 0 1 0 1
Institute for Medical Immunology,Charité - Universitätsmedizin Berlin 0 1 0 0 0 1 0 1
Laboratory of Genetics in Ophthalmology,Institut Imagine 0 45 0 1 0 0 0 1
Human Genetic Laboratory,University of Liege 0 0 0 0 0 0 1 1
MAGI's Lab - Research,MAGI Group 0 2 0 0 0 1 0 1
Genetics and Prenatal Diagnosis Center,The First Affiliated Hospital of Zhengzhou University 0 5 0 1 0 0 0 1
Molecular Genetics of Inherited Kidney Disorders Laboratory,Garvan Institute of Medical Research 0 0 0 0 0 1 0 1
Pars Genome Lab 0 0 0 1 0 0 0 1
Faculty of Health Sciences,Beirut Arab University 0 1 0 0 0 0 1 1
Department of Vascular Biology,Beijing Anzhen Hospital 0 0 0 1 0 0 0 1
RBC Disorders, Laboratory of Genetics and Genomics,Cincinnati Children's Hospital Medical Center 0 2 0 1 0 0 0 1
Practice for Gait Abnormalities, David Pomarino,Competency Network Toe Walking c/o Practice Pomarino 0 0 0 0 0 1 0 1
CMT Laboratory,Bogazici University 0 5 0 1 0 0 0 1
Neurogenetic Laboratory,Second Faculty of Medicine, Charles University 0 1 0 1 0 0 0 1

All variants with conflicting interpretations #

Total variants: 4338
Download table as spreadsheet
HGVS dbSNP
AGT, -6A HAPLOTYPE
ALOX5, VARIANT PROMOTER SP1 BINDING
CX3CR1:c.[841G>A;935C>T] (p.Val294Ile;Thr280Met)
CYP2A6*3
CYP2C19*3 rs4986893
CYP2C19*4A rs28399504
CYP2C19*5 rs56337013
CYP2C9*3 rs1057910
CYP2D6*10 rs1065852
CYP2D6*4 rs3892097
CYP2D6*6 rs5030655
FH Bologna 2
FH Cape Town 2
FH Vancouver 4
GNB3, 825C-T
GRCh37/hg19 19p13.2(chr19:11210898-11222316)
HBB, HBB/HBD FUSION
HBB, HBB/HBD FUSION, HBD137DEL
HLA-B*57:01
NC_000004.11:g.3076606GCA[(40_?)] rs71180116
NC_000006.11:g.5610223_5726369del
NC_000008.10:g.(?_6264113)_(6296618_6299587)del
NC_000008.11:g.11573132C>T rs61199332
NC_000015.9:g.68504037_68504039delGAT rs121908080
NC_012920.1:m.1494C>T rs267606619
NC_012920.1:m.1555A>G rs267606617
NG_008075.1(MPV17):g.16680_18253delinsCCTG
NG_008312.1(RAPSN):g.5005A>G rs786200905
NG_009629.1:g.4535G>A
NG_012123.1:g.2493A>G rs1024611
NM_000014.5(A2M):c.2126-6_2126-2del rs1799759
NM_000014.5(A2M):c.2998A>G (p.Ile1000Val) rs669
NM_000016.5(ACADM):c.351A>C (p.Thr117=) rs74090726
NM_000016.5(ACADM):c.362C>T (p.Thr121Ile) rs121434283
NM_000016.5(ACADM):c.577A>G (p.Thr193Ala) rs121434279
NM_000016.5(ACADM):c.583G>A (p.Gly195Arg) rs121434278
NM_000016.5(ACADM):c.734C>T (p.Ser245Leu) rs121434281
NM_000016.5(ACADM):c.799G>A (p.Gly267Arg) rs121434274
NM_000016.5(ACADM):c.999_1011dup (p.Gln338Ter) rs1225471006
NM_000016.6(ACADM):c.199T>C (p.Tyr67His) rs121434280
NM_000016.6(ACADM):c.985A>G (p.Lys329Glu) rs77931234
NM_000017.4(ACADS):c.1031A>G (p.Glu344Gly) rs387906950
NM_000017.4(ACADS):c.1058C>T (p.Ser353Leu) rs28941773
NM_000017.4(ACADS):c.1147C>T (p.Arg383Cys) rs28940872
NM_000017.4(ACADS):c.136C>T (p.Arg46Trp) rs121908003
NM_000017.4(ACADS):c.164C>T (p.Pro55Leu) rs147442301
NM_000017.4(ACADS):c.268G>A (p.Gly90Ser) rs121908005
NM_000017.4(ACADS):c.274G>T (p.Gly92Cys) rs121908004
NM_000017.4(ACADS):c.307GAG[1] (p.Glu104del) rs387906308
NM_000017.4(ACADS):c.319C>T (p.Arg107Cys) rs61732144
NM_000017.4(ACADS):c.323G>A (p.Gly108Asp) rs387906951
NM_000017.4(ACADS):c.511C>T (p.Arg171Trp) rs1800556
NM_000017.4(ACADS):c.529T>C (p.Trp177Arg) rs57443665
NM_000017.4(ACADS):c.575C>T (p.Ala192Val) rs28940874
NM_000017.4(ACADS):c.625G>A (p.Gly209Ser) rs1799958
NM_000017.4(ACADS):c.973C>T (p.Arg325Trp) rs121908006
NM_000018.2(ACADVL):c.343delG (p.Glu115Lysfs) rs387906249
NM_000018.4(ACADVL):c.1182+1G>A rs113690956
NM_000018.4(ACADVL):c.1246G>A (p.Ala416Thr) rs118204018
NM_000018.4(ACADVL):c.1837C>T (p.Arg613Trp) rs118204014
NM_000018.4(ACADVL):c.385GAG[1] (p.Glu130del) rs387906251
NM_000018.4(ACADVL):c.890AGA[2] (p.Lys299del) rs387906252
NM_000019.4(ACAT1):c.1032AGA[1] (p.Glu345del) rs387906282
NM_000019.4(ACAT1):c.1136G>T (p.Gly379Val) rs120074143
NM_000019.4(ACAT1):c.1138G>A (p.Ala380Thr) rs120074140
NM_000019.4(ACAT1):c.278A>G (p.Asn93Ser) rs120074145
NM_000019.4(ACAT1):c.433C>G (p.Gln145Glu) rs120074148
NM_000019.4(ACAT1):c.547G>A (p.Gly183Arg) rs120074141
NM_000019.4(ACAT1):c.935T>C (p.Ile312Thr) rs120074146
NM_000019.4(ACAT1):c.997G>C (p.Ala333Pro) rs120074147
NM_000020.2(ACVRL1):c.1120C>T (p.Arg374Trp) rs28936401
NM_000020.2(ACVRL1):c.1231C>T (p.Arg411Trp) rs121909287
NM_000020.2(ACVRL1):c.632G>A (p.Gly211Asp) rs28936687
NM_000021.4(PSEN1):c.1292C>A (p.Ala431Glu) rs63750083
NM_000021.4(PSEN1):c.236C>T (p.Ala79Val) rs63749824
NM_000021.4(PSEN1):c.254T>C (p.Leu85Pro) rs63750599
NM_000021.4(PSEN1):c.415A>G (p.Met139Val) rs63751037
NM_000021.4(PSEN1):c.436A>C (p.Met146Leu) rs63750306
NM_000021.4(PSEN1):c.509C>T (p.Ser170Phe) rs63750577
NM_000021.4(PSEN1):c.839A>C (p.Glu280Ala) rs63750231
NM_000022.2(ADA):c.22G>A (p.Asp8Asn) rs73598374
NM_000022.2(ADA):c.986C>T rs121908715
NM_000022.4(ADA):c.219-2A>G rs387906267
NM_000022.4(ADA):c.221G>T (p.Gly74Val) rs199422328
NM_000022.4(ADA):c.226C>T (p.Arg76Trp) rs121908736
NM_000022.4(ADA):c.239A>G (p.Lys80Arg) rs11555566
NM_000022.4(ADA):c.301C>T (p.Arg101Trp) rs121908717
NM_000022.4(ADA):c.320T>C (p.Leu107Pro) rs121908739
NM_000022.4(ADA):c.446G>A (p.Arg149Gln) rs121908737
NM_000022.4(ADA):c.454C>A (p.Leu152Met) rs121908728
NM_000022.4(ADA):c.466C>T (p.Arg156Cys) rs121908735
NM_000022.4(ADA):c.631C>T (p.Arg211Cys) rs121908740
NM_000022.4(ADA):c.632G>A (p.Arg211His) rs121908716
NM_000022.4(ADA):c.643G>A (p.Ala215Thr) rs114025668
NM_000022.4(ADA):c.698C>T (p.Thr233Ile) rs121908729
NM_000022.4(ADA):c.821C>T (p.Pro274Leu) rs121908738
NM_000022.4(ADA):c.872C>T (p.Ser291Leu) rs121908721
NM_000022.4(ADA):c.890C>A (p.Pro297Gln) rs121908718
NM_000022.4(ADA):c.911T>G (p.Leu304Arg) rs199422327
NM_000023.4(SGCA):c.293G>A (p.Arg98His) rs137852621
NM_000023.4(SGCA):c.850C>T (p.Arg284Cys) rs137852623
NM_000024.5(ADRB2):c.46A>G (p.Arg16Gly) rs1042713
NM_000026.4(ADSL):c.1264G>T (p.Asp422Tyr) rs119450943
NM_000026.4(ADSL):c.569G>A (p.Arg190Gln) rs28941471
NM_000026.4(ADSL):c.736A>G (p.Lys246Glu) rs119450944
NM_000027.4(AGA):c.102_108del (p.Thr33_Trp34insTer) rs386833417
NM_000027.4(AGA):c.127_128insATGCGG (p.Ala43_Trp44insAspAla) rs386833418
NM_000027.4(AGA):c.179G>A (p.Gly60Asp) rs121964907
NM_000027.4(AGA):c.302C>T (p.Ala101Val) rs121964908
NM_000027.4(AGA):c.800dup (p.Pro268fs) rs386833436
NM_000027.4(AGA):c.940+1G>T rs386833437
NM_000029.4(AGT):c.803T>C (p.Met268Thr) rs699
NM_000030.3(AGXT):c.1020A>G (p.Ile340Met) rs4426527
NM_000030.3(AGXT):c.245G>A (p.Gly82Glu) rs121908522
NM_000030.3(AGXT):c.32C>T (p.Pro11Leu) rs34116584
NM_000030.3(AGXT):c.508G>A (p.Gly170Arg) rs121908529
NM_000030.3(AGXT):c.697C>T (p.Arg233Cys) rs121908526
NM_000030.3(AGXT):c.698G>A (p.Arg233His) rs121908527
NM_000031.6(ALAD):c.36C>G (p.Phe12Leu) rs121912984
NM_000032.5(ALAS2):c.1699_1700del (p.Met567fs) rs387906473
NM_000032.5(ALAS2):c.1706_1709del (p.Glu569fs) rs387906472
NM_000033.4(ABCD1):c.1165C>G (p.Arg389Gly) rs128624215
NM_000033.4(ABCD1):c.1390C>T (p.Arg464Ter) rs128624221
NM_000033.4(ABCD1):c.1849C>T (p.Arg617Cys) rs4010613
NM_000035.4(ALDOB):c.1027T>C (p.Tyr343His) rs369586696
NM_000035.4(ALDOB):c.10C>T (p.Arg4Ter) rs118204428
NM_000035.4(ALDOB):c.136A>T (p.Arg46Trp) rs41281039
NM_000035.4(ALDOB):c.178C>T (p.Arg60Ter) rs118204429
NM_000035.4(ALDOB):c.360_363del (p.Asn120fs) rs387906225
NM_000035.4(ALDOB):c.625-1G>A rs1564077542
NM_000035.4(ALDOB):c.720C>A (p.Cys240Ter) rs118204426
NM_000036.2(AMPD1):c.1261C>T (p.Arg421Trp) rs35859650
NM_000036.2(AMPD1):c.133C>T (p.Gln45Ter) rs17602729
NM_000036.2(AMPD1):c.1373G>A (p.Arg458His) rs121912682
NM_000037.4(ANK1):c.1801-17G>A rs786205243
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000038.6(APC):c.3927_3931del (p.Glu1309fs) rs121913224
NM_000038.6(APC):c.3949G>C (p.Glu1317Gln) rs1801166
NM_000041.4(APOE):c.127C>T (p.Arg43Cys) rs121918399
NM_000041.4(APOE):c.388T>C (p.Cys130Arg) rs429358
NM_000041.4(APOE):c.487C>T (p.Arg163Cys) rs769455
NM_000043.6(FAS):c.695A>G (p.Tyr232Cys) rs121913079
NM_000043.6(FAS):c.749G>C (p.Arg250Pro) rs121913080
NM_000045.4(ARG1):c.871C>T (p.Arg291Ter) rs104893940
NM_000046.5(ARSB):c.1143-8T>G rs431905496
NM_000046.5(ARSB):c.1178A>C (p.His393Pro) rs118203944
NM_000046.5(ARSB):c.215T>A (p.Leu72Gln) rs397514441
NM_000046.5(ARSB):c.284G>A (p.Arg95Gln) rs118203942
NM_000047.2(ARSL):c.1732C>T (p.Pro578Ser) rs28935474
NM_000047.2(ARSL):c.1743G>A (p.Trp581Ter) rs80338714
NM_000047.2(ARSL):c.36G>C (p.Arg12Ser) rs122460151
NM_000047.2(ARSL):c.410G>T (p.Gly137Val) rs80338711
NM_000048.4(ASL):c.1135C>T (p.Arg379Cys) rs28940287
NM_000048.4(ASL):c.1153C>T (p.Arg385Cys) rs28940286
NM_000049.3(ASPA):c.746A>T (p.Asp249Val) rs104894552
NM_000049.4(ASPA):c.854A>C (p.Glu285Ala) rs28940279
NM_000050.4(ASS1):c.323G>T rs35269064
NM_000051.3(ATM):c.2839-579_2839-576del rs587776552
NM_000051.3(ATM):c.7271T>G (p.Val2424Gly) rs28904921
NM_000051.3(ATM):c.7327C>T (p.Arg2443Ter) rs121434220
NM_000051.4(ATM):c.1066-6T>G rs201686625
NM_000051.4(ATM):c.146C>G rs1800054
NM_000051.4(ATM):c.7875_7876delinsGC (p.Asp2625_Ala2626delinsGluPro) rs267606668
NM_000051.4(ATM):c.8575TCT[1] (p.Ser2860del) rs786203976
NM_000053.4(ATP7B):c.1708-1G>C rs137853280
NM_000053.4(ATP7B):c.1934T>G (p.Met645Arg) rs121907998
NM_000053.4(ATP7B):c.2071G>A (p.Gly691Arg) rs121908001
NM_000053.4(ATP7B):c.2333G>T (p.Arg778Leu) rs28942074
NM_000053.4(ATP7B):c.2621C>T (p.Ala874Val) rs121907994
NM_000053.4(ATP7B):c.2827G>A (p.Gly943Ser) rs28942076
NM_000053.4(ATP7B):c.3207C>A (p.His1069Gln) rs76151636
NM_000053.4(ATP7B):c.3796G>A (p.Gly1266Arg) rs121907992
NM_000055.4(BCHE):c.1004T>C (p.Leu335Pro) rs104893684
NM_000059.3(BRCA2):c.8165C>G (p.Thr2722Arg) rs80359062
NM_000059.3(BRCA2):c.8187G>T (p.Lys2729Asn) rs80359065
NM_000059.4(BRCA2):c.1114A>C (p.Asn372His) rs144848
NM_000059.4(BRCA2):c.3901ACT[1] (p.Thr1302del) rs80359414
NM_000059.4(BRCA2):c.5645C>G (p.Ser1882Ter) rs80358785
NM_000059.4(BRCA2):c.5946del (p.Ser1982fs) rs80359550
NM_000059.4(BRCA2):c.658_659del rs80359604
NM_000059.4(BRCA2):c.7007G>A (p.Arg2336His) rs28897743
NM_000061.2(BTK):c.1625T>C (p.Leu542Pro) rs128621203
NM_000061.2(BTK):c.1773C>A (p.Tyr591Ter) rs128621207
NM_000063.6(C2):c.954G>C (p.Glu318Asp) rs9332739
NM_000064.4(C3):c.304C>G (p.Arg102Gly) rs2230199
NM_000064.4(C3):c.3343G>A (p.Asp1115Asn) rs121909585
NM_000064.4(C3):c.463A>C (p.Lys155Gln) rs147859257
NM_000067.3(CA2):c.754A>G (p.Asn252Asp) rs2228063
NM_000069.3(CACNA1S):c.1583G>A (p.Arg528His) rs80338777
NM_000069.3(CACNA1S):c.2691G>T (p.Arg897Ser) rs80338779
NM_000069.3(CACNA1S):c.3715C>G (p.Arg1239Gly) rs28930069
NM_000069.3(CACNA1S):c.3716G>A (p.Arg1239His) rs28930068
NM_000070.3(CAPN3):c.1469G>A (p.Arg490Gln) rs121434548
NM_000070.3(CAPN3):c.1715G>A (p.Arg572Gln) rs121434544
NM_000070.3(CAPN3):c.1795dup (p.Thr599fs) rs80338803
NM_000070.3(CAPN3):c.2306G>A (p.Arg769Gln) rs80338802
NM_000070.3(CAPN3):c.2362_2363delinsTCATCT (p.Arg788fs) rs1555423217
NM_000070.3(CAPN3):c.550del (p.Thr184fs) rs80338800
NM_000070.3(CAPN3):c.956C>T (p.Pro319Leu) rs121434547
NM_000071.2(CBS):c.1265C>T (p.Pro422Leu) rs28934892
NM_000071.2(CBS):c.1330G>A (p.Asp444Asn) rs28934891
NM_000071.2(CBS):c.1397C>T (p.Ser466Leu) rs121964971
NM_000071.2(CBS):c.502G>A (p.Val168Met) rs121964970
NM_000074.2(CD40LG):c.107T>G (p.Met36Arg) rs104894774
NM_000075.4(CDK4):c.70C>T (p.Arg24Cys) rs11547328
NM_000078.3(CETP):c.1376A>G (p.Asp459Gly) rs2303790
NM_000080.4(CHRNE):c.37G>A (p.Gly13Arg) rs372635387
NM_000080.4(CHRNE):c.710G>T (p.Arg237Leu) rs201434993
NM_000082.3(ERCC8):c.479C>T (p.Ala160Val) rs121434325
NM_000082.3(ERCC8):c.613G>C (p.Ala205Pro) rs121434326
NM_000083.3(CLCN1):c.1655A>G (p.Gln552Arg) rs80356696
NM_000083.3(CLCN1):c.2680C>T (p.Arg894Ter) rs55960271
NM_000083.3(CLCN1):c.950G>A (p.Arg317Gln) rs80356702
NM_000085.4(CLCNKB):c.1312C>T (p.Arg438Cys) rs121909133
NM_000085.5(CLCNKB):c.610G>A rs121909132
NM_000086.2(CLN3):c.461-280_677+382del rs1555468634
NM_000087.3(CNGA1):c.959C>T rs62625014
NM_000088.3(COL1A1):c.3040C>T (p.Arg1014Cys) rs72653170
NM_000090.3(COL3A1):c.1997G>A (p.Gly666Asp) rs121912921
NM_000090.3(COL3A1):c.3518G>A (p.Gly1173Glu) rs121912918
NM_000090.3(COL3A1):c.3851G>A (p.Gly1284Glu) rs587779528
NM_000090.3(COL3A1):c.582+5G>A (p.Gly177_Pro194del) rs587779671
NM_000090.3(COL3A1):c.889G>A (p.Gly297Arg) rs1553507557
NM_000091.4(COL4A3):c.4571C>G (p.Ser1524Ter) rs121912825
