ClinVar Miner

Variants from OMIM with conflicting interpretations

Location: United States — Primary collection method: literature only
Minimum review status of the submission from OMIM: Collection method of the submission from OMIM:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
17339 5458 1223 2922 126 857 1965 6308

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
OMIM pathogenic likely pathogenic uncertain significance likely benign benign affects association drug response protective risk factor other
pathogenic 1216 2888 1593 379 344 28 10 41 15 112 152
uncertain significance 43 25 2 85 87 0 0 1 0 1 1
benign 12 2 12 34 5 1 1 9 3 12 7
affects 24 2 7 9 12 0 5 4 0 5 4
association 13 4 3 11 22 5 0 3 2 8 4
drug response 4 2 0 14 6 0 0 0 1 5 14
protective 12 2 2 10 15 0 1 2 0 9 2
risk factor 188 83 93 99 131 6 8 31 10 0 6
other 178 27 72 37 14 0 0 1 2 1 0

Submitter to submitter summary #

Total submitters: 322
Download table as spreadsheet
Submitter Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
GeneReviews 0 1045 1216 11 4 75 42 1334
Invitae 0 2086 0 241 75 216 656 1170
GeneDx 0 2110 0 357 45 157 291 842
Counsyl 0 605 0 438 9 69 157 668
Illumina Clinical Services Laboratory,Illumina 0 387 0 122 55 136 279 570
EGL Genetic Diagnostics,Eurofins Clinical Diagnostics 0 1000 0 58 40 138 257 484
Ambry Genetics 0 586 0 124 36 76 167 397
Laboratory for Molecular Medicine, Partners HealthCare Personalized Medicine 0 494 0 110 33 79 164 376
Mendelics 0 259 0 34 30 89 220 359
OMIM 27699 1116 0 0 0 287 6 290
SIB Swiss Institute of Bioinformatics 0 87 0 225 0 0 63 288
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories 0 391 0 30 33 133 99 287
CeGaT Praxis fuer Humangenetik Tuebingen 0 14 0 81 12 32 118 233
PreventionGenetics,PreventionGenetics 0 55 0 7 36 93 67 195
Database of Curated Mutations (DoCM) 0 20 0 167 0 13 0 178
Integrated Genetics/Laboratory Corporation of America 0 714 0 35 18 54 60 163
Genetic Services Laboratory, University of Chicago 0 287 0 60 13 37 50 158
Fulgent Genetics,Fulgent Genetics 0 557 0 72 2 35 26 134
Quest Diagnostics Nichols Institute San Juan Capistrano 0 188 0 21 6 79 23 126
NIHR Bioresource Rare Diseases, University of Cambridge 0 112 0 110 0 10 10 126
Athena Diagnostics Inc 0 323 0 30 11 30 56 125
Baylor Genetics 0 455 0 47 3 26 39 114
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 0 165 0 17 16 19 55 105
Inherited Neuropathy Consortium 0 5 0 0 0 0 105 105
Color 0 101 0 16 13 41 39 104
Genomic Research Center, Shahid Beheshti University of Medical Sciences 0 76 0 38 1 8 53 99
Reproductive Health Research and Development,BGI Genomics 0 67 0 21 0 15 47 83
Biesecker Lab/Clinical Genomics Section,National Institutes of Health 0 9 4 0 20 9 48 77
Wong Mito Lab, Molecular and Human Genetics, Baylor College of Medicine 0 63 0 23 2 7 41 73
Equipe Genetique des Anomalies du Developpement,Université de Bourgogne 0 61 0 43 2 9 22 72
Lupski Lab, Baylor-Hopkins CMG, Baylor College of Medicine 0 95 0 63 0 1 8 71
PharmGKB 0 13 0 0 0 68 0 68
Developmental Genetics Unit,King Faisal Specialist Hospital & Research Centre 0 5 0 64 1 1 1 67
University of Washington Center for Mendelian Genomics,University of Washington 0 64 0 58 0 3 4 65
CSER _CC_NCGL, University of Washington 0 12 0 13 5 10 36 63
Mayo Clinic Genetic Testing Laboratories,Mayo Clinic 0 82 0 14 7 13 27 61
Centre for Mendelian Genomics,University Medical Centre Ljubljana 0 107 0 33 0 11 19 57
Blueprint Genetics 0 117 0 22 2 13 21 56
Soonchunhyang University Bucheon Hospital,Soonchunhyang University Medical Center 0 12 0 24 1 5 25 54
Division of Genomic Diagnostics,The Children's Hospital of Philadelphia 0 90 0 10 9 15 19 52
Juha Muilu Group; Institute for Molecular Medicine Finland (FIMM) 0 7 0 46 0 0 0 46
Stanford Center for Inherited Cardiovascular Disease,Stanford University 0 52 0 25 1 2 19 46
Biochemical Molecular Genetic Laboratory,King Abdulaziz Medical City 0 61 0 25 0 6 7 38
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute 0 28 0 7 3 7 21 36
LDLR-LOVD, British Heart Foundation 0 20 0 34 0 0 0 34
Department of Genetics,Sultan Qaboos University Hospital, Oman 0 28 0 8 1 7 19 34
Broad Institute Rare Disease Group,Broad Institute 0 55 0 18 0 1 14 33
ClinVar Staff, National Center for Biotechnology Information (NCBI) 0 24 0 20 0 5 7 32
Diagnostic Laboratory, Department of Genetics,University Medical Center Groningen 0 64 0 4 12 13 3 32
Undiagnosed Diseases Network,NIH 0 49 0 19 0 1 11 31
Division of Human Genetics,Children's Hospital of Philadelphia 0 41 0 14 0 10 5 29
Sharon lab,Hadassah-Hebrew University Medical Center 0 76 0 26 0 3 1 29
CHEO Genetics Diagnostic Laboratory,Children's Hospital of Eastern Ontario 0 21 0 3 3 4 18 27
HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology 0 77 0 16 0 10 1 27
GeneKor MSA 0 18 0 8 2 12 6 26
Human Genome Sequencing Center Clinical Lab,Baylor College of Medicine 0 35 0 9 0 16 0 25
German Consortium for Hereditary Breast and Ovarian Cancer Center Cologne,University Hospital Cologne 0 16 0 19 0 5 0 24
Center for Medical Genetics Ghent,University of Ghent 0 8 0 20 0 0 3 23
DNA and Cytogenetics Diagnostics Unit,Erasmus Medical Center 0 43 0 5 7 5 6 23
Center for Advanced Laboratory Medicine, UC San Diego Health,University of California San Diego 0 9 0 2 5 3 15 23
Robarts Research Institute,Western University 0 3 0 21 0 1 0 22
Department of Laboratory Medicine and Genetics,Trillium Health Partners Credit Valley Hospital 0 2 0 0 0 22 0 22
Genesis Genome Database 0 0 0 0 0 0 22 22
Knight Diagnostic Laboratories,Oregon Health and Sciences University 0 42 0 6 0 14 2 21
Genome Diagnostics Laboratory,University Medical Center Utrecht 0 34 0 2 10 5 2 19
Yale Center for Mendelian Genomics,Yale University 0 22 0 17 0 2 1 19
Gharavi Laboratory,Columbia University 0 26 0 5 0 6 8 19
Molecular Diagnostics Lab,Nemours Alfred I. duPont Hospital for Children 0 34 0 14 0 1 3 18
UCLA Clinical Genomics Center, UCLA 0 17 0 17 0 1 0 18
Laboratory of Genetics and Molecular Cardiology, University of São Paulo 0 16 0 14 0 1 3 18
Medical Genetics Laboratory, Kennedy Center,Juliane Marie Center, Rigshospitalet 0 49 0 15 0 2 2 17
University of Washington Department of Laboratory Medicine, University of Washington 0 22 0 5 0 12 1 17
Centre de Génétique Moléculaire et Chromosomique, Unité de génétique de l'Obésité et des Dyslipidémies,APHP, GH Hôpitaux Universitaires Pitié-Salpêtrière / Charles-Foix 0 12 0 15 0 0 1 16
Department of Pathology and Laboratory Medicine,Sinai Health System 0 53 0 4 3 5 3 15
True Health Diagnostics 0 6 0 0 5 5 5 15
ClinGen PTEN Variant Curation Expert Panel 0 11 0 11 0 1 4 15
Center for Human Genetics, Inc 0 62 0 2 3 5 4 14
Pathway Genomics 0 20 0 2 3 6 4 14
Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago 0 17 0 7 0 1 6 14
Molecular Diagnostics Laboratory,M Health: University of Minnesota 0 22 0 14 0 0 0 14
Institute of Human Genetics,Klinikum rechts der Isar 0 246 0 6 0 7 0 13
Clinical Molecular Genetics Laboratory,Johns Hopkins All Children's Hospital 0 113 0 6 0 3 3 12
Sharing Clinical Reports Project (SCRP) 0 36 0 4 2 4 2 12
Richard Lifton Laboratory, Yale University School of Medicine 0 18 0 8 0 4 1 12
NeuroMeGen,Hospital Clinico Santiago de Compostela 0 1 0 12 0 0 0 12
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego 0 39 0 5 0 7 0 12
Laboratory of Diagnosis and Therapy of Lysosomal Disorders,University of Padova 0 9 0 6 0 0 6 12
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) 0 53 0 0 3 5 3 11
CHU Sainte-Justine Research Center,University of Montreal 0 3 0 11 0 0 0 11
Foundation for Research in Genetics and Endocrinology, FRIGE's Institute of Human Genetics 0 23 0 6 0 2 4 11
International Society for Gastrointestinal Hereditary Tumours (InSiGHT) 0 43 1 3 4 1 1 10
Molecular Genetics Laboratory,Centre for Cardiovascular Surgery and Transplantation 0 3 0 10 0 0 0 10
Genetic Testing Center for Deafness, Department of Otolaryngology Head & Neck Surgery,Institute of Otolaryngology, Chinese PLA General Hospital 0 9 0 10 0 0 1 10
Michigan Medical Genetics Laboratories,University of Michigan 0 9 0 0 3 4 2 9
Academic Department of Medical Genetics, University of Cambridge 0 6 0 5 0 4 0 9
PALB2 database 0 0 0 0 0 9 0 9
Care4Rare-SOLVE, CHEO 0 0 0 0 0 0 9 9
Undiagnosed Diseases Program Translational Research Laboratory,National Institutes of Health 0 4 0 9 0 0 0 9
Institute for Biomarker Research,Medical Diagnostic Laboratories, L.L.C. 0 4 0 0 1 5 3 9
Donald Williams Parsons Laboratory,Baylor College of Medicine 0 9 0 0 0 9 0 9
Tartaglia Lab, Genetics and Rare Diseases Research Division,Bambino Gesu' Children's Hospital 0 9 0 9 0 0 0 9
SingHealth Duke-NUS Institute of Precision Medicine 0 7 0 5 0 0 4 9
Agnes Ginges Centre for Molecular Cardiology,Centenary Institute 0 21 0 1 2 0 5 8
Vantari Genetics 0 4 0 0 3 2 3 8
Cardiovascular Research Group,Instituto Nacional de Saude Doutor Ricardo Jorge 0 20 0 7 0 1 0 8
Human Genetics - Radboudumc,Radboudumc 0 20 0 4 0 1 3 8
Research and Development, ARUP Laboratories 0 75 5 0 0 0 3 8
Fundacion Hipercolesterolemia Familiar 0 16 0 4 0 1 3 8
Research Molecular Genetics Laboratory,Women's College Hospital, University of Toronto 0 39 0 2 0 5 1 8
Pediatric Immunology Service,The Chaim Sheba Medical Center at Tel HaShomer 0 0 0 4 0 0 4 8
ClinGen CDH1 Variant Curation Expert Panel 0 3 0 3 0 0 5 8
National Institute of Sensory Organs,National Hospital Organization Tokyo Medical Center 0 1 0 0 0 8 0 8
Department of Pediatrics, Gifu University 0 8 0 8 0 0 0 8
Breast Cancer Information Core (BIC) (BRCA1) 0 29 0 0 0 2 5 7
Center for Human Disease Modeling,Duke University Medical Center 0 0 0 5 0 0 2 7
Center for Human Genetics,University of Leuven 0 27 0 3 0 1 4 7
Personalized Diabetes Medicine Program,University of Maryland School of Medicine 0 0 0 0 2 2 3 7
Rare Disease Group, Clinical Genetics,Karolinska Institutet 0 2 0 3 0 0 4 7
ClinGen Hearing Loss Variant Curation Expert Panel, 0 10 0 1 1 0 5 7
Greenwood Genetic Center Diagnostic Laboratories,Greenwood Genetic Center 0 13 0 1 0 0 5 6
Courtagen Diagnostics Laboratory,Courtagen Life Sciences 0 31 0 0 0 6 0 6
Breast Cancer Information Core (BIC) (BRCA2) 0 20 0 0 0 3 3 6
RettBASE 0 33 0 2 0 1 3 6
Baylor-Hopkins Center for Mendelian Genomics,Johns Hopkins University 0 40 0 4 0 1 1 6
Institute of Human Genetics, Univ. Regensburg,Univ. Regensburg 0 5 0 5 0 1 0 6
Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA), c/o University of Cambridge 0 49 0 0 0 5 1 6
ClinGen PAH Variant Curation Expert Panel 0 30 0 5 0 0 1 6
Clinical Genomics Lab,St. Jude Children's Research Hospital 0 12 0 3 0 1 2 6
Foulkes Cancer Genetics LDI, Lady Davis Institute for Medical Research 0 16 0 0 0 3 2 5
George Lab Vanderbilt University 0 0 0 5 0 0 0 5
Center for Genetic Medicine Research,Children's National Medical Center 0 0 0 4 0 0 1 5
Department of Medical Genetics,Oslo University Hospital 0 23 0 1 0 4 0 5
Hadassah Hebrew University Medical Center 0 0 0 4 0 1 0 5
Center of Genomic medicine, Geneva,University Hospital of Geneva 0 36 0 2 0 2 1 5
Diagnostics Division,Centre for DNA Fingerprinting and Diagnostics 0 0 0 5 0 0 0 5
Bioinformatics dept.,Datar Cancer Genetics Limited, India 0 5 0 3 0 2 0 5
Cancer Genetics Laboratory,Peter MacCallum Cancer Centre 0 0 0 2 0 5 0 5
Bioscientia Institut fuer Medizinische Diagnostik GmbH,Sonic Healthcare 0 40 0 2 0 2 1 5
Human Genetics Institute Leipzig, Universitätsklinikum Leipzig 0 2 0 5 0 0 0 5
Phosphorus, Inc. 0 5 0 1 3 0 1 5
TIDEX, University of British Columbia 0 4 0 5 0 0 0 5
Iberoamerican FH Network 0 10 0 3 0 0 2 5
CHLA Center for Personalized Medicine,Children's Hospital, Los Angeles 0 15 0 1 0 2 2 5
Human Genomics Unit,Institute for molecular medicine Finland (FIMM) 0 0 0 4 0 1 0 5
Genome Diagnostics Laboratory,VU University Medical Center Amsterdam 0 9 0 1 3 1 0 5
Medical Genetics Summaries 0 2 0 0 0 5 0 5
Génétique des Maladies du Développement, Hospices Civils de Lyon 0 23 0 3 0 0 2 5
Raymond Lab,University of Cambridge 0 5 0 5 0 0 0 5
Eye Genetics Research Group,Children's Medical Research Institute 0 5 0 1 0 0 3 4
Familial Cancer Clinic,Veneto Institute of Oncology 0 0 0 0 0 4 0 4
Department of Ophthalmology and Visual Sciences Kyoto University 0 12 0 0 0 0 4 4
Department of Pharmacy and Biotechnology,University of Bologna 0 0 0 0 2 3 0 4
Chan Lab,Boston Children's Hospital 0 0 0 2 0 2 0 4
Center for Human Genetics and Laboratory Diagnostics, Dr. Klein, Dr. Rost and Colleagues 0 8 0 0 0 0 4 4
Kasturba Medical College,Manipal University 0 3 0 0 0 1 3 4
Neurogenetics Laboratory - MEYER,AOU Meyer 0 2 0 4 0 0 0 4
RBHT Clinical Genetics and Genomics Laboratory,Royal Brompton and Harefield NHS Foundation Trust 0 2 0 4 0 0 0 4
Geisinger Autism and Developmental Medicine Institute,Geisinger Health System 0 5 0 1 0 3 0 4
Cancer Genetics and Genomics Laboratory,British Columbia Cancer Agency 0 2 0 0 3 1 0 4
Kariminejad - Najmabadi Pathology & Genetics Center 0 9 0 4 0 0 0 4
Laboratory of Medical Genetics, National & Kapodistrian University of Athens 0 12 0 4 0 1 0 4
Institute for Genomic Medicine (IGM) Clinical Laboratory,Nationwide Children's Hospital 0 2 0 0 1 2 2 4
Johns Hopkins Genomics,Johns Hopkins University 0 11 0 1 0 1 2 4
Wessex Regional Genetics Laboratory,Salisbury District Hospital 0 14 0 4 0 0 0 4
Xiao lab, Department of Pathology, Memorial Sloan Kettering Cancer Center 0 0 0 3 0 0 1 4
Difficult and Complicated Liver Diseases and Artificial Liver Center,Beijing You An Hospital, Capital Medical University 0 1 0 0 0 4 0 4
Center for Computational Genomics and Data Science,University of Alabama 0 0 0 0 0 4 0 4
Claritas Genomics 0 11 0 1 0 0 2 3
Institute of Human Genetics,Cologne University 0 14 0 1 0 0 2 3
University of British Columbia 0 0 0 2 0 0 1 3
Deafness Gene Diagnosis,Xijing Hospital 0 0 0 3 0 0 0 3
Institute for Integrative and Experimental Genomics,University of Luebeck 0 0 0 3 0 0 0 3
Genome Sciences Centre,British Columbia Cancer Agency 0 3 0 2 0 1 0 3
Medical Genetics, University of Parma 0 0 0 1 0 0 2 3
Centre for Genomic and Experimental Medicine,University of Edinburgh 0 5 0 3 0 0 0 3
Medical Research Institute,Tokyo Medical and Dental University 0 1 0 2 0 1 1 3
Laboratory of Molecular Genetics,CHU RENNES 0 0 0 3 0 0 0 3
Erich and Hanna Klessmann Institute for Cardiovascular Research and Development,Heart and Diabetes Center North Rhine-Westphalia 0 4 0 2 0 0 1 3
Center for Statistical Genetics, Columbia University 0 4 0 0 0 1 2 3
A.C.Camargo Cancer Center / LGBM, A.C.Camargo Cancer Center 0 5 0 0 0 3 0 3
Center for Medical Genetics and Molecular Medicine,Haukeland University Hospital 0 4 0 3 0 0 0 3
Section on Medical Neuroendocrinolgy,National Institutes of Health 0 11 0 2 0 0 1 3
Dept. of Medical Genetics, Telemark Hospital Trust 0 2 0 0 0 1 2 3
Clinical Biochemistry Laboratory,Health Services Laboratory 0 22 0 0 2 0 0 2
Gleeson Lab, University of California San Diego - Department of Neuroscience 0 0 0 2 0 0 0 2
Molecular Genetics Laboratory,BC Children's and BC Women's Hospitals 0 26 0 2 0 0 0 2
FirmaLab 0 3 0 0 0 1 1 2
Division Human Genetics,Medical University Innsbruck 0 12 0 1 0 1 0 2
Institute of Human Genetics,Friedrich-Alexander-Universität Erlangen-Nürnberg 0 25 0 2 0 0 0 2
Genologica Medica 0 10 0 0 0 2 0 2
Northcott Neuroscience Laboratory, ANZAC Research Institute 0 3 0 0 0 1 1 2
Samuels research lab,Centre de Recherche du CHU Ste-Justine 0 5 0 0 0 0 2 2
Institute of Human Genetics,University Medical Center Hamburg-Eppendorf 0 5 0 2 0 0 0 2
Department of Mental Retardation and Birth Defect Research, National Center of Neurology and Psychiatry 0 0 0 2 0 0 0 2
GOLD service, Hunter New England Health 0 6 0 2 0 0 0 2
Section on Endocrinology and Genetics,National Institutes of Health / The Eunice Kennedy Shriver National Institute of Child Health and Human Development 0 0 0 2 0 0 0 2
