ClinVar Miner

Variants from OMIM with conflicting interpretations

Location: United States — Primary collection method: literature only
Minimum review status of the submission from OMIM: Collection method of the submission from OMIM:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
17847 5178 1231 2366 110 775 1508 5396

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
OMIM pathogenic likely pathogenic uncertain significance likely benign benign affects association drug response protective risk factor other
pathogenic 1224 2332 1226 297 213 20 7 40 15 106 152
uncertain significance 38 24 2 77 76 0 0 1 0 1 1
benign 11 1 9 34 5 1 1 9 3 12 7
affects 24 2 7 7 10 0 5 4 0 5 4
association 11 4 4 10 19 5 0 3 2 8 4
drug response 4 2 0 8 5 0 0 0 1 5 14
protective 12 1 1 9 13 0 1 2 0 9 2
risk factor 182 78 86 83 104 5 8 31 10 0 6
other 166 23 50 23 10 0 0 1 2 0 0

Submitter to submitter summary #

Total submitters: 277
Download table as spreadsheet
Submitter Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
GeneReviews 0 982 1224 11 4 73 41 1339
GeneDx 0 2087 0 344 43 145 277 801
Invitae 0 1498 0 171 51 146 425 777
Counsyl 0 548 0 437 8 68 153 662
Illumina Clinical Services Laboratory,Illumina 0 386 0 120 54 135 279 566
EGL Genetic Diagnostics,Eurofins Clinical Diagnostics 0 993 0 56 40 138 255 480
Ambry Genetics 0 584 0 121 36 75 164 390
Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine 0 416 0 86 32 68 154 330
OMIM 27015 1114 0 0 0 289 6 292
ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories 0 288 0 22 26 86 67 194
PreventionGenetics 0 51 0 7 37 91 66 193
Database of Curated Mutations (DoCM) 0 18 0 166 0 13 1 178
SIB Swiss Institute of Bioinformatics 0 49 0 137 0 0 40 177
Integrated Genetics/Laboratory Corporation of America 0 708 0 39 15 53 60 163
Genetic Services Laboratory, University of Chicago 0 286 0 58 13 36 49 154
Fulgent Genetics 0 554 0 71 2 34 25 131
CeGaT Praxis fuer Humangenetik Tuebingen 0 9 0 50 1 17 56 116
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 0 163 0 16 15 19 55 103
Color 0 101 0 16 13 40 39 103
Athena Diagnostics Inc 0 290 0 24 9 23 37 93
Quest Diagnostics Nichols Institute San Juan Capistrano 0 156 0 13 5 60 17 92
Biesecker Lab/Human Development Section,National Institutes of Health 0 6 4 0 20 9 48 77
Genomic Research Center,Shahid Beheshti University of Medical Sciences 0 72 0 32 0 8 32 71
PharmGKB 0 13 0 0 0 68 0 68
Baylor Miraca Genetics Laboratories, 0 175 0 18 3 11 33 64
Developmental Genetics Unit,King Faisal Specialist Hospital & Research Centre 0 5 0 62 0 1 1 64
CSER_CC_NCGL; University of Washington Medical Center 0 12 0 13 5 10 36 63
Mayo Clinic Genetic Testing Laboratories,Mayo Clinic 0 82 0 14 7 12 23 56
Lupski Lab, Baylor-Hopkins CMG,Baylor College of Medicine 0 92 0 48 0 1 8 56
Centre for Mendelian Genomics,University Medical Centre Ljubljana 0 107 0 32 0 11 19 56
Soonchunhyang University Bucheon Hospital,Soonchunhyang University Medical Center 0 12 0 24 1 5 25 54
Division of Genomic Diagnostics,The Children's Hospital of Philadelphia 0 90 0 10 9 15 19 52
University of Washington Center for Mendelian Genomics,University of Washington 0 61 0 42 0 2 3 47
Juha Muilu Group; Institute for Molecular Medicine Finland (FIMM) 0 7 0 46 0 0 0 46
Stanford Center for Inherited Cardiovascular Disease,Stanford University 0 52 0 25 1 2 19 46
Blueprint Genetics, 0 48 0 14 2 7 19 40
Equipe Genetique des Anomalies du Developpement,Université de Bourgogne 0 33 0 16 2 7 19 40
NIHR Bioresource Rare Diseases,University of Cambridge 0 26 0 36 0 2 1 37
Department of Genetics,Sultan Qaboos University Hospital, Oman 0 28 0 7 1 7 19 33
ClinVar Staff, National Center for Biotechnology Information (NCBI) 0 22 0 20 0 5 7 32
LDLR-LOVD, British Heart Foundation 0 19 0 32 0 0 0 32
Diagnostic Laboratory, Department of Genetics,University Medical Center Groningen 0 64 0 4 12 13 3 32
Division of Human Genetics,Children's Hospital of Philadelphia 0 41 0 14 0 10 5 29
CHEO Genetics Diagnostic Laboratory,Children's Hospital of Eastern Ontario 0 21 0 3 3 4 18 27
Mendelics 0 74 0 4 1 12 12 27
Human Genome Sequencing Center Clinical Lab,Baylor College of Medicine 0 35 0 9 0 16 0 25
GeneKor MSA 0 18 0 8 2 11 6 25
Center for Medical Genetics Ghent,University of Ghent 0 8 0 20 0 0 3 23
Robarts Research Institute,Western University 0 1 0 22 0 1 0 23
DNA and Cytogenetics Diagnostics Unit,Erasmus Medical Center 0 43 0 5 7 5 6 23