NM_000092.4(COL4A4):c.2690G>A (p.Gly897Glu) rs121912860
NM_000094.3(COL7A1):c.6017G>A (p.Gly2006Asp) rs121912842
NM_000094.4(COL7A1):c.5096C>T rs121912845
NM_000095.2(COMP):c.1417_1419dupGAC (p.Asp473_Asn474insAsp) rs193922900
NM_000095.3(COMP):c.1569C>G (p.Asn523Lys) rs137852654
NM_000095.3(COMP):c.2152C>T (p.Arg718Trp) rs28936368
NM_000096.3(CP):c.606dupA (p.Asp203Argfs) rs386134143
NM_000096.4(CP):c.1282_1286dup (p.Asp430fs) rs386134145
NM_000096.4(CP):c.2389del (p.Glu797fs) rs386134149
NM_000096.4(CP):c.2630G>A (p.Trp877Ter) rs121909579
NM_000096.4(CP):c.3019-1G>A rs386134142
NM_000097.7(CPOX):c.1339C>T (p.Arg447Cys) rs28931603
NM_000098.3(CPT2):c.1148T>A (p.Phe383Tyr) rs74315295
NM_000098.3(CPT2):c.1883A>C (p.Tyr628Ser) rs28936673
NM_000098.3(CPT2):c.359A>G (p.Tyr120Cys) rs121918528
NM_000098.3(CPT2):c.520G>A (p.Glu174Lys) rs28936674
NM_000099.4(CST3):c.73G>A (p.Ala25Thr) rs1064039
NM_000101.4(CYBA):c.214T>C (p.Tyr72His) rs4673
NM_000101.4(CYBA):c.354C>A (p.Ser118Arg) rs104894514
NM_000102.4(CYP17A1):c.1247G>A (p.Arg416His) rs104894155
NM_000102.4(CYP17A1):c.287G>A (p.Arg96Gln) rs104894153
NM_000102.4(CYP17A1):c.374G>A (p.Arg125Gln) rs104894154
NM_000102.4(CYP17A1):c.715C>T (p.Arg239Ter) rs104894136
NM_000103.4(CYP19A1):c.1303C>T (p.Arg435Cys) rs121434534
NM_000104.3(CYP1B1):c.1103G>A (p.Arg368His) rs79204362
NM_000104.3(CYP1B1):c.1120G>A (p.Asp374Asn) rs104893622
NM_000104.3(CYP1B1):c.1159G>A (p.Glu387Lys) rs55989760
NM_000104.3(CYP1B1):c.155C>T (p.Pro52Leu) rs201824781
NM_000104.4(CYP1B1):c.182G>A rs28936700
NM_000106.5(CYP2D6):c.505G>T (p.Gly169Ter) rs5030865
NM_000106.5(CYP2D6):c.775delA (p.Arg259Glyfs) rs35742686
NM_000108.5(DLD):c.1123G>A (p.Glu375Lys) rs121964992
NM_000108.5(DLD):c.1436A>T (p.Asp479Val) rs397514649
NM_000108.5(DLD):c.875+1G>A rs1328820332
NM_000109.4(DMD):c.69+5590T>A rs1557211730
NM_000110.3(DPYD):c.2657G>A (p.Arg886His) rs1801267
NM_000110.4(DPYD):c.1905+1G>A rs3918290
NM_000111.2(SLC26A3):c.2024_2026dup (p.Ile675dup) rs121913031
NM_000111.3(SLC26A3):c.1652del (p.Phe551fs) rs1584403556
NM_000112.3(SLC26A2):c.-26+2T>C rs386833492
NM_000112.3(SLC26A2):c.1724del (p.Lys575fs) rs386833498
NM_000112.3(SLC26A2):c.1957T>A (p.Cys653Ser) rs104893924
NM_000112.3(SLC26A2):c.391del (p.Leu131fs) rs786200881
NM_000112.3(SLC26A2):c.532C>T (p.Arg178Ter) rs104893919
NM_000112.4(SLC26A2):c.835C>T (p.Arg279Trp) rs104893915
NM_000113.3(TOR1A):c.613T>A (p.Phe205Ile) rs267607134
NM_000113.3(TOR1A):c.646G>C (p.Asp216His) rs1801968
NM_000113.3(TOR1A):c.863G>A (p.Arg288Gln) rs727502811
NM_000113.3(TOR1A):c.907_909delGAG (p.Glu303del) rs80358233
NM_000118.3(ENG):c.360+4A>G rs1564457752
NM_000119.2(EPB42):c.424G>A (p.Ala142Thr) rs104894487
NM_000120.4(EPHX1):c.337T>C (p.Tyr113His) rs1051740
NM_000120.4(EPHX1):c.416A>G (p.His139Arg) rs2234922
NM_000121.4(EPOR):c.1317G>A (p.Trp439Ter) rs121918116
NM_000121.4(EPOR):c.1460A>G (p.Asn487Ser) rs62638745
NM_000123.3(ERCC5):c.2375C>T (p.Ala792Val) rs121434571
NM_000123.3(ERCC5):c.2620G>A (p.Ala874Thr) rs121434576
NM_000124.4(ERCC6):c.1518del (p.Lys506fs) rs786205168
NM_000124.4(ERCC6):c.3284C>G (p.Pro1095Arg) rs4253208
NM_000125.3(ESR1):c.1181G>A (p.Arg394His) rs1131692059
NM_000128.3(F11):c.1253G>T (p.Gly418Val) rs121965071
NM_000128.3(F11):c.166T>C (p.Cys56Arg) rs121965069
NM_000128.3(F11):c.438C>A (p.Cys146Ter) rs121965066
NM_000128.3(F11):c.809A>T (p.Lys270Ile) rs121965070
NM_000128.3(F11):c.901T>C (p.Phe301Leu) rs121965064
NM_000128.3(F11):c.976C>T (p.Arg326Cys) rs28934608
NM_000129.3(F13A1):c.103G>T (p.Val35Leu) rs5985
NM_000129.3(F13A1):c.782G>A (p.Arg261His) rs121913071
NM_000130.4(F5):c.1601G>A (p.Arg534Gln) rs6025
NM_000130.4(F5):c.6304C>T (p.Arg2102Cys) rs118203910
NM_000132.3(F8):c.3169G>A (p.Glu1057Lys) rs28933673
NM_000132.3(F8):c.5422C>T (p.Leu1808Phe) rs137852445
NM_000132.3(F8):c.592T>G (p.Cys198Gly) rs137852475
NM_000133.3(F9):c.580A>G (p.Thr194Ala) rs6048
NM_000133.3(F9):c.819T>C (p.Val273=) rs1800455
NM_000133.3(F9):c.907C>T (p.His303Tyr) rs1801202
NM_000135.2(FANCA):c.3788_3790delTCT (p.Phe1263del) rs397507553
NM_000135.4(FANCA):c.1115_1118del (p.Val372fs) rs397507552
NM_000135.4(FANCA):c.2557C>T (p.Arg853Ter) rs752160950
NM_000135.4(FANCA):c.2639G>A (p.Arg880Gln) rs372254398
NM_000135.4(FANCA):c.3913C>T (p.Leu1305Phe) rs753700179
NM_000136.3(FANCC):c.1642C>T (p.Arg548Ter) rs104886457
NM_000136.3(FANCC):c.1661T>C (p.Leu554Pro) rs104886458
NM_000136.3(FANCC):c.37C>T (p.Gln13Ter) rs121917784
NM_000137.3(FAH):c.1009G>A (p.Gly337Ser) rs80338900
NM_000137.3(FAH):c.1021C>T (p.Arg341Trp) rs11555096
NM_000137.3(FAH):c.1141A>G (p.Arg381Gly) rs121965077
NM_000137.3(FAH):c.401C>A (p.Ala134Asp) rs121965074
NM_000137.3(FAH):c.554-1G>T rs80338895
NM_000137.3(FAH):c.786G>A (p.Trp262Ter) rs80338899
NM_000137.3(FAH):c.836A>G (p.Gln279Arg) rs121965078
NM_000137.4(FAH):c.1062+5G>A rs80338901
NM_000138.4(FBN1):c.2261A>G (p.Tyr754Cys) rs137854479
NM_000138.4(FBN1):c.2920C>T (p.Arg974Cys) rs397514558
NM_000138.4(FBN1):c.3379G>A (p.Gly1127Ser) rs137854468
NM_000138.4(FBN1):c.3725G>A (p.Cys1242Tyr) rs137854471
NM_000138.4(FBN1):c.6431A>G (p.Asn2144Ser) rs137854461
NM_000138.4(FBN1):c.7726C>T (p.Arg2576Cys) rs147195031
NM_000138.4(FBN1):c.8176C>T (p.Arg2726Trp) rs61746008
NM_000138.4(FBN1):c.8326C>T (p.Arg2776Ter) rs137854466
NM_000138.5(FBN1):c.1453C>T (p.Arg485Cys) rs137854485
NM_000138.5(FBN1):c.5788+5G>A rs193922219
NM_000138.5(FBN1):c.718C>T (p.Arg240Cys) rs137854480
NM_000140.4(FECH):c.163G>T (p.Gly55Cys) rs3848519
NM_000140.4(FECH):c.315-48T>C rs2272783
NM_000140.4(FECH):c.801G>A (p.Met267Ile) rs118204037
NM_000141.5(FGFR2):c.1025G>A (p.Cys342Tyr) rs121918487
NM_000141.5(FGFR2):c.1124A>G (p.Tyr375Cys) rs121913478
NM_000141.5(FGFR2):c.1694A>C (p.Glu565Ala) rs121918506
NM_000141.5(FGFR2):c.755C>G (p.Ser252Trp) rs79184941
NM_000141.5(FGFR2):c.755_756delinsTT (p.Ser252Phe) rs121918498
NM_000142.5(FGFR3):c.1024G>T (p.Gly342Cys) rs587778775
NM_000142.5(FGFR3):c.1108G>T (p.Gly370Cys) rs121913479
NM_000142.5(FGFR3):c.1111A>T (p.Ser371Cys) rs121913484
NM_000142.5(FGFR3):c.1118A>G (p.Tyr373Cys) rs121913485
NM_000142.5(FGFR3):c.1138G>A rs28931614
NM_000142.5(FGFR3):c.1612A>G (p.Ile538Val) rs80053154
NM_000142.5(FGFR3):c.1619A>C (p.Asn540Thr) rs77722678
NM_000142.5(FGFR3):c.1619A>G (p.Asn540Ser) rs77722678
NM_000142.5(FGFR3):c.1620C>A (p.Asn540Lys) rs28933068
NM_000142.5(FGFR3):c.1620C>G (p.Asn540Lys) rs28933068
NM_000142.5(FGFR3):c.1948A>C (p.Lys650Gln) rs78311289
NM_000142.5(FGFR3):c.1948A>G (p.Lys650Glu) rs78311289
NM_000142.5(FGFR3):c.1949A>T (p.Lys650Met) rs121913105
NM_000142.5(FGFR3):c.1950G>T (p.Lys650Asn) rs28928868
NM_000142.5(FGFR3):c.2419T>A (p.Ter807Arg) rs121913101
NM_000142.5(FGFR3):c.2419T>G (p.Ter807Gly) rs121913101
NM_000142.5(FGFR3):c.2421A>T (p.Ter807Cys) rs121913103
NM_000142.5(FGFR3):c.251C>T (p.Ser84Leu) rs121913116
NM_000142.5(FGFR3):c.742C>T (p.Arg248Cys) rs121913482
NM_000142.5(FGFR3):c.749C>G (p.Pro250Arg) rs4647924
NM_000142.5(FGFR3):c.833A>G (p.Tyr278Cys) rs121913115
NM_000143.3(FH):c.521C>G (p.Pro174Arg) rs199822819
NM_000143.3(FH):c.698G>T (p.Arg233Leu) rs121913123
NM_000143.4(FH):c.1390+1G>T rs886039367
NM_000143.4(FH):c.1431_1433dup (p.Lys477dup) rs367543046
NM_000145.3(FSHR):c.1760C>A (p.Pro587His) rs386833512
NM_000145.3(FSHR):c.479T>C (p.Ile160Thr) rs121909659
NM_000145.3(FSHR):c.919G>A (p.Ala307Thr) rs6165
NM_000150.2(FUT6):c.739G>A (p.Glu247Lys) rs17855739
NM_000151.4(G6PC1):c.113A>T (p.Asp38Val) rs104894565
NM_000151.4(G6PC1):c.229T>C (p.Trp77Arg) rs104894566
NM_000151.4(G6PC1):c.247C>T (p.Arg83Cys) rs1801175
NM_000151.4(G6PC1):c.328G>A (p.Glu110Lys) rs104894567
NM_000151.4(G6PC1):c.370G>A (p.Ala124Thr) rs104894568
NM_000151.4(G6PC1):c.648G>T (p.Leu216=) rs80356484
NM_000151.4(G6PC1):c.883C>T (p.Arg295Cys) rs104894563
NM_000152.3(GAA):c.2065G>A (p.Glu689Lys) rs1800309
NM_000152.5(GAA):c.2483_2646+1del rs1555603048
NM_000152.5(GAA):c.2560C>T (p.Arg854Ter) rs121907943
NM_000152.5(GAA):c.271G>A (p.Asp91Asn) rs1800299
NM_000152.5(GAA):c.525del (p.Glu176fs) rs386834235
NM_000152.5(GAA):c.953T>C (p.Met318Thr) rs121907936
NM_000153.4(GALC):c.857G>A (p.Gly286Asp) rs199847983
NM_000154.2(GALK1):c.593C>T (p.Ala198Val) rs80084721
NM_000154.2(GALK1):c.94G>A (p.Val32Met) rs104894576
NM_000155.2(GALT):c.-119_-116delGTCA rs111033640
NM_000155.4(GALT):c.221T>C (p.Leu74Pro) rs111033663
NM_000155.4(GALT):c.404C>T (p.Ser135Leu) rs111033690
NM_000155.4(GALT):c.512T>C (p.Phe171Ser) rs111033715
NM_000155.4(GALT):c.547C>A (p.Pro183Thr) rs111033721
NM_000155.4(GALT):c.563A>G (p.Gln188Arg) rs75391579
NM_000155.4(GALT):c.607G>A (p.Glu203Lys) rs111033736
NM_000155.4(GALT):c.940A>G (p.Asn314Asp) rs2070074
NM_000155.4(GALT):c.957C>A (p.His319Gln) rs111033792
NM_000155.4(GALT):c.997C>T (p.Arg333Trp) rs111033800
NM_000156.6(GAMT):c.59G>C (p.Trp20Ser) rs80338734
NM_000157.3(GBA):c.1448T>C rs421016
NM_000157.4(GBA):c.1208G>C (p.Ser403Thr) rs121908307
NM_000157.4(GBA):c.1226A>G (p.Asn409Ser) rs76763715
NM_000157.4(GBA):c.1297G>T (p.Val433Leu) rs80356769
NM_000157.4(GBA):c.1342G>C (p.Asp448His) rs1064651
NM_000158.4(GBE1):c.1543C>T (p.Arg515Cys) rs80338672
NM_000158.4(GBE1):c.1544G>A (p.Arg515His) rs201958741
NM_000158.4(GBE1):c.1570C>T (p.Arg524Ter) rs137852888
NM_000158.4(GBE1):c.771T>A (p.Phe257Leu) rs137852887
NM_000159.4(GCDH):c.1093G>A (p.Glu365Lys) rs121434370
NM_000159.4(GCDH):c.1198G>A (p.Val400Met) rs121434372
NM_000159.4(GCDH):c.1204C>T (p.Arg402Trp) rs121434369
NM_000159.4(GCDH):c.877G>A (p.Ala293Thr) rs121434371
NM_000161.3(GCH1):c.586G>T (p.Ala196Ser) rs104894436
NM_000162.5(GCK):c.629T>A (p.Met210Lys) rs80356654
NM_000162.5(GCK):c.683C>T (p.Thr228Met) rs80356655
NM_000163.5(GHR):c.535C>T (p.Arg179Cys) rs121909362
NM_000165.5(GJA1):c.1127G>A (p.Arg376Gln) rs104893965
NM_000165.5(GJA1):c.226C>A (p.Arg76Ser) rs267606845
NM_000166.6(GJB1):c.164C>T (p.Thr55Ile) rs104894824
NM_000166.6(GJB1):c.407T>C (p.Val136Ala) rs104894826
NM_000166.6(GJB1):c.415G>A (p.Val139Met) rs104894812
NM_000166.6(GJB1):c.614A>G (p.Asn205Ser) rs104894822
NM_000166.6(GJB1):c.704T>G (p.Phe235Cys) rs104894825
NM_000168.5(GLI3):c.2770_2771insNC_012920.1:g.12243..12314
NM_000168.6(GLI3):c.2012del (p.Gly671fs) rs116840743
NM_000168.6(GLI3):c.2023del (p.Glu675fs) rs116840744
NM_000168.6(GLI3):c.2179G>A (p.Gly727Arg) rs121917710
NM_000168.6(GLI3):c.2188_2206del (p.Leu730fs) rs116840754
NM_000168.6(GLI3):c.3439G>T (p.Glu1147Ter) rs116840768
NM_000169.2(GLA):c.1277_1278del (p.Lys426fs) rs869312249
NM_000169.2(GLA):c.484T>C (p.Trp162Arg) rs28935196
NM_000169.3(GLA):c.427G>A (p.Ala143Thr) rs104894845
NM_000169.3(GLA):c.427G>C (p.Ala143Pro) rs104894845
NM_000169.3(GLA):c.640-801G>A rs199473684
NM_000169.3(GLA):c.937G>T (p.Asp313Tyr) rs28935490
NM_000170.2(GLDC):c.1545G>C (p.Arg515Ser) rs121964976
NM_000170.2(GLDC):c.1691G>T (p.Ser564Ile) rs121964974
NM_000170.2(GLDC):c.2216G>A (p.Arg739His) rs121964980
NM_000170.2(GLDC):c.2267_2269del (p.Phe756del) rs121964975
NM_000171.4(GLRA1):c.690C>A (p.Tyr230Ter) rs121918415
NM_000171.4(GLRA1):c.777C>G (p.Ser259Arg) rs121918417
NM_000171.4(GLRA1):c.815T>A (p.Ile272Asn) rs121918409
NM_000171.4(GLRA1):c.832C>A (p.Pro278Thr) rs121918413
NM_000171.4(GLRA1):c.862G>A (p.Val288Met) rs121918416
NM_000171.4(GLRA1):c.882G>C (p.Gln294His) rs121918411
NM_000171.4(GLRA1):c.896G>A (p.Arg299Gln) rs121918408
NM_000171.4(GLRA1):c.896G>T (p.Arg299Leu) rs121918408
NM_000171.4(GLRA1):c.910A>G (p.Lys304Glu) rs121918412
NM_000171.4(GLRA1):c.920A>G (p.Tyr307Cys) rs121918410
NM_000174.4(GP9):c.212T>C (p.Phe71Ser) rs121918037
NM_000178.4(GSS):c.941C>T (p.Pro314Leu) rs75863437
NM_000179.2(MSH6):c.2633T>C (p.Val878Ala) rs2020912
NM_000179.3(MSH6):c.10C>T (p.Gln4Ter) rs786201042
NM_000180.3(GUCY2D):c.389del (p.Pro130Leufs) rs61749670
NM_000180.4(GUCY2D):c.2302C>T (p.Arg768Trp) rs61750168
NM_000180.4(GUCY2D):c.2513G>A (p.Arg838His) rs61750173
NM_000180.4(GUCY2D):c.2798T>C (p.Val933Ala) rs1567961904
NM_000181.4(GUSB):c.1069C>T (p.Arg357Ter) rs121918185
NM_000181.4(GUSB):c.1144C>T (p.Arg382Cys) rs121918173
NM_000182.5(HADHA):c.180+1G>A rs786205088
NM_000185.4(SERPIND1):c.623G>A (p.Arg208His) rs5907
NM_000186.3(CFH):c.184G>A (p.Val62Ile) rs800292
NM_000186.3(CFH):c.2697T>A (p.Tyr899Ter) rs121913057
NM_000186.3(CFH):c.3572C>T (p.Ser1191Leu) rs460897