Institute for Ophthalmic Research,University Tuebingen 0 15 0 1 0 0 1 2
Department of Internal Medicine, University of Texas Health Science Center at Houston 0 1 0 0 0 2 0 2
Laboratory of Molecular Genetics (Pr. Bezieau's lab), CHU de Nantes 0 36 0 2 0 0 0 2
Prostate Cancer Research Center,Institute of Biosciences and Medical Technology, University of Tampere 0 0 0 1 0 0 1 2
Gene Discovery Core-Manton Center,Boston Children's Hospital 0 2 0 1 0 0 1 2
Department of Medical Genetics,University Hospital of North Norway 0 0 0 1 1 0 0 2
Department of Medical Genetics,Sanjay Gandhi Post Graduate Institute of Medical Sciences 0 3 0 2 0 0 0 2
Groupe Hospitalier Pitie Salpetriere, UF Genomique du Developpement,Assistance Publique Hopitaux de Paris 0 5 0 2 0 1 0 2
Oxford Haemato-Oncology Service,Oxford University Hospitals NHS Foundation Trust 0 0 0 1 0 1 0 2
Department of Genetics,Fundacion Jimenez Diaz University Hospital 0 1 0 2 0 0 0 2
Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde,Academisch Medisch Centrum 0 33 0 0 0 2 0 2
Tolun Lab, Human Genetics Laboratory,Bogazici University 0 0 0 0 0 1 1 2
Antonellis Laboratory at Michigan,University of Michigan 0 0 0 2 0 0 0 2
Hardcastle Lab,UCL Institute of Ophthalmology 0 0 0 2 0 0 0 2
Institute for Genomic Medicine, Nationwide Children's Hospital 0 1 0 1 0 0 1 2
SickKids Clinical Genetics Group,The Hospital for Sick Children 0 1 0 0 0 2 0 2
Pediatric Genomics Discovery Program,Yale University 0 1 0 2 0 0 0 2
Kids Research, The Children's Hospital at Westmead 0 0 0 2 0 0 0 2
The Raphael Recanati Genetics Institute,Rabin Medical Center 0 1 0 0 0 0 2 2
van Haaften laboratory, University Medical Center Utrecht 0 0 0 0 0 0 2 2
Genetic Diseases Diagnostic Center,Koc University Hospital 0 0 0 2 0 0 0 2
AG Reprogenetics, University of Münster 0 0 0 1 0 0 1 2
Codex Genetics Limited 0 6 0 1 0 1 0 2
Pharmacogenomics Lab,Chungbuk National University 0 2 0 0 0 2 0 2
Klaassen Lab,Charite University Medicine Berlin 0 0 0 1 0 0 1 2
ClinGen Myeloid Malignancy Variant Curation Expert Panel 0 7 0 1 0 0 1 2
Molecular Otolaryngology and Renal Research Laboratories,University of Iowa Hospital and Clinics 0 0 0 0 0 0 1 1
Molecular Genetics Laboratory,London Health Sciences Centre 0 1 0 0 0 0 1 1
Molecular Genetics Laboratory,Institute for Ophthalmic Research 0 0 0 1 0 0 0 1
Molecular Genetics Laboratory,Children's Mercy Hospital and Clinics 0 5 0 1 0 0 0 1
Laboratory of Gastroenterology and Hepatology,Radboud University Medical Center 0 8 0 0 0 1 0 1
Bristol Genetics Laboratory - North Bristol NHS Trust,Southmead Hospital - Pathology Sciences 0 0 0 1 0 0 0 1
Molecular Diagnostics Laboratory,Seoul National University Hospital 0 0 0 0 0 0 1 1
Molecular Vision Laboratory 0 0 0 0 0 1 0 1
American College of Medical Genetics and Genomics (ACMG) 0 18 0 0 0 1 0 1
CFTR2 0 76 0 0 0 1 0 1
Martin Pollak Laboratory, Beth Israel Deaconess Medical Center 0 0 0 0 0 0 1 1
CVG, University of British Columbia 0 0 0 0 0 0 1 1
Endocrinology Clinic, Seth G.S. Medical College 0 0 0 1 0 0 0 1
Department of Neuroscience, King Faisal Specialist Hospital 0 0 0 0 0 0 1 1
UniProtKB/Swiss-Prot 0 204 0 1 0 0 0 1
Science for Life laboratory, Karolinska Institutet 0 0 0 0 0 0 1 1
Cardiovascular Biomedical Research Unit,Royal Brompton & Harefield NHS Foundation Trust 0 114 0 1 0 0 0 1
SNPedia 0 24 0 0 0 1 0 1
PXE International 0 20 0 0 0 0 1 1
University of Washington School of Medicine 0 0 0 0 0 0 1 1
Wellcome Centre for Mitochondrial Research,Newcastle University 0 49 0 1 0 0 0 1
Shenzhen Institute of Pediatrics,Shenzhen Children's Hospital 0 0 0 1 0 0 0 1
ITMI 0 64 0 1 0 0 0 1
Genomics and Pathology Services,Washington University in St.Louis 0 4 0 1 0 0 0 1
Department of Clinical Science, University of Bergen 0 0 0 1 0 0 0 1
Laboratoire de Biologie Moléculaire,Centre Hospitalo-Universitaire 0 0 0 1 0 0 0 1
Clinical Genetics Karolinska University Hospital,Karolinska University Hospital 0 2 0 1 0 0 0 1
Department of Molecular and Human Genetics, Baylor College of Medicine 0 10 0 0 0 1 0 1
Akiko Shimamura Lab,Fred Hutchinson Cancer Research Center 0 2 0 1 0 0 0 1
Clinical Genetics Research Group, University of Calgary 0 7 0 1 0 0 0 1
Centre for Translational Omics - GOSgene,University College London 0 1 0 1 0 0 0 1
Department of Genetics, Reproduction and Fetal Medicine.,Institute of Biomedicine of Seville (IBIS), University Hospital Virgen del Rocío/CSIC/University of Seville. 0 0 0 0 0 0 1 1
Scripps Translational Science Institute,Scripps Health and The Scripps Research Institute 0 3 0 1 0 0 0 1
Laboratory of Human Genetics,Universidade de São Paulo 0 0 0 0 0 1 0 1
Curoverse 0 1 0 0 0 1 0 1
Center for Individualized Medicine,Mayo Clinic 0 0 0 1 0 0 0 1
Dobyns Lab,Seattle Children's Research Institute 0 17 0 1 0 0 0 1
Molecular Genetics Pathology Laboratory, University Of Arkansas for Medical Sciences 0 1 0 0 0 0 1 1
UW Hindbrain Malformation Research Program,University of Washington 0 62 0 1 0 0 0 1
Centro de Genética y Biología Molecular, Universidad de San Martín de Porres 0 1 0 0 0 1 0 1
Miami Human Genetics,University of Miami Miller School of Medicine 0 0 0 0 0 1 0 1
Paul Sabatier University EA-4555, Paul Sabatier University 0 0 0 0 0 0 1 1
UCL Genetics Institute,UCL 0 0 0 0 0 0 1 1
Centre for Genomic Medicine, Manchester,Central Manchester University Hospitals 0 13 0 1 0 0 0 1
Prof. Thelma's Laboratory, Department of Genetics,University of Delhi South Campus 0 0 0 0 0 0 1 1
Aziz Sancar Institute of Experimental Medicine,Istanbul University 0 1 0 0 0 1 0 1
Molecular and Medical Genetics Group,King's College London 0 2 0 1 0 0 0 1
Forensic Genetics Laboratory,Harris County Institute of Forensic Sciences 0 4 0 0 0 0 1 1
Clinical Genetics, Erasmus University Medical Center 0 1 0 1 0 0 0 1
Leeds Amelogenesis Imperfecta Research Group, University of Leeds 0 4 0 1 0 0 0 1
Institute for Genomic Medicine, Columbia University,Columbia University Medical Center 0 6 0 1 0 0 0 1
Rui Chen Lab,Baylor College of Medicine 0 1 0 0 0 0 1 1
Center for Medical Genomics, Faculty of Medicine Ramathibodi Hospital, Mahidol University,Faculty of Medicine Ramathibodi Hospital, Mahidol University 0 0 0 0 1 0 0 1
Department of Ophthalmology,Flinders University 0 1 0 1 0 0 0 1
Laboratory of Personalized Genomic Medicine,Columbia University Medical Center 0 0 0 1 0 0 0 1
Reutter Lab, Institute of Human Genetics,University Hospital Bonn 0 0 0 0 0 0 1 1
Childrens Diabetes Center,University of Wisconsin-Madison 0 0 0 0 0 0 1 1
Institute of Experimental Endocrinology,Slovak Academy of Sciences 0 1 0 0 0 0 1 1
Unité de Différenciation Epithéliale et Auto-Immunité Rhumatoïde,INSERM - Université Paul Sabatier 0 0 0 1 0 0 0 1
Center of Medical Genetics and Primary Health Care 0 2 0 0 0 1 0 1
Muenke lab,National Institutes of Health 0 2 0 0 0 0 1 1
Endocrine oncology group,Uppsala University 0 0 0 1 0 0 0 1
UMR-S1161,Institut national de la santé et de la recherche médicale 0 0 0 0 0 1 0 1
Santos-Cortez Lab,University of Colorado School of Medicine 0 0 0 0 0 0 1 1
Department of Pathology and Molecular Medicine,Queen's University 0 11 0 0 0 1 0 1
Genetics Department, University Hospital of Toulouse 0 0 0 1 0 0 0 1
Genetics of Mitochondrial Diseases,Imagine Institute 0 0 0 1 0 0 0 1
Pediatric Nephrology (Iijima Lab),Kobe University Graduate School of Medicine 0 0 0 0 0 0 1 1
Dr. Liu's Molecular Genetics Laboratory,University of Miami Miller School of Medicine 0 0 0 1 0 0 0 1
Dan Cohn Lab,University Of California Los Angeles 0 18 0 0 0 1 0 1
Bodamer Research Lab,Boston Children's Hospital 0 0 0 0 0 1 0 1
Center of Vascular Surgery,The Second Affiliated Hospital of Nanchang University 0 0 0 1 0 0 0 1
Genetic Endocrinology Unit / Unidade de Endocrinologia Genetica - LIM25, Universidade de Sao Paulo (USP) 0 0 0 0 0 0 1 1
Beijing Key Laboratory for Genetic Research of Skeletal Deformity,Peking Union Medical College Hospital 0 0 0 1 0 0 0 1
ClinGen RASopathy Variant Curation Expert Panel 0 29 0 1 0 0 0 1
Reproductive Development, Murdoch Childrens Research Institute 0 0 0 0 0 0 1 1
Laboratory of Molecular Neuropathology,The University of Texas Health Science Center at Houston 0 0 0 0 0 1 1 1
Institute of Human Genetics,Polish Academy of Sciences 0 0 0 0 0 0 1 1
Center for Precision Medicine,Vanderbilt University Medical Center 0 3 0 0 0 1 0 1
The Danek Gertner Institute of Human Genetics,Sheba Medical Center 0 0 0 1 0 0 0 1
Hacettepe Genetic Diseases Diagnosis Center,Hacettepe University Faculty of Medicine 0 0 0 1 0 0 0 1
GeneID Lab - Advanced Molecular Diagnostics 0 0 0 0 0 1 1 1
Medical Genetics Lab,Policlinico S. Orsola.Malpighi 0 0 0 1 0 0 0 1
3DMed Clinical Laboratory Inc 0 9 0 0 0 0 1 1
Cancer Diagnostics Division,Gene Solutions 0 0 0 1 0 0 0 1
Marseille Medical Genetics, U1251,Aix Marseille University, Inserm 0 3 0 1 0 0 0 1
UNC Molecular Genetics Laboratory,University of North Carolina at Chapel Hill 0 0 0 1 0 0 0 1
Liping Wei Laboratory,Peking University 0 2 0 0 0 0 1 1
Institute of Neurogenomics,Technical University of Munich 0 0 0 0 0 0 1 1
Cole/Wambach Lab,Washington University in St. Louis 0 5 0 1 0 0 0 1
Institute of Clinical Molecular Biology,Kiel University 0 0 0 0 0 0 1 1
Molecular Dermatology Lab,Tel Aviv Sourasky Medical Center 0 0 0 0 0 0 1 1
Department of Pediatrics,University of Ottawa 0 0 0 0 0 0 1 1
Institute of Bioinformatics 0 0 0 1 0 0 0 1
Laboratory of Medical Genetics,IRCCS Burlo Garofolo 0 0 0 0 0 0 1 1
Laboratory of Molecular Genetics,Montpellier University Hospital 0 0 0 1 0 0 0 1
Bioinformatics Institute,Agency for Science, Technology and Research 0 0 0 0 0 1 0 1
Laboratory of Clinical and Experimental Pathology,Xuzhou Medical University 0 0 0 0 0 1 0 1
ClinGen TP53 Variant Curation Expert Panel,ClinGen 0 4 0 1 0 0 0 1
Stankiewicz Research Laboratory,Baylor College of Medicine 0 0 0 1 0 0 0 1

All variants with conflicting interpretations #

Total variants: 6308
Download table as spreadsheet
HGVS dbSNP
AGT, -6A HAPLOTYPE
ALOX5, VARIANT PROMOTER SP1 BINDING
ATXN8, (CAG)n REPEAT EXPANSION
CD209, -336A-G
CD36, G1439C, 1-BP DEL, 1444A
CX3CR1:c.[841G>A;935C>T] (p.Val294Ile;Thr280Met)
CYP2A6*3
CYP2C19*3 rs4986893
CYP2C19*4A rs28399504
CYP2C19*5 rs56337013
ESR1, IVS1, T-C, -401
FH Bologna 2
FH Cape Town 2
FH Vancouver 4
G6PD AMSTERDAM
G6PD NARA rs587776730
GNB3, 825C-T
GP1BA, 92-BP DUP, SER399-THR411 DUP, VARIABLE REPEATS
GRCh37/hg19 19p13.2(chr19:11210898-11222316)
GRCh38/hg38 9p21.2(chr9:27040565-27060992)
HBB, HBB/HBD FUSION
HBB, HBB/HBD FUSION, HBD137DEL
HBB, HIS143GLN
HBB, TYR145ASN-TO-ASP
HLA-B*57:01
HP, DEL
HPRT CHERMSIDE
HPRT CHICAGO
HPRT CONNERSVILLE
HPRT COORPAROO
HPRT MICHIGAN
IFNGR1, -56C-T
IL1RN, IVS2, 86-BP DUP
MC4R, VAL103ILE (rs2229616)
MECP2, 41-BP DEL, NT1157
MPO, -463G-A
Multiple alleles
NC_000001.10:g.(196722206_?)_(?_196808505)del
NC_000004.11:g.3076606GCA[(40_?)] rs71180116
NC_000006.11:g.5610223_5726369del
NC_000008.10:g.(?_6264113)_(6296618_6299587)del
NC_000008.11:g.11573132C>T rs61199332
NC_000015.9:g.68504037_68504039delGAT rs121908080
NC_000022.10:g.(?_18893735)_(18924066_?)del
NC_012920.1:m.11778G>A rs199476112
NC_012920.1:m.14484T>C rs199476104
NC_012920.1:m.1555A>G rs267606617
NC_012920.1:m.3460G>A rs199476118
NC_012920.1:m.7444G>A rs199474822
NC_012920.1:m.8851T>C rs199476136
NG_012123.1:g.2493A>G rs1024611
NM_000014.5(A2M):c.2126-6_2126-2del rs1799759
NM_000014.5(A2M):c.2998A>G (p.Ile1000Val) rs669
NM_000016.5(ACADM):c.199T>C (p.Tyr67His) rs121434280
NM_000016.5(ACADM):c.351A>C (p.Thr117=) rs74090726
NM_000016.5(ACADM):c.362C>T (p.Thr121Ile) rs121434283
NM_000016.5(ACADM):c.583G>A (p.Gly195Arg) rs121434278
NM_000016.5(ACADM):c.734C>T (p.Ser245Leu) rs121434281
NM_000016.5(ACADM):c.799G>A (p.Gly267Arg) rs121434274
NM_000016.5(ACADM):c.985A>G (p.Lys329Glu) rs77931234
NM_000016.5(ACADM):c.999_1011dup (p.Gln338Ter) rs1225471006
NM_000017.4(ACADS):c.1031A>G (p.Glu344Gly) rs387906950
NM_000017.4(ACADS):c.1058C>T (p.Ser353Leu) rs28941773
NM_000017.4(ACADS):c.1147C>T (p.Arg383Cys) rs28940872
NM_000017.4(ACADS):c.136C>T (p.Arg46Trp) rs121908003
NM_000017.4(ACADS):c.164C>T (p.Pro55Leu) rs147442301
NM_000017.4(ACADS):c.268G>A (p.Gly90Ser) rs121908005
NM_000017.4(ACADS):c.274G>T (p.Gly92Cys) rs121908004
NM_000017.4(ACADS):c.307_309GAG[1] (p.Glu104del) rs387906308
NM_000017.4(ACADS):c.319C>T (p.Arg107Cys) rs61732144
NM_000017.4(ACADS):c.323G>A (p.Gly108Asp) rs387906951
NM_000017.4(ACADS):c.511C>T (p.Arg171Trp) rs1800556
NM_000017.4(ACADS):c.529T>C (p.Trp177Arg) rs57443665
NM_000017.4(ACADS):c.575C>T (p.Ala192Val) rs28940874
NM_000017.4(ACADS):c.625G>A (p.Gly209Ser) rs1799958
NM_000017.4(ACADS):c.973C>T (p.Arg325Trp) rs121908006
NM_000018.2(ACADVL):c.343delG (p.Glu115Lysfs) rs387906249
NM_000018.4(ACADVL):c.1182+1G>A rs113690956
NM_000018.4(ACADVL):c.1246G>A (p.Ala416Thr) rs118204018
NM_000018.4(ACADVL):c.1322G>A (p.Gly441Asp) rs2309689
NM_000018.4(ACADVL):c.1349G>A (p.Arg450His) rs118204016
NM_000018.4(ACADVL):c.1837C>T (p.Arg613Trp) rs118204014
NM_000018.4(ACADVL):c.385_387GAG[1] (p.Glu130del) rs387906251
NM_000018.4(ACADVL):c.890_892AGA[2] (p.Lys299del) rs387906252
NM_000019.4(ACAT1):c.1032_1034AGA[1] (p.Glu345del) rs387906282
NM_000019.4(ACAT1):c.1136G>T (p.Gly379Val) rs120074143
NM_000019.4(ACAT1):c.1138G>A (p.Ala380Thr) rs120074140
NM_000019.4(ACAT1):c.278A>G (p.Asn93Ser) rs120074145
NM_000019.4(ACAT1):c.433C>G (p.Gln145Glu) rs120074148
NM_000019.4(ACAT1):c.547G>A (p.Gly183Arg) rs120074141
NM_000019.4(ACAT1):c.935T>C (p.Ile312Thr) rs120074146
NM_000019.4(ACAT1):c.997G>C (p.Ala333Pro) rs120074147
NM_000021.4(PSEN1):c.1141C>T (p.Leu381Phe) rs63750687
NM_000021.4(PSEN1):c.1276G>C (p.Ala426Pro) rs63751223
NM_000021.4(PSEN1):c.1292C>A (p.Ala431Glu) rs63750083
NM_000021.4(PSEN1):c.236C>T (p.Ala79Val) rs63749824
NM_000021.4(PSEN1):c.338T>C (p.Leu113Pro) rs63751399
NM_000021.4(PSEN1):c.415A>G (p.Met139Val) rs63751037
NM_000021.4(PSEN1):c.436A>C (p.Met146Leu) rs63750306
NM_000021.4(PSEN1):c.509C>T (p.Ser170Phe) rs63750577
NM_000021.4(PSEN1):c.548G>T (p.Gly183Val) rs63751068
NM_000021.4(PSEN1):c.799C>T (p.Pro267Ser) rs63751229
NM_000021.4(PSEN1):c.839A>C (p.Glu280Ala) rs63750231
NM_000021.4(PSEN1):c.998A>G (p.Asp333Gly) rs121917809
NM_000022.2(ADA):c.22G>A (p.Asp8Asn) rs73598374
NM_000022.2(ADA):c.986C>T rs121908715
NM_000022.4(ADA):c.219-2A>G rs387906267
NM_000022.4(ADA):c.221G>T (p.Gly74Val) rs199422328
NM_000022.4(ADA):c.226C>T (p.Arg76Trp) rs121908736
NM_000022.4(ADA):c.239A>G (p.Lys80Arg) rs11555566
NM_000022.4(ADA):c.301C>T (p.Arg101Trp) rs121908717
NM_000022.4(ADA):c.320T>C (p.Leu107Pro) rs121908739
NM_000022.4(ADA):c.446G>A (p.Arg149Gln) rs121908737
NM_000022.4(ADA):c.454C>A (p.Leu152Met) rs121908728
NM_000022.4(ADA):c.466C>T (p.Arg156Cys) rs121908735
NM_000022.4(ADA):c.467G>A (p.Arg156His) rs121908722
NM_000022.4(ADA):c.631C>T (p.Arg211Cys) rs121908740
NM_000022.4(ADA):c.632G>A (p.Arg211His) rs121908716
NM_000022.4(ADA):c.643G>A (p.Ala215Thr) rs114025668
NM_000022.4(ADA):c.821C>T (p.Pro274Leu) rs121908738
NM_000022.4(ADA):c.872C>T (p.Ser291Leu) rs121908721
NM_000023.4(SGCA):c.293G>A (p.Arg98His) rs137852621
NM_000023.4(SGCA):c.850C>T (p.Arg284Cys) rs137852623
NM_000024.5(ADRB2):c.46A>G (p.Arg16Gly) rs1042713
NM_000026.4(ADSL):c.1264G>T (p.Asp422Tyr) rs119450943
NM_000026.4(ADSL):c.569G>A (p.Arg190Gln) rs28941471
NM_000026.4(ADSL):c.736A>G (p.Lys246Glu) rs119450944
NM_000027.4(AGA):c.102_108del (p.Thr33_Trp34insTer) rs386833417
NM_000027.4(AGA):c.127_128insATGCGG (p.Ala43_Trp44insAspAla) rs386833418
NM_000027.4(AGA):c.179G>A (p.Gly60Asp) rs121964907
NM_000027.4(AGA):c.302C>T (p.Ala101Val) rs121964908
NM_000027.4(AGA):c.488G>C (p.Cys163Ser) rs121964904
NM_000027.4(AGA):c.800dup (p.Pro268fs) rs386833436
NM_000027.4(AGA):c.940+1G>T rs386833437
NM_000029.4(AGT):c.803T>C (p.Met268Thr) rs699
NM_000030.3(AGXT):c.1020A>G (p.Ile340Met) rs4426527
NM_000030.3(AGXT):c.121G>A (p.Gly41Arg) rs121908523