German Consortium for Hereditary Breast and Ovarian Cancer Center Cologne,University Hospital Cologne 0 16 0 19 0 4 0 23
HudsonAlpha Institute for Biotechnology 0 62 0 10 0 8 4 22
Department of Laboratory Medicine and Genetics,Trillium Health Partners Credit Valley Hospital 0 2 0 0 0 22 0 22
Knight Diagnostic Laboratories,Oregon Health and Sciences University 0 42 0 6 0 14 2 21
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute 0 14 0 5 2 3 13 21
Genome Diagnostics Laboratory,University Medical Center Utrecht 0 34 0 2 10 5 2 19
Gharavi Laboratory,Columbia University 0 26 0 5 0 6 8 19
Molecular Diagnostics Lab,Nemours Alfred I. duPont Hospital for Children 0 33 0 14 0 1 3 18
UCLA Clinical Genomics Center, UCLA 0 17 0 17 0 1 0 18
Laboratory of Genetics and Molecular Cardiology,University of São Paulo 0 16 0 14 0 1 3 18
Undiagnosed Diseases Network,NIH 0 45 0 12 0 0 6 18
Centre de Génétique Moléculaire et Chromosomique, Unité de génétique de l'Obésité et des Dyslipidémies,APHP, GH Hôpitaux Universitaires Pitié-Salpêtrière / Charles-Foix 0 12 0 15 0 0 1 16
University of Washington Department of Laboratory Medicine,University of Washington 0 22 0 5 0 11 1 16
Yale Center for Mendelian Genomics,Yale University 0 7 0 14 0 1 0 15
Department of Pathology and Laboratory Medicine,Sinai Health System 0 53 0 4 3 5 3 15
Wong Mito Lab, Molecular and Human Genetics,Baylor College of Medicine 0 13 0 11 1 0 3 15
Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago 0 15 0 7 0 1 7 15
International Society for Gastrointestinal Hereditary Tumours (InSiGHT) 0 43 1 3 4 1 5 14
True Health Diagnostics 0 6 0 0 5 4 5 14
Center for Human Genetics, Inc 0 62 0 2 3 5 3 13
Pathway Genomics 0 20 0 2 3 5 4 13
Sharing Clinical Reports Project (SCRP) 0 36 0 4 2 4 2 12
Richard Lifton Laboratory, Yale University School of Medicine 0 18 0 8 0 4 1 12
Clinical Molecular Genetics Laboratory,Johns Hopkins All Children's Hospital 0 108 0 5 0 3 3 11
NeuroMeGen,Hospital Clinico Santiago de Compostela 0 1 0 11 0 0 0 11
Molecular Diagnostics Laboratory,M Health: University of Minnesota 0 20 0 11 0 0 0 11
ClinGen PTEN Variant Curation Expert Panel 0 8 0 9 0 0 2 11
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) 0 46 0 0 3 5 2 10
CHU Sainte-Justine Research Center,University of Montreal 0 3 0 10 0 0 0 10
Molecular Genetics Laboratory,Centre for Cardiovascular Surgery and Transplantation 0 3 0 10 0 0 0 10
Genetic Testing Center for Deafness, Department of Otolaryngology Head & Neck Surgery,Institute of Otolaryngology, Chinese PLA General Hospital 0 6 0 10 0 0 0 10
Michigan Medical Genetics Laboratories,University of Michigan 0 9 0 0 3 4 2 9
PALB2 database 0 0 0 0 0 9 0 9
Care4Rare,CHEO 0 0 0 0 0 0 9 9
Foundation for Research in Genetics and Endocrinology,Institute of Human Genetics 0 20 0 6 0 2 3 9
Institute for Biomarker Research,Medical Diagnostic Laboratories, L.L.C. 0 4 0 0 1 5 3 9
Donald Williams Parsons Laboratory,Baylor College of Medicine 0 9 0 0 0 9 0 9
ARUP Institute,ARUP Laboratories 0 75 5 0 0 1 3 9
Tartaglia Lab, Genetics and Rare Diseases Research Division,Bambino Gesu' Children's Hospital 0 4 0 9 0 0 0 9
SingHealth Duke-NUS Institute of Precision Medicine 0 7 0 5 0 0 4 9
Vantari Genetics 0 4 0 0 3 2 3 8
Cardiovascular Research Group,Instituto Nacional de Saude Doutor Ricardo Jorge 0 18 0 7 0 1 0 8
Human Genetics - Radboudumc,Radboudumc 0 20 0 4 0 1 3 8
Fundacion Hipercolesterolemia Familiar 0 15 0 4 0 1 3 8
Research Molecular Genetics Laboratory,Women's College Hospital, University of Toronto 0 39 0 2 0 5 1 8
Laboratory of Diagnosis and Therapy of Lysosomal Disorders,University of Padova 0 4 0 3 0 0 5 8
Pediatric Immunology Service,The Chaim Sheba Medical Center at Tel HaShomer 0 0 0 4 0 0 4 8
Institute of Human Genetics,Klinikum rechts der Isar 0 112 0 5 0 2 0 7
Breast Cancer Information Core (BIC) (BRCA1) 0 29 0 0 0 2 5 7
Agnes Ginges Centre for Molecular Cardiology,Centenary Institute 0 11 0 1 1 0 5 7
Center for Human Genetics,University of Leuven 0 19 0 3 0 1 4 7
Personalized Diabetes Medicine Program,University of Maryland School of Medicine 0 0 0 0 2 2 3 7
Courtagen Diagnostics Laboratory,Courtagen Life Sciences 0 31 0 0 0 6 0 6
Breast Cancer Information Core (BIC) (BRCA2) 0 20 0 0 0 3 3 6
RettBASE 0 32 0 2 0 1 3 6
Center for Genetic Medicine Research,Children's National Medical Center 0 0 0 4 0 1 2 6