NM_000186.3(CFH):c.3628C>T (p.Arg1210Cys) rs121913059
NM_000187.4(HGD):c.1102A>G (p.Met368Val) rs120074173
NM_000187.4(HGD):c.16-1G>A rs397515347
NM_000187.4(HGD):c.175del (p.Ser59fs) rs397515517
NM_000187.4(HGD):c.457dup (p.Asp153fs) rs397515346
NM_000187.4(HGD):c.481G>A (p.Gly161Arg) rs28941783
NM_000187.4(HGD):c.688C>T (p.Pro230Ser) rs28942100
NM_000187.4(HGD):c.808G>A (p.Gly270Arg) rs120074174
NM_000187.4(HGD):c.899T>G (p.Val300Gly) rs120074170
NM_000188.3(HK1):c.2539G>A (p.Glu847Lys) rs777849213
NM_000190.4(HMBS):c.500G>A (p.Arg167Gln) rs118204095
NM_000190.4(HMBS):c.667G>A (p.Glu223Lys) rs118204110
NM_000190.4(HMBS):c.754G>A (p.Ala252Thr) rs118204113
NM_000191.3(HMGCL):c.206_207del (p.Ser69fs) rs752137615
NM_000191.3(HMGCL):c.208G>C (p.Val70Leu) rs121964996
NM_000193.4(SHH):c.1132_1140del (p.Ala378_Phe380del) rs397515376
NM_000193.4(SHH):c.1147G>A (p.Ala383Thr) rs137853341
NM_000193.4(SHH):c.1270C>G (p.Pro424Ala) rs104894048
NM_000193.4(SHH):c.263A>T (p.Asp88Val) rs104894050
NM_000193.4(SHH):c.298C>T (p.Gln100Ter) rs104894044
NM_000193.4(SHH):c.313A>T (p.Lys105Ter) rs104894045
NM_000193.4(SHH):c.345C>A (p.Asn115Lys) rs267607047
NM_000193.4(SHH):c.349T>C (p.Trp117Arg) rs104894040
NM_000193.4(SHH):c.349T>G (p.Trp117Gly) rs104894040
NM_000193.4(SHH):c.671T>A (p.Val224Glu) rs104894042
NM_000193.4(SHH):c.676G>A (p.Ala226Thr) rs104894043
NM_000193.4(SHH):c.766G>T (p.Glu256Ter) rs104894051
NM_000193.4(SHH):c.788_808del (p.Arg263_Ala269del) rs397515375
NM_000193.4(SHH):c.850G>T (p.Glu284Ter) rs104894046
NM_000193.4(SHH):c.869G>A (p.Gly290Asp) rs104894047
NM_000193.4(SHH):c.91G>A (p.Gly31Arg) rs28936675
NM_000194.2(HPRT1):c.151C>T (p.Arg51Ter) rs137852494
NM_000194.2(HPRT1):c.170T>C (p.Met57Thr) rs137852495
NM_000194.2(HPRT1):c.211G>C (p.Gly71Arg) rs137852488
NM_000195.5(HPS1):c.1472_1487dup (p.His497fs) rs281865163
NM_000195.5(HPS1):c.1996G>T (p.Glu666Ter) rs121908385
NM_000195.5(HPS1):c.397G>T (p.Glu133Ter) rs121908386
NM_000195.5(HPS1):c.398+5G>A rs281865077
NM_000195.5(HPS1):c.972del (p.Met325fs) rs281865082
NM_000195.5(HPS1):c.972dup (p.Met325fs) rs281865082
NM_000196.4(HSD11B2):c.622C>T (p.Arg208Cys) rs121917780
NM_000199.5(SGSH):c.1105G>A (p.Glu369Lys) rs104894640
NM_000199.5(SGSH):c.1298G>A (p.Arg433Gln) rs104894641
NM_000199.5(SGSH):c.1339G>A (p.Glu447Lys) rs104894639
NM_000199.5(SGSH):c.220C>T (p.Arg74Cys) rs104894636
NM_000199.5(SGSH):c.449G>A (p.Arg150Gln) rs104894638
NM_000199.5(SGSH):c.617G>C (p.Arg206Pro) rs104894643
NM_000202.8(IDS):c.1122C>T (p.Gly374=) rs113993948
NM_000202.8(IDS):c.514C>T (p.Arg172Ter) rs104894860
NM_000202.8(IDS):c.998C>T (p.Ser333Leu) rs104894853
NM_000203.5(IDUA):c.590-7G>A rs762411583
NM_000204.4(CFI):c.355G>A (p.Gly119Arg) rs141853578
NM_000209.4(PDX1):c.226G>A (p.Asp76Asn) rs137852783
NM_000209.4(PDX1):c.492G>T (p.Glu164Asp) rs80356661
NM_000209.4(PDX1):c.52T>C (p.Cys18Arg) rs137852785
NM_000209.4(PDX1):c.532G>A (p.Glu178Lys) rs80356662
NM_000209.4(PDX1):c.670G>A (p.Glu224Lys) rs137852787
NM_000211.5(ITGB2):c.817G>A (p.Gly273Arg) rs137852618
NM_000214.3(JAG1):c.701G>A (p.Cys234Tyr) rs121918353
NM_000217.3(KCNA1):c.676A>G (p.Thr226Ala) rs104894354
NM_000217.3(KCNA1):c.677C>G (p.Thr226Arg) rs28933383
NM_000219.6(KCNE1):c.226G>A (p.Asp76Asn) rs74315445
NM_000219.6(KCNE1):c.253G>A (p.Asp85Asn) rs1805128
NM_000222.2(KIT):c.1676T>A (p.Val559Asp) rs121913517
NM_000224.3(KRT18):c.383A>T (p.His128Leu) rs57758506
NM_000228.3(LAMB3):c.124C>T (p.Arg42Ter) rs80356680
NM_000228.3(LAMB3):c.1903C>T (p.Arg635Ter) rs80356682
NM_000231.2(SGCG):c.848G>A (p.Cys283Tyr) rs104894422
NM_000231.3(SGCG):c.787G>A (p.Glu263Lys) rs104894423
NM_000232.4(SGCB):c.299T>A (p.Met100Lys) rs104893871
NM_000232.4(SGCB):c.452C>G (p.Thr151Arg) rs28936383
NM_000232.4(SGCB):c.552T>G (p.Tyr184Ter) rs104893868
NM_000235.4(LIPA):c.482del (p.Asn161fs) rs762559980
NM_000235.4(LIPA):c.594dup (p.Ala199fs) rs780495201
NM_000235.4(LIPA):c.599T>C (p.Leu200Pro) rs121965086
NM_000236.2(LIPC):c.-293G>A rs2070895
NM_000236.3(LIPC):c.1214C>T (p.Thr405Met) rs113298164
NM_000236.3(LIPC):c.866C>T (p.Ser289Phe) rs121912502
NM_000237.3(LPL):c.*1671T>C rs13702
NM_000237.3(LPL):c.106G>A (p.Asp36Asn) rs1801177
NM_000237.3(LPL):c.953A>G (p.Asn318Ser) rs268
NM_000238.4(KCNH2):c.2738C>T (p.Ala913Val) rs77331749
NM_000240.3(MAOA):c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5)
NM_000243.2(MEFV):c.1437C>G (p.Phe479Leu) rs104895083
NM_000243.2(MEFV):c.1958G>A (p.Arg653His) rs104895085
NM_000243.2(MEFV):c.2084A>G rs104895094
NM_000243.2(MEFV):c.2230G>T rs61732874
NM_000243.2(MEFV):c.443A>T (p.Glu148Val) rs104895076
NM_000243.2(MEFV):c.501G>C (p.Glu167Asp) rs104895079
NM_000243.2(MEFV):c.800C>T (p.Thr267Ile) rs104895081
NM_000243.3(MEFV):c.1105C>T rs11466023
NM_000243.3(MEFV):c.1223G>A rs11466024
NM_000243.3(MEFV):c.2040G>A rs28940580
NM_000243.3(MEFV):c.2076_2078del (p.Ile692del) rs104895093
NM_000243.3(MEFV):c.2080A>G rs61752717
NM_000243.3(MEFV):c.2082G>A rs28940578
NM_000243.3(MEFV):c.2177T>C (p.Val726Ala) rs28940579
NM_000243.3(MEFV):c.2282G>A (p.Arg761His) rs104895097
NM_000243.3(MEFV):c.442G>C rs3743930
NM_000243.3(MEFV):c.726C>G (p.Ser242Arg) rs104895127
NM_000244.3(MEN1):c.65T>G (p.Leu22Arg) rs104894256
NM_000244.3(MEN1):c.76G>A (p.Glu26Lys) rs28931612
NM_000249.3(MLH1):c.-42C>T rs41285097
NM_000249.3(MLH1):c.-93G>A rs1800734
NM_000249.3(MLH1):c.2041G>A (p.Ala681Thr) rs63750217
NM_000249.4(MLH1):c.1733A>G (p.Glu578Gly) rs63751612
NM_000249.4(MLH1):c.394G>C (p.Asp132His) rs28930073
NM_000250.2(MPO):c.2031-2A>C rs35897051
NM_000250.2(MPO):c.752T>C (p.Met251Thr) rs56378716
NM_000250.2(MPO):c.995C>T (p.Ala332Val) rs28730837
NM_000251.2(MSH2):c.965G>A (p.Gly322Asp) rs4987188
NM_000252.2(MTM1):c.679-1G>A rs672601324
NM_000253.3(MTTP):c.383T>C (p.Ile128Thr) rs3816873
NM_000254.2(MTR):c.2756A>G (p.Asp919Gly) rs1805087
NM_000254.2(MTR):c.2758C>G (p.His920Asp) rs121913579
NM_000255.4(MMUT):c.1867G>A (p.Gly623Arg) rs121918254
NM_000255.4(MMUT):c.313T>C (p.Trp105Arg) rs121918249
NM_000255.4(MMUT):c.52C>T (p.Gln18Ter) rs121918248
NM_000256.3(MYBPC3):c.1468G>A (p.Gly490Arg) rs200625851
NM_000256.3(MYBPC3):c.2497G>A (p.Ala833Thr) rs199865688
NM_000256.3(MYBPC3):c.3286G>T (p.Glu1096Ter) rs121909377
NM_000256.3(MYBPC3):c.3330+2T>G rs387906397
NM_000256.3(MYBPC3):c.821+5G>A rs397516077
NM_000256.3(MYBPC3):c.913_914del (p.Phe305fs) rs397516080
NM_000257.4(MYH7):c.1357C>T (p.Arg453Cys) rs121913625
NM_000257.4(MYH7):c.1750G>C (p.Gly584Arg) rs121913626
NM_000257.4(MYH7):c.1816G>A (p.Val606Met) rs121913627
NM_000257.4(MYH7):c.2146G>A (p.Gly716Arg) rs121913638
NM_000257.4(MYH7):c.2156G>A (p.Arg719Gln) rs121913641
NM_000257.4(MYH7):c.2167C>T (p.Arg723Cys) rs121913630
NM_000257.4(MYH7):c.2221G>C (p.Gly741Arg) rs121913632
NM_000257.4(MYH7):c.2229G>C (p.Glu743Asp) rs397516139
NM_000257.4(MYH7):c.2770G>A (p.Glu924Lys) rs121913628
NM_000257.4(MYH7):c.728G>A (p.Arg243His) rs267606910
NM_000257.4(MYH7):c.746G>A (p.Arg249Gln) rs3218713
NM_000260.4(MYO7A):c.905G>A (p.Arg302His) rs41298135
NM_000261.2(MYOC):c.1102C>T (p.Gln368Ter) rs74315329
NM_000261.2(MYOC):c.136C>T (p.Arg46Ter) rs74315337
NM_000262.3(NAGA):c.973G>A (p.Glu325Lys) rs121434529
NM_000263.4(NAGLU):c.1444C>T (p.Arg482Trp) rs104894596
NM_000263.4(NAGLU):c.1562C>T (p.Pro521Leu) rs104894595
NM_000263.4(NAGLU):c.1694G>A (p.Arg565Gln) rs104894598
NM_000263.4(NAGLU):c.1694G>C (p.Arg565Pro) rs104894598
NM_000263.4(NAGLU):c.1928G>A (p.Arg643His) rs104894593
NM_000263.4(NAGLU):c.2021G>A (p.Arg674His) rs104894590
NM_000264.5(PTCH1):c.1177G>A (p.Ala393Thr) rs199476091
NM_000264.5(PTCH1):c.2183C>T (p.Thr728Met) rs115556836
NM_000264.5(PTCH1):c.3155C>T (p.Thr1052Met) rs138911275
NM_000265.6(NCF1):c.73_74GT[1] (p.Tyr26fs) rs4029402
NM_000266.4(NDP):c.125A>G (p.His42Arg) rs104894874
NM_000267.3(NF1):c.3104T>G (p.Met1035Arg) rs137854553
NM_000267.3(NF1):c.3728T>C (p.Leu1243Pro) rs137854564
NM_000267.3(NF1):c.4173A>T (p.Arg1391Ser) rs137854554
NM_000267.3(NF1):c.5795T>C (p.Leu1932Pro) rs199474792
NM_000268.4(NF2):c.285CTT[1] (p.Phe96del) rs121434260
NM_000270.3(PNP):c.265G>A (p.Glu89Lys) rs104894453
NM_000270.3(PNP):c.701G>C (p.Arg234Pro) rs104894451
NM_000271.5(NPC1):c.1553G>A (p.Arg518Gln) rs483352886
NM_000271.5(NPC1):c.2848G>A (p.Val950Met) rs120074135
NM_000271.5(NPC1):c.2932C>T (p.Arg978Cys) rs28942108
NM_000271.5(NPC1):c.2974G>C (p.Gly992Arg) rs80358254
NM_000271.5(NPC1):c.2974G>T (p.Gly992Trp) rs80358254
NM_000271.5(NPC1):c.3019C>G (p.Pro1007Ala) rs80358257
NM_000271.5(NPC1):c.3104C>T (p.Ala1035Val) rs28942107
NM_000271.5(NPC1):c.3107C>T (p.Thr1036Met) rs28942104
NM_000271.5(NPC1):c.3182T>C (p.Ile1061Thr) rs80358259
NM_000271.5(NPC1):c.3467A>G (p.Asn1156Ser) rs28942105
NM_000271.5(NPC1):c.3591+1G>A rs786200877
NM_000271.5(NPC1):c.530G>A (p.Cys177Tyr) rs80358252
NM_000274.3(OAT):c.1172G>A (p.Trp391Ter) rs386833596
NM_000274.3(OAT):c.1250C>T (p.Pro417Leu) rs121965044
NM_000274.3(OAT):c.722C>T (p.Pro241Leu) rs121965051
NM_000274.4(OAT):c.192_193del (p.Gly65fs) rs386833600
NM_000274.4(OAT):c.425-4_429del rs386833609
NM_000275.3(OCA2):c.1256G>A (p.Arg419Gln) rs1800407
NM_000275.3(OCA2):c.1327G>A (p.Val443Ile) rs121918166
NM_000275.3(OCA2):c.1441G>A (p.Ala481Thr) rs74653330
NM_000275.3(OCA2):c.2037G>C (p.Trp679Cys) rs121918169
NM_000275.3(OCA2):c.913C>T (p.Arg305Trp) rs1800401
NM_000276.4(OCRL):c.952C>T (p.Arg318Cys) rs137853263
NM_000277.3(PAH):c.1045T>C (p.Ser349Pro) rs62508646
NM_000277.3(PAH):c.1066-3C>T rs62507344
NM_000277.3(PAH):c.1068C>G (p.Tyr356Ter) rs62516095
NM_000277.3(PAH):c.1092_1094del (p.Leu365del) rs62516096
NM_000277.3(PAH):c.1092_1106del (p.Leu365_Leu369del) rs62516097
NM_000277.3(PAH):c.1169A>G (p.Glu390Gly) rs5030856
NM_000277.3(PAH):c.1220C>T (p.Pro407Leu) rs62644473
NM_000277.3(PAH):c.194T>C (p.Ile65Thr) rs75193786
NM_000277.3(PAH):c.1A>G (p.Met1Val) rs62514891
NM_000277.3(PAH):c.281TCA[1] (p.Ile95del) rs62508727
NM_000277.3(PAH):c.293T>C (p.Leu98Ser) rs62517167
NM_000277.3(PAH):c.662A>G (p.Glu221Gly) rs62514934
NM_000277.3(PAH):c.731C>T (p.Pro244Leu) rs118203923
NM_000277.3(PAH):c.764T>C (p.Leu255Ser) rs62642930
NM_000277.3(PAH):c.776C>T (p.Ala259Val) rs118203921
NM_000277.3(PAH):c.782G>A (p.Arg261Gln) rs5030849
NM_000277.3(PAH):c.818C>T (p.Ser273Phe) rs62514953
NM_000277.3(PAH):c.842+1G>A rs5030852
NM_000277.3(PAH):c.842C>T (p.Pro281Leu) rs5030851
NM_000277.3(PAH):c.932T>C (p.Leu311Pro) rs62642936
NM_000277.3(PAH):c.965C>G (p.Ala322Gly) rs62514958
NM_000278.3(PAX2):c.221_226dupAGACCG (p.Thr75_Gly76insGluThr) rs387906530
NM_000280.4(PAX6):c.76C>G (p.Arg26Gly) rs121907913
NM_000281.4(PCBD1):c.259G>T (p.Glu87Ter) rs104894172
NM_000284.4(PDHA1):c.1142_1145dup (p.Trp383fs) rs606231189
NM_000284.4(PDHA1):c.615C>G (p.Phe205Leu) rs137853254
NM_000284.4(PDHA1):c.844A>C (p.Met282Leu) rs2229137
NM_000285.4(PEPD):c.1342G>A (p.Gly448Arg) rs121917724
NM_000285.4(PEPD):c.692_694del (p.Tyr231del) rs745834191
NM_000285.4(PEPD):c.833G>A (p.Gly278Asp) rs121917723
NM_000286.3(PEX12):c.959C>T (p.Ser320Phe) rs28936697
NM_000288.4(PEX7):c.649G>A (p.Gly217Arg) rs121909152
NM_000288.4(PEX7):c.653C>T (p.Ala218Val) rs121909151
NM_000288.4(PEX7):c.694C>T (p.Arg232Ter) rs121909153
NM_000288.4(PEX7):c.875T>A (p.Leu292Ter) rs1805137
NM_000288.4(PEX7):c.903+1G>C rs148591292
NM_000289.6(PFKM):c.116G>C (p.Arg39Pro) rs121918193
NM_000289.6(PFKM):c.283C>T (p.Arg95Ter) rs121918195
NM_000290.4(PGAM2):c.290G>A (p.Gly97Asp) rs77938727
NM_000291.4(PGK1):c.758T>C (p.Ile253Thr) rs137852534
NM_000292.3(PHKA2):c.3341C>T (p.Thr1114Ile) rs137852293
NM_000292.3(PHKA2):c.556C>T (p.Arg186Cys) rs137852294
NM_000292.3(PHKA2):c.557G>A (p.Arg186His) rs137852290
NM_000293.3(PHKB):c.1969C>T (p.Gln657Ter) rs34667348
NM_000293.3(PHKB):c.352G>C (p.Ala118Pro) rs121918022
NM_000295.4(SERPINA1):c.1078G>A (p.Ala360Thr) rs1802959
NM_000295.4(SERPINA1):c.1093G>A (p.Asp365Asn) rs143370956
NM_000295.5(SERPINA1):c.221TCT[2] (p.Phe76del) rs775982338
NM_000295.5(SERPINA1):c.646+1G>T rs751235320
NM_000298.6(PKLR):c.1456C>T (p.Arg486Trp) rs116100695
NM_000302.4(PLOD1):c.2008C>T (p.Arg670Ter) rs121913554
NM_000302.4(PLOD1):c.2032G>A (p.Gly678Arg) rs121913551
NM_000303.3(PMM2):c.131T>C (p.Val44Ala) rs104894534
NM_000303.3(PMM2):c.26G>A (p.Cys9Tyr) rs104894532
NM_000303.3(PMM2):c.317A>T (p.Tyr106Phe) rs387906824
NM_000303.3(PMM2):c.338C>T (p.Pro113Leu) rs80338700