NM_000030.3(AGXT):c.245G>A (p.Gly82Glu) rs121908522
NM_000030.3(AGXT):c.32C>T (p.Pro11Leu) rs34116584
NM_000030.3(AGXT):c.508G>A (p.Gly170Arg) rs121908529
NM_000030.3(AGXT):c.697C>T (p.Arg233Cys) rs121908526
NM_000030.3(AGXT):c.698G>A (p.Arg233His) rs121908527
NM_000030.3(AGXT):c.731T>C (p.Ile244Thr) rs121908525
NM_000031.6(ALAD):c.177G>C (p.Lys59Asn) rs1800435
NM_000031.6(ALAD):c.36C>G (p.Phe12Leu) rs121912984
NM_000031.6(ALAD):c.718C>T (p.Arg240Trp) rs121912982
NM_000032.4(ALAS2):c.-258C>G rs140772352
NM_000032.5(ALAS2):c.1699_1700del (p.Met567fs) rs387906473
NM_000032.5(ALAS2):c.1702_1705AGTG[1] (p.Glu569fs) rs387906472
NM_000033.3(ABCD1):c.874_876delGAG (p.Glu292del) rs387906496
NM_000033.4(ABCD1):c.1165C>G (p.Arg389Gly) rs128624215
NM_000033.4(ABCD1):c.1252C>T (p.Arg418Trp) rs128624220
NM_000033.4(ABCD1):c.1390C>T (p.Arg464Ter) rs128624221
NM_000033.4(ABCD1):c.1866-10G>A rs398123108
NM_000035.4(ALDOB):c.1005C>G (p.Asn335Lys) rs78340951
NM_000035.4(ALDOB):c.1027T>C (p.Tyr343His) rs369586696
NM_000035.4(ALDOB):c.10C>T (p.Arg4Ter) rs118204428
NM_000035.4(ALDOB):c.136A>T (p.Arg46Trp) rs41281039
NM_000035.4(ALDOB):c.178C>T (p.Arg60Ter) rs118204429
NM_000035.4(ALDOB):c.356_359CAAA[1] (p.Asn120fs) rs387906225
NM_000036.2(AMPD1):c.1261C>T (p.Arg421Trp) rs35859650
NM_000036.2(AMPD1):c.133C>T (p.Gln45Ter) rs17602729
NM_000036.2(AMPD1):c.1373G>A (p.Arg458His) rs121912682
NM_000038.6(APC):c.1240C>T (p.Arg414Cys) rs137854567
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000038.6(APC):c.3922_3926AAAGA[1] (p.Glu1309fs) rs121913224
NM_000038.6(APC):c.3949G>C (p.Glu1317Gln) rs1801166
NM_000038.6(APC):c.4012C>T (p.Gln1338Ter) rs121913327
NM_000038.6(APC):c.937_938del (p.Glu313fs) rs387906239
NM_000039.2(APOA1):c.85dup (p.Gln29fs) rs753348565
NM_000040.3(APOC3):c.127G>A (p.Ala43Thr) rs147210663
NM_000040.3(APOC3):c.179+1G>T rs140621530
NM_000040.3(APOC3):c.55+1G>A rs138326449
NM_000040.3(APOC3):c.55C>T (p.Arg19Ter) rs76353203
NM_000041.2(APOE):c.526C>T (p.Arg176Cys) rs7412
NM_000041.4(APOE):c.388T>C (p.Cys130Arg) rs429358
NM_000041.4(APOE):c.487C>T (p.Arg163Cys) rs769455
NM_000043.6(FAS):c.695A>G (p.Tyr232Cys) rs121913079
NM_000043.6(FAS):c.749G>C (p.Arg250Pro) rs121913080
NM_000044.6(AR):c.1823G>A (p.Arg608Gln) rs137852573
NM_000044.6(AR):c.1937C>A (p.Ala646Asp) rs1800053
NM_000044.6(AR):c.2395C>G (p.Gln799Glu) rs137852591
NM_000045.4(ARG1):c.871C>T (p.Arg291Ter) rs104893940
NM_000046.5(ARSB):c.1143-8T>G rs431905496
NM_000046.5(ARSB):c.1178A>C (p.His393Pro) rs118203944
NM_000046.5(ARSB):c.1214G>A (p.Cys405Tyr) rs118203941
NM_000046.5(ARSB):c.215T>A (p.Leu72Gln) rs397514441
NM_000046.5(ARSB):c.284G>A (p.Arg95Gln) rs118203942
NM_000046.5(ARSB):c.349T>C (p.Cys117Arg) rs118203939
NM_000046.5(ARSB):c.410G>T (p.Gly137Val) rs118203938
NM_000046.5(ARSB):c.707T>C (p.Leu236Pro) rs118203940
NM_000047.2(ARSL):c.1732C>T (p.Pro578Ser) rs28935474
NM_000047.2(ARSL):c.1743G>A (p.Trp581Ter) rs80338714
NM_000047.2(ARSL):c.36G>C (p.Arg12Ser) rs122460151
NM_000047.2(ARSL):c.410G>T (p.Gly137Val) rs80338711
NM_000048.4(ASL):c.1135C>T (p.Arg379Cys) rs28940287
NM_000048.4(ASL):c.1153C>T (p.Arg385Cys) rs28940286
NM_000049.3(ASPA):c.212G>A (p.Arg71His) rs104894553
NM_000049.3(ASPA):c.746A>T (p.Asp249Val) rs104894552
NM_000049.3(ASPA):c.854A>C (p.Glu285Ala) rs28940279
NM_000050.4(ASS1):c.323G>T rs35269064
NM_000051.3(ATM):c.103C>T (p.Arg35Ter) rs55861249
NM_000051.3(ATM):c.1066-6T>G rs201686625
NM_000051.3(ATM):c.146C>G (p.Ser49Cys) rs1800054
NM_000051.3(ATM):c.2250G>A (p.Lys750=) rs1137887
NM_000051.3(ATM):c.2839-579_2839-576del rs587776552
NM_000051.3(ATM):c.3118A>G (p.Met1040Val) rs3092857
NM_000051.3(ATM):c.496+5G>A rs796051858
NM_000051.3(ATM):c.6200C>A (p.Ala2067Asp) rs397514577
NM_000051.3(ATM):c.7271T>G (p.Val2424Gly) rs28904921
NM_000051.3(ATM):c.7327C>T (p.Arg2443Ter) rs121434220
NM_000051.3(ATM):c.7875_7876delinsGC (p.Asp2625_Ala2626delinsGluPro) rs267606668
NM_000051.3(ATM):c.8030A>G (p.Tyr2677Cys) rs28942103
NM_000051.3(ATM):c.8480T>G (p.Phe2827Cys) rs121434216
NM_000051.3(ATM):c.9139C>T (p.Arg3047Ter) rs121434219
NM_000052.7(ATP7A):c.1707+6T>A rs797045334
NM_000052.7(ATP7A):c.2981C>T (p.Thr994Ile) rs267606673
NM_000052.7(ATP7A):c.4156C>T (p.Pro1386Ser) rs267606672
NM_000053.4(ATP7B):c.1708-1G>C rs137853280
NM_000053.4(ATP7B):c.1934T>G (p.Met645Arg) rs121907998
NM_000053.4(ATP7B):c.2071G>A (p.Gly691Arg) rs121908001
NM_000053.4(ATP7B):c.2293G>A (p.Asp765Asn) rs28942075
NM_000053.4(ATP7B):c.2333G>T (p.Arg778Leu) rs28942074
NM_000053.4(ATP7B):c.2621C>T (p.Ala874Val) rs121907994
NM_000053.4(ATP7B):c.2827G>A (p.Gly943Ser) rs28942076
NM_000053.4(ATP7B):c.3207C>A (p.His1069Gln) rs76151636
NM_000053.4(ATP7B):c.865C>T (p.Gln289Ter) rs121907999
NM_000055.2(BCHE):c.1253G>T (p.Gly418Val) rs28933390
NM_000055.2(BCHE):c.1699G>A (p.Ala567Thr) rs1803274
NM_000055.2(BCHE):c.293A>G (p.Asp98Gly) rs1799807
NM_000055.2(BCHE):c.812C>T (p.Thr271Met) rs28933389
NM_000055.4(BCHE):c.1004T>C (p.Leu335Pro) rs104893684
NM_000055.4(BCHE):c.1072T>A (p.Leu358Ile) rs121918557
NM_000059.3(BRCA2):c.1114A>C (p.Asn372His) rs144848
NM_000059.3(BRCA2):c.3901_3903ACT[1] (p.Thr1302del) rs80359414
NM_000059.3(BRCA2):c.5645C>G (p.Ser1882Ter) rs80358785
NM_000059.3(BRCA2):c.5946del (p.Ser1982fs) rs80359550
NM_000059.3(BRCA2):c.6275_6276del (p.Leu2092fs) rs11571658
NM_000059.3(BRCA2):c.631+1G>A rs81002897
NM_000059.3(BRCA2):c.658_659del (p.Val220fs) rs80359604
NM_000059.3(BRCA2):c.7007G>A (p.Arg2336His) rs28897743
NM_000059.3(BRCA2):c.7529T>C (p.Leu2510Pro) rs80358979
NM_000059.3(BRCA2):c.771_775del (p.Asn257fs) rs80359671
NM_000059.3(BRCA2):c.8165C>G (p.Thr2722Arg) rs80359062
NM_000059.3(BRCA2):c.8187G>T (p.Lys2729Asn) rs80359065
NM_000059.3(BRCA2):c.8488-1G>A rs397507404
NM_000061.2(BTK):c.1773C>A (p.Tyr591Ter) rs128621207
NM_000061.2(BTK):c.862C>T (p.Arg288Trp) rs128621194
NM_000063.6(C2):c.954G>C (p.Glu318Asp) rs9332739
NM_000064.4(C3):c.304C>G (p.Arg102Gly) rs2230199
NM_000064.4(C3):c.463A>C (p.Lys155Gln) rs147859257
NM_000067.3(CA2):c.754A>G (p.Asn252Asp) rs2228063
NM_000069.2(CACNA1S):c.-476G>A rs2281845
NM_000069.3(CACNA1S):c.1583G>A (p.Arg528His) rs80338777
NM_000069.3(CACNA1S):c.258+57G>A rs1325310
NM_000069.3(CACNA1S):c.2691G>T (p.Arg897Ser) rs80338779
NM_000069.3(CACNA1S):c.3715C>G (p.Arg1239Gly) rs28930069
NM_000069.3(CACNA1S):c.3716G>A (p.Arg1239His) rs28930068
NM_000070.2(CAPN3):c.643_663del(p.Ser215_Gly221del) rs863224965
NM_000070.3(CAPN3):c.1469G>A (p.Arg490Gln) rs121434548
NM_000070.3(CAPN3):c.1715G>A (p.Arg572Gln) rs121434544
NM_000070.3(CAPN3):c.1795dup (p.Thr599fs) rs80338803
NM_000070.3(CAPN3):c.2306G>A (p.Arg769Gln) rs80338802
NM_000070.3(CAPN3):c.2362_2363delinsTCATCT (p.Arg788fs) rs1555423217
NM_000070.3(CAPN3):c.550del (p.Thr184fs) rs80338800
NM_000070.3(CAPN3):c.956C>T (p.Pro319Leu) rs121434547
NM_000071.2(CBS):c.1058C>T (p.Thr353Met) rs121964972
NM_000071.2(CBS):c.1265C>T (p.Pro422Leu) rs28934892
NM_000071.2(CBS):c.1330G>A (p.Asp444Asn) rs28934891
NM_000071.2(CBS):c.1397C>T (p.Ser466Leu) rs121964971
NM_000071.2(CBS):c.1616T>C (p.Leu539Ser) rs121964968
NM_000071.2(CBS):c.341C>T (p.Ala114Val) rs121964964
NM_000071.2(CBS):c.430G>A (p.Glu144Lys) rs121964966
NM_000071.2(CBS):c.434C>T (p.Pro145Leu) rs121964963
NM_000071.2(CBS):c.502G>A (p.Val168Met) rs121964970
NM_000071.2(CBS):c.797G>A (p.Arg266Lys) rs121964969
NM_000074.2(CD40LG):c.107T>G (p.Met36Arg) rs104894774
NM_000074.2(CD40LG):c.418T>G (p.Trp140Gly) rs104894777
NM_000075.4(CDK4):c.70C>T (p.Arg24Cys) rs11547328
NM_000075.4(CDK4):c.71G>A (p.Arg24His) rs104894340
NM_000076.2(CDKN1C):c.845C>G (p.Ser282Ter) rs267606716
NM_000077.4(CDKN2A):c.-16_8GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) rs587780668
NM_000077.4(CDKN2A):c.159G>C (p.Met53Ile) rs104894095
NM_000077.4(CDKN2A):c.167G>T (p.Ser56Ile) rs104894109
NM_000077.4(CDKN2A):c.176T>G (p.Val59Gly) rs104894099
NM_000077.4(CDKN2A):c.226_244del (p.Ala76fs) rs587776716
NM_000077.4(CDKN2A):c.238C>T (p.Arg80Ter) rs121913388
NM_000077.4(CDKN2A):c.266G>A (p.Gly89Asp) rs137854599
NM_000077.4(CDKN2A):c.301G>T (p.Gly101Trp) rs104894094
NM_000077.4(CDKN2A):c.339_340delGCinsCT (p.Pro114Ser) rs387906410
NM_000077.4(CDKN2A):c.377T>A (p.Val126Asp) rs104894098
NM_000077.4(CDKN2A):c.71G>C (p.Arg24Pro) rs104894097
NM_000078.3(CETP):c.1264G>A (p.Val422Ile) rs5882
NM_000078.3(CETP):c.1376A>G (p.Asp459Gly) rs2303790
NM_000080.3(CHRNE):c.37G>A (p.Gly13Arg) rs372635387
NM_000080.4(CHRNE):c.488C>T (p.Ser163Leu) rs121909516
NM_000080.4(CHRNE):c.991C>T (p.Arg331Trp) rs121909515
NM_000082.3(ERCC8):c.479C>T (p.Ala160Val) rs121434325
NM_000082.3(ERCC8):c.613G>C (p.Ala205Pro) rs121434326
NM_000083.3(CLCN1):c.1439C>T (p.Pro480Leu) rs80356694
NM_000083.3(CLCN1):c.1444G>A (p.Gly482Arg) rs746125212
NM_000083.3(CLCN1):c.1655A>G (p.Gln552Arg) rs80356696
NM_000083.3(CLCN1):c.2680C>T (p.Arg894Ter) rs55960271
NM_000083.3(CLCN1):c.2795C>T (p.Pro932Leu) rs80356706
NM_000083.3(CLCN1):c.2926C>T (p.Arg976Ter) rs142539932
NM_000083.3(CLCN1):c.382A>G (p.Met128Val) rs80356699
NM_000083.3(CLCN1):c.689G>A (p.Gly230Glu) rs80356700
NM_000083.3(CLCN1):c.870C>G (p.Ile290Met) rs80356690
NM_000083.3(CLCN1):c.950G>A (p.Arg317Gln) rs80356702
NM_000085.4(CLCNKB):c.1312C>T (p.Arg438Cys) rs121909133
NM_000086.2(CLN3):c.461-280_677+382del rs1555468634
NM_000086.2(CLN3):c.597C>A (p.Tyr199Ter) rs267606737
NM_000086.2(CLN3):c.883G>A (p.Glu295Lys) rs121434286
NM_000087.3(CNGA1):c.959C>T rs62625014
NM_000088.3(COL1A1):c.3040C>T (p.Arg1014Cys) rs72653170
NM_000088.3(COL1A1):c.934C>T (p.Arg312Cys) rs72645347
NM_000089.3(COL1A2):c.2123G>A (p.Arg708Gln) rs72658163
NM_000089.3(COL1A2):c.226-2A>G rs72656355
NM_000090.3(COL3A1):c.145C>G (p.Pro49Ala) rs1234344050
NM_000090.3(COL3A1):c.1744G>A (p.Gly582Ser) rs121912923
NM_000090.3(COL3A1):c.3518G>A (p.Gly1173Glu) rs121912918
NM_000090.3(COL3A1):c.3554G>A (p.Gly1185Asp) rs121912917
NM_000090.3(COL3A1):c.3851G>A (p.Gly1284Glu) rs587779528
NM_000090.3(COL3A1):c.582+5G>A (p.Gly177_Pro194del) rs587779671
NM_000091.4(COL4A3):c.2954G>T (p.Gly985Val) rs121912827
NM_000091.4(COL4A3):c.3499G>A (p.Gly1167Arg) rs267606745
NM_000091.4(COL4A3):c.4571C>G (p.Ser1524Ter) rs121912825
NM_000092.4(COL4A4):c.2690G>A (p.Gly897Glu) rs121912860
NM_000092.4(COL4A4):c.4715C>T (p.Pro1572Leu) rs121912863
NM_000094.3(COL7A1):c.6091G>A (p.Gly2031Ser) rs121912838
NM_000094.3(COL7A1):c.6205C>T (p.Arg2069Cys) rs121912855
NM_000095.2(COMP):c.1417_1419dupGAC (p.Asp473_Asn474insAsp) rs193922900
NM_000095.3(COMP):c.1569C>G (p.Asn523Lys) rs137852654
NM_000095.3(COMP):c.2152C>T (p.Arg718Trp) rs28936368
NM_000095.3(COMP):c.2156G>A (p.Gly719Asp) rs137852655
NM_000096.3(CP):c.606dupA (p.Asp203Argfs) rs386134143
NM_000096.4(CP):c.1282_1286dup (p.Asp430fs) rs386134145
NM_000096.4(CP):c.2389del (p.Glu797fs) rs386134149
NM_000096.4(CP):c.2630G>A (p.Trp877Ter) rs121909579
NM_000096.4(CP):c.3019-1G>A rs386134142
NM_000097.7(CPOX):c.1210A>G (p.Lys404Glu) rs121917868
NM_000098.3(CPT2):c.1148T>A (p.Phe383Tyr) rs74315295
NM_000098.3(CPT2):c.1507C>T (p.Arg503Cys) rs74315296
NM_000098.3(CPT2):c.1657G>A (p.Asp553Asn) rs28936376
NM_000098.3(CPT2):c.1883A>C (p.Tyr628Ser) rs28936673
NM_000098.3(CPT2):c.338C>T (p.Ser113Leu) rs74315294
NM_000098.3(CPT2):c.359A>G (p.Tyr120Cys) rs121918528
NM_000098.3(CPT2):c.520G>A (p.Glu174Lys) rs28936674
NM_000098.3(CPT2):c.680C>T (p.Pro227Leu) rs74315298
NM_000099.4(CST3):c.73G>A (p.Ala25Thr) rs1064039
NM_000100.3(CSTB):c.67-1G>C rs147484110
NM_000101.4(CYBA):c.214T>C (p.Tyr72His) rs4673
NM_000102.4(CYP17A1):c.1247G>A (p.Arg416His) rs104894155
NM_000102.4(CYP17A1):c.1435_1438dup (p.Pro480fs) rs556794126
NM_000102.4(CYP17A1):c.715C>T (p.Arg239Ter) rs104894136
NM_000103.4(CYP19A1):c.1303C>T (p.Arg435Cys) rs121434534
NM_000104.3(CYP1B1):c.1103G>A (p.Arg368His) rs79204362
NM_000104.3(CYP1B1):c.1120G>A (p.Asp374Asn) rs104893622
NM_000104.3(CYP1B1):c.155C>T (p.Pro52Leu) rs201824781
NM_000104.3(CYP1B1):c.182G>A (p.Gly61Glu) rs28936700
NM_000104.3(CYP1B1):c.241T>A (p.Tyr81Asn) rs9282671
NM_000106.5(CYP2D6):c.454delT (p.Trp152Glyfs) rs5030655
NM_000106.5(CYP2D6):c.505G>T (p.Gly169Ter) rs5030865
NM_000106.5(CYP2D6):c.506-1G>A rs3892097
NM_000106.5(CYP2D6):c.775delA (p.Arg259Glyfs) rs35742686
NM_000106.6(CYP2D6):c.100C>T (p.Pro34Ser) rs1065852
NM_000108.5(DLD):c.104dup (p.Tyr35Ter) rs753234219
NM_000108.5(DLD):c.1123G>A (p.Glu375Lys) rs121964992
NM_000108.5(DLD):c.875+1G>A rs1328820332
NM_000109.4(DMD):c.70-1G>T rs863225016
NM_000110.3(DPYD):c.1905+1G>A rs3918290
NM_000110.3(DPYD):c.2657G>A (p.Arg886His) rs1801267
NM_000111.2(SLC26A3):c.2024_2026dup (p.Ile675dup) rs121913031
NM_000112.3(SLC26A2):c.-26+2T>C rs386833492
NM_000112.3(SLC26A2):c.1020_1022delTGT rs121908077
NM_000112.3(SLC26A2):c.1273A>G (p.Asn425Asp) rs104893920
NM_000112.3(SLC26A2):c.1361A>C (p.Gln454Pro) rs104893921
NM_000112.3(SLC26A2):c.1724del (p.Lys575fs) rs386833498
NM_000112.3(SLC26A2):c.1957T>A (p.Cys653Ser) rs104893924
NM_000112.3(SLC26A2):c.2033G>T (p.Gly678Val) rs104893916
NM_000112.3(SLC26A2):c.2144C>T (p.Ala715Val) rs104893918
NM_000112.3(SLC26A2):c.391del (p.Leu131fs) rs786200881
NM_000112.3(SLC26A2):c.532C>T (p.Arg178Ter) rs104893919
NM_000112.3(SLC26A2):c.764G>A (p.Gly255Glu) rs104893917
NM_000112.3(SLC26A2):c.835C>T (p.Arg279Trp) rs104893915
NM_000113.2(TOR1A):c.907_909delGAG (p.Glu303del) rs80358233
NM_000113.3(TOR1A):c.613T>A (p.Phe205Ile) rs267607134
NM_000113.3(TOR1A):c.646G>C (p.Asp216His) rs1801968
NM_000113.3(TOR1A):c.863G>A (p.Arg288Gln) rs727502811
NM_000119.2(EPB42):c.424G>A (p.Ala142Thr) rs104894487
NM_000121.4(EPOR):c.1317G>A (p.Trp439Ter) rs121918116
NM_000121.4(EPOR):c.1460A>G (p.Asn487Ser) rs62638745
NM_000123.3(ERCC5):c.2375C>T (p.Ala792Val) rs121434571
NM_000123.3(ERCC5):c.2620G>A (p.Ala874Thr) rs121434576
NM_000124.4(ERCC6):c.1518del (p.Lys506fs) rs786205168
NM_000124.4(ERCC6):c.2047C>T (p.Arg683Ter) rs121917904
NM_000124.4(ERCC6):c.3284C>G (p.Pro1095Arg) rs4253208
NM_000124.4(ERCC6):c.643G>T (p.Glu215Ter) rs875989810
NM_000125.3(ESR1):c.1181G>A (p.Arg394His) rs1131692059
NM_000127.2(EXT1):c.1016G>A (p.Gly339Asp) rs119103288
NM_000128.3(F11):c.1253G>T (p.Gly418Val) rs121965071
NM_000128.3(F11):c.166T>C (p.Cys56Arg) rs121965069
NM_000128.3(F11):c.438C>A (p.Cys146Ter) rs121965066
NM_000128.3(F11):c.809A>T (p.Lys270Ile) rs121965070
NM_000128.3(F11):c.901T>C (p.Phe301Leu) rs121965064
NM_000128.3(F11):c.976C>T (p.Arg326Cys) rs28934608
NM_000129.3(F13A1):c.103G>T (p.Val35Leu) rs5985
NM_000129.3(F13A1):c.782G>A (p.Arg261His) rs121913071
NM_000130.4(F5):c.1601G>A (p.Arg534Gln) rs6025
NM_000130.4(F5):c.6304C>T (p.Arg2102Cys) rs118203910
NM_000131.4(F7):c.1061C>T (p.Ala354Val) rs36209567
NM_000131.4(F7):c.1238G>A (p.Arg413Gln) rs6046
NM_000132.3(F8):c.1648C>G (p.Arg550Gly) rs137852417
NM_000132.3(F8):c.1660A>G (p.Ser554Gly) rs137852419
NM_000132.3(F8):c.2149C>T (p.Arg717Trp) rs137852435
NM_000132.3(F8):c.3169G>A (p.Glu1057Lys) rs28933673
NM_000132.3(F8):c.3637del (p.Ile1213fs) rs387906450
NM_000132.3(F8):c.5422C>T (p.Leu1808Phe) rs137852445
NM_000132.3(F8):c.5530C>T (p.Pro1844Ser) rs28933675
NM_000132.3(F8):c.6533G>A (p.Arg2178His) rs137852465
NM_000133.3(F9):c.1025C>T (p.Thr342Met) rs137852254
NM_000133.3(F9):c.1069G>A (p.Gly357Arg) rs137852257
NM_000133.3(F9):c.224G>A (p.Arg75Gln) rs137852228
NM_000133.3(F9):c.580A>G (p.Thr194Ala) rs6048
NM_000133.3(F9):c.819T>C (p.Val273=) rs1800455
NM_000133.3(F9):c.907C>T (p.His303Tyr) rs1801202
NM_000135.2(FANCA):c.3788_3790delTCT (p.Phe1263del) rs397507553
NM_000135.4(FANCA):c.1111_1114TTGG[1] (p.Val372fs) rs397507552
NM_000135.4(FANCA):c.2557C>T (p.Arg853Ter) rs752160950
NM_000135.4(FANCA):c.2639G>A (p.Arg880Gln) rs372254398
NM_000135.4(FANCA):c.3913C>T (p.Leu1305Phe) rs753700179
NM_000136.3(FANCC):c.1642C>T (p.Arg548Ter) rs104886457
NM_000136.3(FANCC):c.1661T>C (p.Leu554Pro) rs104886458
NM_000136.3(FANCC):c.37C>T (p.Gln13Ter) rs121917784
NM_000137.3(FAH):c.1009G>A (p.Gly337Ser) rs80338900