Institute of Human Genetics, Univ. Regensburg,Univ. Regensburg 0 5 0 5 0 1 0 6
Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA), c/o University of Cambridge 0 49 0 0 0 5 1 6
Foulkes Cancer Genetics LDI,Lady Davis Institute for Medical Research 0 16 0 0 0 3 2 5
George Lab Vanderbilt University 0 0 0 5 0 0 0 5
Department of Medical Genetics,Oslo University Hospital 0 23 0 1 0 4 0 5
Undiagnosed Diseases Program Translational Research Laboratory,National Institutes of Health 0 4 0 5 0 0 0 5
Center of Genomic medicine, Geneva,University Hospital of Geneva 0 31 0 2 0 2 1 5
Bioinformatics dept.,Datar Cancer Genetics Limited, India 0 5 0 3 0 2 0 5
Cancer Genetics Laboratory,Peter MacCallum Cancer Centre 0 0 0 2 0 5 0 5
Bioscientia Institut fuer Medizinische Diagnostik GmbH,Sonic Healthcare 0 30 0 2 0 2 1 5
Human Genetics Institute Leipzig, Universitätsklinikum Leipzig 0 2 0 5 0 0 0 5
Phosphorus, Inc. 0 5 0 1 3 0 1 5
Rare Disease Group, Clinical Genetics,Karolinska Institutet 0 1 0 1 0 0 4 5
Human Genomics Unit,Institute for molecular medicine Finland (FIMM) 0 0 0 4 0 1 0 5
Genome Diagnostics Laboratory,VU University Medical Center Amsterdam 0 9 0 1 3 1 0 5
Medical Genetics Summaries 0 0 0 0 0 5 0 5
Clinical Genomics Lab,St. Jude Children's Research Hospital 0 12 0 3 0 0 2 5
ClinGen CDH1 Variant Curation Expert Panel 0 1 0 1 0 0 4 5
Eye Genetics Research Group,Children's Medical Research Institute 0 5 0 1 0 0 3 4
Familial Cancer Clinic,Veneto Institute of Oncology 0 0 0 0 0 4 0 4
Department of Ophthalmology and Visual Sciences Kyoto University 0 12 0 0 0 0 4 4
Department of Pharmacy and Biotechnology,University of Bologna 0 0 0 0 2 3 0 4
Chan Lab,Boston Children's Hospital 0 0 0 2 0 2 0 4
Diagnostics Division,Centre for DNA Fingerprinting and Diagnostics 0 0 0 4 0 0 0 4
Neurogenetics Laboratory - MEYER,AOU Meyer 0 2 0 4 0 0 0 4
RBHT Clinical Genetics and Genomics Laboratory,Royal Brompton and Harefield NHS Foundation Trust 0 2 0 4 0 0 0 4
Geisinger Autism and Developmental Medicine Institute,Geisinger Health System 0 5 0 1 0 3 0 4
Cancer Genetics and Genomics Laboratory,British Columbia Cancer Agency 0 2 0 0 3 1 0 4
Iberoamerican FH Network 0 10 0 3 0 0 1 4
CHLA Center for Personalized Medicine,Children's Hospital, Los Angeles 0 15 0 1 0 1 2 4
ClinGen PAH Variant Curation Expert Panel, 0 26 0 3 0 0 1 4
Broad Institute Rare Disease Group,Broad Institute 0 26 0 2 0 0 2 4
Institute for Genomic Medicine (IGM) Clinical Laboratory,Nationwide Children's Hospital 0 1 0 0 1 2 2 4
Claritas Genomics 0 11 0 1 0 0 2 3
Institute of Human Genetics,Cologne University 0 14 0 1 0 0 2 3
University of British Columbia 0 0 0 2 0 0 1 3
Deafness Gene Diagnosis,Xijing Hospital 0 0 0 3 0 0 0 3
Institute for Integrative and Experimental Genomics,University of Luebeck 0 0 0 3 0 0 0 3
Medical Genetics,University of Parma 0 0 0 1 0 0 2 3
Centre for Genomic and Experimental Medicine,University of Edinburgh 0 5 0 3 0 0 0 3
Medical Research Institute,Tokyo Medical and Dental University 0 1 0 2 0 1 1 3
Baylor-Hopkins Center for Mendelian Genomics,Johns Hopkins University 0 38 0 1 0 1 1 3
Laboratory of Molecular Genetics,CHU RENNES 0 0 0 3 0 0 0 3
Erich and Hanna Klessmann Institute for Cardiovascular Research and Development,Heart and Diabetes Center North Rhine-Westphalia 0 4 0 2 0 0 1 3
Center for Human Genetics and Laboratory Diagnostics, Dr. Klein, Dr. Rost and Colleagues 0 8 0 0 0 0 3 3
Kasturba Medical College,Manipal University 0 2 0 0 0 1 2 3
Center for Medical Genetics and Molecular Medicine,Haukeland University Hospital 0 4 0 3 0 0 0 3
Section on Medical Neuroendocrinolgy,National Institutes of Health 0 11 0 2 0 0 1 3
Biochemical Molecular Genetic Laboratory,King Abdulaziz Medical City 0 13 0 1 0 2 0 3
Dept. of Medical Genetics, Telemark Hospital Trust 0 2 0 0 0 1 2 3
Laboratoire de Cytogenetique,Hospices Civils de Lyon 0 10 0 3 0 0 0 3
Clinical Biochemistry Laboratory,Health Services Laboratory 0 22 0 0 2 0 0 2
Gleeson Lab,University of California San Diego - Department of Neuroscience 0 0 0 2 0 0 0 2
Molecular Genetics Laboratory,BC Children's and BC Women's Hospitals 0 26 0 2 0 0 0 2
FirmaLab 0 3 0 0 0 1 1 2
Division Human Genetics,Medical University Innsbruck 0 12 0 1 0 1 0 2
Genologica Medica 0 10 0 0 0 2 0 2
Northcott Neuroscience Laboratory, ANZAC Research Institute 0 3 0 0 0 1 1 2
Samuels research lab,Centre de Recherche du CHU Ste-Justine 0 5 0 0 0 0 2 2