NM_000303.3(PMM2):c.357C>A (p.Phe119Leu) rs80338701
NM_000303.3(PMM2):c.385G>A (p.Val129Met) rs104894525
NM_000303.3(PMM2):c.395T>C (p.Ile132Thr) rs80338702
NM_000303.3(PMM2):c.422G>A (p.Arg141His) rs28936415
NM_000303.3(PMM2):c.484C>T (p.Arg162Trp) rs104894526
NM_000303.3(PMM2):c.563A>G (p.Asp188Gly) rs80338704
NM_000303.3(PMM2):c.640-15479C>T rs1258107584
NM_000303.3(PMM2):c.647A>T (p.Asn216Ile) rs78290141
NM_000303.3(PMM2):c.677C>G (p.Thr226Ser) rs80338706
NM_000303.3(PMM2):c.691G>A (p.Val231Met) rs80338707
NM_000303.3(PMM2):c.710C>G (p.Thr237Arg) rs80338708
NM_000303.3(PMM2):c.722G>C (p.Cys241Ser) rs80338709
NM_000304.4(PMP22):c.199G>C (p.Ala67Pro) rs104894623
NM_000304.4(PMP22):c.281dup (p.Arg95fs) rs80338763
NM_000304.4(PMP22):c.353C>T (p.Thr118Met) rs104894619
NM_000304.4(PMP22):c.448G>T (p.Gly150Cys) rs104894624
NM_000304.4(PMP22):c.469C>T (p.Arg157Trp) rs28936682
NM_000304.4(PMP22):c.47T>C (p.Leu16Pro) rs104894617
NM_000304.4(PMP22):c.65C>T (p.Ser22Phe) rs104894625
NM_000304.4(PMP22):c.82T>C (p.Trp28Arg) rs104894626
NM_000310.3(PPT1):c.29T>A (p.Leu10Ter) rs137852699
NM_000310.3(PPT1):c.364A>T (p.Arg122Trp) rs137852695
NM_000310.3(PPT1):c.451C>T (p.Arg151Ter) rs137852700
NM_000311.5(PRNP):c.385A>G (p.Met129Val) rs1799990
NM_000311.5(PRNP):c.538G>A (p.Val180Ile) rs74315408
NM_000311.5(PRNP):c.655G>A (p.Glu219Lys) rs1800014
NM_000312.3(PROC):c.631C>T (p.Arg211Trp) rs121918143
NM_000312.3(PROC):c.935C>T (p.Ser312Leu) rs121918160
NM_000313.3(PROS1):c.1501T>C (p.Ser501Pro) rs121918472
NM_000314.7(PTEN):c.-764G>A rs587776674
NM_000314.8(PTEN):c.1003C>T (p.Arg335Ter) rs121909231
NM_000316.3(PTH1R):c.103G>A (p.Glu35Lys) rs1559532562
NM_000317.3(PTS):c.155A>G (p.Asn52Ser) rs104894275
NM_000317.3(PTS):c.166G>A (p.Val56Met) rs104894277
NM_000321.2(RB1):c.1072C>T (p.Arg358Ter) rs121913301
NM_000322.5(PRPH2):c.554T>C (p.Leu185Pro) rs121918563
NM_000327.3(ROM1):c.339dup (p.Leu114fs) rs71458427
NM_000329.3(RPE65):c.11+5G>A rs61751276
NM_000330.3(RS1):c.214G>A (p.Glu72Lys) rs104894928
NM_000330.3(RS1):c.304C>T (p.Arg102Trp) rs61752067
NM_000334.4(SCN4A):c.2411C>T (p.Ser804Phe) rs121908546
NM_000334.4(SCN4A):c.3466G>A (p.Ala1156Thr) rs80338958
NM_000335.4(SCN5A):c.3157G>A (p.Glu1053Lys) rs137854617
NM_000335.4(SCN5A):c.3781G>A (p.Gly1261Ser) rs137854616
NM_000335.5(SCN5A):c.3305C>A (p.Ser1102Tyr) rs7626962
NM_000335.5(SCN5A):c.3575G>A (p.Arg1192Gln) rs41261344
NM_000335.5(SCN5A):c.4531C>T (p.Arg1511Trp) rs137854602
NM_000335.5(SCN5A):c.5347G>A (p.Glu1783Lys) rs137854601
NM_000335.5(SCN5A):c.892G>A (p.Gly298Ser) rs137854608
NM_000336.3(SCNN1B):c.109G>A (p.Gly37Ser) rs137852706
NM_000336.3(SCNN1B):c.245C>G (p.Ser82Cys) rs35731153
NM_000337.5(SGCD):c.451T>G (p.Ser151Ala) rs121909298
NM_000340.2(SLC2A2):c.1250C>T (p.Pro417Leu) rs121909744
NM_000341.4(SLC3A1):c.1085G>A (p.Arg362His) rs121912697
NM_000341.4(SLC3A1):c.1400T>A (p.Met467Lys) rs121912691
NM_000341.4(SLC3A1):c.1400T>C (p.Met467Thr) rs121912691
NM_000342.3(SLC4A1):c.-62G>A rs387906565
NM_000342.3(SLC4A1):c.118G>A (p.Glu40Lys) rs45562031
NM_000342.3(SLC4A1):c.980C>G (p.Pro327Arg) rs28931583
NM_000342.4(SLC4A1):c.166A>G (p.Lys56Glu) rs5036
NM_000342.4(SLC4A1):c.1765C>T (p.Arg589Cys) rs121912745
NM_000342.4(SLC4A1):c.1937G>A (p.Arg646Gln) rs121912757
NM_000342.4(SLC4A1):c.1972G>A (p.Glu658Lys) rs75731670
NM_000342.4(SLC4A1):c.2561C>T (p.Pro854Leu) rs2285644
NM_000342.4(SLC4A1):c.2603C>T (p.Pro868Leu) rs121912759
NM_000343.4(SLC5A1):c.1673G>A (p.Arg558His) rs201799893
NM_000344.3(SMN1):c.785G>T (p.Ser262Ile) rs1554066659
NM_000344.3(SMN1):c.815A>G (p.Tyr272Cys) rs104893922
NM_000348.4(SRD5A2):c.586G>A (p.Gly196Ser) rs121434250
NM_000349.3(STAR):c.466-11T>A rs1053284504
NM_000349.3(STAR):c.545G>A (p.Arg182His) rs104894086
NM_000349.3(STAR):c.559G>A (p.Val187Met) rs104894089
NM_000350.2(ABCA4):c.2588G>C rs76157638
NM_000350.2(ABCA4):c.5882G>A rs1800553
NM_000350.2(ABCA4):c.[1622T>C;3113C>T]
NM_000350.3(ABCA4):c.1715G>A (p.Arg572Gln) rs61748559
NM_000350.3(ABCA4):c.2828G>A (p.Arg943Gln) rs1801581
NM_000350.3(ABCA4):c.3113C>T (p.Ala1038Val) rs61751374
NM_000350.3(ABCA4):c.3364G>A (p.Glu1122Lys) rs61751399
NM_000350.3(ABCA4):c.4139C>T (p.Pro1380Leu) rs61750130
NM_000350.3(ABCA4):c.52C>T (p.Arg18Trp) rs121909205
NM_000350.3(ABCA4):c.5819T>C (p.Leu1940Pro) rs61753033
NM_000350.3(ABCA4):c.5908C>T (p.Leu1970Phe) rs28938473
NM_000350.3(ABCA4):c.6079C>T (p.Leu2027Phe) rs61751408
NM_000350.3(ABCA4):c.6148G>C (p.Val2050Leu) rs41292677
NM_000350.3(ABCA4):c.634C>T (p.Arg212Cys) rs61750200
NM_000350.3(ABCA4):c.6529G>A (p.Asp2177Asn) rs1800555
NM_000352.5(ABCC8):c.1672-20A>G rs931436550
NM_000352.6(ABCC8):c.4258C>T (p.Arg1420Cys) rs28938469
NM_000352.6(ABCC8):c.4477C>T (p.Arg1493Trp) rs28936371
NM_000353.3(TAT):c.169C>T (p.Arg57Ter) rs118203914
NM_000354.5(SERPINA7):c.631G>A (p.Ala211Thr) rs2234036
NM_000359.3(TGM1):c.1075G>A (p.Val359Met) rs202037016
NM_000359.3(TGM1):c.1166G>A (p.Arg389His) rs121918723
NM_000359.3(TGM1):c.1187G>A (p.Arg396His) rs121918721
NM_000359.3(TGM1):c.1187G>T (p.Arg396Leu) rs121918721
NM_000359.3(TGM1):c.1223_1227del (p.Asp408fs) rs398122905
NM_000359.3(TGM1):c.125C>A (p.Ser42Tyr) rs41295338
NM_000359.3(TGM1):c.1469A>G (p.Asp490Gly) rs121918724
NM_000359.3(TGM1):c.1552G>A (p.Val518Met) rs35312232
NM_000359.3(TGM1):c.1744C>T (p.Gln582Ter) rs397514522
NM_000359.3(TGM1):c.281G>A (p.Gly94Asp) rs121918729
NM_000359.3(TGM1):c.376C>T (p.Arg126Cys) rs397514524
NM_000359.3(TGM1):c.424C>T (p.Arg142Cys) rs121918716
NM_000359.3(TGM1):c.428G>A (p.Arg143His) rs121918719
NM_000359.3(TGM1):c.652G>A (p.Gly218Ser) rs121918732
NM_000359.3(TGM1):c.832G>A (p.Gly278Arg) rs121918725
NM_000359.3(TGM1):c.919C>T (p.Arg307Trp) rs121918731
NM_000359.3(TGM1):c.943C>T (p.Arg315Cys) rs397514525
NM_000359.3(TGM1):c.944G>T (p.Arg315Leu) rs143473912
NM_000359.3(TGM1):c.968G>A (p.Arg323Gln) rs121918717
NM_000360.4(TH):c.1141C>A (p.Gln381Lys) rs121917762
NM_000360.4(TH):c.605G>A (p.Arg202His) rs80338892
NM_000360.4(TH):c.614T>C (p.Leu205Pro) rs121917763
NM_000360.4(TH):c.848C>T (p.Thr283Met) rs121917764
NM_000360.4(TH):c.917G>A (p.Arg306His) rs28934580
NM_000361.2(THBD):c.127G>A (p.Ala43Thr) rs1800576
NM_000363.5(TNNI3):c.244C>T (p.Pro82Ser) rs77615401
NM_000368.4(TSC1):c.671T>G (p.Met224Arg) rs118203426
NM_000368.5(TSC1):c.1760A>G (p.Lys587Arg) rs118203576
NM_000368.5(TSC1):c.2194C>T (p.His732Tyr) rs118203657
NM_000369.5(TSHR):c.1657G>A (p.Ala553Thr) rs121908872
NM_000371.3(TTR):c.191T>C (p.Phe64Ser) rs104894665
NM_000371.3(TTR):c.262A>T (p.Ile88Leu) rs121918085
NM_000371.3(TTR):c.88T>C (p.Cys30Arg) rs121918083
NM_000371.4(TTR):c.328C>A (p.His110Asn) rs121918074
NM_000371.4(TTR):c.371G>A (p.Arg124His) rs121918095
NM_000371.4(TTR):c.416C>T (p.Thr139Met) rs28933981
NM_000371.4(TTR):c.421GTC[1] (p.Val142del) rs121918096
NM_000372.5(TYR):c.1205G>A (p.Arg402Gln) rs1126809
NM_000372.5(TYR):c.1217C>T (p.Pro406Leu) rs104894313
NM_000372.5(TYR):c.575C>A (p.Ser192Tyr) rs1042602
NM_000375.3(UROS):c.197C>T (p.Ala66Val) rs28941774
NM_000375.3(UROS):c.217T>C (p.Cys73Arg) rs121908012
NM_000375.3(UROS):c.244G>T (p.Val82Phe) rs121908016
NM_000375.3(UROS):c.673G>A (p.Gly225Ser) rs121908020
NM_000380.3(XPA):c.323G>T (p.Cys108Phe) rs104894131
NM_000382.3(ALDH3A2):c.1157A>G (p.Asn386Ser) rs72547575
NM_000383.4(AIRE):c.967_979del (p.Leu323fs) rs386833675
NM_000384.3(APOB):c.10672C>T (p.Arg3558Cys)
NM_000388.4(CASR):c.2915C>T (p.Thr972Met) rs200620134
NM_000388.4(CASR):c.2956G>T (p.Ala986Ser) rs1801725
NM_000391.4(TPP1):c.1094G>A (p.Cys365Tyr) rs119455954
NM_000391.4(TPP1):c.509-1G>C rs56144125
NM_000391.4(TPP1):c.622C>T (p.Arg208Ter) rs119455955
NM_000391.4(TPP1):c.857A>G (p.Asn286Ser) rs119455958
NM_000392.5(ABCC2):c.2302C>T (p.Arg768Trp) rs56199535
NM_000392.5(ABCC2):c.3196C>T (p.Arg1066Ter) rs72558199
NM_000396.4(CTSK):c.721C>T (p.Arg241Ter) rs74315303
NM_000396.4(CTSK):c.830C>T (p.Ala277Val) rs74315304
NM_000396.4(CTSK):c.926T>C (p.Leu309Pro) rs29001685
NM_000399.5(EGR2):c.1225C>T (p.Arg409Trp) rs104894159
NM_000399.5(EGR2):c.803T>A (p.Ile268Asn) rs104894158
NM_000400.3(ERCC2):c.1381C>G (p.Leu461Val) rs121913016
NM_000401.3(EXT2):c.110C>T (p.Ser37Leu) rs527624522
NM_000401.3(EXT2):c.1118T>A (p.Val373Asp) rs371996957
NM_000401.3(EXT2):c.2015C>T (p.Thr672Met) rs138722406
NM_000402.4(G6PD):c.1093G>A (p.Ala365Thr) rs5030869
NM_000402.4(G6PD):c.1114C>T (p.Leu372Phe) rs137852342
NM_000402.4(G6PD):c.1243T>C (p.Cys415Arg) rs137852322
NM_000402.4(G6PD):c.1246A>G (p.Lys416Glu) rs137852320
NM_000402.4(G6PD):c.1268G>A (p.Arg423His) rs137852316
NM_000402.4(G6PD):c.1406G>C (p.Arg469Pro) rs137852337
NM_000402.4(G6PD):c.1429G>A (p.Gly477Arg) rs137852317
NM_000402.4(G6PD):c.1466G>C (p.Arg489Pro) rs72554665
NM_000402.4(G6PD):c.1466G>T (p.Arg489Leu) rs72554665
NM_000402.4(G6PD):c.1478G>A (p.Arg493His) rs72554664
NM_000402.4(G6PD):c.193_195delATC (p.Ile66del) rs137852338
NM_000402.4(G6PD):c.233T>C (p.Ile78Thr) rs76645461
NM_000402.4(G6PD):c.292G>A (p.Val98Met) rs1050828
NM_000402.4(G6PD):c.466A>G (p.Asn156Asp) rs1050829
NM_000402.4(G6PD):c.577G>A (p.Gly193Ser) rs137852314
NM_000402.4(G6PD):c.583A>G (p.Asn195Asp) rs137852331
NM_000402.4(G6PD):c.632A>T (p.Asp211Val) rs5030872
NM_000402.4(G6PD):c.653C>T (p.Ser218Phe) rs5030868
NM_000402.4(G6PD):c.727G>T (p.Val243Leu) rs137852326
NM_000402.4(G6PD):c.770G>A (p.Arg257Gln) rs137852328
NM_000402.4(G6PD):c.934G>C (p.Asp312His) rs137852318
NM_000402.4(G6PD):c.961G>A (p.Val321Met) rs137852327
NM_000405.5(GM2A):c.164C>T (p.Pro55Leu) rs730882196
NM_000406.3(GNRHR):c.317A>G (p.Gln106Arg) rs104893836
NM_000407.4(GP1BB):c.137G>A (p.Trp46Ter) rs121909752
NM_000409.4(GUCA1A):c.250C>T (p.Leu84Phe) rs869320709
NM_000409.4(GUCA1A):c.320T>C (p.Ile107Thr) rs869320710
NM_000410.3(HFE):c.193A>T (p.Ser65Cys) rs1800730
NM_000410.3(HFE):c.845G>A (p.Cys282Tyr) rs1800562
NM_000414.4(HSD17B4):c.1369A>T (p.Asn457Tyr) rs137853097
NM_000414.4(HSD17B4):c.46G>A (p.Gly16Ser) rs137853096
NM_000416.2(IFNGR1):c.653_655del (p.Glu218del) rs587776858
NM_000418.4(IL4R):c.223A>G (p.Ile75Val) rs1805010
NM_000419.3(ITGA2B):c.1787T>C rs76811038
NM_000419.5(ITGA2B):c.1073G>A (p.Arg358His) rs137852908
NM_000419.5(ITGA2B):c.1346G>A (p.Gly449Asp) rs1598380253
NM_000419.5(ITGA2B):c.1878G>C (p.Gln626His) rs80277041
NM_000419.5(ITGA2B):c.2602-3C>G rs763330792
NM_000419.5(ITGA2B):c.2621T>G (p.Ile874Ser) rs5911
NM_000419.5(ITGA2B):c.2870C>T (p.Ser957Leu) rs80002943
NM_000420.3(KEL):c.1790T>C (p.Leu597Pro) rs8176038
NM_000424.4(KRT5):c.1649del (p.Gly550fs) rs61126080
NM_000424.4(KRT5):c.74C>T (p.Pro25Leu) rs57499817
NM_000426.3(LAMA2):c.1580G>A (p.Cys527Tyr) rs121913574
NM_000426.3(LAMA2):c.2584T>C (p.Cys862Arg) rs121913573
NM_000426.3(LAMA2):c.2901C>A (p.Cys967Ter) rs121913577
NM_000426.3(LAMA2):c.3718C>T (p.Gln1240Ter) rs121913569
NM_000426.3(LAMA2):c.9253C>T rs121913571
NM_000426.4(LAMA2):c.7750-1713_7899-2153del
NM_000429.3(MAT1A):c.1070C>T (p.Pro357Leu) rs118204003
NM_000430.4(PAFAH1B1):c.22C>T (p.Arg8Ter) rs121434489
NM_000430.4(PAFAH1B1):c.484G>A (p.Gly162Ser) rs121434487
NM_000431.4(MVK):c.1129G>A (p.Val377Ile) rs28934897
NM_000432.3(MYL2):c.52T>C (p.Phe18Leu) rs104894370
NM_000432.4(MYL2):c.37G>A (p.Ala13Thr) rs104894363
NM_000432.4(MYL2):c.64G>A (p.Glu22Lys) rs104894368
NM_000433.3(NCF2):c.1183C>T (p.Arg395Trp) rs13306575
NM_000433.3(NCF2):c.230G>A (p.Arg77Gln) rs119103275
NM_000433.3(NCF2):c.55_63del (p.Lys19_Asp21del) rs796065033
NM_000434.4(NEU1):c.893C>T (p.Ala298Val) rs104893981
NM_000435.3(NOTCH3):c.3058G>C (p.Ala1020Pro) rs35769976
NM_000435.3(NOTCH3):c.397C>T (p.Arg133Cys) rs137852642
NM_000439.5(PCSK1):c.661A>G (p.Asn221Asp) rs6232
NM_000441.1(SLC26A4):c.578C>T rs111033348
NM_000441.2(SLC26A4):c.-103T>C rs60284988
NM_000441.2(SLC26A4):c.1001+1G>A rs80338849
NM_000441.2(SLC26A4):c.1105A>G (p.Lys369Glu) rs121908361
NM_000441.2(SLC26A4):c.1115C>T (p.Ala372Val) rs121908364
NM_000441.2(SLC26A4):c.1151A>G (p.Glu384Gly) rs111033244
NM_000441.2(SLC26A4):c.1246A>C (p.Thr416Pro) rs28939086
NM_000441.2(SLC26A4):c.1588T>C (p.Tyr530His) rs111033254
NM_000441.2(SLC26A4):c.2162C>T (p.Thr721Met) rs121908363
NM_000441.2(SLC26A4):c.2168A>G (p.His723Arg) rs121908362
NM_000441.2(SLC26A4):c.279del (p.Ser93fs) rs786204421
NM_000441.2(SLC26A4):c.397T>A (p.Ser133Thr) rs121908365
NM_000441.2(SLC26A4):c.707T>C (p.Leu236Pro) rs80338848