NM_000137.3(FAH):c.1021C>T (p.Arg341Trp) rs11555096
NM_000137.3(FAH):c.1062+5G>A rs80338901
NM_000137.3(FAH):c.1069G>T (p.Glu357Ter) rs121965075
NM_000137.3(FAH):c.401C>A (p.Ala134Asp) rs121965074
NM_000137.3(FAH):c.554-1G>T rs80338895
NM_000137.3(FAH):c.786G>A (p.Trp262Ter) rs80338899
NM_000138.4(FBN1):c.1453C>T (p.Arg485Cys) rs137854485
NM_000138.4(FBN1):c.2261A>G (p.Tyr754Cys) rs137854479
NM_000138.4(FBN1):c.2920C>T (p.Arg974Cys) rs397514558
NM_000138.4(FBN1):c.3217G>A (p.Glu1073Lys) rs137854478
NM_000138.4(FBN1):c.3379G>A (p.Gly1127Ser) rs137854468
NM_000138.4(FBN1):c.3509G>A (p.Arg1170His) rs137854475
NM_000138.4(FBN1):c.364C>T (p.Arg122Cys) rs137854467
NM_000138.4(FBN1):c.3725G>A (p.Cys1242Tyr) rs137854471
NM_000138.4(FBN1):c.4781G>A (p.Gly1594Asp) rs267606798
NM_000138.4(FBN1):c.5284G>A (p.Gly1762Ser) rs387906623
NM_000138.4(FBN1):c.5788+5G>A rs193922219
NM_000138.4(FBN1):c.6354C>T (p.Ile2118=) rs112989722
NM_000138.4(FBN1):c.6431A>G (p.Asn2144Ser) rs137854461
NM_000138.4(FBN1):c.718C>T (p.Arg240Cys) rs137854480
NM_000138.4(FBN1):c.7339G>A (p.Glu2447Lys) rs137854464
NM_000138.4(FBN1):c.7726C>T (p.Arg2576Cys) rs147195031
NM_000138.4(FBN1):c.8176C>T (p.Arg2726Trp) rs61746008
NM_000138.4(FBN1):c.8326C>T (p.Arg2776Ter) rs137854466
NM_000138.5(FBN1):c.8226+1G>A rs398122833
NM_000140.4(FECH):c.163G>T (p.Gly55Cys) rs3848519
NM_000140.4(FECH):c.315-48T>C rs2272783
NM_000140.4(FECH):c.801G>A (p.Met267Ile) rs118204037
NM_000142.4(FGFR3):c.1024G>T (p.Gly342Cys) rs587778775
NM_000142.4(FGFR3):c.1108G>T (p.Gly370Cys) rs121913479
NM_000142.4(FGFR3):c.1111A>T (p.Ser371Cys) rs121913484
NM_000142.4(FGFR3):c.1118A>G (p.Tyr373Cys) rs121913485
NM_000142.4(FGFR3):c.1172C>A (p.Ala391Glu) rs28931615
NM_000142.4(FGFR3):c.1612A>G (p.Ile538Val) rs80053154
NM_000142.4(FGFR3):c.1619A>C (p.Asn540Thr) rs77722678
NM_000142.4(FGFR3):c.1619A>G (p.Asn540Ser) rs77722678
NM_000142.4(FGFR3):c.1620C>A (p.Asn540Lys) rs28933068
NM_000142.4(FGFR3):c.1620C>G (p.Asn540Lys) rs28933068
NM_000142.4(FGFR3):c.1948A>C (p.Lys650Gln) rs78311289
NM_000142.4(FGFR3):c.1948A>G (p.Lys650Glu) rs78311289
NM_000142.4(FGFR3):c.1949A>T (p.Lys650Met) rs121913105
NM_000142.4(FGFR3):c.1950G>T (p.Lys650Asn) rs28928868
NM_000142.4(FGFR3):c.2419T>A (p.Ter807Arg) rs121913101
NM_000142.4(FGFR3):c.2419T>G (p.Ter807Gly) rs121913101
NM_000142.4(FGFR3):c.2421A>T (p.Ter807Cys) rs121913103
NM_000142.4(FGFR3):c.251C>T (p.Ser84Leu) rs121913116
NM_000142.4(FGFR3):c.742C>T (p.Arg248Cys) rs121913482
NM_000142.4(FGFR3):c.746C>G (p.Ser249Cys) rs121913483
NM_000142.4(FGFR3):c.833A>G (p.Tyr278Cys) rs121913115
NM_000143.3(FH):c.302G>C (p.Arg101Pro) rs75086406
NM_000143.3(FH):c.320A>C (p.Asn107Thr) rs121913121
NM_000143.3(FH):c.521C>G (p.Pro174Arg) rs199822819
NM_000143.3(FH):c.698G>T (p.Arg233Leu) rs121913123
NM_000145.3(FSHR):c.1760C>A (p.Pro587His) rs386833512
NM_000145.3(FSHR):c.479T>C (p.Ile160Thr) rs121909659
NM_000145.3(FSHR):c.919G>A (p.Ala307Thr) rs6165
NM_000148.3(FUT1):c.725T>G (p.Leu242Arg) rs28934588
NM_000150.2(FUT6):c.739G>A (p.Glu247Lys) rs17855739
NM_000151.4(G6PC):c.113A>T (p.Asp38Val) rs104894565
NM_000151.4(G6PC):c.229T>C (p.Trp77Arg) rs104894566
NM_000151.4(G6PC):c.328G>A (p.Glu110Lys) rs104894567
NM_000151.4(G6PC):c.370G>A (p.Ala124Thr) rs104894568
NM_000151.4(G6PC):c.377_378TA[3] (p.Tyr128fs) rs80356488
NM_000151.4(G6PC):c.648G>T (p.Leu216=) rs80356484
NM_000151.4(G6PC):c.883C>T (p.Arg295Cys) rs104894563
NM_000152.3(GAA):c.2065G>A (p.Glu689Lys) rs1800309
NM_000152.5(GAA):c.-32-13T>G rs386834236
NM_000152.5(GAA):c.1561G>A (p.Glu521Lys) rs121907937
NM_000152.5(GAA):c.1935C>A (p.Asp645Glu) rs28940868
NM_000152.5(GAA):c.2483_2646+1del rs1555603048
NM_000152.5(GAA):c.2560C>T (p.Arg854Ter) rs121907943
NM_000152.5(GAA):c.271G>A (p.Asp91Asn) rs1800299
NM_000152.5(GAA):c.525del (p.Glu176fs) rs386834235
NM_000152.5(GAA):c.710C>T (p.Ala237Val) rs121907944
NM_000152.5(GAA):c.896T>G (p.Leu299Arg) rs121907940
NM_000152.5(GAA):c.953T>C (p.Met318Thr) rs121907936
NM_000153.4(GALC):c.857G>A (p.Gly286Asp) rs199847983
NM_000154.2(GALK1):c.593C>T (p.Ala198Val) rs80084721
NM_000154.2(GALK1):c.94G>A (p.Val32Met) rs104894576
NM_000155.2(GALT):c.-119_-116delGTCA rs111033640
NM_000155.4(GALT):c.404C>T (p.Ser135Leu) rs111033690
NM_000155.4(GALT):c.512T>C (p.Phe171Ser) rs111033715
NM_000155.4(GALT):c.547C>A (p.Pro183Thr) rs111033721
NM_000155.4(GALT):c.607G>A (p.Glu203Lys) rs111033736
NM_000155.4(GALT):c.940A>G (p.Asn314Asp) rs2070074
NM_000155.4(GALT):c.957C>A (p.His319Gln) rs111033792
NM_000155.4(GALT):c.997C>T (p.Arg333Trp) rs111033800
NM_000156.6(GAMT):c.59G>C (p.Trp20Ser) rs80338734
NM_000157.3(GBA):c.1448T>C rs421016
NM_000157.4(GBA):c.1090G>A (p.Gly364Arg) rs121908305
NM_000157.4(GBA):c.115+1G>A rs104886460
NM_000157.4(GBA):c.1192C>T (p.Arg398Ter) rs121908309
NM_000157.4(GBA):c.1226A>G (p.Asn409Ser) rs76763715
NM_000157.4(GBA):c.1246G>A (p.Gly416Ser) rs121908311
NM_000157.4(GBA):c.1265_1319del (p.Leu422fs) rs80356768
NM_000157.4(GBA):c.1297G>T (p.Val433Leu) rs80356769
NM_000157.4(GBA):c.1342G>C (p.Asp448His) rs1064651
NM_000157.4(GBA):c.1343A>T (p.Asp448Val) rs77369218
NM_000157.4(GBA):c.1504C>T (p.Arg502Cys) rs80356771
NM_000157.4(GBA):c.1604G>A (p.Arg535His) rs75822236
NM_000157.4(GBA):c.476G>A (p.Arg159Gln) rs79653797
NM_000157.4(GBA):c.509G>T (p.Arg170Leu) rs80356763
NM_000157.4(GBA):c.680A>G (p.Asn227Ser) rs364897
NM_000157.4(GBA):c.754T>A (p.Phe252Ile) rs381737
NM_000157.4(GBA):c.764T>A (p.Phe255Tyr) rs74500255
NM_000157.4(GBA):c.887G>A (p.Arg296Gln) rs78973108
NM_000158.3(GBE1):c.993-?_1618+?del
NM_000158.4(GBE1):c.143+1G>A rs397515343
NM_000158.4(GBE1):c.1543C>T (p.Arg515Cys) rs80338672
NM_000158.4(GBE1):c.1544G>A (p.Arg515His) rs201958741
NM_000158.4(GBE1):c.1570C>T (p.Arg524Ter) rs137852888
NM_000158.4(GBE1):c.1571G>A (p.Arg524Gln) rs80338673
NM_000158.4(GBE1):c.1634A>G (p.His545Arg) rs137852889
NM_000158.4(GBE1):c.1643G>A (p.Trp548Ter) rs137852894
NM_000158.4(GBE1):c.1774G>T (p.Glu592Ter) rs137852890
NM_000158.4(GBE1):c.1883A>G (p.His628Arg) rs137852891
NM_000158.4(GBE1):c.671T>C (p.Leu224Pro) rs137852886
NM_000158.4(GBE1):c.691+5G>C rs397515344
NM_000158.4(GBE1):c.771T>A (p.Phe257Leu) rs137852887
NM_000158.4(GBE1):c.986A>C (p.Tyr329Ser) rs80338671
NM_000159.4(GCDH):c.1093G>A (p.Glu365Lys) rs121434370
NM_000159.4(GCDH):c.1198G>A (p.Val400Met) rs121434372
NM_000159.4(GCDH):c.1204C>T (p.Arg402Trp) rs121434369
NM_000159.4(GCDH):c.877G>A (p.Ala293Thr) rs121434371
NM_000160.5(GCGR):c.118G>A (p.Gly40Ser) rs1801483
NM_000161.3(GCH1):c.671A>G (p.Lys224Arg) rs41298442
NM_000161.3(GCH1):c.747G>C (p.Arg249Ser) rs104894442
NM_000162.5(GCK):c.629T>A (p.Met210Lys) rs80356654
NM_000162.5(GCK):c.683C>T (p.Thr228Met) rs80356655
NM_000163.5(GHR):c.1630A>C (p.Ile544Leu) rs6180
NM_000163.5(GHR):c.484G>A (p.Val162Ile) rs6413484
NM_000163.5(GHR):c.535C>T (p.Arg179Cys) rs121909362
NM_000165.5(GJA1):c.1085G>A (p.Arg362Gln) rs2227885
NM_000165.5(GJA1):c.1127G>A (p.Arg376Gln) rs104893965
NM_000165.5(GJA1):c.226C>A (p.Arg76Ser) rs267606845
NM_000165.5(GJA1):c.65G>A (p.Gly22Glu) rs104893964
NM_000165.5(GJA1):c.681A>T (p.Glu227Asp) rs875989815
NM_000165.5(GJA1):c.716G>A (p.Arg239Gln) rs764670582
NM_000166.6(GJB1):c.164C>T (p.Thr55Ile) rs104894824
NM_000166.6(GJB1):c.254C>G (p.Ser85Cys) rs104894823
NM_000166.6(GJB1):c.283G>A (p.Val95Met) rs104894821
NM_000166.6(GJB1):c.407T>C (p.Val136Ala) rs104894826
NM_000166.6(GJB1):c.415G>A (p.Val139Met) rs104894812
NM_000166.6(GJB1):c.467T>G (p.Leu156Arg) rs104894818
NM_000166.6(GJB1):c.614A>G (p.Asn205Ser) rs104894822
NM_000166.6(GJB1):c.704T>G (p.Phe235Cys) rs104894825
NM_000168.5(GLI3):c.2770_2771insNC_012920.1:g.12243..12314
NM_000168.6(GLI3):c.2012del (p.Gly671fs) rs116840743
NM_000168.6(GLI3):c.2023del (p.Glu675fs) rs116840744
NM_000168.6(GLI3):c.2119C>T (p.Pro707Ser) rs121917716
NM_000168.6(GLI3):c.2179G>A (p.Gly727Arg) rs121917710
NM_000168.6(GLI3):c.2188_2206del (p.Leu730fs) rs116840754
NM_000168.6(GLI3):c.3439G>T (p.Glu1147Ter) rs116840768
NM_000169.2(GLA):c.427G>A (p.Ala143Thr) rs104894845
NM_000169.2(GLA):c.427G>C (p.Ala143Pro) rs104894845
NM_000169.2(GLA):c.484T>C (p.Trp162Arg) rs28935196
NM_000169.2(GLA):c.639+919G>A rs199473684
NM_000169.2(GLA):c.937G>T (p.Asp313Tyr) rs28935490
NM_000170.2(GLDC):c.1166C>T (p.Ala389Val) rs121964979
NM_000170.2(GLDC):c.1545G>C (p.Arg515Ser) rs121964976
NM_000170.2(GLDC):c.1691G>T (p.Ser564Ile) rs121964974
NM_000170.2(GLDC):c.2216G>A (p.Arg739His) rs121964980
NM_000170.2(GLDC):c.2267_2269del (p.Phe756del) rs121964975
NM_000173.7(GP1BA):c.217C>T (p.Leu73Phe) rs121908063
NM_000173.7(GP1BA):c.763A>G (p.Met255Val) rs121908064
NM_000174.4(GP9):c.182A>G (p.Asn61Ser) rs5030764
NM_000174.4(GP9):c.70T>C (p.Cys24Arg) rs28933378
NM_000176.3(NR3C1):c.1088A>G (p.Asn363Ser) rs56149945
NM_000176.3(NR3C1):c.66G>A (p.Glu22=) rs6189
NM_000178.4(GSS):c.941C>T (p.Pro314Leu) rs75863437
NM_000179.2(MSH6):c.10C>T (p.Gln4Ter) rs786201042
NM_000179.2(MSH6):c.2633T>C (p.Val878Ala) rs2020912
NM_000180.3(GUCY2D):c.154G>T (p.Ala52Ser) rs61749665
NM_000180.3(GUCY2D):c.2302C>T (p.Arg768Trp) rs61750168
NM_000180.3(GUCY2D):c.2513G>A (p.Arg838His) rs61750173
NM_000180.3(GUCY2D):c.389del (p.Pro130Leufs) rs61749670
NM_000181.4(GUSB):c.1069C>T (p.Arg357Ter) rs121918185
NM_000181.4(GUSB):c.1144C>T (p.Arg382Cys) rs121918173
NM_000182.5(HADHA):c.1132C>T (p.Gln378Ter) rs137852770
NM_000182.5(HADHA):c.180+1G>A rs786205088
NM_000182.5(HADHA):c.180+3A>G rs781222705
NM_000182.5(HADHA):c.871C>T (p.Arg291Ter) rs137852775
NM_000182.5(HADHA):c.914T>A (p.Ile305Asn) rs137852774
NM_000183.3(HADHB):c.182G>A (p.Arg61His) rs121913132
NM_000183.3(HADHB):c.740G>A (p.Arg247His) rs121913133
NM_000185.4(SERPIND1):c.623G>A (p.Arg208His) rs5907
NM_000186.3(CFH):c.1204= (p.His402=) rs1061170
NM_000186.3(CFH):c.184G>A (p.Val62Ile) rs800292
NM_000186.3(CFH):c.3572C>T (p.Ser1191Leu) rs460897
NM_000186.3(CFH):c.3628C>T (p.Arg1210Cys) rs121913059
NM_000187.4(HGD):c.1102A>G (p.Met368Val) rs120074173
NM_000187.4(HGD):c.16-1G>A rs397515347
NM_000187.4(HGD):c.175del (p.Ser59fs) rs397515517
NM_000187.4(HGD):c.457dup (p.Asp153fs) rs397515346
NM_000187.4(HGD):c.481G>A (p.Gly161Arg) rs28941783
NM_000187.4(HGD):c.688C>T (p.Pro230Ser) rs28942100
NM_000187.4(HGD):c.808G>A (p.Gly270Arg) rs120074174
NM_000187.4(HGD):c.899T>G (p.Val300Gly) rs120074170
NM_000190.4(HMBS):c.500G>A (p.Arg167Gln) rs118204095
NM_000190.4(HMBS):c.601C>T (p.Arg201Trp) rs118204109
NM_000190.4(HMBS):c.667G>A (p.Glu223Lys) rs118204110
NM_000191.3(HMGCL):c.202_203CT[2] (p.Ser69fs) rs752137615
NM_000191.3(HMGCL):c.208G>C (p.Val70Leu) rs121964996
NM_000192.3(TBX5):c.710G>A (p.Arg237Gln) rs104894378
NM_000193.4(SHH):c.1132_1140del (p.Ala378_Phe380del) rs397515376
NM_000193.4(SHH):c.1147G>A (p.Ala383Thr) rs137853341
NM_000193.4(SHH):c.1270C>G (p.Pro424Ala) rs104894048
NM_000193.4(SHH):c.263A>T (p.Asp88Val) rs104894050
NM_000193.4(SHH):c.298C>T (p.Gln100Ter) rs104894044
NM_000193.4(SHH):c.313A>T (p.Lys105Ter) rs104894045
NM_000193.4(SHH):c.345C>A (p.Asn115Lys) rs267607047
NM_000193.4(SHH):c.349T>C (p.Trp117Arg) rs104894040
NM_000193.4(SHH):c.349T>G (p.Trp117Gly) rs104894040
NM_000193.4(SHH):c.671T>A (p.Val224Glu) rs104894042
NM_000193.4(SHH):c.676G>A (p.Ala226Thr) rs104894043
NM_000193.4(SHH):c.766G>T (p.Glu256Ter) rs104894051
NM_000193.4(SHH):c.788_808del (p.Arg263_Ala269del) rs397515375
NM_000193.4(SHH):c.850G>T (p.Glu284Ter) rs104894046
NM_000193.4(SHH):c.869G>A (p.Gly290Asp) rs104894047
NM_000193.4(SHH):c.91G>A (p.Gly31Arg) rs28936675
NM_000194.2(HPRT1):c.122T>C (p.Leu41Pro) rs137852480
NM_000194.2(HPRT1):c.151C>G (p.Arg51Gly) rs137852494
NM_000194.2(HPRT1):c.151C>T (p.Arg51Ter) rs137852494
NM_000194.2(HPRT1):c.155A>G (p.Asp52Gly) rs137852502
NM_000194.2(HPRT1):c.170T>C (p.Met57Thr) rs137852495
NM_000194.2(HPRT1):c.172G>A (p.Gly58Arg) rs137852500
NM_000194.2(HPRT1):c.209G>A (p.Gly70Glu) rs137852487
NM_000194.2(HPRT1):c.211G>C (p.Gly71Arg) rs137852488
NM_000194.2(HPRT1):c.222C>A (p.Phe74Leu) rs137852481
NM_000194.2(HPRT1):c.232C>G (p.Leu78Val) rs137852501
NM_000194.2(HPRT1):c.239A>T (p.Asp80Val) rs137852478
NM_000194.2(HPRT1):c.312C>A (p.Ser104Arg) rs137852485
NM_000194.2(HPRT1):c.329C>T (p.Ser110Leu) rs137852482
NM_000194.2(HPRT1):c.389T>A (p.Val130Asp) rs137852483
NM_000194.2(HPRT1):c.396T>G (p.Ile132Met) rs137852477
NM_000194.2(HPRT1):c.419G>A (p.Gly140Asp) rs137852503
NM_000194.2(HPRT1):c.459T>G (p.Tyr153Ter) rs137852505
NM_000194.2(HPRT1):c.46G>A (p.Gly16Ser) rs137852499
NM_000194.2(HPRT1):c.481G>T (p.Ala161Ser) rs137852484
NM_000194.2(HPRT1):c.582C>G (p.Asp194Glu) rs137852504
NM_000194.2(HPRT1):c.595T>G (p.Phe199Val) rs137852486
NM_000194.2(HPRT1):c.602A>G (p.Asp201Gly) rs137852479
NM_000194.2(HPRT1):c.643_*6del21 (p.Lys215fs) rs387906428
NM_000195.5(HPS1):c.1472_1487dup (p.His497fs) rs281865163
NM_000195.5(HPS1):c.1996G>T (p.Glu666Ter) rs121908385
NM_000195.5(HPS1):c.397G>T (p.Glu133Ter) rs121908386
NM_000195.5(HPS1):c.398+5G>A rs281865077
NM_000195.5(HPS1):c.972del (p.Met325fs) rs281865082
NM_000195.5(HPS1):c.972dup (p.Met325fs) rs281865082
NM_000196.4(HSD11B2):c.343_348del (p.Glu115_Leu116del) rs794726669
NM_000196.4(HSD11B2):c.622C>T (p.Arg208Cys) rs121917780
NM_000197.2(HSD17B3):c.238C>T (p.Arg80Trp) rs119481077
NM_000199.5(SGSH):c.1105G>A (p.Glu369Lys) rs104894640
NM_000199.5(SGSH):c.1298G>A (p.Arg433Gln) rs104894641
NM_000199.5(SGSH):c.1339G>A (p.Glu447Lys) rs104894639
NM_000199.5(SGSH):c.220C>T (p.Arg74Cys) rs104894636
NM_000199.5(SGSH):c.449G>A (p.Arg150Gln) rs104894638
NM_000199.5(SGSH):c.617G>C (p.Arg206Pro) rs104894643
NM_000203.5(IDUA):c.1091C>T (p.Thr364Met) rs121965032
NM_000203.5(IDUA):c.1855C>G (p.Arg619Gly) rs121965031
NM_000203.5(IDUA):c.300-3C>G rs1226056948
NM_000203.5(IDUA):c.898G>A (p.Ala300Thr) rs121965030
NM_000204.4(CFI):c.355G>A (p.Gly119Arg) rs141853578
NM_000207.3(INS):c.127T>G (p.Cys43Gly) rs80356666
NM_000207.3(INS):c.143T>G (p.Phe48Cys) rs80356668
NM_000207.3(INS):c.265C>T (p.Arg89Cys) rs80356669
NM_000207.3(INS):c.287G>A (p.Cys96Tyr) rs80356671
NM_000207.3(INS):c.71C>A (p.Ala24Asp) rs80356663
NM_000207.3(INS):c.94G>A (p.Gly32Ser) rs80356664
NM_000208.4(INSR):c.1195C>T (p.Arg399Ter) rs121913151
NM_000208.4(INSR):c.3034G>A (p.Val1012Met) rs1799816
NM_000209.4(PDX1):c.226G>A (p.Asp76Asn) rs137852783
NM_000209.4(PDX1):c.492G>T (p.Glu164Asp) rs80356661
NM_000209.4(PDX1):c.52T>C (p.Cys18Arg) rs137852785
NM_000209.4(PDX1):c.532G>A (p.Glu178Lys) rs80356662
NM_000209.4(PDX1):c.670G>A (p.Glu224Lys) rs137852787
NM_000211.5(ITGB2):c.1756C>T (p.Arg586Trp) rs5030672
NM_000211.5(ITGB2):c.817G>A (p.Gly273Arg) rs137852618
NM_000212.2(ITGB3):c.176T>C (p.Leu59Pro) rs5918
NM_000213.5(ITGB4):c.182G>A (p.Cys61Tyr) rs80338755
NM_000214.3(JAG1):c.701G>A (p.Cys234Tyr) rs121918353
NM_000214.3(JAG1):c.821G>A (p.Gly274Asp) rs28939668
NM_000217.3(KCNA1):c.676A>G (p.Thr226Ala) rs104894354
NM_000217.3(KCNA1):c.677C>G (p.Thr226Arg) rs28933383
NM_000218.2(KCNQ1):c.160_168dup (p.Ile54_Pro56dup) rs397515877
NM_000218.2(KCNQ1):c.211_219delGCCGCGCCC rs397508107
NM_000219.6(KCNE1):c.221C>T (p.Ser74Leu) rs74315446
NM_000219.6(KCNE1):c.226G>A (p.Asp76Asn) rs74315445
NM_000219.6(KCNE1):c.253G>A (p.Asp85Asn) rs1805128
NM_000220.5(KCNJ1):c.1070T>C (p.Met357Thr) rs59172778
NM_000222.2(KIT):c.1676T>A (p.Val559Asp) rs121913517
NM_000222.2(KIT):c.1676T>C (p.Val559Ala) rs121913517
NM_000222.2(KIT):c.1924A>G (p.Lys642Glu) rs121913512
NM_000222.2(KIT):c.2446G>C (p.Asp816His) rs121913506
NM_000222.2(KIT):c.2446G>T (p.Asp816Tyr) rs121913506
NM_000222.2(KIT):c.2447A>T (p.Asp816Val) rs121913507
NM_000222.2(KIT):c.2515G>A (p.Glu839Lys) rs121913509
NM_000224.3(KRT18):c.383A>T (p.His128Leu) rs57758506
NM_000226.4(KRT9):c.487C>T (p.Arg163Trp) rs59616921
NM_000226.4(KRT9):c.488G>A (p.Arg163Gln) rs57758262
NM_000228.3(LAMB3):c.124C>T (p.Arg42Ter) rs80356680
NM_000228.3(LAMB3):c.1903C>T (p.Arg635Ter) rs80356682
NM_000228.3(LAMB3):c.596G>C (p.Gly199Ala) rs121912486
NM_000228.3(LAMB3):c.628+42G>A rs587776812
NM_000231.2(SGCG):c.787G>A (p.Glu263Lys) rs104894423