Institute of Human Genetics,University Medical Center Hamburg-Eppendorf 0 5 0 2 0 0 0 2
Department of Mental Retardation and Birth Defect Research, National Center of Neurology and Psychiatry 0 0 0 2 0 0 0 2
Section on Endocrinology and Genetics,National Institutes of Health / The Eunice Kennedy Shriver National Institute of Child Health and Human Development 0 0 0 2 0 0 0 2
Institute for Ophthalmic Research,University Tuebingen 0 15 0 1 0 0 1 2
Department of Internal Medicine, University of Texas Health Science Center at Houston 0 1 0 0 0 2 0 2
Hadassah Hebrew University Medical Center 0 0 0 1 0 1 0 2
Laboratory of Molecular Genetics (Pr. Bezieau's lab),CHU de Nantes 0 36 0 2 0 0 0 2
Genome Sciences Centre,British Columbia Cancer Agency 0 3 0 2 0 0 0 2
Prostate Cancer Research Center,Institute of Biosciences and Medical Technology, University of Tampere 0 0 0 1 0 0 1 2
Department of Medical Genetics,University Hospital of North Norway 0 0 0 1 1 0 0 2
A.C.Camargo Cancer Center / LGBM, A.C.Camargo Cancer Center 0 5 0 0 0 2 0 2
Groupe Hospitalier Pitie Salpetriere, UF Genomique du Developpement,Assistance Publique Hopitaux de Paris 0 5 0 2 0 1 0 2
Oxford Haemato-Oncology Service,Oxford University Hospitals NHS Foundation Trust 0 0 0 1 0 1 0 2
Department of Genetics,Fundacion Jimenez Diaz University Hospital 0 1 0 2 0 0 0 2
Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde,Academisch Medisch Centrum 0 33 0 0 0 2 0 2
Tolun Lab, Human Genetics Laboratory,Bogazici University 0 0 0 0 0 1 1 2
Antonellis Laboratory at Michigan,University of Michigan 0 0 0 2 0 0 0 2
Hardcastle Lab,UCL Institute of Ophthalmology 0 0 0 2 0 0 0 2
Kids Research,The Children's Hospital at Westmead 0 0 0 2 0 0 0 2
ClinGen Hearing Loss Variant Curation Expert Panel, 0 9 0 0 0 0 2 2
van Haaften laboratory,University Medical Center Utrecht 0 0 0 0 0 0 2 2
Johns Hopkins Genomics,Johns Hopkins University 0 3 0 0 0 1 1 2
Genetic Diseases Diagnostic Center,Koc University Hospital 0 0 0 2 0 0 0 2
Greenwood Genetic Center Diagnostic Laboratories,Greenwood Genetic Center 0 13 0 0 0 0 1 1
Molecular Otolaryngology and Renal Research Laboratories,University of Iowa Hospital and Clinics 0 0 0 0 0 0 1 1
Molecular Genetics Laboratory,Institute for Ophthalmic Research 0 0 0 1 0 0 0 1
Molecular Genetics Laboratory,Children's Mercy Hospital and Clinics 0 5 0 1 0 0 0 1
Laboratory of Gastroenterology and Hepatology,Radboud University Medical Center 0 8 0 0 0 1 0 1
Bristol Genetics Laboratory - North Bristol NHS Trust,Southmead Hospital - Pathology Sciences 0 0 0 1 0 0 0 1
Molecular Diagnostics Laboratory,Seoul National University Hospital 0 0 0 0 0 0 1 1
Molecular Vision Laboratory 0 0 0 0 0 1 0 1
American College of Medical Genetics and Genomics (ACMG) 0 17 0 0 0 1 0 1
CFTR2 0 76 0 0 0 1 0 1
Martin Pollak Laboratory, Beth Israel Deaconess Medical Center 0 0 0 0 0 0 1 1
CVG, University of British Columbia 0 0 0 0 0 0 1 1
Endocrinology Clinic, Seth G.S. Medical College 0 0 0 1 0 0 0 1
Department of Neuroscience, King Faisal Specialist Hospital 0 0 0 0 0 0 1 1
UniProtKB/Swiss-Prot 0 204 0 1 0 0 0 1
Science for Life laboratory, Karolinska Institutet 0 0 0 0 0 0 1 1
Cardiovascular Biomedical Research Unit,Royal Brompton & Harefield NHS Foundation Trust 0 114 0 1 0 0 0 1
SNPedia 0 24 0 0 0 1 0 1
PXE International 0 20 0 0 0 0 1 1
University of Washington School of Medicine 0 0 0 0 0 0 1 1
Shenzhen Institute of Pediatrics,Shenzhen Children's Hospital 0 0 0 1 0 0 0 1
ITMI 0 63 0 1 0 0 0 1
Institute of Human Genetics,Friedrich-Alexander-Universität Erlangen-Nürnberg 0 16 0 1 0 0 0 1
Genomics and Pathology Services,Washington University in St.Louis 0 4 0 1 0 0 0 1
Department of Clinical Science, University of Bergen 0 0 0 1 0 0 0 1
Laboratoire de Biologie Moléculaire,Centre Hospitalo-Universitaire 0 0 0 1 0 0 0 1
GOLD service, Hunter New England Health 0 4 0 1 0 0 0 1
Clinical Genetics Karolinska University Hospital,Karolinska University Hospital 0 2 0 1 0 0 0 1
Department of Molecular and Human Genetics, Baylor College of Medicine 0 10 0 0 0 1 0 1
Akiko Shimamura Lab,Fred Hutchinson Cancer Research Center 0 2 0 1 0 0 0 1
Clinical Genetics Research Group, University of Calgary 0 7 0 1 0 0 0 1
Centre for Translational Omics - GOSgene,University College London 0 1 0 1 0 0 0 1
Department of Genetics, Reproduction and Fetal Medicine.,Institute of Biomedicine of Seville (IBIS), University Hospital Virgen del Rocío/CSIC/University of Seville. 0 0 0 0 0 0 1 1