NM_000441.2(SLC26A4):c.85G>C (p.Glu29Gln) rs111033205
NM_000441.2(SLC26A4):c.919-2A>G rs111033313
NM_000443.4(ABCB4):c.1769G>A (p.Arg590Gln) rs45575636
NM_000446.7(PON1):c.163T>A (p.Leu55Met) rs854560
NM_000446.7(PON1):c.575A>G (p.Gln192Arg) rs662
NM_000447.3(PSEN2):c.389C>T (p.Ser130Leu) rs63750197
NM_000447.3(PSEN2):c.422A>T (p.Asn141Ile) rs63750215
NM_000447.3(PSEN2):c.717G>A (p.Met239Ile) rs63749884
NM_000448.2(RAG1):c.1566G>T (p.Trp522Cys) rs193922461
NM_000454.4(SOD1):c.272A>C (p.Asp91Ala) rs80265967
NM_000454.4(SOD1):c.289G>A (p.Asp97Asn) rs121912459
NM_000455.4(STK11):c.200T>C (p.Leu67Pro) rs137853077
NM_000455.4(STK11):c.717G>C (p.Trp239Cys) rs137853082
NM_000455.5(STK11):c.1062C>G (p.Phe354Leu) rs59912467
NM_000458.4(HNF1B):c.494G>A (p.Arg165His)
NM_000459.4(TEK):c.2545C>T (p.Arg849Trp) rs80338908
NM_000459.4(TEK):c.2690A>C (p.Tyr897Ser) rs80338909
NM_000465.4(BARD1):c.1670G>C (p.Cys557Ser) rs28997576
NM_000466.3(PEX1):c.1991T>C (p.Leu664Pro) rs121434455
NM_000477.7(ALB):c.725G>A (p.Arg242His) rs75002628
NM_000478.6(ALPL):c.1001G>A (p.Gly334Asp) rs121918009
NM_000478.6(ALPL):c.211C>T (p.Arg71Cys) rs121918001
NM_000478.6(ALPL):c.346G>A (p.Ala116Thr) rs121918013
NM_000478.6(ALPL):c.485G>T (p.Gly162Val) rs121918012
NM_000478.6(ALPL):c.526G>A (p.Ala176Thr) rs121918019
NM_000478.6(ALPL):c.535G>A (p.Ala179Thr) rs121918000
NM_000478.6(ALPL):c.571G>A (p.Glu191Lys) rs121918007
NM_000478.6(ALPL):c.746G>T (p.Gly249Val) rs121918018
NM_000478.6(ALPL):c.979T>C (p.Phe327Leu) rs121918010
NM_000478.6(ALPL):c.98C>T (p.Ala33Val) rs121918005
NM_000480.3(AMPD3):c.1744C>T (p.Arg582Cys) rs3741040
NM_000481.3(AMT):c.878-1G>A rs181134220
NM_000481.4(AMT):c.125A>G (p.His42Arg) rs121964983
NM_000481.4(AMT):c.350C>T (p.Ser117Leu) rs769468125
NM_000481.4(AMT):c.574C>T (p.Gln192Ter) rs121964986
NM_000481.4(AMT):c.826G>C (p.Asp276His) rs121964984
NM_000481.4(AMT):c.959G>A (p.Arg320His) rs121964985
NM_000483.5(APOC2):c.229A>C (p.Lys77Gln) rs5126
NM_000484.4(APP):c.2010_2011inv (p.Lys670_Met671delinsAsnLeu) rs281865161
NM_000484.4(APP):c.2075C>G (p.Ala692Gly) rs63750671
NM_000484.4(APP):c.2078A>G (p.Glu693Gly) rs63751039
NM_000484.4(APP):c.2137G>A (p.Ala713Thr) rs63750066
NM_000484.4(APP):c.2149G>A (p.Val717Ile) rs63750264
NM_000486.5(AQP2):c.190G>A (p.Gly64Arg) rs104894326
NM_000487.6(ARSA):c.*96A>G rs6151429
NM_000487.6(ARSA):c.1055A>G (p.Asn352Ser) rs2071421
NM_000487.6(ARSA):c.1174C>T (p.Arg392Trp) rs74315480
NM_000487.6(ARSA):c.302G>A (p.Gly101Asp) rs74315455
NM_000487.6(ARSA):c.370G>A (p.Gly124Ser) rs74315461
NM_000487.6(ARSA):c.641C>T (p.Ala214Val) rs74315467
NM_000487.6(ARSA):c.677C>T (p.Ala226Val) rs74315468
NM_000487.6(ARSA):c.736C>T (p.Arg246Cys) rs74315470
NM_000487.6(ARSA):c.868C>T (p.Arg290Cys) rs74315473
NM_000487.6(ARSA):c.931G>A (p.Gly311Ser) rs74315459
NM_000488.3(SERPINC1):c.1246G>T (p.Ala416Ser) rs121909548
NM_000488.3(SERPINC1):c.218C>T (p.Pro73Leu) rs121909551
NM_000488.3(SERPINC1):c.235C>T (p.Arg79Cys) rs121909547
NM_000488.3(SERPINC1):c.236G>A (p.Arg79His) rs121909552
NM_000488.3(SERPINC1):c.391C>T (p.Leu131Phe) rs121909567
NM_000488.3(SERPINC1):c.655A>G (p.Asn219Asp) rs121909571
NM_000488.3(SERPINC1):c.89T>A (p.Val30Glu) rs2227624
NM_000489.5(ATRX):c.5579A>G (p.Asn1860Ser) rs45439799
NM_000489.5(ATRX):c.6149T>C (p.Ile2050Thr) rs122445110
NM_000492.3(CFTR):c.1046C>T (p.Ala349Val) rs121909021
NM_000492.3(CFTR):c.1210-12T[5] rs1805177
NM_000492.3(CFTR):c.1373G>T (p.Gly458Val) rs121909009
NM_000492.3(CFTR):c.1438G>T (p.Gly480Cys) rs79282516
NM_000492.3(CFTR):c.1475C>T (p.Ser492Phe) rs121909017
NM_000492.3(CFTR):c.1516A>G (p.Ile506Val) rs1800091
NM_000492.3(CFTR):c.1521_1523delCTT (p.Phe508delPhe) rs113993960
NM_000492.3(CFTR):c.1572C>A (p.Cys524Ter) rs121908754
NM_000492.3(CFTR):c.1658G>A (p.Arg553Gln) rs121909044
NM_000492.3(CFTR):c.1666A>G (p.Ile556Val) rs75789129
NM_000492.3(CFTR):c.1679G>A (p.Arg560Lys) rs80055610
NM_000492.3(CFTR):c.171G>A (p.Trp57Ter) rs121909025
NM_000492.3(CFTR):c.1721C>A (p.Pro574His) rs121908758
NM_000492.3(CFTR):c.1820_1903del (p.Met607_Gln634del) rs121908777
NM_000492.3(CFTR):c.273+4A>G rs387906374
NM_000492.3(CFTR):c.2735C>T (p.Ser912Leu) rs121909034
NM_000492.3(CFTR):c.3254A>G (p.His1085Arg) rs79635528
NM_000492.3(CFTR):c.3469-20T>C rs373002889
NM_000492.3(CFTR):c.3659C>T (p.Thr1220Ile) rs1800123
NM_000492.3(CFTR):c.3712C>T (p.Gln1238Ter) rs121908766
NM_000492.3(CFTR):c.3717+4A>G rs387906362
NM_000492.3(CFTR):c.3873G>C (p.Gln1291His) rs121909015
NM_000492.3(CFTR):c.4056G>C (p.Gln1352His) rs113857788
NM_000492.3(CFTR):c.650A>G (p.Glu217Gly) rs121909046
NM_000492.4(CFTR):c.1651G>A (p.Gly551Ser) rs121909013
NM_000492.4(CFTR):c.2423_2424dup (p.Ser809fs) rs387906359
NM_000492.4(CFTR):c.2551C>T (p.Arg851Ter) rs121909012
NM_000492.4(CFTR):c.2991G>C (p.Leu997Phe) rs1800111
NM_000492.4(CFTR):c.326A>G (p.Tyr109Cys) rs121909031
NM_000492.4(CFTR):c.328G>C (p.Asp110His) rs113993958
NM_000492.4(CFTR):c.350G>A (p.Arg117His) rs78655421
NM_000492.4(CFTR):c.3746G>A (p.Gly1249Glu) rs121909040
NM_000492.4(CFTR):c.3763T>C (p.Ser1255Pro) rs121909041
NM_000493.4(COL10A1):c.2011T>C (p.Ser671Pro) rs111033552
NM_000494.4(COL17A1):c.2336-2A>G rs1478395810
NM_000497.3(CYP11B1):c.1269T>G (p.Tyr423Ter) rs267606755
NM_000497.3(CYP11B1):c.1343G>A (p.Arg448His) rs28934586
NM_000497.3(CYP11B1):c.281C>T (p.Pro94Leu) rs104894070
NM_000500.7(CYP21A2):c.332_339delGAGACTAC (p.Gly111Valfs) rs387906510
NM_000500.7(CYP21A2):c.955C>T (p.Gln319Ter) rs6445
NM_000500.9(CYP21A2):c.1069C>T (p.Arg357Trp) rs7769409
NM_000500.9(CYP21A2):c.1360C>T (p.Pro454Ser) rs6445
NM_000500.9(CYP21A2):c.188A>T (p.His63Leu) rs9378252
NM_000500.9(CYP21A2):c.293-13C>G rs6467
NM_000500.9(CYP21A2):c.518T>A (p.Ile173Asn) rs6475
NM_000500.9(CYP21A2):c.844G>T (p.Val282Leu) rs6471
NM_000500.9(CYP21A2):c.92C>T (p.Pro31Leu) rs9378251
NM_000503.6(EYA1):c.1276G>A (p.Gly426Ser) rs121909199
NM_000504.4(F10):c.424G>A (p.Glu142Lys) rs61753266
NM_000506.3(F2):c.598G>A (p.Glu200Lys) rs62623459
NM_000506.4(F2):c.1787G>T (p.Arg596Leu) rs387907201
NM_000506.5(F2):c.*97G>A rs1799963
NM_000508.3(FGA):c.112A>G (p.Arg38Gly) rs121909608
NM_000511.6(FUT2):c.418A>T (p.Ile140Phe) rs1047781
NM_000511.6(FUT2):c.461G>A (p.Trp154Ter) rs601338
NM_000512.5(GALNS):c.1156C>T (p.Arg386Cys) rs118204437
NM_000512.5(GALNS):c.337A>T (p.Ile113Phe) rs118204438
NM_000512.5(GALNS):c.935C>G (p.Thr312Ser) rs118204446
NM_000514.4(GDNF):c.277C>T (p.Arg93Trp) rs36119840
NM_000514.4(GDNF):c.448G>A (p.Asp150Asn) rs76466003
NM_000515.5(GH1):c.626G>A (p.Arg209His) rs137853223
NM_000516.6(GNAS):c.344C>T (p.Pro115Leu) rs137854539
NM_000517.4(HBA2):c.142G>C (p.Asp48His) rs281864834
NM_000517.4(HBA2):c.427T>A (p.Ter143Lys) rs41464951
NM_000517.4(HBA2):c.427T>C (p.Ter143Gln) rs41464951
NM_000517.4(HBA2):c.427T>G (p.Ter143Glu) rs41464951
NM_000517.4(HBA2):c.49A>G (p.Lys17Glu) rs281865555
NM_000517.6(HBA2):c.146T>G (p.Leu49Arg) rs41392146
NM_000517.6(HBA2):c.178G>C (p.Gly60Arg) rs41328049
NM_000517.6(HBA2):c.257A>T (p.Asp86Val) rs41331747
NM_000517.6(HBA2):c.301-1G>A rs587776827
NM_000517.6(HBA2):c.30C>G (p.Asn10Lys) rs111033604
NM_000517.6(HBA2):c.314G>A (p.Cys105Tyr) rs41417548
NM_000517.6(HBA2):c.377T>C (p.Leu126Pro) rs41397847
NM_000517.6(HBA2):c.377T>G (p.Leu126Arg) rs41397847
NM_000517.6(HBA2):c.379G>A (p.Asp127Asn) rs33933481
NM_000517.6(HBA2):c.391G>C (p.Ala131Pro) rs41529844
NM_000517.6(HBA2):c.420del (p.Lys140fs) rs63750520
NM_000517.6(HBA2):c.428A>C (p.Ter143Ser) rs41321345
NM_000517.6(HBA2):c.69C>T (p.Gly23=) rs63751457
NM_000517.6(HBA2):c.89T>C (p.Leu30Pro) rs41341344
NM_000518.4(HBB):c.125T>C (p.Phe42Ser) rs33926796
NM_000518.4(HBB):c.137T>C (p.Phe46Ser) rs33978338
NM_000518.4(HBB):c.142G>A (p.Asp48Asn) rs33932070
NM_000518.4(HBB):c.157G>A (p.Asp53Asn) rs33961886
NM_000518.4(HBB):c.157G>C (p.Asp53His) rs33961886
NM_000518.4(HBB):c.182T>A (p.Val61Glu) rs33931779
NM_000518.4(HBB):c.184A>G (p.Lys62Glu) rs33995148
NM_000518.4(HBB):c.191A>G (p.His64Arg) rs33985544
NM_000518.4(HBB):c.194G>C (p.Gly65Ala) rs33922018
NM_000518.4(HBB):c.208G>A (p.Gly70Ser) rs33947415
NM_000518.4(HBB):c.220G>A (p.Asp74Asn) rs33945705
NM_000518.4(HBB):c.232C>G (p.His78Asp) rs33991294
NM_000518.4(HBB):c.232C>T (p.His78Tyr) rs33991294
NM_000518.4(HBB):c.238G>A (p.Asp80Asn) rs33990858
NM_000518.4(HBB):c.238G>C (p.Asp80His) rs33990858
NM_000518.4(HBB):c.238G>T (p.Asp80Tyr) rs33990858
NM_000518.4(HBB):c.23A>G (p.Glu8Gly) rs34387455
NM_000518.4(HBB):c.25A>G (p.Lys9Glu) rs33926764
NM_000518.4(HBB):c.263C>A (p.Thr88Lys) rs33993568
NM_000518.4(HBB):c.266T>C (p.Leu89Pro) rs33940204
NM_000518.4(HBB):c.271G>A (p.Glu91Lys) rs33913712
NM_000518.4(HBB):c.275T>C (p.Leu92Pro) rs33917785
NM_000518.4(HBB):c.275T>G (p.Leu92Arg) rs33917785
NM_000518.4(HBB):c.283G>A (p.Asp95Asn) rs33959340
NM_000518.4(HBB):c.29C>G (p.Ser10Cys) rs33918131
NM_000518.4(HBB):c.320T>G (p.Leu107Arg) rs33941844
NM_000518.4(HBB):c.332T>C (p.Leu111Pro) rs35256489
NM_000518.4(HBB):c.34G>A (p.Val12Ile) rs33974228
NM_000518.4(HBB):c.34G>T (p.Val12Phe) rs33974228
NM_000518.4(HBB):c.364G>A (p.Glu122Lys) rs33946267
NM_000518.4(HBB):c.364G>C (p.Glu122Gln) rs33946267
NM_000518.4(HBB):c.371C>T (p.Thr124Ile) rs33935383
NM_000518.4(HBB):c.374C>A (p.Pro125Gln) rs33983276
NM_000518.4(HBB):c.374C>T (p.Pro125Leu) rs33983276
NM_000518.4(HBB):c.404T>C (p.Val135Ala) rs33966761
NM_000518.4(HBB):c.410G>A (p.Gly137Asp) rs33949486
NM_000518.4(HBB):c.422C>A (p.Ala141Asp) rs33927093
NM_000518.4(HBB):c.430C>T (p.His144Tyr) rs33929415
NM_000518.4(HBB):c.44T>C (p.Leu15Pro) rs33935445
NM_000518.4(HBB):c.44T>G (p.Leu15Arg) rs33935445
NM_000518.4(HBB):c.64G>T (p.Asp22Tyr) rs33950093
NM_000518.4(HBB):c.67G>A (p.Glu23Lys) rs33959855
NM_000518.4(HBB):c.67G>C (p.Glu23Gln) rs33959855
NM_000518.4(HBB):c.68A>C (p.Glu23Ala) rs33936254
NM_000518.4(HBB):c.68A>G (p.Glu23Gly) rs33936254
NM_000518.4(HBB):c.68A>T (p.Glu23Val) rs33936254
NM_000518.4(HBB):c.71T>A (p.Val24Asp) rs33945546
NM_000518.4(HBB):c.8A>G (p.His3Arg) rs33983205
NM_000518.5(HBB):c.-138C>A rs33944208
NM_000518.5(HBB):c.-80T>A rs33980857
NM_000518.5(HBB):c.100G>A (p.Val34Met) rs1141370
NM_000518.5(HBB):c.103G>T (p.Val35Phe) rs1141387
NM_000518.5(HBB):c.122G>A (p.Arg41Lys) rs34831026
NM_000518.5(HBB):c.128T>C (p.Phe43Ser) rs34378160
NM_000518.5(HBB):c.131A>C (p.Glu44Ala) rs35262412
NM_000518.5(HBB):c.16C>T (p.Pro6Ser) rs33912272
NM_000518.5(HBB):c.170G>A (p.Gly57Asp) rs34439278
NM_000518.5(HBB):c.174C>A (p.Asn58Lys) rs35278874
NM_000518.5(HBB):c.179A>C (p.Lys60Thr) rs35537181
NM_000518.5(HBB):c.180G>C (p.Lys60Asn) rs34621955
NM_000518.5(HBB):c.186G>C (p.Lys62Asn) rs34446260
NM_000518.5(HBB):c.190C>T (p.His64Tyr) rs33922873
NM_000518.5(HBB):c.19GAG[1] (p.Glu8del) rs63750928
NM_000518.5(HBB):c.200A>C (p.Lys67Thr) rs35939489
NM_000518.5(HBB):c.205C>T (p.Leu69Phe) rs33961459
NM_000518.5(HBB):c.209G>A (p.Gly70Asp) rs34718174
NM_000518.5(HBB):c.20A>T (p.Glu7Val) rs334
NM_000518.5(HBB):c.250G>C (p.Gly84Arg) rs33930385
NM_000518.5(HBB):c.250G>T (p.Gly84Cys) rs33930385
NM_000518.5(HBB):c.251G>A (p.Gly84Asp) rs1803195
NM_000518.5(HBB):c.253A>G (p.Thr85Ala) rs35960772
NM_000518.5(HBB):c.262A>C (p.Thr88Pro) rs35553496
NM_000518.5(HBB):c.286A>G (p.Lys96Glu) rs33914359
NM_000518.5(HBB):c.314G>C (p.Arg105Thr) rs33911434
NM_000518.5(HBB):c.315G>C (p.Arg105Ser) rs33914944
NM_000518.5(HBB):c.316-3C>G rs33913413
NM_000518.5(HBB):c.316C>T (p.Leu106Phe) rs34022507
NM_000518.5(HBB):c.323dup (p.Asn109fs) rs35225141
NM_000518.5(HBB):c.328G>A (p.Val110Met) rs33969677
NM_000518.5(HBB):c.328G>C (p.Val110Leu) rs33969677
NM_000518.5(HBB):c.341T>A (p.Val114Glu) rs34484056
NM_000518.5(HBB):c.344T>C (p.Leu115Pro) rs36015961
NM_000518.5(HBB):c.363A>C (p.Lys121Asn) rs34726542
NM_000518.5(HBB):c.380T>A (p.Val127Glu) rs33925391
NM_000518.5(HBB):c.380T>C (p.Val127Ala) rs33925391
NM_000518.5(HBB):c.389C>T (p.Ala130Val) rs111645889
NM_000518.5(HBB):c.394C>A (p.Gln132Lys) rs33910209
NM_000518.5(HBB):c.397A>C (p.Lys133Gln) rs33953406
NM_000518.5(HBB):c.431A>C (p.His144Pro) rs33918338
NM_000518.5(HBB):c.431A>G (p.His144Arg) rs33918338
NM_000518.5(HBB):c.435G>C (p.Lys145Asn) rs35020585
NM_000518.5(HBB):c.436T>C (p.Tyr146His) rs33949869
NM_000518.5(HBB):c.437A>G (p.Tyr146Cys) rs35117167
NM_000518.5(HBB):c.440_441dup (p.Ter148ThrextTer?) rs33999427