NM_000231.2(SGCG):c.848G>A (p.Cys283Tyr) rs104894422
NM_000232.4(SGCB):c.272G>T (p.Arg91Leu) rs104893869
NM_000232.4(SGCB):c.299T>A (p.Met100Lys) rs104893871
NM_000232.4(SGCB):c.452C>G (p.Thr151Arg) rs28936383
NM_000232.4(SGCB):c.552T>G (p.Tyr184Ter) rs104893868
NM_000233.4(LHCGR):c.1193T>C (p.Met398Thr) rs121912526
NM_000235.4(LIPA):c.482del (p.Asn161fs) rs762559980
NM_000235.4(LIPA):c.594dup (p.Ala199fs) rs780495201
NM_000235.4(LIPA):c.599T>C (p.Leu200Pro) rs121965086
NM_000236.2(LIPC):c.-293G>A rs2070895
NM_000236.3(LIPC):c.1214C>T (p.Thr405Met) rs113298164
NM_000236.3(LIPC):c.866C>T (p.Ser289Phe) rs121912502
NM_000237.3(LPL):c.*1671T>C rs13702
NM_000237.3(LPL):c.106G>A (p.Asp36Asn) rs1801177
NM_000237.3(LPL):c.1421C>G (p.Ser474Ter) rs328
NM_000237.3(LPL):c.953A>G (p.Asn318Ser) rs268
NM_000240.3(MAOA):c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) rs1346551029
NM_000242.2(MBL2):c.154C>T rs5030737
NM_000242.2(MBL2):c.170G>A (p.Gly57Glu) rs1800451
NM_000243.2(MEFV):c.1105C>T (p.Pro369Ser) rs11466023
NM_000243.2(MEFV):c.1223G>A (p.Arg408Gln) rs11466024
NM_000243.2(MEFV):c.1432C>T (p.His478Tyr) rs104895105
NM_000243.2(MEFV):c.1437C>G (p.Phe479Leu) rs104895083
NM_000243.2(MEFV):c.1958G>A (p.Arg653His) rs104895085
NM_000243.2(MEFV):c.2040G>A (p.Met680Ile) rs28940580
NM_000243.2(MEFV):c.2080A>G (p.Met694Val) rs61752717
NM_000243.2(MEFV):c.2082G>A (p.Met694Ile) rs28940578
NM_000243.2(MEFV):c.2084A>G rs104895094
NM_000243.2(MEFV):c.2177T>C (p.Val726Ala) rs28940579
NM_000243.2(MEFV):c.2230G>T rs61732874
NM_000243.2(MEFV):c.2282G>A (p.Arg761His) rs104895097
NM_000243.2(MEFV):c.442G>C (p.Glu148Gln) rs3743930
NM_000243.2(MEFV):c.443A>T (p.Glu148Val) rs104895076
NM_000243.2(MEFV):c.501G>C (p.Glu167Asp) rs104895079
NM_000243.2(MEFV):c.800C>T (p.Thr267Ile) rs104895081
NM_000244.3(MEN1):c.1594C>T (p.Arg532Ter) rs104894261
NM_000244.3(MEN1):c.65T>G (p.Leu22Arg) rs104894256
NM_000244.3(MEN1):c.76G>A (p.Glu26Lys) rs28931612
NM_000248.3(MITF):c.952G>A (p.Glu318Lys) rs149617956
NM_000249.3(MLH1):c.-42C>T rs41285097
NM_000249.3(MLH1):c.-93G>A rs1800734
NM_000249.3(MLH1):c.1733A>G (p.Glu578Gly) rs63751612
NM_000249.3(MLH1):c.2041G>A (p.Ala681Thr) rs63750217
NM_000249.3(MLH1):c.218T>G (p.Leu73Arg) rs397514684
NM_000249.3(MLH1):c.394G>C (p.Asp132His) rs28930073
NM_000249.3(MLH1):c.793C>T (p.Arg265Cys) rs63751194
NM_000250.2(MPO):c.1555_1568del (p.Met519fs) rs536522394
NM_000250.2(MPO):c.752T>C (p.Met251Thr) rs56378716
NM_000250.2(MPO):c.995C>T (p.Ala332Val) rs28730837
NM_000251.2(MSH2):c.1571G>C (p.Arg524Pro) rs63751207
NM_000251.2(MSH2):c.1915C>T (p.His639Tyr) rs28929484
NM_000251.2(MSH2):c.965G>A (p.Gly322Asp) rs4987188
NM_000252.2(MTM1):c.679-1G>A rs672601324
NM_000253.3(MTTP):c.383T>C (p.Ile128Thr) rs3816873
NM_000254.2(MTR):c.2756A>G (p.Asp919Gly) rs1805087
NM_000254.2(MTR):c.2758C>G (p.His920Asp) rs121913579
NM_000254.2(MTR):c.3518C>T (p.Pro1173Leu) rs121913578
NM_000255.4(MMUT):c.1867G>A (p.Gly623Arg) rs121918254
NM_000255.4(MMUT):c.313T>C (p.Trp105Arg) rs121918249
NM_000255.4(MMUT):c.52C>T (p.Gln18Ter) rs121918248
NM_000256.3(MYBPC3):c.1224-19G>A rs587776699
NM_000256.3(MYBPC3):c.1468G>A (p.Gly490Arg) rs200625851
NM_000256.3(MYBPC3):c.1624G>C (p.Glu542Gln) rs121909374
NM_000256.3(MYBPC3):c.2234A>G (p.Asp745Gly) rs727503190
NM_000256.3(MYBPC3):c.2459G>A (p.Arg820Gln) rs2856655
NM_000256.3(MYBPC3):c.2497G>A (p.Ala833Thr) rs199865688
NM_000256.3(MYBPC3):c.2618C>A (p.Pro873His) rs371401403
NM_000256.3(MYBPC3):c.2618C>T (p.Pro873Leu) rs371401403
NM_000256.3(MYBPC3):c.2864_2865del (p.Pro955fs) rs397515990
NM_000256.3(MYBPC3):c.3286G>T (p.Glu1096Ter) rs121909377
NM_000256.3(MYBPC3):c.3330+2T>G rs387906397
NM_000256.3(MYBPC3):c.3373G>A (p.Val1125Met) rs121909378
NM_000256.3(MYBPC3):c.3742_3759dup (p.Gly1248_Cys1253dup) rs193922384
NM_000256.3(MYBPC3):c.3791G>T (p.Cys1264Phe) rs397514751
NM_000256.3(MYBPC3):c.821+5G>A rs397516077
NM_000256.3(MYBPC3):c.913_914del (p.Phe305fs) rs397516080
NM_000257.4(MYH7):c.1046T>C (p.Met349Thr) rs121913640
NM_000257.4(MYH7):c.1208G>T (p.Arg403Leu) rs121913624
NM_000257.4(MYH7):c.1322C>T (p.Thr441Met) rs121913653
NM_000257.4(MYH7):c.1357C>A (p.Arg453Ser) rs121913625
NM_000257.4(MYH7):c.1357C>T (p.Arg453Cys) rs121913625
NM_000257.4(MYH7):c.1491G>T (p.Glu497Asp) rs267606911
NM_000257.4(MYH7):c.1594T>C (p.Ser532Pro) rs121913642
NM_000257.4(MYH7):c.1750G>C (p.Gly584Arg) rs121913626
NM_000257.4(MYH7):c.1816G>A (p.Val606Met) rs121913627
NM_000257.4(MYH7):c.1925C>T (p.Ser642Leu) rs121913646
NM_000257.4(MYH7):c.2146G>A (p.Gly716Arg) rs121913638
NM_000257.4(MYH7):c.2156G>A (p.Arg719Gln) rs121913641
NM_000257.4(MYH7):c.2167C>T (p.Arg723Cys) rs121913630
NM_000257.4(MYH7):c.2221G>C (p.Gly741Arg) rs121913632
NM_000257.4(MYH7):c.2229G>C (p.Glu743Asp) rs397516139
NM_000257.4(MYH7):c.2770G>A (p.Glu924Lys) rs121913628
NM_000257.4(MYH7):c.2845G>A (p.Glu949Lys) rs121913629
NM_000257.4(MYH7):c.5134C>T (p.Arg1712Trp) rs121913650
NM_000257.4(MYH7):c.5177_5179AGA[3] (p.Lys1729del) rs367543052
NM_000257.4(MYH7):c.5378T>C (p.Leu1793Pro) rs121913654
NM_000257.4(MYH7):c.5458C>T (p.Arg1820Trp) rs145734640
NM_000257.4(MYH7):c.5647G>A (p.Glu1883Lys) rs121913652
NM_000257.4(MYH7):c.728G>A (p.Arg243His) rs267606910
NM_000257.4(MYH7):c.732+1G>A rs730880850
NM_000257.4(MYH7):c.746G>A (p.Arg249Gln) rs3218713
NM_000257.4(MYH7):c.767G>A (p.Gly256Glu) rs121913633
NM_000258.2(MYL3):c.427G>A (p.Glu143Lys) rs104893750
NM_000258.2(MYL3):c.461G>A (p.Arg154His) rs104893749
NM_000260.4(MYO7A):c.2011G>A (p.Gly671Ser) rs387906699
NM_000260.4(MYO7A):c.635G>A (p.Arg212His) rs28934610
NM_000260.4(MYO7A):c.652G>A (p.Asp218Asn) rs201539845
NM_000260.4(MYO7A):c.905G>A (p.Arg302His) rs41298135
NM_000261.2(MYOC):c.1102C>T (p.Gln368Ter) rs74315329
NM_000261.2(MYOC):c.136C>T (p.Arg46Ter) rs74315337
NM_000262.3(NAGA):c.479C>G (p.Ser160Cys) rs121434532
NM_000262.3(NAGA):c.973G>A (p.Glu325Lys) rs121434529
NM_000262.3(NAGA):c.986G>A (p.Arg329Gln) rs121434533
NM_000263.4(NAGLU):c.1444C>T (p.Arg482Trp) rs104894596
NM_000263.4(NAGLU):c.1562C>T (p.Pro521Leu) rs104894595
NM_000263.4(NAGLU):c.1694G>A (p.Arg565Gln) rs104894598
NM_000263.4(NAGLU):c.1694G>C (p.Arg565Pro) rs104894598
NM_000263.4(NAGLU):c.1928G>A (p.Arg643His) rs104894593
NM_000263.4(NAGLU):c.2021G>A (p.Arg674His) rs104894590
NM_000263.4(NAGLU):c.889C>T (p.Arg297Ter) rs104894592
NM_000265.6(NCF1):c.73_74GT[1] (p.Tyr26fs) rs4029402
NM_000266.4(NDP):c.125A>G (p.His42Arg) rs104894874
NM_000266.4(NDP):c.361C>T (p.Arg121Trp) rs104894878
NM_000267.3(NF1):c.1466A>G (p.Tyr489Cys) rs137854557
NM_000267.3(NF1):c.3104T>G (p.Met1035Arg) rs137854553
NM_000267.3(NF1):c.3728T>C (p.Leu1243Pro) rs137854564
NM_000267.3(NF1):c.4168C>T (p.Leu1390Phe) rs199474789
NM_000267.3(NF1):c.4173A>T (p.Arg1391Ser) rs137854554
NM_000267.3(NF1):c.4267A>G (p.Lys1423Glu) rs137854550
NM_000267.3(NF1):c.574C>T (p.Arg192Ter) rs397514641
NM_000267.3(NF1):c.5795T>C (p.Leu1932Pro) rs199474792
NM_000270.3(PNP):c.701G>C (p.Arg234Pro) rs104894451
NM_000271.4(NPC1):c.3044_3097del rs797044431
NM_000271.5(NPC1):c.1553G>A (p.Arg518Gln) rs483352886
NM_000271.5(NPC1):c.2848G>A (p.Val950Met) rs120074135
NM_000271.5(NPC1):c.2932C>T (p.Arg978Cys) rs28942108
NM_000271.5(NPC1):c.2974G>C (p.Gly992Arg) rs80358254
NM_000271.5(NPC1):c.2974G>T (p.Gly992Trp) rs80358254
NM_000271.5(NPC1):c.3019C>G (p.Pro1007Ala) rs80358257
NM_000271.5(NPC1):c.3104C>T (p.Ala1035Val) rs28942107
NM_000271.5(NPC1):c.3107C>T (p.Thr1036Met) rs28942104
NM_000271.5(NPC1):c.3182T>C (p.Ile1061Thr) rs80358259
NM_000271.5(NPC1):c.3467A>G (p.Asn1156Ser) rs28942105
NM_000271.5(NPC1):c.3591+1G>A rs786200877
NM_000271.5(NPC1):c.530G>A (p.Cys177Tyr) rs80358252
NM_000274.3(OAT):c.1172G>A (p.Trp391Ter) rs386833596
NM_000274.3(OAT):c.1186C>T (p.Arg396Ter) rs121965036
NM_000274.3(OAT):c.1250C>T (p.Pro417Leu) rs121965044
NM_000274.3(OAT):c.722C>T (p.Pro241Leu) rs121965051
NM_000274.3(OAT):c.994G>A (p.Val332Met) rs121965047
NM_000275.3(OCA2):c.1256G>A (p.Arg419Gln) rs1800407
NM_000275.3(OCA2):c.1327G>A (p.Val443Ile) rs121918166
NM_000275.3(OCA2):c.1441G>A (p.Ala481Thr) rs74653330
NM_000275.3(OCA2):c.2228C>T (p.Pro743Leu) rs121918167
NM_000275.3(OCA2):c.913C>T (p.Arg305Trp) rs1800401
NM_000276.4(OCRL):c.952C>T (p.Arg318Cys) rs137853263
NM_000277.3(PAH):c.1045T>C (p.Ser349Pro) rs62508646
NM_000277.3(PAH):c.1065+3A>G rs62508689
NM_000277.3(PAH):c.1066-3C>T rs62507344
NM_000277.3(PAH):c.1068C>G (p.Tyr356Ter) rs62516095
NM_000277.3(PAH):c.1092_1094del (p.Leu365del) rs62516096
NM_000277.3(PAH):c.1139C>T (p.Thr380Met) rs62642937
NM_000277.3(PAH):c.1169A>G (p.Glu390Gly) rs5030856
NM_000277.3(PAH):c.1243G>A (p.Asp415Asn) rs62644499
NM_000277.3(PAH):c.194T>C (p.Ile65Thr) rs75193786
NM_000277.3(PAH):c.1A>G (p.Met1Val) rs62514891
NM_000277.3(PAH):c.227A>G (p.Glu76Gly) rs62507347
NM_000277.3(PAH):c.261C>A (p.Ser87Arg) rs62516151
NM_000277.3(PAH):c.281_283TCA[1] (p.Ile95del) rs62508727
NM_000277.3(PAH):c.293T>C (p.Leu98Ser) rs62517167
NM_000277.3(PAH):c.527G>T (p.Arg176Leu) rs74486803
NM_000277.3(PAH):c.734T>C (p.Val245Ala) rs76212747
NM_000277.3(PAH):c.764T>C (p.Leu255Ser) rs62642930
NM_000277.3(PAH):c.776C>T (p.Ala259Val) rs118203921
NM_000277.3(PAH):c.782G>A (p.Arg261Gln) rs5030849
NM_000277.3(PAH):c.818C>T (p.Ser273Phe) rs62514953
NM_000277.3(PAH):c.842+1G>A rs5030852
NM_000277.3(PAH):c.842C>T (p.Pro281Leu) rs5030851
NM_000277.3(PAH):c.916A>G (p.Ile306Val) rs62642934
NM_000277.3(PAH):c.932T>C (p.Leu311Pro) rs62642936
NM_000277.3(PAH):c.965C>G (p.Ala322Gly) rs62514958
NM_000278.3(PAX2):c.221_226dupAGACCG (p.Thr75_Gly76insGluThr) rs387906530
NM_000280.4(PAX6):c.76C>G (p.Arg26Gly) rs121907913
NM_000281.4(PCBD1):c.259G>T (p.Glu87Ter) rs104894172
NM_000283.3(PDE6B):c.1678C>T (p.Arg560Cys) rs201541131
NM_000284.4(PDHA1):c.1142_1145dup (p.Trp383fs) rs606231189
NM_000284.4(PDHA1):c.844A>C (p.Met282Leu) rs2229137
NM_000285.4(PEPD):c.692_694del (p.Tyr231del) rs745834191
NM_000286.3(PEX12):c.949C>T (p.Leu317Phe) rs61752112
NM_000286.3(PEX12):c.959C>T (p.Ser320Phe) rs28936697
NM_000287.4(PEX6):c.1802G>A (p.Arg601Gln) rs34324426
NM_000287.4(PEX6):c.1841del (p.Leu614fs) rs863225083
NM_000287.4(PEX6):c.821C>T (p.Pro274Leu) rs61753219
NM_000288.4(PEX7):c.340-10A>G rs267608255
NM_000288.4(PEX7):c.345T>G (p.Tyr115Ter) rs121909154
NM_000288.4(PEX7):c.40A>C (p.Thr14Pro) rs61753233
NM_000288.4(PEX7):c.45_52dup (p.His18fs) rs63535662
NM_000288.4(PEX7):c.649G>A (p.Gly217Arg) rs121909152
NM_000288.4(PEX7):c.653C>T (p.Ala218Val) rs121909151
NM_000288.4(PEX7):c.694C>T (p.Arg232Ter) rs121909153
NM_000288.4(PEX7):c.6_12TGCGGTG[3] (p.Gly7fs) rs62636519
NM_000288.4(PEX7):c.875T>A (p.Leu292Ter) rs1805137
NM_000288.4(PEX7):c.903+1G>C rs148591292
NM_000290.4(PGAM2):c.233G>A (p.Trp78Ter) rs10250779
NM_000290.4(PGAM2):c.268C>T (p.Arg90Trp) rs104894034
NM_000290.4(PGAM2):c.290G>A (p.Gly97Asp) rs77938727
NM_000291.4(PGK1):c.758T>C (p.Ile253Thr) rs137852534
NM_000292.3(PHKA2):c.3341C>T (p.Thr1114Ile) rs137852293
NM_000292.3(PHKA2):c.556C>T (p.Arg186Cys) rs137852294
NM_000292.3(PHKA2):c.557G>A (p.Arg186His) rs137852290
NM_000293.3(PHKB):c.1969C>T (p.Gln657Ter) rs34667348
NM_000293.3(PHKB):c.352G>C (p.Ala118Pro) rs121918022
NM_000294.3(PHKG2):c.926G>A (p.Arg309Gln) rs572115942
NM_000295.4(SERPINA1):c.1078G>A (p.Ala360Thr) rs1802959
NM_000295.4(SERPINA1):c.1093G>A (p.Asp365Asn) rs143370956
NM_000295.4(SERPINA1):c.721A>T (p.Lys241Ter) rs199422211
NM_000295.5(SERPINA1):c.221_223TCT[2] (p.Phe76del) rs775982338
NM_000298.6(PKLR):c.1456C>T (p.Arg486Trp) rs116100695
NM_000301.3(PLG):c.1858G>A (p.Ala620Thr) rs121918027
NM_000302.4(PLOD1):c.2032G>A (p.Gly678Arg) rs121913551
NM_000303.3(PMM2):c.131T>C (p.Val44Ala) rs104894534
NM_000303.3(PMM2):c.26G>A (p.Cys9Tyr) rs104894532
NM_000303.3(PMM2):c.317A>T (p.Tyr106Phe) rs387906824
NM_000303.3(PMM2):c.338C>T (p.Pro113Leu) rs80338700
NM_000303.3(PMM2):c.357C>A (p.Phe119Leu) rs80338701
NM_000303.3(PMM2):c.385G>A (p.Val129Met) rs104894525
NM_000303.3(PMM2):c.395T>C (p.Ile132Thr) rs80338702
NM_000303.3(PMM2):c.422G>A (p.Arg141His) rs28936415
NM_000303.3(PMM2):c.484C>T (p.Arg162Trp) rs104894526
NM_000303.3(PMM2):c.563A>G (p.Asp188Gly) rs80338704
NM_000303.3(PMM2):c.640-15479C>T rs1258107584
NM_000303.3(PMM2):c.677C>G (p.Thr226Ser) rs80338706
NM_000303.3(PMM2):c.691G>A (p.Val231Met) rs80338707
NM_000303.3(PMM2):c.710C>G (p.Thr237Arg) rs80338708
NM_000303.3(PMM2):c.722G>C (p.Cys241Ser) rs80338709
NM_000304.4(PMP22):c.199G>C (p.Ala67Pro) rs104894623
NM_000304.4(PMP22):c.19_20del (p.Ser7fs) rs587776691
NM_000304.4(PMP22):c.281del (p.Gly94fs) rs80338763
NM_000304.4(PMP22):c.281dup (p.Arg95fs) rs80338763
NM_000304.4(PMP22):c.344_355del (p.Ala115_Thr118del) rs786205111
NM_000304.4(PMP22):c.353C>T (p.Thr118Met) rs104894619
NM_000304.4(PMP22):c.36C>A (p.His12Gln) rs104894622
NM_000304.4(PMP22):c.448G>T (p.Gly150Cys) rs104894624
NM_000304.4(PMP22):c.469C>T (p.Arg157Trp) rs28936682
NM_000304.4(PMP22):c.47T>C (p.Leu16Pro) rs104894617
NM_000304.4(PMP22):c.65C>T (p.Ser22Phe) rs104894625
NM_000304.4(PMP22):c.82T>C (p.Trp28Arg) rs104894626
NM_000306.4(POU1F1):c.515G>A (p.Arg172Gln) rs104893765
NM_000306.4(POU1F1):c.811C>T (p.Arg271Trp) rs104893755
NM_000310.3(PPT1):c.29T>A (p.Leu10Ter) rs137852699
NM_000310.3(PPT1):c.364A>T (p.Arg122Trp) rs137852695
NM_000310.3(PPT1):c.451C>T (p.Arg151Ter) rs137852700
NM_000311.4(PRNP):c.160_183GGTGGTGGCTGGGGGCAGCCTCAT(4) (p.Gln59_Pro60insGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGln) rs193922906
NM_000311.5(PRNP):c.305C>T (p.Pro102Leu) rs74315401
NM_000311.5(PRNP):c.313C>A (p.Pro105Thr) rs74315414
NM_000311.5(PRNP):c.313C>T (p.Pro105Ser) rs74315414
NM_000311.5(PRNP):c.314C>T (p.Pro105Leu) rs11538758
NM_000311.5(PRNP):c.350C>T (p.Ala117Val) rs74315402
NM_000311.5(PRNP):c.385A>G (p.Met129Val) rs1799990
NM_000311.5(PRNP):c.435T>G (p.Tyr145Ter) rs80356710
NM_000311.5(PRNP):c.478C>T (p.Gln160Ter) rs80356711
NM_000311.5(PRNP):c.512A>G (p.Asn171Ser) rs16990018
NM_000311.5(PRNP):c.538G>A (p.Val180Ile) rs74315408
NM_000311.5(PRNP):c.547A>G (p.Thr183Ala) rs74315411
NM_000311.5(PRNP):c.560A>G (p.His187Arg) rs74315413
NM_000311.5(PRNP):c.593T>C (p.Phe198Ser) rs74315405
NM_000311.5(PRNP):c.598G>A (p.Glu200Lys) rs28933385
NM_000311.5(PRNP):c.623G>A (p.Arg208His) rs74315412
NM_000311.5(PRNP):c.628G>A (p.Val210Ile) rs74315407
NM_000311.5(PRNP):c.650A>G (p.Gln217Arg) rs74315406
NM_000311.5(PRNP):c.655G>A (p.Glu219Lys) rs1800014
NM_000311.5(PRNP):c.695T>G (p.Met232Arg) rs74315409
NM_000312.3(PROC):c.629C>T (p.Pro210Leu) rs121918145
NM_000312.3(PROC):c.631C>T (p.Arg211Trp) rs121918143
NM_000312.3(PROC):c.659G>A (p.Arg220Gln) rs121918153
NM_000312.3(PROC):c.793C>T (p.Leu265Phe) rs121918156
NM_000312.3(PROC):c.814C>T (p.Arg272Cys) rs121918154
NM_000312.3(PROC):c.935C>T (p.Ser312Leu) rs121918160
NM_000314.6(PTEN):c.802delG (p.Asp268Thrfs) rs587776672
NM_000314.7(PTEN):c.-764G>A rs587776674
NM_000314.7(PTEN):c.-861G>T rs587776675
NM_000314.7(PTEN):c.1003C>T (p.Arg335Ter) rs121909231
NM_000314.7(PTEN):c.253+1G>A rs587776667
NM_000314.7(PTEN):c.278A>G (p.His93Arg) rs121909238
NM_000314.7(PTEN):c.368A>G (p.His123Arg) rs121909222
NM_000314.7(PTEN):c.388C>T (p.Arg130Ter) rs121909224
NM_000314.7(PTEN):c.389G>A (p.Arg130Gln) rs121909229
NM_000314.7(PTEN):c.395G>T (p.Gly132Val) rs121909241
NM_000314.7(PTEN):c.492+2T>G rs1554898244
NM_000314.7(PTEN):c.510T>A (p.Ser170Arg) rs121909221
NM_000314.7(PTEN):c.564T>A (p.Tyr188Ter) rs606231170
NM_000314.7(PTEN):c.696del (p.Arg233fs) rs587776669
NM_000314.7(PTEN):c.701G>A (p.Arg234Gln) rs121909235
NM_000314.7(PTEN):c.722T>C (p.Phe241Ser) rs121909240
NM_000314.7(PTEN):c.755A>G (p.Asp252Gly) rs121909239
NM_000314.7(PTEN):c.761_765del (p.Lys254fs) rs606231169
NM_000316.3(PTH1R):c.103G>A (p.Glu35Lys) rs1559532562
NM_000317.3(PTS):c.155A>G (p.Asn52Ser) rs104894275
NM_000317.3(PTS):c.166G>A (p.Val56Met) rs104894277
NM_000317.3(PTS):c.347A>G (p.Asp116Gly) rs104894279
NM_000317.3(PTS):c.46C>T (p.Arg16Cys) rs104894274