Scripps Translational Science Institute,Scripps Health and The Scripps Research Institute 0 3 0 1 0 0 0 1
Laboratory of Human Genetics,Universidade de São Paulo 0 0 0 0 0 1 0 1
Curoverse 0 1 0 0 0 1 0 1
Center for Individualized Medicine,Mayo Clinic 0 0 0 1 0 0 0 1
Molecular Genetics Pathology Laboratory, University Of Arkansas for Medical Sciences 0 1 0 0 0 0 1 1
UW Hindbrain Malformation Research Program,University of Washington 0 62 0 1 0 0 0 1
Centro de Genética y Biología Molecular,Universidad de San Martín de Porres 0 1 0 0 0 1 0 1
Miami Human Genetics,University of Miami Miller School of Medicine 0 0 0 0 0 1 0 1
Paul Sabatier University EA-4555, Paul Sabatier University 0 0 0 0 0 0 1 1
UCL Genetics Institute,UCL 0 0 0 0 0 0 1 1
Centre for Genomic Medicine, Manchester,Central Manchester University Hospitals 0 5 0 1 0 0 0 1
Prof. Thelma's Laboratory, Department of Genetics,University of Delhi South Campus 0 0 0 0 0 0 1 1
Center for Human Disease Modeling,Duke University Medical Center 0 0 0 1 0 0 0 1
Aziz Sancar Institute of Experimental Medicine,Istanbul University 0 1 0 0 0 1 0 1
HerediLab, Inc. 0 0 0 0 0 1 0 1
Molecular and Medical Genetics Group,King's College London 0 2 0 1 0 0 0 1
Forensic Genetics Laboratory,Harris County Institute of Forensic Sciences 0 4 0 0 0 0 1 1
Clinical Genetics, Erasmus University Medical Center 0 0 0 1 0 0 0 1
Leeds Amelogenesis Imperfecta Research Group,Leeds University 0 4 0 1 0 0 0 1
Rui Chen Lab,Baylor College of Medicine 0 1 0 0 0 0 1 1
Center for Medical Genomics, Faculty of Medicine Ramathibodi Hospital, Mahidol University,Faculty of Medicine Ramathibodi Hospital, Mahidol University 0 0 0 0 1 0 0 1
Center for Statistical Genetics,Baylor College of Medicine 0 2 0 0 0 1 0 1
Department of Ophthalmology,Flinders University 0 1 0 1 0 0 0 1
Reutter Lab, Institute of Human Genetics,University Hospital Bonn 0 0 0 0 0 0 1 1
Childrens Diabetes Center,University of Wisconsin-Madison 0 0 0 0 0 0 1 1
Institute of Experimental Endocrinology,Slovak Academy of Sciences 0 1 0 0 0 0 1 1
Unité de Différenciation Epithéliale et Auto-Immunité Rhumatoïde,INSERM - Université Paul Sabatier 0 0 0 1 0 0 0 1
Endocrine oncology group,Uppsala University 0 0 0 1 0 0 0 1
UMR-S1161,Institut national de la santé et de la recherche médicale 0 0 0 0 0 1 0 1
TIDEX,University of British Columbia 0 4 0 1 0 0 0 1
Department of Pathology and Molecular Medicine,Queen's University 0 11 0 0 0 1 0 1
Genetics of Mitochondrial Diseases,Imagine Institute 0 0 0 1 0 0 0 1
Pediatric Nephrology (Iijima Lab),Kobe University Graduate School of Medicine 0 0 0 0 0 0 1 1
Dr. Liu's Molecular Genetics Laboratory,University of Miami Miller School of Medicine 0 0 0 1 0 0 0 1
Dan Cohn Lab,University Of California Los Angeles 0 18 0 0 0 1 0 1
Bodamer Research Lab,Boston Children's Hospital 0 0 0 0 0 1 0 1
Institute for Genomic Medicine, Nationwide Children's Hospital 0 1 0 1 0 0 0 1
Center of Vascular Surgery,The Second Affiliated Hospital of Nanchang University 0 0 0 1 0 0 0 1
ClinGen RASopathy Variant Curation Expert Panel, 0 27 0 1 0 0 0 1
Molecular Development Laboratory,Murdoch Childrens Research Institute 0 0 0 0 0 0 1 1
Pediatric Genomics Discovery Program,Yale University 0 1 0 1 0 0 0 1
Institute of Human Genetics,Polish Academy of Sciences 0 0 0 0 0 0 1 1
Center for Precision Medicine,Vanderbilt University Medical Center 0 3 0 0 0 1 0 1
Hacettepe Genetic Diseases Diagnosis Center,Hacettepe University Faculty of Medicine 0 0 0 1 0 0 0 1
GeneID Lab - Advanced Molecular Diagnostics 0 0 0 0 0 1 1 1
3DMed Clinical Laboratory Inc 0 9 0 0 0 0 1 1
Cancer Diagnostics Division,Gene Solutions 0 0 0 1 0 0 0 1
UNC Molecular Genetics Laboratory,University of North Carolina at Chapel Hill 0 0 0 1 0 0 0 1
Liping Wei Laboratory,Peking University 0 2 0 0 0 0 1 1
Institute of Neurogenomics,Technical University of Munich 0 0 0 0 0 0 1 1
The Raphael Recanati Genetics Institute,Rabin Medical Center 0 1 0 0 0 0 1 1
Cole/Wambach Lab,Washington University in St. Louis 0 5 0 1 0 0 0 1
Institute of Clinical Molecular Biology,Kiel University 0 0 0 0 0 0 1 1
Molecular Dermatology Lab,Tel Aviv Sourasky Medical Center 0 0 0 0 0 0 1 1
Institute of Bioinformatics 0 0 0 1 0 0 0 1
Wessex Regional Genetics Laboratory,Salisbury District Hospital 0 4 0 1 0 0 0 1

All variants with conflicting interpretations #

Total variants: 5396