NM_000518.5(HBB):c.4G>A (p.Val2Met) rs33958358
NM_000518.5(HBB):c.50G>A (p.Gly17Asp) rs33962676
NM_000518.5(HBB):c.59A>G (p.Asn20Ser) rs33972047
NM_000518.5(HBB):c.5T>C (p.Val2Ala) rs33949930
NM_000518.5(HBB):c.61G>A (p.Val21Met) rs35890959
NM_000518.5(HBB):c.75T>A (p.Gly25=) rs33951465
NM_000518.5(HBB):c.79G>A (p.Glu27Lys) rs33950507
NM_000518.5(HBB):c.82G>T (p.Ala28Ser) rs35424040
NM_000518.5(HBB):c.8A>C (p.His3Pro) rs33983205
NM_000518.5(HBB):c.92+6T>C rs35724775
NM_000518.5(HBB):c.93G>T (p.Arg31Ser) rs1135071
NM_000519.4(HBD):c.226C>G (p.Leu76Val) rs34430836
NM_000519.4(HBD):c.82G>T (p.Ala28Ser) rs35152987
NM_000520.5(HEXA):c.-207-2357_253+5128delinsG
NM_000520.6(HEXA):c.1177C>T (p.Arg393Ter) rs121907963
NM_000520.6(HEXA):c.1351C>G (p.Leu451Val) rs28940871
NM_000520.6(HEXA):c.1444G>A (p.Glu482Lys) rs121907952
NM_000520.6(HEXA):c.1453T>C (p.Trp485Arg) rs121907968
NM_000520.6(HEXA):c.346+1G>C rs797044432
NM_000520.6(HEXA):c.508C>T (p.Arg170Trp) rs121907972
NM_000520.6(HEXA):c.509G>A (p.Arg170Gln) rs121907957
NM_000520.6(HEXA):c.611A>G (p.His204Arg) rs121907976
NM_000520.6(HEXA):c.739C>T (p.Arg247Trp) rs121907970
NM_000520.6(HEXA):c.806-7G>A rs770932296
NM_000520.6(HEXA):c.902T>G (p.Met301Arg) rs121907977
NM_000520.6(HEXA):c.912CTT[1] (p.Phe305del) rs121907960
NM_000521.4(HEXB):c.1627G>A (p.Ala543Thr) rs121907984
NM_000521.4(HEXB):c.619A>G (p.Ile207Val) rs10805890
NM_000525.3(KCNJ11):c.157G>A (p.Gly53Ser) rs80356613
NM_000525.3(KCNJ11):c.157G>C (p.Gly53Arg) rs80356613
NM_000525.3(KCNJ11):c.67A>G (p.Lys23Glu) rs5219
NM_000525.3(KCNJ11):c.902G>A (p.Arg301His) rs74339576
NM_000526.5(KRT14):c.356T>C (p.Met119Thr) rs28928893
NM_000526.5(KRT14):c.368A>G (p.Asn123Ser) rs60171927
NM_000526.5(KRT14):c.373C>T (p.Arg125Cys) rs60399023
NM_000526.5(KRT14):c.374G>A (p.Arg125His) rs58330629
NM_000527.4(LDLR):c.-138delT rs387906307
NM_000527.4(LDLR):c.313+1G>A
NM_000527.4(LDLR):c.664_681dup18 (p.Asp227_Glu228insCysLysAspLysSerAsp) rs387906306
NM_000527.4(LDLR):c.680_681delAC (p.Asp227Glyfs) rs387906305
NM_000527.4(LDLR):c.694+2T>C rs200238879
NM_000527.5(LDLR):c.1118_1121dup (p.Tyr375fs) rs875989916
NM_000527.5(LDLR):c.1202T>A (p.Leu401His) rs121908038
NM_000527.5(LDLR):c.1216C>A (p.Arg406=) rs121908043
NM_000527.5(LDLR):c.1285G>A (p.Val429Met)
NM_000527.5(LDLR):c.1291G>A (p.Ala431Thr)
NM_000527.5(LDLR):c.1297G>C (p.Asp433His) rs121908036
NM_000527.5(LDLR):c.131G>A (p.Trp44Ter) rs267607213
NM_000527.5(LDLR):c.137G>C (p.Cys46Ser) rs121908041
NM_000527.5(LDLR):c.139_144del (p.Asp47_Gly48del) rs387906301
NM_000527.5(LDLR):c.1567G>A (p.Val523Met)
NM_000527.5(LDLR):c.1637G>A (p.Gly546Asp)
NM_000527.5(LDLR):c.1646G>A (p.Gly549Asp)
NM_000527.5(LDLR):c.1694G>T (p.Gly565Val) rs28942082
NM_000527.5(LDLR):c.1891_2311+1062del
NM_000527.5(LDLR):c.2000G>A (p.Cys667Tyr) rs28942083
NM_000527.5(LDLR):c.2043C>A (p.Cys681Ter)
NM_000527.5(LDLR):c.2054C>T (p.Pro685Leu)
NM_000527.5(LDLR):c.2140+1G>A rs145787161
NM_000527.5(LDLR):c.2140+86C>G rs587776886
NM_000527.5(LDLR):c.2483A>G (p.Tyr828Cys)
NM_000527.5(LDLR):c.2531G>A (p.Gly844Asp) rs121908037
NM_000527.5(LDLR):c.259T>G (p.Trp87Gly) rs121908025
NM_000527.5(LDLR):c.326G>C (p.Cys109Ser) rs121908042
NM_000527.5(LDLR):c.523G>A (p.Asp175Asn) rs121908033
NM_000527.5(LDLR):c.530C>T (p.Ser177Leu)
NM_000527.5(LDLR):c.551G>A (p.Cys184Tyr)
NM_000527.5(LDLR):c.564C>G (p.Tyr188Ter) rs121908034
NM_000527.5(LDLR):c.621C>T (p.Gly207=) rs121908044
NM_000527.5(LDLR):c.651TGG[1] (p.Gly219del) rs121908027
NM_000527.5(LDLR):c.670G>A (p.Asp224Asn) rs387906303
NM_000527.5(LDLR):c.681C>G (p.Asp227Glu) rs121908028
NM_000527.5(LDLR):c.682G>A (p.Glu228Lys)
NM_000527.5(LDLR):c.693C>A (p.Cys231Ter)
NM_000527.5(LDLR):c.782G>T (p.Cys261Phe) rs121908040
NM_000527.5(LDLR):c.910G>A (p.Asp304Asn) rs121908030
NM_000527.5:c.(190+1_191-1)_(817+1_818-1)dup
NM_000528.4(MAN2B1):c.1067C>G (p.Pro356Arg) rs121434333
NM_000528.4(MAN2B1):c.1830+1G>C rs80338677
NM_000528.4(MAN2B1):c.215A>T (p.His72Leu) rs387906261
NM_000528.4(MAN2B1):c.2248C>T (p.Arg750Trp) rs80338680
NM_000528.4(MAN2B1):c.2278C>T (p.Arg760Ter) rs121434331
NM_000528.4(MAN2B1):c.2426T>C (p.Leu809Pro) rs80338681
NM_000530.8(MPZ):c.242A>G (p.His81Arg) rs121913594
NM_000531.6(OTC):c.118C>T (p.Arg40Cys) rs72554307
NM_000531.6(OTC):c.137A>G (p.Lys46Arg) rs1800321
NM_000531.6(OTC):c.674C>T (p.Pro225Leu) rs67120076
NM_000531.6(OTC):c.912G>T (p.Leu304Phe) rs72558465
NM_000532.5(PCCB):c.1228C>T (p.Arg410Trp) rs121964959
NM_000532.5(PCCB):c.1283C>T (p.Thr428Ile) rs111033542
NM_000532.5(PCCB):c.1304A>G (p.Tyr435Cys) rs121964961
NM_000532.5(PCCB):c.1538_1540dup (p.Arg514_Ile515insPro) rs202247821
NM_000532.5(PCCB):c.502G>A (p.Glu168Lys) rs121964960
NM_000533.5(PLP1):c.409C>T (p.Arg137Trp) rs132630295
NM_000535.7(PMS2):c.137G>T (p.Ser46Ile) rs121434629
NM_000536.4(RAG2):c.1352G>C (p.Gly451Ala) rs121918575
NM_000536.4(RAG2):c.230C>A (p.Thr77Asn) rs121918574
NM_000536.4(RAG2):c.644C>T (p.Thr215Ile) rs35691292
NM_000539.3(RHO):c.1033G>A (p.Val345Met) rs104893795
NM_000539.3(RHO):c.1040C>T (p.Pro347Leu) rs29001566
NM_000539.3(RHO):c.173C>G (p.Thr58Arg) rs28933394
NM_000539.3(RHO):c.316G>A (p.Gly106Arg) rs104893773
NM_000539.3(RHO):c.533A>G (p.Tyr178Cys) rs104893776
NM_000539.3(RHO):c.632A>C (p.His211Pro) rs28933993
NM_000539.3(RHO):c.745G>T (p.Glu249Ter) rs104893783
NM_000539.3(RHO):c.789CTG[1] (p.Cys264del) rs121918590
NM_000540.2(RYR1):c.11941C>T (p.His3981Tyr) rs148772854
NM_000540.2(RYR1):c.97A>G (p.Lys33Glu) rs193922746
NM_000540.3(RYR1):c.1209C>G (p.Ile403Met) rs118192116
NM_000540.3(RYR1):c.14387A>G (p.Tyr4796Cys) rs118192167
NM_000540.3(RYR1):c.14545G>A (p.Val4849Ile) rs118192168
NM_000540.3(RYR1):c.14693T>C (p.Ile4898Thr) rs118192170
NM_000540.3(RYR1):c.1840C>T (p.Arg614Cys) rs118192172
NM_000540.3(RYR1):c.6488G>A (p.Arg2163His) rs118192163
NM_000540.3(RYR1):c.6617C>T (p.Thr2206Met) rs118192177
NM_000540.3(RYR1):c.7300G>A (p.Gly2434Arg) rs121918593
NM_000540.3(RYR1):c.7372C>T (p.Arg2458Cys) rs28933397
NM_000540.3(RYR1):c.7373G>A (p.Arg2458His) rs121918594
NM_000543.5(SMPD1):c.1735G>A (p.Gly579Ser) rs120074119
NM_000545.6(HNF1A):c.1592G>C (p.Ser531Thr) rs137853246
NM_000545.6(HNF1A):c.79A>C (p.Ile27Leu) rs1169288
NM_000545.6(HNF1A):c.92G>A (p.Gly31Asp) rs137853247
NM_000546.6(TP53):c.215C>G (p.Pro72Arg) rs1042522
NM_000546.6(TP53):c.743G>A (p.Arg248Gln) rs11540652
NM_000546.6(TP53):c.818G>A (p.Arg273His) rs28934576
NM_000548.5(TSC2):c.4508A>C (p.Gln1503Pro) rs45516293
NM_000548.5(TSC2):c.5238_5255del (p.His1746_Arg1751del) rs137854218
NM_000549.5(TSHB):c.205C>T (p.Gln69Ter) rs121918670
NM_000550.3(TYRP1):c.277C>T (p.Arg93Cys) rs387907171
NM_000550.3(TYRP1):c.497C>G (p.Ser166Ter) rs104894130
NM_000551.4(VHL):c.241C>T (p.Pro81Ser) rs104893829
NM_000551.4(VHL):c.414A>G (p.Pro138=) rs869025648
NM_000552.4(VWF):c.4751A>G (p.Tyr1584Cys) rs1800386
NM_000552.5(VWF):c.4196G>A rs1800382
NM_000553.6(WRN):c.1105C>T (p.Arg369Ter) rs17847577
NM_000553.6(WRN):c.3139-1G>C rs113993961
NM_000557.5(GDF5):c.1144del (p.Ala382fs) rs1568731526
NM_000558.3(HBA1):c.142G>A (p.Asp48Asn) rs34269448
NM_000558.3(HBA1):c.154G>C (p.Gly52Arg) rs33960522
NM_000558.3(HBA1):c.179G>A (p.Gly60Asp) rs28928878
NM_000558.3(HBA1):c.187_189delGTG (p.Val63del) rs35672478
NM_000558.3(HBA1):c.193G>C (p.Asp65His) rs33984024
NM_000558.3(HBA1):c.20A>G (p.Asp7Gly) rs33986902
NM_000558.3(HBA1):c.226G>T (p.Asp76Tyr) rs33977363
NM_000558.3(HBA1):c.270C>G (p.His90Gln) rs1061009
NM_000558.3(HBA1):c.283G>C (p.Asp95His) rs34102339
NM_000558.3(HBA1):c.287C>T (p.Pro96Leu) rs33931314
NM_000558.3(HBA1):c.341T>A (p.Leu114His) rs35654345
NM_000558.3(HBA1):c.344C>G (p.Pro115Arg) rs33910377
NM_000558.3(HBA1):c.349G>A (p.Glu117Lys) rs63749882
NM_000558.3(HBA1):c.389T>C (p.Leu130Pro) rs35993655
NM_000558.3(HBA1):c.49A>G (p.Lys17Glu) rs41407250
NM_000558.5(HBA1):c.104T>G (p.Leu35Arg) rs35203445
NM_000558.5(HBA1):c.17C>A (p.Ala6Asp) rs34090856
NM_000558.5(HBA1):c.223G>C (p.Asp75His) rs28928875
NM_000558.5(HBA1):c.273G>C (p.Lys91Asn) rs33914470
NM_000558.5(HBA1):c.337C>G (p.His113Asp) rs34830032
NM_000558.5(HBA1):c.350A>C (p.Glu117Ala) rs35932809
NM_000558.5(HBA1):c.362C>A (p.Ala121Glu) rs63749927
NM_000558.5(HBA1):c.364G>A (p.Val122Met) rs63751008
NM_000558.5(HBA1):c.84G>T (p.Glu28Asp) rs41530750
NM_000558.5(HBA1):c.91G>A (p.Glu31Lys) rs33993166
NM_000559.2(HBG1):c.227C>T (p.Thr76Ile) rs1061234
NM_000579.3(CCR5):c.-301+246A>G rs1799987
NM_000579.3(CCR5):c.554_585del (p.Ser185fs) rs333
NM_000602.4(SERPINE1):c.43G>A (p.Ala15Thr) rs6092
NM_000602.5(SERPINE1):c.-820G[(4_5)] rs1799762
NM_000603.5(NOS3):c.894T>G (p.Asp298Glu) rs1799983
NM_000616.5(CD4):c.793C>T (p.Arg265Trp) rs28919570
NM_000617.3(SLC11A2):c.1197G>C (p.Glu399Asp) rs121918365
NM_000621.4(HTR2A):c.614-2211T>C rs7997012
NM_000631.5(NCF4):c.759-1G>C rs200347935
NM_000636.4(SOD2):c.47T>C (p.Val16Ala) rs4880
NM_000642.3(AGL):c.1222C>T (p.Arg408Ter) rs113994128
NM_000642.3(AGL):c.1735+1G>T rs199922945
NM_000642.3(AGL):c.3965del (p.Val1322fs) rs113994132
NM_000642.3(AGL):c.3980G>A (p.Trp1327Ter) rs267606640
NM_000642.3(AGL):c.4260-12A>G rs369973784
NM_000642.3(AGL):c.4456del (p.Ser1486fs) rs113994134
NM_000642.3(AGL):c.4529dup (p.Tyr1510Ter) rs387906244
NM_000660.7(TGFB1):c.1159T>C (p.Cys387Arg) rs1336387628
NM_000660.7(TGFB1):c.133C>T (p.Arg45Cys) rs1555755308
NM_000660.7(TGFB1):c.29C>T (p.Pro10Leu) rs1800470
NM_000660.7(TGFB1):c.328C>T (p.Arg110Cys) rs1555755242
NM_000666.3(ACY1):c.1057C>T (p.Arg353Cys) rs121912698
NM_000684.3(ADRB1):c.145A>G (p.Ser49Gly) rs1801252
NM_000685.4(AGTR1):c.110dup (p.Ile38fs) rs387906577
NM_000686.5(AGTR2):c.402del (p.Phe134fs) rs387906503
NM_000686.5(AGTR2):c.62G>T (p.Gly21Val) rs121917810
NM_000702.4(ATP1A2):c.1133C>A (p.Thr378Asn) rs28934002
NM_000702.4(ATP1A2):c.1244C>T (p.Thr415Met) rs121918618
NM_000702.4(ATP1A2):c.193C>T (p.Arg65Trp) rs121918619
NM_000719.7(CACNA1C):c.1204G>A (p.Gly402Ser) rs80315385
NM_000719.7(CACNA1C):c.1216G>A (p.Gly406Arg) rs79891110
NM_000726.4(CACNB4):c.311G>T (p.Cys104Phe) rs1805031
NM_000742.4(CHRNA2):c.836T>A (p.Ile279Asn) rs104894063
NM_000743.5(CHRNA3):c.645C>T (p.Tyr215=) rs1051730
NM_000744.7(CHRNA4):c.1629C>T (p.Ser543=) rs1044396
NM_000744.7(CHRNA4):c.1659G>A (p.Ala553=) rs1044397
NM_000744.7(CHRNA4):c.839C>T (p.Ser280Phe) rs121909580
NM_000744.7(CHRNA4):c.851C>T (p.Ser284Leu) rs28931591
NM_000745.3(CHRNA5):c.1192G>A (p.Asp398Asn) rs16969968
NM_000748.3(CHRNB2):c.859G>A (p.Val287Met) rs74315291
NM_000748.3(CHRNB2):c.859G>C (p.Val287Leu) rs74315291
NM_000754.3(COMT):c.214G>T (p.Ala72Ser) rs6267
NM_000754.4(COMT):c.472G>A (p.Val158Met) rs4680
NM_000755.5(CRAT):c.962G>A (p.Arg321His) rs138665095
NM_000756.4(CRH):c.89C>G (p.Pro30Arg) rs748404250
NM_000760.4(CSF3R):c.998-2A>T rs879253750
NM_000767.5(CYP2B6):c.785A>G (p.Lys262Arg) rs2279343
NM_000769.1(CYP2C19):c.681G>A (p.Pro227=) rs4244285
NM_000782.5(CYP24A1):c.1226T>C (p.Leu409Ser) rs6068812
NM_000784.4(CYP27A1):c.1016C>T (p.Thr339Met) rs121908102
NM_000784.4(CYP27A1):c.1183C>A (p.Arg395Ser) rs121908096
NM_000784.4(CYP27A1):c.1183C>T (p.Arg395Cys) rs121908096
NM_000784.4(CYP27A1):c.1214G>A (p.Arg405Gln) rs121908099
NM_000784.4(CYP27A1):c.1263+1G>A rs397515355
NM_000784.4(CYP27A1):c.1420C>T (p.Arg474Trp) rs121908098
NM_000784.4(CYP27A1):c.1421G>A (p.Arg474Gln) rs121908097
NM_000784.4(CYP27A1):c.1435C>G (p.Arg479Gly) rs72551322
NM_000784.4(CYP27A1):c.1435C>T (p.Arg479Cys) rs72551322
NM_000784.4(CYP27A1):c.434G>A (p.Gly145Glu) rs72551313
NM_000784.4(CYP27A1):c.844+1G>A rs397515354
NM_000784.4(CYP27A1):c.845-1G>A rs397515353
NM_000784.4(CYP27A1):c.944_948del (p.Leu315fs) rs397515356
NM_000785.4(CYP27B1):c.1166G>A (p.Arg389His) rs118204009
NM_000785.4(CYP27B1):c.320G>A (p.Arg107His) rs28934604
NM_000789.3(ACE):c.2306-117_2306-116insAF118569.1:g.14094_14382
NM_000796.6(DRD3):c.25G>A (p.Gly9Ser) rs6280
NM_000812.4(GABRB1):c.860C>T (p.Thr287Ile) rs886039818
NM_000814.6(GABRB3):c.94G>A (p.Gly32Arg) rs71651682
NM_000824.5(GLRB):c.610+5G>A rs281864922
NM_000824.5(GLRB):c.752G>A (p.Gly251Asp) rs121909749
NM_000827.4(GRIA1):c.1906G>A (p.Ala636Thr) rs587776937
NM_000829.4(GRIA4):c.2090G>C (p.Arg697Pro) rs765556214
NM_000834.4(GRIN2B):c.1367G>A (p.Cys456Tyr) rs397514555
NM_000834.4(GRIN2B):c.1619G>A (p.Arg540His) rs672601378
NM_000834.4(GRIN2B):c.1658C>T (p.Pro553Leu) rs397514556