NM_000321.2(RB1):c.1072C>T (p.Arg358Ter) rs121913301
NM_000321.2(RB1):c.1436_1438ACA[1] (p.Asn480del) rs587776788
NM_000321.2(RB1):c.1666C>T (p.Arg556Ter) rs121913304
NM_000321.2(RB1):c.1981C>T (p.Arg661Trp) rs137853294
NM_000321.2(RB1):c.2134T>C (p.Cys712Arg) rs137853296
NM_000321.2(RB1):c.2242G>T (p.Glu748Ter) rs121913297
NM_000322.5(PRPH2):c.136C>T (p.Arg46Ter) rs61755771
NM_000322.5(PRPH2):c.514C>T (p.Arg172Trp) rs61755792
NM_000322.5(PRPH2):c.629C>G (p.Pro210Arg) rs61755798
NM_000322.5(PRPH2):c.647C>T (p.Pro216Leu) rs61755806
NM_000326.5(RLBP1):c.677T>A (p.Met226Lys) rs137853291
NM_000327.3(ROM1):c.339dup (p.Leu114fs) rs71458427
NM_000328.3(RPGR):c.1905+500_1905+501del rs398122960
NM_000328.3(RPGR):c.823G>A (p.Gly275Ser) rs62642057
NM_000329.3(RPE65):c.11+5G>A rs61751276
NM_000329.3(RPE65):c.1543C>T (p.Arg515Trp) rs121917745
NM_000329.3(RPE65):c.394G>A (p.Ala132Thr) rs61752878
NM_000334.4(SCN4A):c.2006G>A (p.Arg669His) rs80338784
NM_000334.4(SCN4A):c.2014C>A (p.Arg672Ser) rs80338785
NM_000334.4(SCN4A):c.2014C>G (p.Arg672Gly) rs80338785
NM_000334.4(SCN4A):c.2015G>A (p.Arg672His) rs80338788
NM_000334.4(SCN4A):c.2411C>T (p.Ser804Phe) rs121908546
NM_000334.4(SCN4A):c.3395G>A (p.Arg1132Gln) rs80338789
NM_000334.4(SCN4A):c.3466G>A (p.Ala1156Thr) rs80338958
NM_000334.4(SCN4A):c.4343G>A (p.Arg1448His) rs121908545
NM_000334.4(SCN4A):c.737C>T (p.Ser246Leu) rs80338951
NM_000336.3(SCNN1B):c.109G>A (p.Gly37Ser) rs137852706
NM_000336.3(SCNN1B):c.245C>G (p.Ser82Cys) rs35731153
NM_000336.3(SCNN1B):c.880G>A (p.Gly294Ser) rs72654338
NM_000337.5(SGCD):c.451T>G (p.Ser151Ala) rs121909298
NM_000339.3(SLC12A3):c.1046C>T (p.Pro349Leu) rs121909383
NM_000339.3(SLC12A3):c.1964G>A (p.Arg655His) rs121909380
NM_000340.2(SLC2A2):c.589G>A (p.Val197Ile) rs121909741
NM_000341.4(SLC3A1):c.1400T>A (p.Met467Lys) rs121912691
NM_000342.3(SLC4A1):c.118G>A (p.Glu40Lys) rs45562031
NM_000342.4(SLC4A1):c.1199_1225del (p.Ala400_Ala408del) rs769664228
NM_000342.4(SLC4A1):c.166A>G (p.Lys56Glu) rs5036
NM_000342.4(SLC4A1):c.1937G>A (p.Arg646Gln) rs121912757
NM_000342.4(SLC4A1):c.2561C>T (p.Pro854Leu) rs2285644
NM_000342.4(SLC4A1):c.2573C>A (p.Ala858Asp) rs121912751
NM_000342.4(SLC4A1):c.2603C>T (p.Pro868Leu) rs121912759
NM_000344.3(SMN1):c.785G>T (p.Ser262Ile) rs1554066659
NM_000344.3(SMN1):c.815A>G (p.Tyr272Cys) rs104893922
NM_000344.3(SMN1):c.821C>T (p.Thr274Ile) rs1554066666
NM_000345.4(SNCA):c.150T>G (p.His50Gln) rs201106962
NM_000346.4(SOX9):c.1320C>G (p.Tyr440Ter) rs80338688
NM_000346.4(SOX9):c.507C>G (p.His169Gln) rs2229989
NM_000348.4(SRD5A2):c.145G>A (p.Ala49Thr) rs9282858
NM_000348.4(SRD5A2):c.586G>A (p.Gly196Ser) rs121434250
NM_000348.4(SRD5A2):c.680G>A (p.Arg227Gln) rs9332964
NM_000348.4(SRD5A2):c.682G>A (p.Ala228Thr) rs121434249
NM_000349.3(STAR):c.466-11T>A rs1053284504
NM_000349.3(STAR):c.545G>A (p.Arg182His) rs104894086
NM_000349.3(STAR):c.559G>A (p.Val187Met) rs104894089
NM_000350.2(ABCA4):c.2588G>C rs76157638
NM_000350.2(ABCA4):c.5882G>A rs1800553
NM_000350.3(ABCA4):c.1715G>A (p.Arg572Gln) rs61748559
NM_000350.3(ABCA4):c.2791G>A (p.Val931Met) rs58331765
NM_000350.3(ABCA4):c.2828G>A (p.Arg943Gln) rs1801581
NM_000350.3(ABCA4):c.3113C>T (p.Ala1038Val) rs61751374
NM_000350.3(ABCA4):c.3364G>A (p.Glu1122Lys) rs61751399
NM_000350.3(ABCA4):c.3602T>G (p.Leu1201Arg) rs61750126
NM_000350.3(ABCA4):c.4139C>T (p.Pro1380Leu) rs61750130
NM_000350.3(ABCA4):c.52C>T (p.Arg18Trp) rs121909205
NM_000350.3(ABCA4):c.5338C>G (p.Pro1780Ala) rs121909207
NM_000350.3(ABCA4):c.5461-10T>C rs1800728
NM_000350.3(ABCA4):c.5714+5G>A rs61751407
NM_000350.3(ABCA4):c.5908C>T (p.Leu1970Phe) rs28938473
NM_000350.3(ABCA4):c.6148G>C (p.Val2050Leu) rs41292677
NM_000350.3(ABCA4):c.634C>T (p.Arg212Cys) rs61750200
NM_000350.3(ABCA4):c.6529G>A (p.Asp2177Asn) rs1800555
NM_000353.3(TAT):c.169C>T (p.Arg57Ter) rs118203914
NM_000354.5(SERPINA7):c.631G>A (p.Ala211Thr) rs2234036
NM_000358.3(TGFBI):c.1501C>A (p.Pro501Thr) rs121909212
NM_000359.3(TGM1):c.1075G>A (p.Val359Met) rs202037016
NM_000359.3(TGM1):c.1166G>A (p.Arg389His) rs121918723
NM_000359.3(TGM1):c.1187G>A (p.Arg396His) rs121918721
NM_000359.3(TGM1):c.1187G>T (p.Arg396Leu) rs121918721
NM_000359.3(TGM1):c.1223_1227del (p.Asp408fs) rs398122905
NM_000359.3(TGM1):c.125C>A (p.Ser42Tyr) rs41295338
NM_000359.3(TGM1):c.1469A>G (p.Asp490Gly) rs121918724
NM_000359.3(TGM1):c.1552G>A (p.Val518Met) rs35312232
NM_000359.3(TGM1):c.1744C>T (p.Gln582Ter) rs397514522
NM_000359.3(TGM1):c.281G>A (p.Gly94Asp) rs121918729
NM_000359.3(TGM1):c.376C>T (p.Arg126Cys) rs397514524
NM_000359.3(TGM1):c.424C>T (p.Arg142Cys) rs121918716
NM_000359.3(TGM1):c.428G>A (p.Arg143His) rs121918719
NM_000359.3(TGM1):c.652G>A (p.Gly218Ser) rs121918732
NM_000359.3(TGM1):c.832G>A (p.Gly278Arg) rs121918725
NM_000359.3(TGM1):c.919C>T (p.Arg307Trp) rs121918731
NM_000359.3(TGM1):c.943C>T (p.Arg315Cys) rs397514525
NM_000359.3(TGM1):c.944G>T (p.Arg315Leu) rs143473912
NM_000359.3(TGM1):c.968G>A (p.Arg323Gln) rs121918717
NM_000360.4(TH):c.1141C>A (p.Gln381Lys) rs121917762
NM_000360.4(TH):c.1388C>T (p.Thr463Met) rs45471299
NM_000360.4(TH):c.605G>A (p.Arg202His) rs80338892
NM_000360.4(TH):c.614T>C (p.Leu205Pro) rs121917763
NM_000361.2(THBD):c.127G>A (p.Ala43Thr) rs1800576
NM_000361.2(THBD):c.1456G>T (p.Asp486Tyr) rs41348347
NM_000361.2(THBD):c.1483C>T (p.Pro495Ser) rs1800578
NM_000363.5(TNNI3):c.244C>T (p.Pro82Ser) rs77615401
NM_000363.5(TNNI3):c.433C>T (p.Arg145Trp) rs104894724
NM_000363.5(TNNI3):c.511G>A (p.Ala171Thr) rs121917761
NM_000363.5(TNNI3):c.575G>A (p.Arg192His) rs104894729
NM_000363.5(TNNI3):c.586G>A (p.Asp196Asn) rs104894727
NM_000364.4(TNNT2):c.305G>A (p.Arg102Gln) rs121964856
NM_000364.4(TNNT2):c.421C>T (p.Arg141Trp) rs74315380
NM_000364.4(TNNT2):c.641_643AGA[3] (p.Lys217del) rs45578238
NM_000367.4(TPMT):c.460G>A (p.Ala154Thr) rs1800460
NM_000367.4(TPMT):c.719A>G (p.Tyr240Cys) rs1142345
NM_000368.4(TSC1):c.1760A>G (p.Lys587Arg) rs118203576
NM_000368.4(TSC1):c.2194C>T (p.His732Tyr) rs118203657
NM_000368.4(TSC1):c.610C>T (p.Arg204Cys) rs1060505021
NM_000368.4(TSC1):c.64C>T (p.Arg22Trp) rs749030456
NM_000369.2(TSHR):c.106G>C (p.Asp36His) rs61747482
NM_000369.2(TSHR):c.1637G>A (p.Trp546Ter) rs121908866
NM_000369.2(TSHR):c.1657G>A (p.Ala553Thr) rs121908872
NM_000370.3(TTPA):c.303T>G (p.His101Gln) rs121917849
NM_000370.3(TTPA):c.400C>T (p.Arg134Ter) rs121917851
NM_000370.3(TTPA):c.487del (p.Trp163fs) rs397515378
NM_000370.3(TTPA):c.513_514insTT (p.Thr172fs) rs397515379
NM_000370.3(TTPA):c.575G>A (p.Arg192His) rs121917850
NM_000370.3(TTPA):c.744del (p.Glu249fs) rs397515377
NM_000371.3(TTR):c.238A>G (p.Thr80Ala) rs121918070
NM_000371.3(TTR):c.250T>C (p.Phe84Leu) rs121918091
NM_000371.3(TTR):c.262A>T (p.Ile88Leu) rs121918085
NM_000371.3(TTR):c.265T>C (p.Tyr89His) rs121918100
NM_000371.3(TTR):c.328C>A (p.His110Asn) rs121918074
NM_000371.3(TTR):c.349G>T (p.Ala117Ser) rs267607161
NM_000371.3(TTR):c.371G>A (p.Arg124His) rs121918095
NM_000371.3(TTR):c.379A>G (p.Ile127Val) rs121918089
NM_000371.3(TTR):c.386C>T (p.Ala129Val) rs121918092
NM_000371.3(TTR):c.416C>T (p.Thr139Met) rs28933981
NM_000371.3(TTR):c.421_423GTC[1] (p.Val142del) rs121918096
NM_000371.3(TTR):c.88T>C (p.Cys30Arg) rs121918083
NM_000372.5(TYR):c.1147G>A (p.Asp383Asn) rs121908011
NM_000372.5(TYR):c.1205G>A (p.Arg402Gln) rs1126809
NM_000372.5(TYR):c.1209G>T (p.Arg403Ser) rs104894316
NM_000372.5(TYR):c.1217C>T (p.Pro406Leu) rs104894313
NM_000372.5(TYR):c.1255G>A (p.Gly419Arg) rs61754392
NM_000372.5(TYR):c.1336G>A (p.Gly446Ser) rs104894317
NM_000372.5(TYR):c.140G>A (p.Gly47Asp) rs61753180
NM_000372.5(TYR):c.230G>A (p.Arg77Gln) rs61753185
NM_000372.5(TYR):c.242C>T (p.Pro81Leu) rs28940876
NM_000372.5(TYR):c.575C>A (p.Ser192Tyr) rs1042602
NM_000372.5(TYR):c.649C>T (p.Arg217Trp) rs63159160
NM_000372.5(TYR):c.823G>T (p.Val275Phe) rs104894314
NM_000372.5(TYR):c.896G>A (p.Arg299His) rs61754375
NM_000375.3(UROS):c.197C>T (p.Ala66Val) rs28941774
NM_000375.3(UROS):c.217T>C (p.Cys73Arg) rs121908012
NM_000375.3(UROS):c.244G>T (p.Val82Phe) rs121908016
NM_000375.3(UROS):c.673G>A (p.Gly225Ser) rs121908020
NM_000380.3(XPA):c.323G>T (p.Cys108Phe) rs104894131
NM_000382.3(ALDH3A2):c.1157A>G (p.Asn386Ser)
NM_000382.3(ALDH3A2):c.1293_1294GA[2] (p.Glu433fs) rs387906256
NM_000382.3(ALDH3A2):c.1307_1311dup (p.Leu438fs) rs387906257
NM_000382.3(ALDH3A2):c.798G>C (p.Lys266Asn) rs72547569
NM_000383.4(AIRE):c.967_979del (p.Leu323fs) rs386833675
NM_000384.3(APOB):c.10580G>A (p.Arg3527Gln) rs5742904
NM_000384.3(APOB):c.10672C>T (p.Arg3558Cys) rs12713559
NM_000388.4(CASR):c.1394G>A (p.Arg465Gln) rs104893716
NM_000388.4(CASR):c.1745G>A (p.Cys582Tyr) rs104893690
NM_000388.4(CASR):c.196C>T (p.Arg66Cys) rs121909266
NM_000388.4(CASR):c.2383C>T (p.Arg795Trp) rs121909258
NM_000388.4(CASR):c.2641T>C (p.Phe881Leu) rs104893704
NM_000388.4(CASR):c.2657G>C (p.Arg886Pro) rs1057520791
NM_000388.4(CASR):c.2693G>A (p.Arg898Gln) rs121909269
NM_000388.4(CASR):c.2915C>T (p.Thr972Met) rs200620134
NM_000388.4(CASR):c.2956G>T (p.Ala986Ser) rs1801725
NM_000388.4(CASR):c.413C>T (p.Thr138Met) rs121909263
NM_000388.4(CASR):c.428G>A (p.Gly143Glu) rs121909264
NM_000391.4(TPP1):c.1094G>A (p.Cys365Tyr) rs119455954
NM_000391.4(TPP1):c.509-1G>C rs56144125
NM_000391.4(TPP1):c.622C>T (p.Arg208Ter) rs119455955
NM_000391.4(TPP1):c.857A>G (p.Asn286Ser) rs119455958
NM_000391.4(TPP1):c.887-10A>G rs755445790
NM_000392.5(ABCC2):c.3196C>T (p.Arg1066Ter) rs72558199
NM_000396.4(CTSK):c.721C>T (p.Arg241Ter) rs74315303
NM_000396.4(CTSK):c.830C>T (p.Ala277Val) rs74315304
NM_000396.4(CTSK):c.926T>C (p.Leu309Pro) rs29001685
NM_000399.5(EGR2):c.1075C>T (p.Arg359Trp) rs104894161
NM_000399.5(EGR2):c.1225C>T (p.Arg409Trp) rs104894159
NM_000399.5(EGR2):c.803T>A (p.Ile268Asn) rs104894158
NM_000400.3(ERCC2):c.1381C>G (p.Leu461Val) rs121913016
NM_000400.3(ERCC2):c.2047C>T (p.Arg683Trp) rs41556519
NM_000401.3(EXT2):c.110C>T (p.Ser37Leu) rs527624522
NM_000401.3(EXT2):c.1118T>A (p.Val373Asp) rs371996957
NM_000401.3(EXT2):c.2015C>T (p.Thr672Met) rs138722406
NM_000402.4(G6PD):c.1039G>A (p.Glu347Lys) rs137852339
NM_000402.4(G6PD):c.1054T>C (p.Tyr352His) rs137852347
NM_000402.4(G6PD):c.1093G>A (p.Ala365Thr) rs5030869
NM_000402.4(G6PD):c.1114C>T (p.Leu372Phe) rs137852342
NM_000402.4(G6PD):c.1172C>T (p.Ala391Val) rs137852345
NM_000402.4(G6PD):c.1179C>A (p.Asn393Lys) rs137852329
NM_000402.4(G6PD):c.1192G>A (p.Glu398Lys) rs387906468
NM_000402.4(G6PD):c.1243T>C (p.Cys415Arg) rs137852322
NM_000402.4(G6PD):c.1246A>G (p.Lys416Glu) rs137852320
NM_000402.4(G6PD):c.1249C>T (p.Arg417Cys) rs137852334
NM_000402.4(G6PD):c.1268G>A (p.Arg423His) rs137852316
NM_000402.4(G6PD):c.1270G>C (p.Val424Leu) rs137852335
NM_000402.4(G6PD):c.1319G>A (p.Gly440Asp) rs137852336
NM_000402.4(G6PD):c.1406G>C (p.Arg469Pro) rs137852337
NM_000402.4(G6PD):c.1429G>A (p.Gly477Arg) rs137852317
NM_000402.4(G6PD):c.1466G>C (p.Arg489Pro) rs72554665
NM_000402.4(G6PD):c.1466G>T (p.Arg489Leu) rs72554665
NM_000402.4(G6PD):c.1478G>A (p.Arg493His) rs72554664
NM_000402.4(G6PD):c.185A>G (p.His62Arg) rs137852340
NM_000402.4(G6PD):c.193_195delATC (p.Ile66del) rs137852338
NM_000402.4(G6PD):c.221C>G (p.Ala74Gly) rs78478128
NM_000402.4(G6PD):c.233T>C (p.Ile78Thr) rs76645461
NM_000402.4(G6PD):c.292G>A (p.Val98Met) rs1050828
NM_000402.4(G6PD):c.466A>G (p.Asn156Asp) rs1050829
NM_000402.4(G6PD):c.482G>T (p.Gly161Val) rs137852341
NM_000402.4(G6PD):c.556G>A (p.Glu186Lys) rs137852313
NM_000402.4(G6PD):c.577G>A (p.Gly193Ser) rs137852314
NM_000402.4(G6PD):c.583A>G (p.Asn195Asp) rs137852331
NM_000402.4(G6PD):c.632A>T (p.Asp211Val) rs5030872
NM_000402.4(G6PD):c.653C>T (p.Ser218Phe) rs5030868
NM_000402.4(G6PD):c.682C>T (p.Arg228Cys) rs137852330
NM_000402.4(G6PD):c.683G>A (p.Arg228His) rs137852332
NM_000402.4(G6PD):c.683G>C (p.Arg228Pro) rs137852332
NM_000402.4(G6PD):c.727G>T (p.Val243Leu) rs137852326
NM_000402.4(G6PD):c.770G>A (p.Arg257Gln) rs137852328
NM_000402.4(G6PD):c.896G>A (p.Cys299Tyr) rs137852346
NM_000402.4(G6PD):c.934G>C (p.Asp312His) rs137852318
NM_000402.4(G6PD):c.961G>A (p.Val321Met) rs137852327
NM_000404.2(GLB1):c.245C>T rs72555393
NM_000404.2(GLB1):c.367G>A rs28934274
NM_000404.4(GLB1):c.1051C>T (p.Arg351Ter) rs72555372
NM_000404.4(GLB1):c.1223A>C (p.Gln408Pro) rs72555369
NM_000404.4(GLB1):c.1444C>T (p.Arg482Cys) rs72555365
NM_000404.4(GLB1):c.145C>T (p.Arg49Cys) rs72555358
NM_000404.4(GLB1):c.1498A>G (p.Thr500Ala) rs72555368
NM_000404.4(GLB1):c.1772A>G (p.Tyr591Cys) rs72555371
NM_000404.4(GLB1):c.601C>T (p.Arg201Cys) rs72555360
NM_000404.4(GLB1):c.947A>G (p.Tyr316Cys) rs72555361
NM_000405.5(GM2A):c.164C>T (p.Pro55Leu) rs730882196
NM_000406.2(GNRHR):c.30T>A (p.Asn10Lys) rs104893843
NM_000406.2(GNRHR):c.317A>G (p.Gln106Arg) rs104893836
NM_000407.4(GP1BB):c.137G>A (p.Trp46Ter) rs121909752
NM_000409.4(GUCA1A):c.149C>T (p.Pro50Leu) rs104893968
NM_000409.4(GUCA1A):c.296A>G (p.Tyr99Cys) rs104893967
NM_000410.3(HFE):c.175G>A (p.Val59Met) rs111033557
NM_000410.3(HFE):c.187C>G (p.His63Asp) rs1799945
NM_000410.3(HFE):c.193A>T (p.Ser65Cys) rs1800730
NM_000410.3(HFE):c.845G>A (p.Cys282Tyr) rs1800562
NM_000411.8(HLCS):c.1519+5G>A rs753887925
NM_000411.8(HLCS):c.1648G>A (p.Val550Met) rs119103231
NM_000411.8(HLCS):c.1711G>A (p.Asp571Asn) rs119103228
NM_000411.8(HLCS):c.647T>G (p.Leu216Arg) rs28934602
NM_000411.8(HLCS):c.710T>C (p.Leu237Pro) rs119103227
NM_000412.4(HRG):c.271C>T (p.Pro91Ser) rs761776963
NM_000414.4(HSD17B4):c.101C>T (p.Ala34Val) rs587777442
NM_000414.4(HSD17B4):c.1369A>T (p.Asn457Tyr) rs137853097
NM_000414.4(HSD17B4):c.1538C>T (p.Pro513Leu) rs587777444
NM_000414.4(HSD17B4):c.1547T>C (p.Ile516Thr) rs587777443
NM_000414.4(HSD17B4):c.1628G>C (p.Arg543Pro) rs201009485
NM_000414.4(HSD17B4):c.46G>A (p.Gly16Ser) rs137853096
NM_000416.2(IFNGR1):c.260T>C (p.Ile87Thr) rs104893973
NM_000416.2(IFNGR1):c.653_655del (p.Glu218del) rs587776858
NM_000418.4(IL4R):c.223A>G (p.Ile75Val) rs1805010
NM_000419.5(ITGA2B):c.2621T>G (p.Ile874Ser) rs5911
NM_000419.5(ITGA2B):c.3077G>A (p.Arg1026Gln) rs879255514
NM_000420.3(KEL):c.1790T>C (p.Leu597Pro) rs8176038
NM_000422.3(KRT17):c.275A>G (p.Asn92Ser) rs59151893
NM_000424.4(KRT5):c.1649del (p.Gly550fs) rs61126080
NM_000424.4(KRT5):c.74C>T (p.Pro25Leu) rs57499817
NM_000426.3(LAMA2):c.1580G>A (p.Cys527Tyr) rs121913574
NM_000426.3(LAMA2):c.2584T>C (p.Cys862Arg) rs121913573
NM_000426.3(LAMA2):c.2901C>A (p.Cys967Ter) rs121913577
NM_000426.3(LAMA2):c.3718C>T (p.Gln1240Ter) rs121913569
NM_000426.3(LAMA2):c.4487C>T (p.Ala1496Val) rs147077184
NM_000426.3(LAMA2):c.7750-1713_7899-2153del
NM_000426.3(LAMA2):c.9253C>T rs121913571
NM_000429.3(MAT1A):c.1070C>T (p.Pro357Leu) rs118204003
NM_000430.4(PAFAH1B1):c.484G>A (p.Gly162Ser) rs121434487
NM_000431.4(MVK):c.1129G>A (p.Val377Ile) rs28934897
NM_000431.4(MVK):c.500C>T (p.Pro167Leu) rs104895300
NM_000432.3(MYL2):c.173G>A (p.Arg58Gln) rs104894369
NM_000432.3(MYL2):c.37G>A (p.Ala13Thr) rs104894363
NM_000432.3(MYL2):c.52T>C (p.Phe18Leu) rs104894370
NM_000432.3(MYL2):c.64G>A (p.Glu22Lys) rs104894368
NM_000433.3(NCF2):c.1183C>T (p.Arg395Trp) rs13306575
NM_000433.3(NCF2):c.55_63del (p.Lys19_Asp21del) rs796065033
NM_000434.4(NEU1):c.649G>A (p.Val217Met) rs28940583
NM_000434.4(NEU1):c.779T>A (p.Phe260Tyr) rs104893977
NM_000434.4(NEU1):c.893C>T (p.Ala298Val) rs104893981
NM_000435.3(NOTCH3):c.3058G>C (p.Ala1020Pro) rs35769976
NM_000435.3(NOTCH3):c.397C>T (p.Arg133Cys) rs137852642
NM_000435.3(NOTCH3):c.505C>T (p.Arg169Cys) rs28933696
NM_000439.5(PCSK1):c.661A>G (p.Asn221Asp) rs6232
NM_000441.1(SLC26A4):c.578C>T rs111033348
NM_000441.2(SLC26A4):c.-103T>C rs60284988
NM_000441.2(SLC26A4):c.1001+1G>A rs80338849
NM_000441.2(SLC26A4):c.1003T>C (p.Phe335Leu) rs111033212
NM_000441.2(SLC26A4):c.1105A>G (p.Lys369Glu) rs121908361
NM_000441.2(SLC26A4):c.1115C>T (p.Ala372Val) rs121908364
NM_000441.2(SLC26A4):c.1151A>G (p.Glu384Gly) rs111033244
NM_000441.2(SLC26A4):c.1246A>C (p.Thr416Pro) rs28939086
NM_000441.2(SLC26A4):c.1334T>G (p.Leu445Trp) rs111033307
NM_000441.2(SLC26A4):c.1588T>C (p.Tyr530His) rs111033254