Download table as spreadsheet
HGVS dbSNP
AGT, -6A HAPLOTYPE
ALOX5, VARIANT PROMOTER SP1 BINDING
CD209, -336A-G
CD36, G1439C, 1-BP DEL, 1444A
CHEK2, 1-BP DEL, 1100C
CX3CR1:c.[841G>A;935C>T] (p.Val294Ile;Thr280Met)
CYP2A6*3
ESR1, IVS1, T-C, -401
FH Bologna 2
FH Cape Town 2
FH Vancouver 4
G6PD AMSTERDAM
G6PD NARA rs587776730
GNB3, 825C-T
GP1BA, 92-BP DUP, SER399-THR411 DUP, VARIABLE REPEATS
GRCh38/hg38 9p21.2(chr9:27040565-27060992)
HBB, HBB/HBD FUSION
HBB, HBB/HBD FUSION, HBD137DEL
HBB, HIS143GLN
HBB, TYR145ASN-TO-ASP
HLA-B*57:01
HP, DEL
HPRT CHERMSIDE
HPRT CHICAGO
HPRT CONNERSVILLE
HPRT COORPAROO
HPRT MICHIGAN
IFNGR1, -56C-T
IL1RN, IVS2, 86-BP DUP
MC4R, VAL103ILE (rs2229616)
MECP2, 41-BP DEL, NT1157
MPO, -463G-A
Multiple alleles
NC_000001.11:g.(196753076_?)_(?_196839375)del
NC_000006.12:g.5609990_5726136del116147
NC_000008.11:g.(?_6406592)_(6439097_6442066)del
NC_000015.9:g.68504037_68504039delGAT rs121908080
NC_000017.11:g.3600934_3658165del57232
NC_000022.11:g.(?_18906222)_(18936553_?)del
NC_012920.1:m.11778G>A rs199476112
NC_012920.1:m.14484T>C rs199476104
NC_012920.1:m.1555A>G rs267606617
NC_012920.1:m.3460G>A rs199476118
NG_008165.1:g.12526_12528CAM[(>46)]
NG_011506.1:g.15883_17827del1945insTG
NG_011564.1:g.6399C>T rs9934438
NG_011801.1:g.72149_72150delTT rs1169875761
NG_012123.1:g.2493A>G rs1024611
NG_016173.1:g.37172CTG[(107_127)]
NM_000014.5(A2M):c.2126-6_2126-2del rs1799759
NM_000014.5(A2M):c.2998A>G (p.Ile1000Val) rs669
NM_000016.5(ACADM):c.199T>C (p.Tyr67His) rs121434280
NM_000016.5(ACADM):c.351A>C (p.Thr117=) rs74090726
NM_000016.5(ACADM):c.362C>T (p.Thr121Ile) rs121434283
NM_000016.5(ACADM):c.583G>A (p.Gly195Arg) rs121434278
NM_000016.5(ACADM):c.734C>T (p.Ser245Leu) rs121434281
NM_000016.5(ACADM):c.799G>A (p.Gly267Arg) rs121434274
NM_000016.5(ACADM):c.999_1011dup (p.Gln338Terfs) rs1225471006
NM_000017.2(ACADS):c.164C>T (p.Pro55Leu) rs147442301
NM_000017.3(ACADS):c.1031A>G (p.Glu344Gly) rs387906950
NM_000017.3(ACADS):c.1058C>T (p.Ser353Leu) rs28941773
NM_000017.3(ACADS):c.1138C>T (p.Arg380Trp) rs28940875
NM_000017.3(ACADS):c.1147C>T (p.Arg383Cys) rs28940872
NM_000017.3(ACADS):c.136C>T (p.Arg46Trp) rs121908003
NM_000017.3(ACADS):c.268G>A (p.Gly90Ser) rs121908005
NM_000017.3(ACADS):c.310_312delGAG (p.Glu104del) rs387906308
NM_000017.3(ACADS):c.323G>A (p.Gly108Asp) rs387906951
NM_000017.3(ACADS):c.511C>T (p.Arg171Trp) rs1800556
NM_000017.3(ACADS):c.529T>C (p.Trp177Arg) rs57443665
NM_000017.3(ACADS):c.575C>T (p.Ala192Val) rs28940874
NM_000017.3(ACADS):c.625G>A (p.Gly209Ser) rs1799958
NM_000017.3(ACADS):c.973C>T (p.Arg325Trp) rs121908006
NM_000018.2(ACADVL):c.1182+1G>A rs113690956
NM_000018.3(ACADVL):c.1246G>A (p.Ala416Thr) rs118204018
NM_000018.3(ACADVL):c.1322G>A (p.Gly441Asp) rs2309689
NM_000018.3(ACADVL):c.1837C>T (p.Arg613Trp) rs118204014
NM_000018.3(ACADVL):c.343delG (p.Glu115Lysfs) rs387906249
NM_000018.3(ACADVL):c.388_390delGAG (p.Glu130del) rs387906251
NM_000018.3(ACADVL):c.896_898delAGA (p.Lys299del) rs387906252
NM_000018.4(ACADVL):c.1349G>A (p.Arg450His) rs118204016
NM_000021.3(PSEN1):c.1141C>T (p.Leu381Phe) rs63750687
NM_000021.3(PSEN1):c.1276G>C (p.Ala426Pro) rs63751223
NM_000021.3(PSEN1):c.1292C>A (p.Ala431Glu) rs63750083
NM_000021.3(PSEN1):c.236C>T (p.Ala79Val) rs63749824
NM_000021.3(PSEN1):c.338T>C (p.Leu113Pro) rs63751399
NM_000021.3(PSEN1):c.415A>G (p.Met139Val) rs63751037
NM_000021.3(PSEN1):c.436A>C (p.Met146Leu) rs63750306
NM_000021.3(PSEN1):c.509C>T (p.Ser170Phe) rs63750577
NM_000021.3(PSEN1):c.548G>T (p.Gly183Val) rs63751068
NM_000021.3(PSEN1):c.799C>T (p.Pro267Ser) rs63751229
NM_000021.3(PSEN1):c.839A>C (p.Glu280Ala) rs63750231
NM_000021.3(PSEN1):c.998A>G (p.Asp333Gly) rs121917809
NM_000022.2(ADA):c.226C>T (p.Arg76Trp) rs121908736
NM_000022.2(ADA):c.22G>A (p.Asp8Asn) rs73598374
NM_000022.2(ADA):c.320T>C (p.Leu107Pro) rs121908739
NM_000022.2(ADA):c.454C>A (p.Leu152Met) rs121908728
NM_000022.2(ADA):c.466C>T (p.Arg156Cys) rs121908735
NM_000022.2(ADA):c.631C>T (p.Arg211Cys) rs121908740
NM_000022.2(ADA):c.632G>A (p.Arg211His) rs121908716
NM_000022.2(ADA):c.986C>T rs121908715
NM_000022.3(ADA):c.219-2A>G rs387906267
NM_000022.3(ADA):c.239A>G (p.Lys80Arg) rs11555566
NM_000022.3(ADA):c.301C>T (p.Arg101Trp) rs121908717
NM_000022.3(ADA):c.446G>A (p.Arg149Gln) rs121908737
NM_000022.3(ADA):c.467G>A (p.Arg156His) rs121908722
NM_000022.3(ADA):c.643G>A (p.Ala215Thr) rs114025668
NM_000022.3(ADA):c.821C>T (p.Pro274Leu) rs121908738