NM_000834.4(GRIN2B):c.2044C>T (p.Arg682Cys) rs387906636
NM_000836.2(GRIN2D):c.1999G>A (p.Val667Ile) rs886040861
NM_000875.5(IGF1R):c.1532G>A (p.Arg511Gln) rs33958176
NM_000883.4(IMPDH1):c.568C>T (p.Arg190Trp) rs121912553
NM_000890.5(KCNJ5):c.1159G>C (p.Gly387Arg) rs199830292
NM_000890.5(KCNJ5):c.451G>A (p.Gly151Arg) rs386352319
NM_000891.2(KCNJ2):c.277G>A (p.Val93Ile) rs147750704
NM_000892.5(KLKB1):c.428G>A (p.Ser143Asn) rs3733402
NM_000894.2(LHB):c.364G>A (p.Gly122Ser) rs5030774
NM_000901.5(NR3C2):c.2017C>T (p.Arg673Ter) rs121912571
NM_000903.3(NQO1):c.559C>T (p.Pro187Ser) rs1800566
NM_000939.4(POMC):c.706C>G (p.Arg236Gly) rs28932472
NM_000941.3(POR):c.1370G>A (p.Arg457His) rs28931608
NM_000941.3(POR):c.15A>G (p.Gly5=) rs10262966
NM_000941.3(POR):c.859G>C (p.Ala287Pro) rs121912974
NM_000949.7(PRLR):c.508A>C (p.Ile170Leu) rs72478580
NM_000964.4(RARA):c.826C>T (p.Arg276Trp) rs786205678
NM_000965.4(RARB):c.1159C>T (p.Arg387Cys) rs397518483
NM_000969.5(RPL5):c.418G>A (p.Gly140Ser) rs121434406
NM_000996.4(RPL35A):c.304C>T (p.Arg102Ter) rs116840809
NM_000996.4(RPL35A):c.79CTT[1] (p.Leu28del) rs116840807
NM_000996.4(RPL35A):c.97G>A (p.Val33Ile) rs116840808
NM_001001331.4(ATP2B2):c.1891G>A (p.Val631Met) rs61736451
NM_001001547.3(CD36):c.949dup (p.Ile317fs) rs70961716
NM_001001547.3(CD36):c.975T>G (p.Tyr325Ter) rs3211938
NM_001001557.4(GDF6):c.1271A>G (p.Lys424Arg) rs121909353
NM_001001557.4(GDF6):c.1287C>A (p.Ser429Arg) rs1554571225
NM_001001557.4(GDF6):c.746C>A (p.Ala249Glu) rs121909352
NM_001002294.3(FMO3):c.1302G>A (p.Met434Ile) rs72549332
NM_001002294.3(FMO3):c.1474C>T (p.Arg492Trp) rs72549334
NM_001002294.3(FMO3):c.458C>T (p.Pro153Leu) rs72549326
NM_001002294.3(FMO3):c.769G>A (p.Val257Met) rs1736557
NM_001002294.3(FMO3):c.913G>T (p.Glu305Ter) rs61753344
NM_001003679.3(LEPR):c.1968G>C (p.Lys656Asn) rs1805094
NM_001003722.1(GLE1):c.2078C>T (p.Ser693Phe) rs1564162129
NM_001003800.2(BICD2):c.2108C>T (p.Thr703Met) rs371707778
NM_001004334.4(GPR179):c.984del (p.Ser329fs) rs770066665
NM_001007228.2(SPOP):c.248A>G (p.Tyr83Cys)
NM_001007228.2(SPOP):c.362G>A (p.Arg121Gln)
NM_001007228.2(SPOP):c.395G>T (p.Gly132Val)
NM_001007228.2(SPOP):c.412C>T (p.Arg138Cys)
NM_001007228.2(SPOP):c.430G>A (p.Asp144Asn)
NM_001007228.2(SPOP):c.73A>G (p.Thr25Ala)
NM_001007792.1(NTRK1):c.1552del (p.Arg518fs) rs80356675
NM_001007792.1(NTRK1):c.1976C>T (p.Pro659Leu) rs121964868
NM_001008212.2(OPTN):c.1634G>A (p.Arg545Gln) rs75654767
NM_001008212.2(OPTN):c.293T>A (p.Met98Lys) rs11258194
NM_001008216.2(GALE):c.101A>G (p.Asn34Ser) rs121908046
NM_001008216.2(GALE):c.269G>A (p.Gly90Glu) rs28940882
NM_001008216.2(GALE):c.548T>C (p.Leu183Pro) rs121908045
NM_001008216.2(GALE):c.770A>G (p.Lys257Arg) rs28940884
NM_001008216.2(GALE):c.956G>A (p.Gly319Glu) rs28940885
NM_001009944.3(PKD1):c.11249_11263del (p.Arg3750_Leu3754del) rs1567154953
NM_001009944.3(PKD1):c.2534T>C (p.Leu845Ser) rs199476100
NM_001009944.3(PKD1):c.971G>T (p.Arg324Leu) rs199476099
NM_001009999.3(KDM1A):c.1739A>G (p.Asp580Gly) rs864309716
NM_001010867.4(IBA57):c.323A>C (p.Tyr108Ser) rs781627051
NM_001010892.3(RSPH4A):c.1468C>T (p.Arg490Ter) rs118204043
NM_001010892.3(RSPH4A):c.325C>T (p.Gln109Ter) rs118204042
NM_001010892.3(RSPH4A):c.460C>T (p.Gln154Ter) rs118204041
NM_001011.4(RPS7):c.147+1G>A rs397507554
NM_001012515.3(FECH):c.68-23C>T rs2269219
NM_001012720.2(RGR):c.196A>C (p.Ser66Arg) rs104894187
NM_001013703.4(EIF2AK4):c.1392del (p.Arg465fs) rs587777102
NM_001013838.3(CARMIL2):c.1115T>G (p.Leu372Arg) rs1567628757
NM_001013838.3(CARMIL2):c.149G>C (p.Arg50Thr) rs1567626023
NM_001013838.3(CARMIL2):c.1916T>A (p.Leu639His) rs775061512
NM_001017420.3(ESCO2):c.1269G>A (p.Trp423Ter) rs80359864
NM_001017420.3(ESCO2):c.1615T>G (p.Trp539Gly) rs80359868
NM_001017420.3(ESCO2):c.604C>T (p.Gln202Ter) rs80359850
NM_001017420.3(ESCO2):c.760del (p.Thr254fs) rs80359852
NM_001017420.3(ESCO2):c.760dup (p.Thr254fs) rs80359852
NM_001017922.2(ERMAP):c.169G>A (p.Gly57Arg) rs56025238
NM_001017980.3(VMA21):c.*6A>G rs878854355
NM_001017995.3(SH3PXD2B):c.969del (p.Arg324fs) rs794728006
NM_001018005.2(TPM1):c.475G>A (p.Asp159Asn) rs397516373
NM_001018115.2(FANCD2):c.904C>T (p.Arg302Trp) rs121917787
NM_001020658.2(PUM1):c.3103A>T (p.Thr1035Ser) rs771145682
NM_001021.6(RPS17):c.201_202del (p.Gly68fs) rs116840812
NM_001021.6(RPS17):c.2T>G (p.Met1Arg) rs116840811
NM_001024630.4(RUNX2):c.598A>G (p.Thr200Ala) rs104893993
NM_001024688.2(NBN):c.896del (p.Pro299fs) rs587781969
NM_001025295.3(IFITM5):c.-14C>T rs587776916
NM_001026.4(RPS24):c.4_6delinsTACGGATAG (p.Asn2delinsTyrGlyTer) rs116840806
NM_001030001.4(RPS29):c.149T>C (p.Ile50Thr) rs587777569
NM_001031710.3(KLHL7):c.1258C>T (p.Arg420Cys) rs780705654
NM_001031710.3(KLHL7):c.178GTT[1] (p.Val61del) rs1554286093
NM_001031710.3(KLHL7):c.976C>T (p.Arg326Ter) rs77078070
NM_001031726.3(C19orf12):c.187G>C (p.Ala63Pro) rs376103979
NM_001031726.3(C19orf12):c.205G>A (p.Gly69Arg) rs515726205
NM_001031726.3(C19orf12):c.238C>T (p.Gln80Ter) rs1064797235
NM_001031726.3(C19orf12):c.32C>T (p.Thr11Met) rs397514477
NM_001031726.3(C19orf12):c.336G>A (p.Trp112Ter) rs1555714808
NM_001031726.3(C19orf12):c.424A>G (p.Lys142Glu) rs146170087
NM_001031734.4(FDX2):c.431C>T (p.Pro144Leu) rs888630930
NM_001031847.2(CPT1A):c.(?_1744)_2107del (p.Met582Glnfs)
NM_001031847.2(CPT1A):c.948delG (p.Ile317Serfs) rs80356800
NM_001032386.2(SUOX):c.650G>A (p.Arg217Gln) rs121908007
NM_001033855.3(DCLRE1C):c.103C>G (p.His35Asp) rs121908159
NM_001034850.2(RETREG1):c.926C>G (p.Ser309Ter) rs137852739
NM_001035.3(RYR2):c.12602A>G (p.Gln4201Arg) rs121918605
NM_001035.3(RYR2):c.13489C>T (p.Arg4497Cys) rs121918600
NM_001035.3(RYR2):c.13957G>T (p.Val4653Phe) rs121918604
NM_001035.3(RYR2):c.6982C>T (p.Pro2328Ser) rs121918603
NM_001037.5(SCN1B):c.448+88G>A rs267607028
NM_001037.5(SCN1B):c.449-2A>G rs1600370558
NM_001037333.3(CYFIP2):c.259C>T (p.Arg87Cys) rs1131692231
NM_001037333.3(CYFIP2):c.260G>C (p.Arg87Pro) rs1554108163
NM_001037333.3(CYFIP2):c.260G>T (p.Arg87Leu) rs1554108163
NM_001038.6(SCNN1A):c.1477T>C (p.Trp493Arg) rs5742912
NM_001038603.3(MARVELD2):c.1183-1G>A rs200781822
NM_001038603.3(MARVELD2):c.1331+1G>A rs762352115
NM_001039.4(SCNN1G):c.1589A>G (p.Asn530Ser) rs148985177
NM_001039348.3(EFEMP1):c.1033C>T (p.Arg345Trp) rs121434491
NM_001039569.2(AP1S3):c.97C>T (p.Arg33Trp) rs138292988
NM_001039958.2(MESP2):c.307G>T (p.Glu103Ter) rs71647808
NM_001039958.2(MESP2):c.373C>G (p.Leu125Val) rs71647806
NM_001039958.2(MESP2):c.500_503dup (p.Gly169fs) rs113994158
NM_001039958.2(MESP2):c.700G>T (p.Glu234Ter) rs118204035
NM_001040108.1(MLH3):c.1870G>C (p.Glu624Gln) rs28756986
NM_001040108.1(MLH3):c.2221G>T (p.Val741Phe) rs28756990
NM_001040108.1(MLH3):c.3826T>C (p.Trp1276Arg) rs121908439
NM_001040108.1(MLH3):c.4351G>A (p.Glu1451Lys) rs28939071
NM_001040142.2(SCN2A):c.3631G>A (p.Glu1211Lys) rs387906684
NM_001040142.2(SCN2A):c.5645G>A (p.Arg1882Gln) rs794727444
NM_001040167.2(LFNG):c.564C>A (p.Phe188Leu) rs104894024
NM_001040436.3(YARS2):c.156C>G (p.Phe52Leu) rs267607180
NM_001040716.2(PC):c.1351C>T (p.Arg451Cys) rs113994143
NM_001040716.2(PC):c.1828G>A (p.Ala610Thr) rs28940589
NM_001040716.2(PC):c.2229G>T (p.Met743Ile) rs28940590
NM_001040716.2(PC):c.434T>C (p.Val145Ala) rs28940591
NM_001040716.2(PC):c.467G>A (p.Arg156Gln) rs119103241
NM_001041.4(SI):c.1730T>G (p.Val577Gly) rs121912615
NM_001041.4(SI):c.3218G>A (p.Gly1073Asp) rs121912616
NM_001042425.2(TFAP2A):c.751A>G (p.Arg251Gly) rs121909574
NM_001042492.3(NF1):c.4330A>G (p.Lys1444Glu) rs137854550
NM_001042537.1(SLC9A6):c.526-9_526-5del rs796053290
NM_001042646.3(TRAK1):c.1759dup (p.His587fs) rs1559390743
NM_001042646.3(TRAK1):c.986T>C (p.Leu329Pro) rs770281448
NM_001044.5(SLC6A3):c.1031+1G>A rs431905514
NM_001045.6(SLC6A4):c.1273A>G (p.Ile425Val) rs28914832
NM_001048166.1(STIL):c.2829+1G>A rs199422206
NM_001048166.1(STIL):c.3658del (p.Leu1219_Val1220insTer) rs199422207
NM_001048166.1(STIL):c.3718C>T (p.Gln1240Ter) rs121918609
NM_001048174.2(MUTYH):c.1143_1144dup (p.Glu382fs) rs587780078
NM_001048174.2(MUTYH):c.452A>G (p.Tyr151Cys) rs34612342
NM_001060.5(TBXA2R):c.179G>T (p.Arg60Leu) rs34377097
NM_001061.6(TBXAS1):c.1235G>A (p.Arg412Gln) rs199422117
NM_001063.4(TF):c.1765C>T (p.Pro589Ser) rs1049296
NM_001063.4(TF):c.956A>G (p.His319Arg) rs41295774
NM_001069.3(TUBB2A):c.743C>T (p.Ala248Val) rs2808001
NM_001072.4(UGT1A6):c.1453T>G (p.Tyr485Asp) rs34993780
NM_001072.4(UGT1A6):c.862-10021T>G rs4124874
NM_001072.4(UGT1A6):c.862-6061C>A rs35350960
NM_001077365.2(POMT1):c.1939G>A (p.Ala647Thr) rs119462987
NM_001077401.2(ACVRL1):c.1232G>A (p.Arg411Gln) rs121909284
NM_001077415.3(CRELD1):c.320G>A (p.Arg107His) rs28941780
NM_001077415.3(CRELD1):c.932C>T (p.Thr311Ile) rs28942092
NM_001077415.3(CRELD1):c.985C>T (p.Arg329Cys) rs28942091
NM_001077446.4(TSEN34):c.172C>T (p.Arg58Trp) rs113994150
NM_001077653.2(TBX20):c.456C>G (p.Ile152Met) rs137852954
NM_001079802.2(FKTN):c.373G>A (p.Gly125Ser) rs34006675
NM_001079866.2(BCS1L):c.547C>T (p.Arg183Cys) rs144885874
NM_001079866.2(BCS1L):c.550C>T (p.Arg184Cys) rs121908578
NM_001080397.2(SLC45A1):c.628C>T (p.Arg210Trp) rs781036625
NM_001080413.3(NOBOX):c.1064G>A (p.Arg355His) rs201947677
NM_001080413.3(NOBOX):c.271G>T (p.Gly91Trp) rs77587352
NM_001080413.3(NOBOX):c.349C>T (p.Arg117Trp) rs7800847
NM_001080472.4(FITM2):c.694G>A (p.Gly232Arg) rs765281145
NM_001080477.4(TENM3):c.4046C>G (p.Ala1349Gly) rs1243762658
NM_001080477.4(TENM3):c.7687C>T (p.Arg2563Trp) rs755000701
NM_001080483.3(MYMK):c.271C>A (p.Pro91Thr) rs137868995
NM_001080522.2(CC2D2A):c.3364C>T (p.Pro1122Ser) rs118204051
NM_001080522.2(CC2D2A):c.4340A>C (p.Glu1447Ala) rs387907058
NM_001081.4(CUBN):c.9053A>C (p.Tyr3018Ser) rs370778353
NM_001082538.3(TCTN1):c.221-2A>G rs367543065
NM_001082971.2(DDC):c.272C>T (p.Ala91Val) rs137853211
NM_001083116.3(PRF1):c.1304C>T (p.Thr435Met) rs28933376
NM_001083116.3(PRF1):c.272C>T (p.Ala91Val) rs35947132
NM_001083116.3(PRF1):c.755A>G (p.Asn252Ser) rs28933375
NM_001083614.2(EARS2):c.328G>A (p.Gly110Ser) rs201842633
NM_001083619.3(GRIA2):c.1582C>A (p.Pro528Thr)
NM_001083619.3(GRIA2):c.1825G>A (p.Gly609Arg)
NM_001083619.3(GRIA2):c.1831G>A rs1553956958
NM_001083619.3(GRIA2):c.1915G>T rs1579377564
NM_001083619.3(GRIA2):c.905A>G (p.Asp302Gly)
NM_001083961.2(WDR62):c.1576G>A (p.Glu526Lys) rs147875659
NM_001083962.2(TCF4):c.1739G>A (p.Arg580Gln) rs121909121
NM_001085.5(SERPINA3):c.754C>G (p.Pro252Ala) rs17473
NM_001085411.3(NADK2):c.1018C>T (p.Arg340Ter) rs587777772
NM_001085411.3(NADK2):c.1A>G (p.Met1Val) rs1277388010
NM_001097577.3(ANG):c.122A>T (p.Lys41Ile) rs121909536
NM_001097577.3(ANG):c.208A>G (p.Ile70Val) rs121909541
NM_001098.3(ACO2):c.2050C>T (p.Arg684Trp) rs768950391
NM_001099667.3(ARMS2):c.205G>T (p.Ala69Ser) rs10490924
NM_001099857.5(IKBKG):c.1117+5G>C rs1557236796
NM_001100.3(ACTA1):c.1000C>T (p.Pro334Ser) rs121909531
NM_001100.3(ACTA1):c.1074G>T (p.Trp358Cys) rs587777354
NM_001100.3(ACTA1):c.668T>C (p.Leu223Pro) rs121909530
NM_001100.3(ACTA1):c.881A>T (p.Asp294Val) rs121909529
NM_001100913.3(PACS2):c.625G>A (p.Glu209Lys) rs1555408401
NM_001101426.4(CRPPA):c.1105GTT[3] (p.Val372del) rs587777798
NM_001101648.2(NPC1L1):c.3617T>A (p.Ile1206Asn) rs52815063
NM_001102.4(ACTN1):c.137G>A (p.Arg46Gln) rs387907348
NM_001103.3(ACTN2):c.1459T>C (p.Cys487Arg) rs1572140109
NM_001103.3(ACTN2):c.2180T>G (p.Leu727Arg) rs1572148902
NM_001103.3(ACTN2):c.2194_2226del (p.Ala732_Ile742del) rs1572148914
NM_001103.3(ACTN2):c.26A>G (p.Gln9Arg) rs121434525
NM_001103.3(ACTN2):c.392T>C (p.Leu131Pro) rs1572114611
NM_001104.4(ACTN3):c.1729C>T (p.Arg577Ter) rs1815739
NM_001105206.3(LAMA4):c.3238C>T (p.Arg1080Ter) rs372615994
NM_001105537.3(ZNF142):c.[4183delC;4185G>A]
NM_001105537.4(ZNF142):c.1292del (p.Cys431fs) rs1559296368
NM_001105537.4(ZNF142):c.3175C>T (p.Arg1059Ter) rs546151500
NM_001105537.4(ZNF142):c.3698G>T (p.Cys1233Phe) rs1275959058
NM_001105537.4(ZNF142):c.4498C>T (p.Arg1500Trp) rs367658234
NM_001105537.4(ZNF142):c.817_818del (p.Lys273fs) rs1447313633
NM_001106.4(ACVR2B):c.119G>A (p.Arg40His) rs121434437
NM_001110556.2(FLNA):c.2280+266_2827-25delinsTG
NM_001110556.2(FLNA):c.3562G>A (p.Ala1188Thr) rs28935472
NM_001110556.2(FLNA):c.3596C>T (p.Ser1199Leu) rs28935473
NM_001110556.2(FLNA):c.4660G>A (p.Gly1554Arg) rs1603360542
NM_001110556.2(FLNA):c.5217G>A (p.Thr1739=) rs387907371