NM_000441.2(SLC26A4):c.2162C>T (p.Thr721Met) rs121908363
NM_000441.2(SLC26A4):c.2168A>G (p.His723Arg) rs121908362
NM_000441.2(SLC26A4):c.279del (p.Ser93fs) rs786204421
NM_000441.2(SLC26A4):c.397T>A (p.Ser133Thr) rs121908365
NM_000441.2(SLC26A4):c.707T>C (p.Leu236Pro) rs80338848
NM_000441.2(SLC26A4):c.85G>C (p.Glu29Gln) rs111033205
NM_000441.2(SLC26A4):c.919-2A>G rs111033313
NM_000443.4(ABCB4):c.959C>T (p.Ser320Phe) rs72552778
NM_000445.5(PLEC):c.2668_2676CAGGAGGCC[1] (p.890_892QEA[1]) rs786205252
NM_000445.5(PLEC):c.5998C>T (p.Arg2000Trp) rs80338756
NM_000446.7(PON1):c.163T>A (p.Leu55Met) rs854560
NM_000446.7(PON1):c.575A>G (p.Gln192Arg) rs662
NM_000447.3(PSEN2):c.1316A>C (p.Asp439Ala) rs63750110
NM_000447.3(PSEN2):c.364A>C (p.Thr122Pro) rs63749851
NM_000447.3(PSEN2):c.389C>T (p.Ser130Leu) rs63750197
NM_000447.3(PSEN2):c.422A>T (p.Asn141Ile) rs63750215
NM_000447.3(PSEN2):c.717G>A (p.Met239Ile) rs63749884
NM_000448.2(RAG1):c.1566G>T (p.Trp522Cys) rs193922461
NM_000448.2(RAG1):c.2326C>T (p.Arg776Trp) rs121918572
NM_000448.2(RAG1):c.2923C>T (p.Arg975Trp) rs121918570
NM_000449.3(RFX5):c.446G>A (p.Arg149Gln) rs137853099
NM_000454.4(SOD1):c.115C>G (p.Leu39Val) rs121912432
NM_000454.4(SOD1):c.272A>C (p.Asp91Ala) rs80265967
NM_000454.4(SOD1):c.289G>A (p.Asp97Asn) rs121912459
NM_000454.4(SOD1):c.335dup (p.Cys112fs) rs1568810771
NM_000455.4(STK11):c.1062C>G (p.Phe354Leu) rs59912467
NM_000455.4(STK11):c.200T>C (p.Leu67Pro) rs137853077
NM_000455.4(STK11):c.508C>T (p.Gln170Ter) rs121913323
NM_000455.4(STK11):c.580G>T (p.Asp194Tyr) rs121913315
NM_000455.4(STK11):c.717G>C (p.Trp239Cys) rs137853082
NM_000458.4(HNF1B):c.494G>A (p.Arg165His) rs121918675
NM_000459.4(TEK):c.2545C>T (p.Arg849Trp) rs80338908
NM_000459.4(TEK):c.2690A>C (p.Tyr897Ser) rs80338909
NM_000465.4(BARD1):c.1670G>C (p.Cys557Ser) rs28997576
NM_000466.3(PEX1):c.1991T>C (p.Leu664Pro) rs121434455
NM_000466.3(PEX1):c.2114T>G (p.Leu705Trp) rs863225084
NM_000477.7(ALB):c.725G>A (p.Arg242His) rs75002628
NM_000478.6(ALPL):c.1001G>A (p.Gly334Asp) rs121918009
NM_000478.6(ALPL):c.1250A>G (p.Asn417Ser) rs121918014
NM_000478.6(ALPL):c.211C>T (p.Arg71Cys) rs121918001
NM_000478.6(ALPL):c.346G>A (p.Ala116Thr) rs121918013
NM_000478.6(ALPL):c.485G>T (p.Gly162Val) rs121918012
NM_000478.6(ALPL):c.526G>A (p.Ala176Thr) rs121918019
NM_000478.6(ALPL):c.535G>A (p.Ala179Thr) rs121918000
NM_000478.6(ALPL):c.571G>A (p.Glu191Lys) rs121918007
NM_000478.6(ALPL):c.746G>T (p.Gly249Val) rs121918018
NM_000478.6(ALPL):c.979T>C (p.Phe327Leu) rs121918010
NM_000480.3(AMPD3):c.1744C>T (p.Arg582Cys) rs3741040
NM_000481.3(AMT):c.125A>G (p.His42Arg) rs121964983
NM_000481.3(AMT):c.139G>A (p.Gly47Arg) rs121964982
NM_000481.3(AMT):c.350C>T (p.Ser117Leu) rs769468125
NM_000481.3(AMT):c.574C>T (p.Gln192Ter) rs121964986
NM_000481.3(AMT):c.826G>C (p.Asp276His) rs121964984
NM_000481.3(AMT):c.878-1G>A rs181134220
NM_000481.3(AMT):c.959G>A (p.Arg320His) rs121964985
NM_000483.5(APOC2):c.178G>A (p.Glu60Lys) rs5122
NM_000483.5(APOC2):c.229A>C (p.Lys77Gln) rs5126
NM_000484.4(APP):c.1995G>C (p.Glu665Asp) rs63750363
NM_000484.4(APP):c.2010_2011inv (p.Lys670_Met671delinsAsnLeu) rs281865161
NM_000484.4(APP):c.2075C>G (p.Ala692Gly) rs63750671
NM_000484.4(APP):c.2078A>G (p.Glu693Gly) rs63751039
NM_000484.4(APP):c.2124C>T (p.Gly708=) rs148888161
NM_000484.4(APP):c.2137G>A (p.Ala713Thr) rs63750066
NM_000484.4(APP):c.2143G>A (p.Val715Met) rs63750734
NM_000484.4(APP):c.2149G>A (p.Val717Ile) rs63750264
NM_000486.5(AQP2):c.190G>A (p.Gly64Arg) rs104894326
NM_000486.5(AQP2):c.785C>T (p.Pro262Leu) rs104894339
NM_000487.6(ARSA):c.*96A>G rs6151429
NM_000487.6(ARSA):c.1010A>T (p.Asp337Val) rs74315475
NM_000487.6(ARSA):c.1055A>G (p.Asn352Ser) rs2071421
NM_000487.6(ARSA):c.1114C>T (p.Arg372Trp) rs74315476
NM_000487.6(ARSA):c.1115G>A (p.Arg372Gln) rs74315477
NM_000487.6(ARSA):c.1150G>A (p.Glu384Lys) rs74315479
NM_000487.6(ARSA):c.1174C>T (p.Arg392Trp) rs74315480
NM_000487.6(ARSA):c.1210+1G>A rs80338820
NM_000487.6(ARSA):c.1232C>T (p.Thr411Ile) rs74315481
NM_000487.6(ARSA):c.1283C>T (p.Pro428Leu) rs28940893
NM_000487.6(ARSA):c.257G>A (p.Arg86Gln) rs74315458
NM_000487.6(ARSA):c.293C>T (p.Ser98Phe) rs74315456
NM_000487.6(ARSA):c.302G>A (p.Gly101Asp) rs74315455
NM_000487.6(ARSA):c.370G>A (p.Gly124Ser) rs74315461
NM_000487.6(ARSA):c.413C>T (p.Pro138Leu) rs74315462
NM_000487.6(ARSA):c.465+1G>A rs80338815
NM_000487.6(ARSA):c.511G>A (p.Asp171Asn) rs74315466
NM_000487.6(ARSA):c.542T>G (p.Ile181Ser) rs74315457
NM_000487.6(ARSA):c.641C>T (p.Ala214Val) rs74315467
NM_000487.6(ARSA):c.677C>T (p.Ala226Val) rs74315468
NM_000487.6(ARSA):c.736C>T (p.Arg246Cys) rs74315470
NM_000487.6(ARSA):c.739G>A (p.Gly247Arg) rs74315471
NM_000487.6(ARSA):c.763G>A (p.Glu255Lys) rs74315483
NM_000487.6(ARSA):c.827C>T (p.Thr276Met) rs74315472
NM_000487.6(ARSA):c.868C>T (p.Arg290Cys) rs74315473
NM_000487.6(ARSA):c.931G>A (p.Gly311Ser) rs74315459
NM_000488.3(SERPINC1):c.1246G>T (p.Ala416Ser) rs121909548
NM_000488.3(SERPINC1):c.1256C>T (p.Ala419Val) rs121909568
NM_000488.3(SERPINC1):c.166C>T (p.Arg56Cys) rs28929469
NM_000488.3(SERPINC1):c.218C>T (p.Pro73Leu) rs121909551
NM_000488.3(SERPINC1):c.235C>T (p.Arg79Cys) rs121909547
NM_000488.3(SERPINC1):c.236G>A (p.Arg79His) rs121909552
NM_000488.3(SERPINC1):c.391C>T (p.Leu131Phe) rs121909567
NM_000488.3(SERPINC1):c.482G>A (p.Arg161Gln) rs121909563
NM_000488.3(SERPINC1):c.89T>A (p.Val30Glu) rs2227624
NM_000489.5(ATRX):c.109C>T (p.Arg37Ter) rs122445108
NM_000489.5(ATRX):c.5579A>G (p.Asn1860Ser) rs45439799
NM_000489.5(ATRX):c.568C>G (p.Pro190Ala) rs122445103
NM_000489.5(ATRX):c.6149T>C (p.Ile2050Thr) rs122445110
NM_000492.3(CFTR):c.1040G>A (p.Arg347His) rs77932196
NM_000492.3(CFTR):c.1040G>T (p.Arg347Leu) rs77932196
NM_000492.3(CFTR):c.1046C>T (p.Ala349Val) rs121909021
NM_000492.3(CFTR):c.1055G>A (p.Arg352Gln) rs121908753
NM_000492.3(CFTR):c.1210-12T[5] rs1805177
NM_000492.3(CFTR):c.1364C>A (p.Ala455Glu) rs74551128
NM_000492.3(CFTR):c.1408G>A (p.Val470Met) rs213950
NM_000492.3(CFTR):c.1438G>T (p.Gly480Cys) rs79282516
NM_000492.3(CFTR):c.1475C>T (p.Ser492Phe) rs121909017
NM_000492.3(CFTR):c.1516A>G (p.Ile506Val) rs1800091
NM_000492.3(CFTR):c.1521_1523delCTT (p.Phe508delPhe) rs113993960
NM_000492.3(CFTR):c.1523T>G (p.Phe508Cys) rs74571530
NM_000492.3(CFTR):c.1572C>A (p.Cys524Ter) rs121908754
NM_000492.3(CFTR):c.1601C>A (p.Ala534Glu) rs387906368
NM_000492.3(CFTR):c.1624G>T (p.Gly542Ter) rs113993959
NM_000492.3(CFTR):c.1645A>C (p.Ser549Arg) rs121908757
NM_000492.3(CFTR):c.1646G>A (p.Ser549Asn) rs121908755
NM_000492.3(CFTR):c.1651G>A (p.Gly551Ser) rs121909013
NM_000492.3(CFTR):c.1652G>A (p.Gly551Asp) rs75527207
NM_000492.3(CFTR):c.1658G>A (p.Arg553Gln) rs121909044
NM_000492.3(CFTR):c.1666A>G (p.Ile556Val) rs75789129
NM_000492.3(CFTR):c.1679G>A (p.Arg560Lys) rs80055610
NM_000492.3(CFTR):c.1682C>A (p.Ala561Glu) rs121909047
NM_000492.3(CFTR):c.171G>A (p.Trp57Ter) rs121909025
NM_000492.3(CFTR):c.1721C>A (p.Pro574His) rs121908758
NM_000492.3(CFTR):c.1727G>C (p.Gly576Ala) rs1800098
NM_000492.3(CFTR):c.1820_1903del (p.Met607_Gln634del) rs121908777
NM_000492.3(CFTR):c.2551C>T (p.Arg851Ter) rs121909012
NM_000492.3(CFTR):c.2735C>T (p.Ser912Leu) rs121909034
NM_000492.3(CFTR):c.2738A>G (p.Tyr913Cys) rs121909008
NM_000492.3(CFTR):c.2991G>C (p.Leu997Phe) rs1800111
NM_000492.3(CFTR):c.3199G>A (p.Ala1067Thr) rs121909020
NM_000492.3(CFTR):c.3254A>G (p.His1085Arg) rs79635528
NM_000492.3(CFTR):c.328G>C (p.Asp110His) rs113993958
NM_000492.3(CFTR):c.3469-20T>C rs373002889
NM_000492.3(CFTR):c.350G>A (p.Arg117His) rs78655421
NM_000492.3(CFTR):c.3659C>T (p.Thr1220Ile) rs1800123
NM_000492.3(CFTR):c.3712C>T (p.Gln1238Ter) rs121908766
NM_000492.3(CFTR):c.3717+4A>G rs387906362
NM_000492.3(CFTR):c.3746G>A (p.Gly1249Glu) rs121909040
NM_000492.3(CFTR):c.3752G>A (p.Ser1251Asn) rs74503330
NM_000492.3(CFTR):c.3763T>C (p.Ser1255Pro) rs121909041
NM_000492.3(CFTR):c.3808G>A (p.Asp1270Asn) rs11971167
NM_000492.3(CFTR):c.3846G>A (p.Trp1282Ter) rs77010898
NM_000492.3(CFTR):c.3873G>C (p.Gln1291His) rs121909015
NM_000492.3(CFTR):c.4056G>C (p.Gln1352His) rs113857788
NM_000492.3(CFTR):c.4364C>G (p.Ser1455Ter) rs121909043
NM_000492.3(CFTR):c.617T>G (p.Leu206Trp) rs121908752
NM_000492.3(CFTR):c.650A>G (p.Glu217Gly) rs121909046
NM_000493.4(COL10A1):c.2011T>C (p.Ser671Pro) rs111033552
NM_000494.4(COL17A1):c.2336-2A>G rs1478395810
NM_000495.5(COL4A5):c.161G>A (p.Gly54Asp) rs104886043
NM_000495.5(COL4A5):c.4613G>C (p.Trp1538Ser) rs104886293
NM_000495.5(COL4A5):c.5030G>A (p.Arg1677Gln) rs104886308
NM_000496.3(CRYBB2):c.463C>T (p.Gln155Ter) rs74315489
NM_000497.3(CYP11B1):c.1269T>G (p.Tyr423Ter) rs267606755
NM_000497.3(CYP11B1):c.1343G>A (p.Arg448His) rs28934586
NM_000497.3(CYP11B1):c.281C>T (p.Pro94Leu) rs104894070
NM_000498.3(CYP11B2):c.554C>T (p.Thr185Ile) rs121912978
NM_000500.7(CYP21A2):c.332_339delGAGACTAC (p.Gly111Valfs) rs387906510
NM_000500.7(CYP21A2):c.955C>T (p.Gln319Ter) rs7755898
NM_000500.9(CYP21A2):c.1069C>T (p.Arg357Trp) rs7769409
NM_000500.9(CYP21A2):c.1360C>T (p.Pro454Ser) rs6445
NM_000500.9(CYP21A2):c.17_19TGC[6] (p.Leu10dup) rs61338903
NM_000500.9(CYP21A2):c.188A>T (p.His63Leu) rs9378252
NM_000500.9(CYP21A2):c.293-13C>G rs6467
NM_000500.9(CYP21A2):c.518T>A (p.Ile173Asn) rs6475
NM_000500.9(CYP21A2):c.806G>C (p.Ser269Thr) rs6472
NM_000500.9(CYP21A2):c.844G>T (p.Val282Leu) rs6471
NM_000500.9(CYP21A2):c.92C>T (p.Pro31Leu) rs9378251
NM_000503.6(EYA1):c.1276G>A (p.Gly426Ser) rs121909199
NM_000504.4(F10):c.424G>A (p.Glu142Lys) rs61753266
NM_000505.3(F12):c.158A>G (p.Tyr53Cys) rs118204455
NM_000505.3(F12):c.1681-1G>A rs199988476
NM_000506.3(F2):c.598G>A (p.Glu200Lys) rs62623459
NM_000506.4(F2):c.*97G>A rs1799963
NM_000506.4(F2):c.1787G>T (p.Arg596Leu) rs387907201
NM_000508.3(FGA):c.112A>G (p.Arg38Gly) rs121909608
NM_000510.3(FSHB):c.236_237del (p.Val79fs) rs5030646
NM_000511.6(FUT2):c.461G>A (p.Trp154Ter) rs601338
NM_000512.5(GALNS):c.1156C>T (p.Arg386Cys) rs118204437
NM_000512.5(GALNS):c.337A>T (p.Ile113Phe) rs118204438
NM_000512.5(GALNS):c.935C>G (p.Thr312Ser) rs118204446
NM_000514.4(GDNF):c.277C>T (p.Arg93Trp) rs36119840
NM_000514.4(GDNF):c.448G>A (p.Asp150Asn) rs76466003
NM_000517.4(HBA2):c.142G>C (p.Asp48His) rs281864834
NM_000517.4(HBA2):c.427T>A (p.Ter143Lys) rs41464951
NM_000517.4(HBA2):c.427T>C (p.Ter143Gln) rs41464951
NM_000517.4(HBA2):c.427T>G (p.Ter143Glu) rs41464951
NM_000517.4(HBA2):c.49A>G (p.Lys17Glu) rs281865555
NM_000517.6(HBA2):c.122A>T (p.Lys41Met) rs281864828
NM_000517.6(HBA2):c.146T>G (p.Leu49Arg) rs41392146
NM_000517.6(HBA2):c.178G>C (p.Gly60Arg) rs41328049
NM_000517.6(HBA2):c.186G>C (p.Lys62Asn) rs33985574
NM_000517.6(HBA2):c.257A>T (p.Asp86Val) rs41331747
NM_000517.6(HBA2):c.266C>T (p.Ala89Val) rs33983416
NM_000517.6(HBA2):c.301-1G>A rs587776827
NM_000517.6(HBA2):c.314G>A (p.Cys105Tyr) rs41417548
NM_000517.6(HBA2):c.377T>C (p.Leu126Pro) rs41397847
NM_000517.6(HBA2):c.377T>G (p.Leu126Arg) rs41397847
NM_000517.6(HBA2):c.379G>A (p.Asp127Asn) rs33933481
NM_000517.6(HBA2):c.391G>C (p.Ala131Pro) rs41529844
NM_000517.6(HBA2):c.418A>G (p.Lys140Glu) rs41361546
NM_000517.6(HBA2):c.420del (p.Lys140fs) rs63750520
NM_000517.6(HBA2):c.428A>C (p.Ter143Ser) rs41321345
NM_000517.6(HBA2):c.69C>T (p.Gly23=) rs63751457
NM_000517.6(HBA2):c.70G>T (p.Glu24Ter) rs281864819
NM_000517.6(HBA2):c.89T>C (p.Leu30Pro) rs41341344
NM_000518.4(HBB):c.125T>C (p.Phe42Ser) rs33926796
NM_000518.4(HBB):c.126_129delCTTT (p.Phe42fs) rs80356821
NM_000518.4(HBB):c.137T>C (p.Phe46Ser) rs33978338
NM_000518.4(HBB):c.157G>A (p.Asp53Asn) rs33961886
NM_000518.4(HBB):c.157G>C (p.Asp53His) rs33961886
NM_000518.4(HBB):c.182T>A (p.Val61Glu) rs33931779
NM_000518.4(HBB):c.184A>G (p.Lys62Glu) rs33995148
NM_000518.4(HBB):c.19G>A (p.Glu7Lys) rs33930165
NM_000518.4(HBB):c.203T>A (p.Val68Glu) rs33918343
NM_000518.4(HBB):c.206T>A (p.Leu69His) rs33972593
NM_000518.4(HBB):c.208G>A (p.Gly70Ser) rs33947415
NM_000518.4(HBB):c.220G>A (p.Asp74Asn) rs33945705
NM_000518.4(HBB):c.232C>G (p.His78Asp) rs33991294
NM_000518.4(HBB):c.238G>A (p.Asp80Asn) rs33990858
NM_000518.4(HBB):c.238G>C (p.Asp80His) rs33990858
NM_000518.4(HBB):c.238G>T (p.Asp80Tyr) rs33990858
NM_000518.4(HBB):c.23A>G (p.Glu8Gly) rs34387455
NM_000518.4(HBB):c.248A>C (p.Lys83Thr) rs33987903
NM_000518.4(HBB):c.248A>T (p.Lys83Met) rs33987903
NM_000518.4(HBB):c.263C>A (p.Thr88Lys) rs33993568
NM_000518.4(HBB):c.266T>C (p.Leu89Pro) rs33940204
NM_000518.4(HBB):c.269G>A (p.Ser90Asn) rs33917628
NM_000518.4(HBB):c.271G>A (p.Glu91Lys) rs33913712
NM_000518.4(HBB):c.275T>C (p.Leu92Pro) rs33917785
NM_000518.4(HBB):c.277C>T (p.His93Tyr) rs33924775
NM_000518.4(HBB):c.283G>A (p.Asp95Asn) rs33959340
NM_000518.4(HBB):c.283G>C (p.Asp95His) rs33959340
NM_000518.4(HBB):c.293A>T (p.His98Leu) rs33951978
NM_000518.4(HBB):c.298G>A (p.Asp100Asn) rs33954595
NM_000518.4(HBB):c.298G>C (p.Asp100His) rs33954595
NM_000518.4(HBB):c.298G>T (p.Asp100Tyr) rs33954595
NM_000518.4(HBB):c.299A>C (p.Asp100Ala) rs33971048
NM_000518.4(HBB):c.299A>G (p.Asp100Gly) rs33971048
NM_000518.4(HBB):c.299A>T (p.Asp100Val) rs33971048
NM_000518.4(HBB):c.29C>G (p.Ser10Cys) rs33918131
NM_000518.4(HBB):c.302C>T (p.Pro101Leu) rs33965000
NM_000518.4(HBB):c.304G>A (p.Glu102Lys) rs33966487
NM_000518.4(HBB):c.320T>G (p.Leu107Arg) rs33941844
NM_000518.4(HBB):c.332T>C (p.Leu111Pro) rs35256489
NM_000518.4(HBB):c.34G>A (p.Val12Ile) rs33974228
NM_000518.4(HBB):c.34G>T (p.Val12Phe) rs33974228
NM_000518.4(HBB):c.364G>A (p.Glu122Lys) rs33946267
NM_000518.4(HBB):c.364G>C (p.Glu122Gln) rs33946267
NM_000518.4(HBB):c.371C>T (p.Thr124Ile) rs33935383
NM_000518.4(HBB):c.374C>A (p.Pro125Gln) rs33983276
NM_000518.4(HBB):c.374C>G (p.Pro125Arg) rs33983276
NM_000518.4(HBB):c.374C>T (p.Pro125Leu) rs33983276
NM_000518.4(HBB):c.404T>C (p.Val135Ala) rs33966761
NM_000518.4(HBB):c.410G>A (p.Gly137Asp) rs33949486
NM_000518.4(HBB):c.422C>A (p.Ala141Asp) rs33927093
NM_000518.4(HBB):c.428C>A (p.Ala143Asp) rs33921821
NM_000518.4(HBB):c.439C>G (p.His147Asp) rs33961444
NM_000518.4(HBB):c.440A>C (p.His147Pro) rs33954264
NM_000518.4(HBB):c.440A>T (p.His147Leu) rs33954264
NM_000518.4(HBB):c.44T>C (p.Leu15Pro) rs33935445
NM_000518.4(HBB):c.44T>G (p.Leu15Arg) rs33935445
NM_000518.4(HBB):c.64G>T (p.Asp22Tyr) rs33950093
NM_000518.4(HBB):c.67G>A (p.Glu23Lys) rs33959855
NM_000518.4(HBB):c.67G>C (p.Glu23Gln) rs33959855
NM_000518.4(HBB):c.68A>C (p.Glu23Ala) rs33936254
NM_000518.4(HBB):c.68A>G (p.Glu23Gly) rs33936254
NM_000518.4(HBB):c.68A>T (p.Glu23Val) rs33936254
NM_000518.4(HBB):c.70G>T (p.Val24Phe) rs33929459
NM_000518.4(HBB):c.71T>A (p.Val24Asp) rs33945546
NM_000518.4(HBB):c.86T>A (p.Leu29Gln) rs33916412
NM_000518.5(HBB):c.*110T>C rs33978907
NM_000518.5(HBB):c.*111A>G rs63751128
NM_000518.5(HBB):c.*113A>G rs33985472
NM_000518.5(HBB):c.-137C>G rs33941377
NM_000518.5(HBB):c.-138C>T rs33944208
NM_000518.5(HBB):c.-140C>T rs34999973
NM_000518.5(HBB):c.-142C>T rs34883338
NM_000518.5(HBB):c.-78A>G rs33931746
NM_000518.5(HBB):c.-80T>A rs33980857
NM_000518.5(HBB):c.100G>A (p.Val34Met) rs1141370
NM_000518.5(HBB):c.114G>A (p.Trp38Ter) rs33974936
NM_000518.5(HBB):c.122G>A (p.Arg41Lys) rs34831026
NM_000518.5(HBB):c.128T>C (p.Phe43Ser) rs34378160
NM_000518.5(HBB):c.131A>C (p.Glu44Ala) rs35262412
NM_000518.5(HBB):c.16C>T (p.Pro6Ser) rs33912272
NM_000518.5(HBB):c.170G>A (p.Gly57Asp) rs34439278
NM_000518.5(HBB):c.174C>A (p.Asn58Lys) rs35278874
NM_000518.5(HBB):c.179A>C (p.Lys60Thr) rs35537181
NM_000518.5(HBB):c.180G>C (p.Lys60Asn) rs34621955
NM_000518.5(HBB):c.186G>C (p.Lys62Asn) rs34446260
NM_000518.5(HBB):c.190C>T (p.His64Tyr) rs33922873
NM_000518.5(HBB):c.199A>G (p.Lys67Glu) rs34165323
NM_000518.5(HBB):c.200A>C (p.Lys67Thr) rs35939489
NM_000518.5(HBB):c.209G>A (p.Gly70Asp) rs34718174
NM_000518.5(HBB):c.20A>T (p.Glu7Val) rs334
NM_000518.5(HBB):c.217dup (p.Ser73fs) rs33969853
NM_000518.5(HBB):c.230del (p.Ala77fs) rs281864901
NM_000518.5(HBB):c.249G>Y (p.Lys83Asn) rs33991993
NM_000518.5(HBB):c.250G>T (p.Gly84Cys) rs33930385
NM_000518.5(HBB):c.251G>A (p.Gly84Asp) rs1803195