NM_000022.3(ADA):c.872C>T (p.Ser291Leu) rs121908721
NM_000023.2(SGCA):c.850C>T (p.Arg284Cys) rs137852623
NM_000023.3(SGCA):c.293G>A (p.Arg98His) rs137852621
NM_000024.5(ADRB2):c.79C>G (p.Gln27Glu) rs1042714
NM_000026.2(ADSL):c.569G>A (p.Arg190Gln) rs28941471
NM_000026.3(ADSL):c.1264G>T (p.Asp422Tyr) rs119450943
NM_000026.3(ADSL):c.736A>G (p.Lys246Glu) rs119450944
NM_000027.3(AGA):c.102_108delGCCCTTT (p.Trp34Terfs) rs386833417
NM_000027.3(AGA):c.127_127+1insATGCGG (p.42_43insAspAla) rs386833418
NM_000027.3(AGA):c.179G>A (p.Gly60Asp) rs121964907
NM_000027.3(AGA):c.302C>T (p.Ala101Val) rs121964908
NM_000027.3(AGA):c.807_940del134 rs386833437
NM_000027.4(AGA):c.800dup (p.Pro268Alafs) rs386833436
NM_000029.3(AGT):c.803T>C (p.Met268Thr) rs699
NM_000030.2(AGXT):c.1020A>G (p.Ile340Met) rs4426527
NM_000030.2(AGXT):c.121G>A (p.Gly41Arg) rs121908523
NM_000030.2(AGXT):c.245G>A (p.Gly82Glu) rs121908522
NM_000030.2(AGXT):c.32C>T (p.Pro11Leu) rs34116584
NM_000030.2(AGXT):c.508G>A (p.Gly170Arg) rs121908529
NM_000030.2(AGXT):c.697C>T (p.Arg233Cys) rs121908526
NM_000030.2(AGXT):c.698G>A (p.Arg233His) rs121908527
NM_000030.2(AGXT):c.731T>C (p.Ile244Thr) rs121908525
NM_000031.5(ALAD):c.177G>C (p.Lys59Asn) rs1800435
NM_000031.5(ALAD):c.36C>G (p.Phe12Leu) rs121912984
NM_000031.5(ALAD):c.718C>T (p.Arg240Trp) rs121912982
NM_000032.4(ALAS2):c.-258C>G rs140772352
NM_000032.4(ALAS2):c.1699_1700delAT (p.Met567Glufs) rs387906473
NM_000032.4(ALAS2):c.1706_1709delAGTG (p.Glu569Glyfs) rs387906472
NM_000033.3(ABCD1):c.1252C>T (p.Arg418Trp) rs128624220
NM_000033.3(ABCD1):c.1866-10G>A rs398123108
NM_000033.3(ABCD1):c.874_876delGAG (p.Glu292del) rs387906496
NM_000035.3(ALDOB):c.360_363delCAAA (p.Asn120Lysfs) rs387906225
NM_000035.4(ALDOB):c.1027T>C (p.Tyr343His) rs369586696
NM_000035.4(ALDOB):c.10C>T (p.Arg4Ter) rs118204428
NM_000035.4(ALDOB):c.136A>T (p.Arg46Trp) rs41281039
NM_000035.4(ALDOB):c.178C>T (p.Arg60Ter) rs118204429
NM_000036.2(AMPD1):c.1261C>T (p.Arg421Trp) rs35859650
NM_000036.2(AMPD1):c.133C>T (p.Gln45Ter) rs17602729
NM_000036.2(AMPD1):c.1373G>A (p.Arg458His) rs121912682
NM_000038.5(APC):c.-30416G>A rs879253785
NM_000038.5(APC):c.1240C>T (p.Arg414Cys) rs137854567
NM_000038.5(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000038.5(APC):c.3927_3931delAAAGA (p.Glu1309Aspfs) rs121913224
NM_000038.5(APC):c.3949G>C (p.Glu1317Gln) rs1801166
NM_000038.5(APC):c.4012C>T (p.Gln1338Ter) rs121913327
NM_000038.5(APC):c.937_938delGA (p.Glu313Asnfs) rs387906239
NM_000040.1(APOC3):c.55C>T (p.Arg19Ter) rs76353203
NM_000040.2(APOC3):c.127G>A (p.Ala43Thr) rs147210663
NM_000040.2(APOC3):c.55+1G>A rs138326449
NM_000040.3(APOC3):c.179+1G>T rs140621530
NM_000041.2(APOE):c.526C>T (p.Arg176Cys) rs7412
NM_000041.4(APOE):c.388T>C (p.Cys130Arg) rs429358
NM_000043.5(FAS):c.749G>C (p.Arg250Pro) rs121913080
NM_000044.4(AR):c.1823G>A (p.Arg608Gln) rs137852573
NM_000044.4(AR):c.1937C>A (p.Ala646Asp) rs1800053
NM_000044.4(AR):c.2395C>G (p.Gln799Glu) rs137852591
NM_000045.3(ARG1):c.871C>T (p.Arg291Ter) rs104893940
NM_000046.4(ARSB):c.1143-8T>G rs431905496
NM_000046.4(ARSB):c.1178A>C (p.His393Pro) rs118203944
NM_000046.4(ARSB):c.1214G>A (p.Cys405Tyr) rs118203941
NM_000046.4(ARSB):c.215T>A (p.Leu72Gln) rs397514441
NM_000046.4(ARSB):c.284G>A (p.Arg95Gln) rs118203942
NM_000046.4(ARSB):c.349T>C (p.Cys117Arg) rs118203939
NM_000046.4(ARSB):c.410G>T (p.Gly137Val) rs118203938
NM_000046.4(ARSB):c.707T>C (p.Leu236Pro) rs118203940
NM_000047.2(ARSE):c.1732C>T (p.Pro578Ser) rs28935474
NM_000047.2(ARSE):c.1743G>A (p.Trp581Ter) rs80338714
NM_000047.2(ARSE):c.36G>C (p.Arg12Ser) rs122460151
NM_000047.2(ARSE):c.410G>T (p.Gly137Val) rs80338711
NM_000048.3(ASL):c.1135C>T (p.Arg379Cys) rs28940287
NM_000049.2(ASPA):c.212G>A (p.Arg71His) rs104894553
NM_000049.2(ASPA):c.746A>T (p.Asp249Val) rs104894552
NM_000050.4(ASS1):c.1087C>T (p.Arg363Trp) rs121908640
NM_000050.4(ASS1):c.1168G>A (p.Gly390Arg) rs121908641
NM_000050.4(ASS1):c.256C>T (p.Arg86Cys) rs121908644
NM_000050.4(ASS1):c.323G>T rs35269064
NM_000050.4(ASS1):c.40G>A (p.Gly14Ser) rs121908636
NM_000050.4(ASS1):c.470G>A (p.Arg157His) rs121908637
NM_000050.4(ASS1):c.539G>A (p.Ser180Asn) rs121908638
NM_000050.4(ASS1):c.53C>T (p.Ser18Leu) rs121908643
NM_000050.4(ASS1):c.835C>T (p.Arg279Ter) rs121908645
NM_000050.4(ASS1):c.928A>C (p.Lys310Gln) rs121908648
NM_000050.4(ASS1):c.970G>A (p.Gly324Ser) rs121908639
NM_000051.3(ATM):c.103C>T (p.Arg35Ter) rs55861249