NM_001110556.2(FLNA):c.67_68del (p.Thr23fs) rs80338840
NM_001110792.2(MECP2):c.1318G>A (p.Gly440Ser) rs61753971
NM_001110792.2(MECP2):c.334C>G (p.Leu112Val) rs28935168
NM_001110792.2(MECP2):c.352C>T (p.Arg118Trp) rs28934907
NM_001110792.2(MECP2):c.433C>T (p.Arg145Cys) rs28934904
NM_001110792.2(MECP2):c.509C>T (p.Thr170Met) rs28934906
NM_001110792.2(MECP2):c.5C>T (p.Ala2Val) rs179363901
NM_001110792.2(MECP2):c.799C>T (p.Arg267Ter) rs61749721
NM_001110792.2(MECP2):c.916C>T (p.Arg306Ter) rs61751362
NM_001111.5(ADAR):c.2608G>A (p.Ala870Thr) rs398122893
NM_001111.5(ADAR):c.2615T>C (p.Ile872Thr) rs398122897
NM_001111.5(ADAR):c.2675G>A (p.Arg892His) rs398122892
NM_001111.5(ADAR):c.2997G>T (p.Lys999Asn) rs398122896
NM_001111.5(ADAR):c.3019G>A (p.Gly1007Arg) rs398122822
NM_001111.5(ADAR):c.3335A>T (p.Tyr1112Phe) rs398122895
NM_001111.5(ADAR):c.3337G>C (p.Asp1113His) rs398122894
NM_001111.5(ADAR):c.577C>G (p.Pro193Ala) rs145588689
NM_001111067.4(ACVR1):c.983G>A (p.Gly328Glu) rs387906589
NM_001113491.2(SEPTIN9):c.316C>T (p.Arg106Trp) rs80338761
NM_001113491.2(SEPTIN9):c.332C>T (p.Ser111Phe) rs80338762
NM_001113491.2(SEPTIN9):c.76+12996G>C rs80338760
NM_001114748.2(TMEM240):c.509C>T (p.Pro170Leu) rs606231451
NM_001119.5(ADD1):c.1378G>T (p.Gly460Trp) rs4961
NM_001122659.3(EDNRB):c.169G>A (p.Gly57Ser) rs1801710
NM_001122659.3(EDNRB):c.914G>A (p.Ser305Asn) rs5352
NM_001122681.2(SH3BP2):c.1253C>T (p.Pro418Leu) rs121909146
NM_001122764.3(PPOX):c.502C>T (p.Arg168Cys) rs121918325
NM_001122764.3(PPOX):c.767C>G (p.Pro256Arg) rs12735723
NM_001122769.3(LCA5):c.1151del (p.Pro384fs) rs386834252
NM_001122769.3(LCA5):c.1476dup (p.Pro493fs) rs386834253
NM_001122769.3(LCA5):c.835C>T (p.Gln279Ter) rs121918165
NM_001126105.2(SLC7A7):c.1005_1008del (p.Phe335Leufs) rs386833794
NM_001126105.2(SLC7A7):c.161G>T (p.Gly54Val) rs121908677
NM_001126105.2(SLC7A7):c.625+1G>A rs386833822
NM_001126108.2(SLC12A3):c.1763C>T (p.Ala588Val) rs121909382
NM_001126108.2(SLC12A3):c.1964G>A (p.Arg655His) rs121909380
NM_001126108.2(SLC12A3):c.2549T>C (p.Leu850Pro) rs121909379
NM_001126131.2(POLG):c.1760C>T (p.Pro587Leu) rs113994096
NM_001126131.2(POLG):c.2542G>A (p.Gly848Ser) rs113994098
NM_001126131.2(POLG):c.752C>T (p.Thr251Ile) rs113994094
NM_001127178.3(PIGG):c.2005C>T (p.Arg669Cys) rs372392424
NM_001127207.2(SMARCAL1):c.2542G>T (p.Glu848Ter) rs119473033
NM_001127222.2(CACNA1A):c.4633C>T (p.Arg1545Ter) rs121909324
NM_001127222.2(CACNA1A):c.4979G>A (p.Arg1660His) rs121908216
NM_001127392.3(MYRF):c.2084G>A (p.Arg695His) rs1382225004
NM_001127593.1(FCGR3A):c.197T>A (p.Leu66His) rs10127939
NM_001127671.2(LIFR):c.2074C>T (p.Arg692Ter) rs199775294
NM_001127698.2(SPINK5):c.1431-12G>A rs368134354
NM_001127701.1(SERPINA1):c.1096G>A (p.Glu366Lys) rs28929474
NM_001127701.1(SERPINA1):c.1159G>A (p.Glu387Lys) rs121912712
NM_001127701.1(SERPINA1):c.1178C>T (p.Pro393Leu) rs199422209
NM_001127701.1(SERPINA1):c.1200A>C (p.Glu400Asp) rs1303
NM_001127701.1(SERPINA1):c.17C>T (p.Ser6Leu) rs140814100
NM_001127701.1(SERPINA1):c.187C>T (p.Arg63Cys) rs28931570
NM_001127701.1(SERPINA1):c.194T>C (p.Leu65Pro) rs28931569
NM_001127701.1(SERPINA1):c.326C>T (p.Thr109Met) rs199422213
NM_001127701.1(SERPINA1):c.374G>A (p.Arg125His) rs709932
NM_001127701.1(SERPINA1):c.739C>T (p.Arg247Cys) rs28929470
NM_001127701.1(SERPINA1):c.839A>T (p.Asp280Val) rs121912714
NM_001127701.1(SERPINA1):c.863A>T (p.Glu288Val) rs17580
NM_001127713.1(ATL1):c.1222A>G (p.Met408Val) rs28939094
NM_001127713.1(ATL1):c.1243C>T (p.Arg415Trp) rs119476050
NM_001127713.1(ATL1):c.1244G>A (p.Arg415Gln) rs397514712
NM_001127713.1(ATL1):c.470T>G (p.Leu157Trp) rs119476051
NM_001127713.1(ATL1):c.715C>T (p.Arg239Cys) rs119476046
NM_001127713.1(ATL1):c.773A>G (p.His258Arg) rs119476048
NM_001127895.2(CHST8):c.229C>T (p.Arg77Trp) rs149660944
NM_001127898.4(CLCN5):c.941C>T (p.Ser314Leu) rs151340626
NM_001127898.4(CLCN5):c.989G>T (p.Gly330Val) rs151340630
NM_001128126.3(AP4S1):c.289C>T (p.Arg97Ter) rs200440467
NM_001128148.3(TFRC):c.58T>C (p.Tyr20His) rs863225436
NM_001128431.4(SLC39A14):c.751-9C>G rs1039778197
NM_001128840.3(CACNA1D):c.1220+678G>A rs386834264
NM_001128840.3(CACNA1D):c.1220+678_1220+679insGGG rs398122827
NM_001128929.3(ROBO2):c.2882T>C (p.Ile961Thr) rs267607014
NM_001129.5(AEBP1):c.1743C>A (p.Cys581Ter) rs777647845
NM_001130823.3(DNMT1):c.1532A>G (p.Tyr511Cys) rs199473690
NM_001130823.3(DNMT1):c.1814G>C (p.Gly605Ala) rs397509393
NM_001130987.2(DYSF):c.3946A>G (p.Ile1316Val) rs121908954
NM_001130987.2(DYSF):c.5546G>A (p.Arg1849Lys) rs786205084
NM_001130987.2(DYSF):c.6241C>T (p.Arg2081Cys) rs121908955
NM_001130987.2(DYSF):c.991G>A (p.Gly331Arg) rs121908963
NM_001134232.2(TMEM106B):c.754G>A (p.Asp252Asn) rs1554310600
NM_001134363.3(RBM20):c.1907G>A (p.Arg636His) rs267607004
NM_001134407.3(GRIN2A):c.1553G>A (p.Arg518His) rs397518470
NM_001134407.3(GRIN2A):c.1592C>T (p.Thr531Met) rs397518468
NM_001134665.3(TRMT10A):c.379C>T (p.Arg127Ter) rs587777743
NM_001134831.2(AHI1):c.2168G>A (p.Arg723Gln) rs121434351
NM_001134831.2(AHI1):c.2282C>T (p.Ser761Leu) rs794727174
NM_001135242.2(NDRG1):c.442C>T (p.Arg148Ter) rs119483085
NM_001135254.2(PAX7):c.220C>T (p.Arg74Ter) rs1176071790
NM_001135651.3(EIF2AK2):c.1382C>G (p.Ser461Cys) rs1572996700
NM_001135651.3(EIF2AK2):c.31A>C (p.Met11Leu) rs1363544084
NM_001135651.3(EIF2AK2):c.325G>T (p.Ala109Ser)
NM_001135651.3(EIF2AK2):c.398A>T (p.Tyr133Phe) rs1573029592
NM_001135651.3(EIF2AK2):c.95A>G (p.Asn32Ser)
NM_001136219.3(FCGR2A):c.500A>G (p.His167Arg) rs1801274
NM_001136271.2(NKX2-6):c.453_454insT (p.Lys152Ter) rs587777422
NM_001136473.1(LITAF):c.334G>A (p.Gly112Ser) rs104894519
NM_001136473.1(LITAF):c.344C>A (p.Thr115Asn) rs104894520
NM_001136473.1(LITAF):c.346T>G (p.Trp116Gly) rs104894521
NM_001139.3(ALOX12B):c.1294C>T (p.Arg432Ter) rs397514527
NM_001139.3(ALOX12B):c.1642C>T (p.Arg548Trp) rs397514532
NM_001142279.2(RNASEH2B):c.554T>G (p.Val185Gly) rs74555752
NM_001142301.1(TMEM67):c.1332+1G>A rs386834187
NM_001142301.1(TMEM67):c.627-2A>G rs386834207
NM_001142446.2(ANK1):c.127-39509T>C rs77173848
NM_001142446.2(ANK1):c.127-39554G>A rs183894680
NM_001142569.3(INAVA):c.743A>T (p.Tyr248Phe)
NM_001142633.2(PIK3R5):c.1885C>T (p.Pro629Ser) rs61761068
NM_001142730.3(KCTD1):c.2009G>A (p.Gly670Asp) rs587777003
NM_001142800.2(EYS):c.9405T>A (p.Tyr3135Ter) rs137853190
NM_001142864.4(PIEZO1):c.6380C>T (p.Thr2127Met) rs587776991
NM_001142966.2(GREB1L):c.5068G>A (p.Val1690Met) rs1555663997
NM_001143992.2(WRAP53):c.1126C>T (p.His376Tyr) rs281865549
NM_001143992.2(WRAP53):c.1192C>T (p.Arg398Trp) rs281865548
NM_001143992.2(WRAP53):c.1303G>A (p.Gly435Arg) rs281865550
NM_001143992.2(WRAP53):c.492C>A (p.Phe164Leu) rs281865547
NM_001144869.3(LIPT2):c.314T>G (p.Leu105Arg) rs1190703859
NM_001144869.3(LIPT2):c.377T>G (p.Leu126Arg) rs753904927
NM_001144869.3(LIPT2):c.89T>C (p.Leu30Pro) rs539962457
NM_001144967.3(NEDD4L):c.2677G>A (p.Glu893Lys)
NM_001145026.2(PTPRQ):c.6881G>A (p.Trp2294Ter) rs1555214288
NM_001145112.1(PATL2):c.1108G>A (p.Gly370Arg) rs1397500378
NM_001145112.1(PATL2):c.478C>T (p.Arg160Ter) rs548527219
NM_001145112.1(PATL2):c.784C>T (p.Arg262Ter) rs1351320025
NM_001145112.1(PATL2):c.839G>A (p.Arg280Gln) rs569729547
NM_001145112.1(PATL2):c.953T>C (p.Ile318Thr) rs1011539285
NM_001145661.2(GATA2):c.1061C>T (p.Thr354Met) rs387906631
NM_001145809.2(MYH14):c.1150G>T (p.Gly384Cys) rs119103280
NM_001146040.1(GLRA1):c.(?_-287)_(912+?)del
NM_001146079.2(CLDN14):c.301G>A (p.Gly101Arg) rs74315438
NM_001146079.2(CLDN14):c.694G>A (p.Gly232Arg) rs786204841
NM_001146274.2(TCF7L2):c.450+33966C>T rs7903146
NM_001148.6(ANK2):c.11218C>A (p.Leu3740Ile) rs35530544
NM_001148.6(ANK2):c.11231C>A (p.Thr3744Asn) rs121912705
NM_001148.6(ANK2):c.11716C>T (p.Arg3906Trp) rs121912706
NM_001148.6(ANK2):c.11791G>A (p.Glu3931Lys) rs45454496
NM_001148.6(ANK2):c.4373A>G (p.Glu1458Gly) rs72544141
NM_001159699.2(FHL1):c.720C>G (p.Cys240Trp) rs122458141
NM_001159773.2(CANT1):c.228dup (p.Trp77fs) rs587776896
NM_001160036.2(RHOBTB2):c.1421C>G (p.Ala474Gly) rs1554504656
NM_001160036.2(RHOBTB2):c.1448G>A (p.Arg483His) rs1554504663
NM_001160036.2(RHOBTB2):c.1528A>G (p.Asn510Asp) rs1554504678
NM_001160036.2(RHOBTB2):c.1531C>T (p.Arg511Trp) rs1554504681
NM_001160179.2(NAT1):c.445G>A (p.Val149Ile) rs4987076
NM_001160372.4(TRAPPC9):c.1414C>T (p.Arg472Ter) rs267607137
NM_001161352.2(KCNMA1):c.1123G>A (p.Gly375Arg) rs1554829003
NM_001163213.1(FGFR3):c.746C>G (p.Ser249Cys) rs121913483
NM_001163435.3(TBCK):c.2060-2A>G rs62321379
NM_001163817.2(DHCR7):c.1A>G (p.Met1Val) rs104886033
NM_001163817.2(DHCR7):c.278C>T (p.Thr93Met) rs80338853
NM_001164277.1(SLC37A4):c.287G>A (p.Trp96Ter) rs121908976
NM_001164277.1(SLC37A4):c.83G>A (p.Arg28His) rs121908978
NM_001164277.2(SLC37A4):c.703GTG[1] (p.Val236del) rs121908977
NM_001164278.2(SLC37A4):c.1309C>T (p.Arg437Ter) rs121908979
NM_001164405.1(BHLHA9):c.220_221delinsTT (p.Glu74Leu) rs886037856
NM_001164811.2(PET117):c.172C>T (p.Gln58Ter)
NM_001165927.1(MKS1):c.50+313T>C rs386834052
NM_001165927.1(MKS1):c.994+1G>A rs199874059
NM_001165960.1(ALOXE3):c.1105T>A (p.Leu369Met) rs121434235
NM_001165963.4(SCN1A):c.5006C>A (p.Ala1669Glu) rs397514458
NM_001165963.4(SCN1A):c.5126C>T (p.Thr1709Ile) rs121918629
NM_001165963.4(SCN1A):c.664C>T (p.Arg222Ter) rs121918624
NM_001166107.1(HMGCS2):c.1144C>T (p.Arg382Ter) rs137852637
NM_001166107.1(HMGCS2):c.1373G>A (p.Arg458His) rs137852639
NM_001166107.1(HMGCS2):c.160G>A (p.Val54Met) rs28937320
NM_001166107.1(HMGCS2):c.520T>C (p.Phe174Leu) rs137852636
NM_001166107.1(HMGCS2):c.560-633G>A rs137852638
NM_001166108.2(PALLD):c.1965-12616C>T rs121908291
NM_001166244.1(HPSE2):c.1291_1292del (p.Asn431fs) rs397515338
NM_001167.4(XIAP):c.1045GAG[1] (p.Glu350del) rs199683465
NM_001168338.1(PLG):c.112A>G (p.Lys38Glu) rs73015965
NM_001170629.2(CHD8):c.4009C>T (p.Arg1337Ter) rs397514552
NM_001171.5(ABCC6):c.1088_1120del (p.Gln363_Arg373del) rs387906353
NM_001171.5(ABCC6):c.1967_1989del (p.Gly656fs) rs74315130
NM_001171.5(ABCC6):c.3712G>C (p.Asp1238His) rs63749796
NM_001171.5(ABCC6):c.3803G>A (p.Arg1268Gln) rs2238472
NM_001171.5(ABCC6):c.3961G>A (p.Gly1321Ser) rs63749823
NM_001171155.2(PET100):c.142C>T (p.Gln48Ter) rs587779779
NM_001171814.1(OAT):c.-215-3048del rs386833599
NM_001173990.3(TMEM216):c.218G>T (p.Arg73Leu) rs201108965
NM_001173990.3(TMEM216):c.230G>C (p.Gly77Ala) rs386833830
NM_001173990.3(TMEM216):c.341T>G (p.Leu114Arg) rs386833831
NM_001177316.2(SLC34A3):c.756G>A (p.Gln252=) rs121918239
NM_001178010.2(CDC45):c.1756C>T (p.Arg586Trp) rs778665661
NM_001178010.2(CDC45):c.203A>G (p.Gln68Arg) rs879255633
NM_001178010.2(CDC45):c.226A>C (p.Asn76His) rs879255632
NM_001178010.2(CDC45):c.469C>T (p.Arg157Cys) rs540217942
NM_001178010.2(CDC45):c.773A>G (p.Asp258Gly) rs754080445
NM_001178010.2(CDC45):c.989C>T (p.Ala330Val) rs146559223
NM_001182.5(ALDH7A1):c.1279G>C (p.Glu427Gln) rs121912707
NM_001189.4(NKX3-2):c.507_508del (p.Gly171fs) rs1560165127
NM_001190737.2(NFIB):c.265C>T (p.Arg89Ter) rs764333096
NM_001190737.2(NFIB):c.376A>G (p.Lys126Glu) rs1554709662
NM_001190737.2(NFIB):c.395T>C (p.Leu132Pro) rs1554709654
NM_001191061.2(SLC25A22):c.617C>T (p.Pro206Leu) rs121918334
NM_001193466.2(KANSL1):c.1652+1G>A rs281865470
NM_001193466.2(KANSL1):c.1816C>T (p.Arg606Ter) rs281865469
NM_001193466.2(KANSL1):c.916C>T (p.Gln306Ter) rs281865468
NM_001193466.2(KANSL1):c.985_986del (p.Leu329fs) rs281865473
NM_001194998.2(CEP152):c.2034T>G (p.Tyr678Ter) rs182018947
NM_001194998.2(CEP152):c.2959C>T (p.Arg987Ter) rs267606718
NM_001194998.2(CEP152):c.794A>C (p.Gln265Pro) rs267606717
NM_001195129.2(PRSS56):c.1795C>G (p.Pro599Ala) rs61744404
NM_001195129.2(PRSS56):c.904G>T (p.Val302Phe) rs74703359
NM_001195263.2(PDZD7):c.1500C>A (p.Tyr500Ter) rs953422571
NM_001195263.2(PDZD7):c.197G>T (p.Arg66Leu) rs1426679303
NM_001195263.2(PDZD7):c.2107del (p.Ser703fs) rs397516633
NM_001195263.2(PDZD7):c.307G>C (p.Gly103Arg) rs148695069
NM_001195263.2(PDZD7):c.682G>A (p.Gly228Arg) rs753034799
NM_001195263.2(PDZD7):c.854T>G (p.Met285Arg) rs1554835827
NM_001195518.2(MICU1):c.547C>T (p.Gln183Ter) rs777327250
NM_001195518.2(MICU1):c.735+1G>A rs369915689
NM_001195553.2(DCX):c.184G>A (p.Asp62Asn) rs104894779
NM_001198800.3(ASCC1):c.869A>G (p.Asn290Ser) rs146370051
NM_001199198.3(TBC1D23):c.1687+2T>A rs1553731605