NM_000518.5(HBB):c.253A>G (p.Thr85Ala) rs35960772
NM_000518.5(HBB):c.262A>C (p.Thr88Pro) rs35553496
NM_000518.5(HBB):c.268A>C (p.Ser90Arg) rs35351128
NM_000518.5(HBB):c.286A>G (p.Lys96Glu) rs33914359
NM_000518.5(HBB):c.294C>R (p.His98Gln) rs34515413
NM_000518.5(HBB):c.2T>C (p.Met1Thr) rs33941849
NM_000518.5(HBB):c.305A>G (p.Glu102Gly) rs33937393
NM_000518.5(HBB):c.306G>C (p.Glu102Asp) rs35209591
NM_000518.5(HBB):c.312C>G (p.Phe104Leu) rs35067717
NM_000518.5(HBB):c.314G>C (p.Arg105Thr) rs33911434
NM_000518.5(HBB):c.315G>C (p.Arg105Ser) rs33914944
NM_000518.5(HBB):c.316-3C>A rs33913413
NM_000518.5(HBB):c.316-3C>G rs33913413
NM_000518.5(HBB):c.316C>T (p.Leu106Phe) rs34022507
NM_000518.5(HBB):c.328G>A (p.Val110Met) rs33969677
NM_000518.5(HBB):c.337T>C (p.Cys113Arg) rs35849199
NM_000518.5(HBB):c.344T>C (p.Leu115Pro) rs36015961
NM_000518.5(HBB):c.363A>C (p.Lys121Asn) rs34726542
NM_000518.5(HBB):c.380T>A (p.Val127Glu) rs33925391
NM_000518.5(HBB):c.380T>C (p.Val127Ala) rs33925391
NM_000518.5(HBB):c.380T>G (p.Val127Gly) rs33925391
NM_000518.5(HBB):c.389C>T (p.Ala130Val) rs111645889
NM_000518.5(HBB):c.394C>A (p.Gln132Lys) rs33910209
NM_000518.5(HBB):c.397A>C (p.Lys133Gln) rs33953406
NM_000518.5(HBB):c.421G>A (p.Ala141Thr) rs34980264
NM_000518.5(HBB):c.431A>C (p.His144Pro) rs33918338
NM_000518.5(HBB):c.431A>G (p.His144Arg) rs33918338
NM_000518.5(HBB):c.435G>C (p.Lys145Asn) rs35020585
NM_000518.5(HBB):c.436T>C (p.Tyr146His) rs33949869
NM_000518.5(HBB):c.437A>G (p.Tyr146Cys) rs35117167
NM_000518.5(HBB):c.438T>A (p.Tyr146Ter) rs35291591
NM_000518.5(HBB):c.440_441dup (p.Ter148ThrextTer?) rs33999427
NM_000518.5(HBB):c.4G>A (p.Val2Met) rs33958358
NM_000518.5(HBB):c.50G>A (p.Gly17Asp) rs33962676
NM_000518.5(HBB):c.59A>G (p.Asn20Ser) rs33972047
NM_000518.5(HBB):c.5T>C (p.Val2Ala) rs33949930
NM_000518.5(HBB):c.61G>A (p.Val21Met) rs35890959
NM_000518.5(HBB):c.75T>A (p.Gly25=) rs33951465
NM_000518.5(HBB):c.79G>A (p.Glu27Lys) rs33950507
NM_000518.5(HBB):c.82G>T (p.Ala28Ser) rs35424040
NM_000518.5(HBB):c.85dup (p.Leu29fs) rs35532010
NM_000518.5(HBB):c.92+1G>T rs33971440
NM_000518.5(HBB):c.92+5G>A rs33915217
NM_000518.5(HBB):c.93-15T>G rs35456885
NM_000518.5(HBB):c.93G>T (p.Arg31Ser) rs1135071
NM_000519.4(HBD):c.226C>G (p.Leu76Val) rs34430836
NM_000519.4(HBD):c.82G>T (p.Ala28Ser) rs35152987
NM_000520.5(HEXA):c.-207-2357_253+5128delinsG
NM_000520.5(HEXA):c.1177C>T (p.Arg393Ter) rs121907963
NM_000520.5(HEXA):c.1453T>C (p.Trp485Arg) rs121907968
NM_000520.5(HEXA):c.1496G>A (p.Arg499His) rs121907956
NM_000520.5(HEXA):c.739C>T (p.Arg247Trp) rs121907970
NM_000520.5(HEXA):c.902T>G (p.Met301Arg) rs121907977
NM_000520.5(HEXA):c.915_917del (p.Phe305del) rs121907960
NM_000520.6(HEXA):c.1351C>G (p.Leu451Val) rs28940871
NM_000520.6(HEXA):c.1444G>A (p.Glu482Lys) rs121907952
NM_000520.6(HEXA):c.1495C>T (p.Arg499Cys) rs121907966
NM_000520.6(HEXA):c.1510C>T (p.Arg504Cys) rs28942071
NM_000520.6(HEXA):c.346+1G>C rs797044432
NM_000520.6(HEXA):c.508C>T (p.Arg170Trp) rs121907972
NM_000520.6(HEXA):c.509G>A (p.Arg170Gln) rs121907957
NM_000520.6(HEXA):c.590A>C (p.Lys197Thr) rs121907973
NM_000520.6(HEXA):c.611A>G (p.His204Arg) rs121907976
NM_000520.6(HEXA):c.672+1G>A rs387906311
NM_000520.6(HEXA):c.805+1G>A rs121907980
NM_000520.6(HEXA):c.806-7G>A rs770932296
NM_000521.3(HEXB):c.185C>T (p.Ser62Leu) rs820878
NM_000521.4(HEXB):c.1367A>C (p.Tyr456Ser) rs121907982
NM_000521.4(HEXB):c.1514G>A (p.Arg505Gln) rs121907983
NM_000521.4(HEXB):c.1627G>A (p.Ala543Thr) rs121907984
NM_000521.4(HEXB):c.362A>G (p.Lys121Arg) rs11556045
NM_000521.4(HEXB):c.619A>G (p.Ile207Val) rs10805890
NM_000523.4(HOXD13):c.32G>C (p.Gly11Ala) rs536639583
NM_000525.3(KCNJ11):c.124T>C (p.Cys42Arg) rs80356610
NM_000525.3(KCNJ11):c.149G>C (p.Arg50Pro) rs80356611
NM_000525.3(KCNJ11):c.157G>A (p.Gly53Ser) rs80356613
NM_000525.3(KCNJ11):c.157G>C (p.Gly53Arg) rs80356613
NM_000525.3(KCNJ11):c.158G>A (p.Gly53Asp) rs80356615
NM_000525.3(KCNJ11):c.175G>A (p.Val59Met) rs80356616
NM_000525.3(KCNJ11):c.176T>G (p.Val59Gly) rs80356617
NM_000525.3(KCNJ11):c.497G>T (p.Cys166Phe) rs80356618
NM_000525.3(KCNJ11):c.499A>C (p.Ile167Leu) rs80356620
NM_000525.3(KCNJ11):c.509A>G (p.Lys170Arg) rs80356621
NM_000525.3(KCNJ11):c.510G>C (p.Lys170Asn) rs80356622
NM_000525.3(KCNJ11):c.601C>T (p.Arg201Cys) rs80356625
NM_000525.3(KCNJ11):c.602G>A (p.Arg201His) rs80356624
NM_000525.3(KCNJ11):c.67A>G (p.Lys23Glu) rs5219
NM_000525.3(KCNJ11):c.844G>A (p.Glu282Lys) rs267607196
NM_000525.3(KCNJ11):c.902G>A (p.Arg301His) rs74339576
NM_000526.5(KRT14):c.356T>C (p.Met119Thr) rs28928893
NM_000526.5(KRT14):c.368A>G (p.Asn123Ser) rs60171927
NM_000526.5(KRT14):c.373C>T (p.Arg125Cys) rs60399023
NM_000526.5(KRT14):c.374G>A (p.Arg125His) rs58330629
NM_000527.4(LDLR):c.-138delT rs387906307
NM_000527.4(LDLR):c.1202T>A (p.Leu401His) rs121908038
NM_000527.4(LDLR):c.1285G>A (p.Val429Met) rs28942078
NM_000527.4(LDLR):c.1291G>A (p.Ala431Thr) rs28942079
NM_000527.4(LDLR):c.1297G>C (p.Asp433His) rs121908036
NM_000527.4(LDLR):c.131G>A (p.Trp44Ter) rs267607213
NM_000527.4(LDLR):c.137G>C (p.Cys46Ser) rs121908041
NM_000527.4(LDLR):c.139_144del (p.Asp47_Gly48del) rs387906301
NM_000527.4(LDLR):c.1567G>A (p.Val523Met) rs28942080
NM_000527.4(LDLR):c.1637G>A (p.Gly546Asp) rs28942081
NM_000527.4(LDLR):c.1646G>A (p.Gly549Asp) rs28941776
NM_000527.4(LDLR):c.1694G>T (p.Gly565Val) rs28942082
NM_000527.4(LDLR):c.1891_2311+1062del (p.(?))
NM_000527.4(LDLR):c.2000G>A (p.Cys667Tyr) rs28942083
NM_000527.4(LDLR):c.2043C>A (p.Cys681Ter) rs121908031
NM_000527.4(LDLR):c.2054C>T (p.Pro685Leu) rs28942084
NM_000527.4(LDLR):c.2140+1G>A rs145787161
NM_000527.4(LDLR):c.2140+86C>G rs587776886
NM_000527.4(LDLR):c.2483A>G (p.Tyr828Cys) rs28942085
NM_000527.4(LDLR):c.2531G>A (p.Gly844Asp) rs121908037
NM_000527.4(LDLR):c.259T>G (p.Trp87Gly) rs121908025
NM_000527.4(LDLR):c.313+1G>A rs112029328
NM_000527.4(LDLR):c.523G>A (p.Asp175Asn) rs121908033
NM_000527.4(LDLR):c.530C>T (p.Ser177Leu) rs121908026
NM_000527.4(LDLR):c.551G>A (p.Cys184Tyr) rs121908039
NM_000527.4(LDLR):c.564C>G (p.Tyr188Ter) rs121908034
NM_000527.4(LDLR):c.621C>T (p.Gly207=) rs121908044
NM_000527.4(LDLR):c.664_681dup18 (p.Asp227_Glu228insCysLysAspLysSerAsp) rs387906306
NM_000527.4(LDLR):c.670G>A (p.Asp224Asn) rs387906303
NM_000527.4(LDLR):c.680_681delAC (p.Asp227Glyfs) rs387906305
NM_000527.4(LDLR):c.681C>G (p.Asp227Glu) rs121908028
NM_000527.4(LDLR):c.682G>A (p.Glu228Lys) rs121908029
NM_000527.4(LDLR):c.693C>A (p.Cys231Ter) rs121908035
NM_000527.4(LDLR):c.694+2T>C rs200238879
NM_000527.4(LDLR):c.782G>T (p.Cys261Phe) rs121908040
NM_000527.4(LDLR):c.910G>A (p.Asp304Asn) rs121908030
NM_000528.4(MAN2B1):c.1067C>G (p.Pro356Arg) rs121434333
NM_000528.4(MAN2B1):c.1830+1G>C rs80338677
NM_000528.4(MAN2B1):c.215A>T (p.His72Leu) rs387906261
NM_000528.4(MAN2B1):c.2248C>T (p.Arg750Trp) rs80338680
NM_000528.4(MAN2B1):c.2278C>T (p.Arg760Ter) rs121434331
NM_000528.4(MAN2B1):c.2426T>C (p.Leu809Pro) rs80338681
NM_000530.8(MPZ):c.103G>T (p.Asp35Tyr) rs121913596
NM_000530.8(MPZ):c.131C>T (p.Ser44Phe) rs121913598
NM_000530.8(MPZ):c.186C>G (p.Ile62Met) rs121913605
NM_000530.8(MPZ):c.188C>G (p.Ser63Cys) rs121913585
NM_000530.8(MPZ):c.188_190del (p.Ser63del) rs879254109
NM_000530.8(MPZ):c.242A>G (p.His81Arg) rs121913594
NM_000530.8(MPZ):c.270C>A (p.Asp90Glu) rs121913584
NM_000530.8(MPZ):c.276G>A (p.Val92=) rs1558154193
NM_000530.8(MPZ):c.286A>G (p.Lys96Glu) rs121913583
NM_000530.8(MPZ):c.293G>A (p.Arg98His) rs121913589
NM_000530.8(MPZ):c.293G>C (p.Arg98Pro) rs121913589
NM_000530.8(MPZ):c.308G>A (p.Gly103Glu) rs121913600
NM_000530.8(MPZ):c.313C>A (p.Pro105Thr) rs121913609
NM_000530.8(MPZ):c.367G>A (p.Gly123Ser) rs121913608
NM_000530.8(MPZ):c.371C>T (p.Thr124Met) rs121913595
NM_000530.8(MPZ):c.409G>A (p.Gly137Ser) rs121913588
NM_000530.8(MPZ):c.499G>C (p.Gly167Arg) rs121913586
NM_000530.8(MPZ):c.584+2T>G rs879254054
NM_000531.6(OTC):c.118C>T (p.Arg40Cys) rs72554307
NM_000531.6(OTC):c.137A>G (p.Lys46Arg) rs1800321
NM_000531.6(OTC):c.674C>T (p.Pro225Leu) rs67120076
NM_000532.5(PCCB):c.1228C>T (p.Arg410Trp) rs121964959
NM_000532.5(PCCB):c.1283C>T (p.Thr428Ile) rs111033542
NM_000532.5(PCCB):c.1304A>G (p.Tyr435Cys) rs121964961
NM_000532.5(PCCB):c.1538_1540dup (p.Arg514_Ile515insPro) rs202247821
NM_000532.5(PCCB):c.502G>A (p.Glu168Lys) rs121964960
NM_000533.5(PLP1):c.409C>T (p.Arg137Trp) rs132630295
NM_000533.5(PLP1):c.487T>C (p.Trp163Arg) rs132630279
NM_000535.7(PMS2):c.1144+2T>A rs267608158
NM_000535.7(PMS2):c.137G>T (p.Ser46Ile) rs121434629
NM_000535.7(PMS2):c.1731_1732delinsAGT (p.Arg578fs) rs1057515572
NM_000535.7(PMS2):c.2002A>G (p.Ile668Val) rs869320619
NM_000535.7(PMS2):c.2184_2185TC[1] (p.Leu729fs) rs587779335
NM_000536.4(RAG2):c.115A>G (p.Arg39Gly) rs121917897
NM_000536.4(RAG2):c.123C>G (p.Cys41Trp) rs121917895
NM_000536.4(RAG2):c.1352G>C (p.Gly451Ala) rs121918575
NM_000536.4(RAG2):c.1433G>A (p.Cys478Tyr) rs121918573
NM_000536.4(RAG2):c.230C>A (p.Thr77Asn) rs121918574
NM_000536.4(RAG2):c.283G>A (p.Gly95Arg) rs36001797
NM_000536.4(RAG2):c.644C>T (p.Thr215Ile) rs35691292
NM_000536.4(RAG2):c.686G>A (p.Arg229Gln) rs121917894
NM_000536.4(RAG2):c.854T>G (p.Met285Arg) rs121917896
NM_000539.3(RHO):c.1040C>G (p.Pro347Arg) rs29001566
NM_000539.3(RHO):c.1040C>T (p.Pro347Leu) rs29001566
NM_000539.3(RHO):c.158C>G (p.Pro53Arg) rs28933395
NM_000539.3(RHO):c.266G>A (p.Gly89Asp) rs104893772
NM_000539.3(RHO):c.511C>T (p.Pro171Ser) rs104893794
NM_000539.3(RHO):c.568G>T (p.Asp190Tyr) rs104893779
NM_000539.3(RHO):c.800C>T (p.Pro267Leu) rs104893781
NM_000540.2(RYR1):c.1021G>A (p.Gly341Arg) rs121918592
NM_000540.2(RYR1):c.11941C>T (p.His3981Tyr) rs148772854
NM_000540.2(RYR1):c.1209C>G (p.Ile403Met) rs118192116
NM_000540.2(RYR1):c.13909A>G (p.Thr4637Ala) rs118192166
NM_000540.2(RYR1):c.14387A>G (p.Tyr4796Cys) rs118192167
NM_000540.2(RYR1):c.14477C>T (p.Thr4826Ile) rs121918595
NM_000540.2(RYR1):c.14545G>A (p.Val4849Ile) rs118192168
NM_000540.2(RYR1):c.14582G>A (p.Arg4861His) rs63749869
NM_000540.2(RYR1):c.14693T>C (p.Ile4898Thr) rs118192170
NM_000540.2(RYR1):c.1565A>C (p.Tyr522Ser) rs118192162
NM_000540.2(RYR1):c.1840C>T (p.Arg614Cys) rs118192172
NM_000540.2(RYR1):c.325C>T (p.Arg109Trp) rs118192173
NM_000540.2(RYR1):c.487C>T (p.Arg163Cys) rs118192161
NM_000540.2(RYR1):c.6487C>T (p.Arg2163Cys) rs118192175
NM_000540.2(RYR1):c.6488G>A (p.Arg2163His) rs118192163
NM_000540.2(RYR1):c.6502G>A (p.Val2168Met) rs118192176
NM_000540.2(RYR1):c.6617C>T (p.Thr2206Met) rs118192177
NM_000540.2(RYR1):c.6721C>T rs200563280
NM_000540.2(RYR1):c.7300G>A (p.Gly2434Arg) rs121918593
NM_000540.2(RYR1):c.7304G>A (p.Arg2435His) rs28933396
NM_000540.2(RYR1):c.7372C>T (p.Arg2458Cys) rs28933397
NM_000540.2(RYR1):c.7373G>A (p.Arg2458His) rs121918594
NM_000540.2(RYR1):c.742G>A (p.Gly248Arg) rs1801086
NM_000540.2(RYR1):c.97A>G (p.Lys33Glu) rs193922746
NM_000543.5(SMPD1):c.1267C>T (p.His423Tyr) rs120074126
NM_000543.5(SMPD1):c.1735G>A (p.Gly579Ser) rs120074119
NM_000545.6(HNF1A):c.1720G>A (p.Gly574Ser) rs1169305
NM_000545.6(HNF1A):c.1748G>A (p.Arg583Gln) rs137853242
NM_000545.6(HNF1A):c.79A>C (p.Ile27Leu) rs1169288
NM_000545.6(HNF1A):c.827C>A (p.Ala276Asp) rs137853245
NM_000545.6(HNF1A):c.92G>A (p.Gly31Asp) rs137853247
NM_000547.5(TPO):c.1978C>G (p.Gln660Glu) rs121908088
NM_000548.5(TSC2):c.4508A>C (p.Gln1503Pro) rs45516293
NM_000548.5(TSC2):c.4639G>A (p.Val1547Ile) rs745895675
NM_000550.3(TYRP1):c.1067G>A (p.Arg356Gln) rs281865424
NM_000550.3(TYRP1):c.497C>G (p.Ser166Ter) rs104894130
NM_000551.3(VHL):c.188T>C (p.Leu63Pro) rs104893827
NM_000551.3(VHL):c.191G>C (p.Arg64Pro) rs104893826
NM_000551.3(VHL):c.241C>T (p.Pro81Ser) rs104893829
NM_000551.3(VHL):c.481C>T (p.Arg161Ter) rs5030818
NM_000551.3(VHL):c.499C>G (p.Arg167Gly) rs5030820
NM_000551.3(VHL):c.499C>T (p.Arg167Trp) rs5030820
NM_000551.3(VHL):c.500G>A (p.Arg167Gln) rs5030821
NM_000551.3(VHL):c.562C>G (p.Leu188Val) rs5030824
NM_000551.3(VHL):c.574C>T (p.Pro192Ser) rs28940300
NM_000551.3(VHL):c.598C>T (p.Arg200Trp) rs28940298
NM_000552.4(VWF):c.2372C>T (p.Thr791Met) rs61748477
NM_000552.4(VWF):c.2561G>A (p.Arg854Gln) rs41276738
NM_000552.4(VWF):c.3797C>T (p.Pro1266Leu) rs61749370
NM_000552.4(VWF):c.3916C>T (p.Arg1306Trp) rs61749384
NM_000552.4(VWF):c.3922C>T (p.Arg1308Cys) rs61749387
NM_000552.4(VWF):c.4196G>A (p.Arg1399His) rs1800382
NM_000552.4(VWF):c.4751A>G (p.Tyr1584Cys) rs1800386
NM_000552.4(VWF):c.4789C>T (p.Arg1597Trp) rs61750117
NM_000553.4(WRN):c.1105C>T (p.Arg369Ter) rs17847577
NM_000553.4(WRN):c.3139-1G>C rs113993961
NM_000554.6(CRX):c.122G>A (p.Arg41Gln) rs61748436
NM_000557.5(GDF5):c.-275= rs143383
NM_000557.5(GDF5):c.1144del (p.Ala382fs) rs1568731526
NM_000558.3(HBA1):c.134C>T (p.Pro45Leu) rs33978134
NM_000558.3(HBA1):c.179G>A (p.Gly60Asp) rs28928878
NM_000558.3(HBA1):c.187_189delGTG (p.Val63del) rs35672478
NM_000558.3(HBA1):c.193G>C (p.Asp65His) rs33984024
NM_000558.3(HBA1):c.20A>G (p.Asp7Gly) rs33986902
NM_000558.3(HBA1):c.270C>G (p.His90Gln) rs1061009
NM_000558.3(HBA1):c.278G>A (p.Arg93Gln) rs33991779
NM_000558.3(HBA1):c.278G>T (p.Arg93Leu) rs33991779
NM_000558.3(HBA1):c.283G>C (p.Asp95His) rs34102339
NM_000558.3(HBA1):c.287C>T (p.Pro96Leu) rs33931314
NM_000558.3(HBA1):c.341T>A (p.Leu114His) rs35654345
NM_000558.3(HBA1):c.349G>A (p.Glu117Lys) rs63749882
NM_000558.3(HBA1):c.389T>C (p.Leu130Pro) rs35993655
NM_000558.3(HBA1):c.424C>T (p.Arg142Cys) rs33991910
NM_000558.3(HBA1):c.425G>A (p.Arg142His) rs33935328
NM_000558.3(HBA1):c.425G>T (p.Arg142Leu) rs33935328
NM_000558.3(HBA1):c.49A>G (p.Lys17Glu) rs41407250
NM_000558.5(HBA1):c.104T>G (p.Leu35Arg) rs35203445
NM_000558.5(HBA1):c.17C>A (p.Ala6Asp) rs34090856
NM_000558.5(HBA1):c.223G>C (p.Asp75His) rs28928875
NM_000558.5(HBA1):c.265G>T (p.Ala89Ser) rs35239527
NM_000558.5(HBA1):c.273G>C (p.Lys91Asn) rs33914470
NM_000558.5(HBA1):c.337C>G (p.His113Asp) rs34830032
NM_000558.5(HBA1):c.350A>C (p.Glu117Ala) rs35932809
NM_000558.5(HBA1):c.362C>A (p.Ala121Glu) rs63749927
NM_000558.5(HBA1):c.364G>A (p.Val122Met) rs63751008
NM_000558.5(HBA1):c.379G>C (p.Asp127His) rs63750950
NM_000558.5(HBA1):c.410T>G (p.Leu137Arg) rs34635364
NM_000558.5(HBA1):c.421T>C (p.Tyr141His) rs35723200
NM_000558.5(HBA1):c.84G>T (p.Glu28Asp) rs41530750
NM_000559.2(HBG1):c.227C>T (p.Thr76Ile) rs1061234
NM_000579.3(CCR5):c.-301+246A>G rs1799987
NM_000579.3(CCR5):c.554_585del (p.Ser185fs) rs333
NM_000593.5(TAP1):c.2156G>A (p.Arg719Gln) rs121917702
NM_000602.4(SERPINE1):c.-820_-817G(4_5) rs1799762
NM_000602.4(SERPINE1):c.43G>A (p.Ala15Thr) rs6092
NM_000603.5(NOS3):c.894T>G (p.Asp298Glu) rs1799983
NM_000616.5(CD4):c.793C>T (p.Arg265Trp) rs28919570
NM_000617.3(SLC11A2):c.1197G>C (p.Glu399Asp) rs121918365
NM_000621.4(HTR2A):c.614-2211T>C rs7997012
NM_000628.5(IL10RB):c.139A>G (p.Lys47Glu) rs2834167
NM_000636.4(SOD2):c.47T>C (p.Val16Ala) rs4880
NM_000642.3(AGL):c.1222C>T (p.Arg408Ter) rs113994128
NM_000642.3(AGL):c.16C>T (p.Gln6Ter) rs113994126
NM_000642.3(AGL):c.1735+1G>T rs199922945
NM_000642.3(AGL):c.18_19del (p.Gln6fs) rs113994127
NM_000642.3(AGL):c.2039G>A (p.Trp680Ter) rs113994129
NM_000642.3(AGL):c.3965del (p.Val1322fs) rs113994132
NM_000642.3(AGL):c.3980G>A (p.Trp1327Ter) rs267606640
NM_000642.3(AGL):c.4259+5G>A rs780504025
NM_000642.3(AGL):c.4260-12A>G rs369973784
NM_000642.3(AGL):c.4456del (p.Ser1486fs) rs113994134
NM_000642.3(AGL):c.4529dup (p.Tyr1510Ter) rs387906244
NM_000660.7(TGFB1):c.1159T>C (p.Cys387Arg) rs1336387628
NM_000660.7(TGFB1):c.133C>T (p.Arg45Cys) rs1555755308
NM_000660.7(TGFB1):c.29C>T (p.Pro10Leu) rs1800470
NM_000660.7(TGFB1):c.328C>T (p.Arg110Cys) rs1555755242
NM_000666.3(ACY1):c.1057C>T (p.Arg353Cys) rs121912698
NM_000666.3(ACY1):c.1178G>A (p.Arg393His) rs121912701
NM_000684.3(ADRB1):c.145A>G (p.Ser49Gly) rs1801252
NM_000686.5(AGTR2):c.402del (p.Phe134fs) rs387906503
NM_000686.5(AGTR2):c.62G>T (p.Gly21Val) rs121917810
NM_000687.4(AHCY):c.428A>G (p.Tyr143Cys) rs121918608
NM_000690.4(ALDH2):c.1510G>A (p.Glu504Lys) rs671
NM_000702.4(ATP1A2):c.1244C>T (p.Thr415Met)