NM_000051.3(ATM):c.1066-6T>G rs201686625
NM_000051.3(ATM):c.146C>G (p.Ser49Cys) rs1800054
NM_000051.3(ATM):c.2250G>A (p.Lys750=) rs1137887
NM_000051.3(ATM):c.2839-579_2839-576del rs587776552
NM_000051.3(ATM):c.3118A>G (p.Met1040Val) rs3092857
NM_000051.3(ATM):c.496+5G>A rs796051858
NM_000051.3(ATM):c.5762_5763insNG_009830.1:g.91138_91274 rs774925473
NM_000051.3(ATM):c.6200C>A (p.Ala2067Asp) rs397514577
NM_000051.3(ATM):c.7271T>G (p.Val2424Gly) rs28904921
NM_000051.3(ATM):c.7327C>T (p.Arg2443Ter) rs121434220
NM_000051.3(ATM):c.7638_7646delTAGAATTTC (p.Arg2547_Ser2549del) rs587776547
NM_000051.3(ATM):c.7875_7876delTGinsGC (p.Asp2625_Ala2626delinsGluPro) rs267606668
NM_000051.3(ATM):c.8030A>G (p.Tyr2677Cys) rs28942103
NM_000051.3(ATM):c.8480T>G (p.Phe2827Cys) rs121434216
NM_000051.3(ATM):c.8578_8580delTCT (p.Ser2860del) rs786203976
NM_000051.3(ATM):c.9139C>T (p.Arg3047Ter) rs121434219
NM_000052.6(ATP7A):c.1707+6T>A rs797045334
NM_000053.3(ATP7B):c.1708-1G>C rs137853280
NM_000053.3(ATP7B):c.1934T>G (p.Met645Arg) rs121907998
NM_000053.3(ATP7B):c.2071G>A (p.Gly691Arg) rs121908001
NM_000053.3(ATP7B):c.2293G>A (p.Asp765Asn) rs28942075
NM_000053.3(ATP7B):c.2333G>T (p.Arg778Leu) rs28942074
NM_000053.3(ATP7B):c.2621C>T (p.Ala874Val) rs121907994
NM_000053.3(ATP7B):c.2755C>G (p.Arg919Gly) rs121907993
NM_000053.3(ATP7B):c.2827G>A (p.Gly943Ser) rs28942076
NM_000053.3(ATP7B):c.3207C>A (p.His1069Gln) rs76151636
NM_000053.3(ATP7B):c.3443T>C (p.Ile1148Thr) rs60431989
NM_000053.3(ATP7B):c.865C>T (p.Gln289Ter) rs121907999
NM_000055.2(BCHE):c.1072T>A (p.Leu358Ile) rs121918557
NM_000055.2(BCHE):c.1253G>T (p.Gly418Val) rs28933390
NM_000055.2(BCHE):c.1699G>A (p.Ala567Thr) rs1803274
NM_000055.2(BCHE):c.293A>G (p.Asp98Gly) rs1799807
NM_000055.2(BCHE):c.812C>T (p.Thr271Met) rs28933389
NM_000055.3(BCHE):c.1004T>C (p.Leu335Pro) rs104893684
NM_000057.2(BLM):c.2308-953_2555+4719del
NM_000057.3(BLM):c.2207_2212delATCTGAinsTAGATTC (p.Tyr736Leufs) rs113993962
NM_000057.3(BLM):c.557_559delCAA (p.Ser186_Pro521delinsTer) rs367543035
NM_000059.3(BRCA2):c.1114A>C (p.Asn372His) rs144848
NM_000059.3(BRCA2):c.3904_3906delACT (p.Thr1302del) rs80359414
NM_000059.3(BRCA2):c.5645C>G (p.Ser1882Ter) rs80358785
NM_000059.3(BRCA2):c.5946delT (p.Ser1982Argfs) rs80359550
NM_000059.3(BRCA2):c.631+1G>A rs81002897
NM_000059.3(BRCA2):c.658_659delGT (p.Val220Ilefs) rs80359604
NM_000059.3(BRCA2):c.7529T>C (p.Leu2510Pro) rs80358979
NM_000059.3(BRCA2):c.771_775delTCAAA (p.Asn257Lysfs) rs80359671
NM_000059.3(BRCA2):c.8165C>G (p.Thr2722Arg) rs80359062
NM_000059.3(BRCA2):c.8187G>T (p.Lys2729Asn) rs80359065
NM_000059.3(BRCA2):c.8488-1G>A rs397507404
NM_000061.2(BTK):c.1773C>A (p.Tyr591Ter) rs128621207
NM_000061.2(BTK):c.862C>T (p.Arg288Trp) rs128621194
NM_000063.5(C2):c.954G>C (p.Glu318Asp) rs9332739
NM_000064.3(C3):c.304C>G (p.Arg102Gly) rs2230199
NM_000064.3(C3):c.463A>C (p.Lys155Gln) rs147859257
NM_000067.2(CA2):c.754A>G (p.Asn252Asp) rs2228063
NM_000069.2(CACNA1S):c.1583G>A (p.Arg528His) rs80338777
NM_000069.2(CACNA1S):c.2691G>T (p.Arg897Ser) rs80338779
NM_000069.2(CACNA1S):c.3715C>G (p.Arg1239Gly) rs28930069
NM_000069.2(CACNA1S):c.3716G>A (p.Arg1239His) rs28930068
NM_000070.2(CAPN3):c.1469G>A (p.Arg490Gln) rs121434548
NM_000070.2(CAPN3):c.1715G>A (p.Arg572Gln) rs121434544
NM_000070.2(CAPN3):c.1795dupA (p.Thr599Asnfs) rs80338803
NM_000070.2(CAPN3):c.2306G>A (p.Arg769Gln) rs80338802
NM_000070.2(CAPN3):c.2362_2363delAGinsTCATCT (p.Arg788Serfs) rs1555423217
NM_000070.2(CAPN3):c.643_663del(p.Ser215_Gly221del) rs863224965
NM_000070.2(CAPN3):c.956C>T (p.Pro319Leu) rs121434547
NM_000070.3(CAPN3):c.549delA (p.Thr184Argfs) rs80338800
NM_000071.2(CBS):c.1058C>T (p.Thr353Met) rs121964972
NM_000071.2(CBS):c.1265C>T (p.Pro422Leu) rs28934892
NM_000071.2(CBS):c.1330G>A (p.Asp444Asn) rs28934891
NM_000071.2(CBS):c.1397C>T (p.Ser466Leu) rs121964971
NM_000071.2(CBS):c.1616T>C (p.Leu539Ser) rs121964968
NM_000071.2(CBS):c.341C>T (p.Ala114Val) rs121964964
NM_000071.2(CBS):c.430G>A (p.Glu144Lys) rs121964966
NM_000071.2(CBS):c.502G>A (p.Val168Met) rs121964970
NM_000071.2(CBS):c.797G>A (p.Arg266Lys) rs121964969
NM_000074.2(CD40LG):c.107T>G (p.Met36Arg) rs104894774
NM_000074.2(CD40LG):c.418T>G (p.Trp140Gly) rs104894777
NM_000075.3(CDK4):c.70C>T (p.Arg24Cys) rs11547328
NM_000075.3(CDK4):c.71G>A (p.Arg24His) rs104894340
NM_000076.2(CDKN1C):c.845C>G (p.Ser282Ter) rs267606716
NM_000077.4(CDKN2A):c.159G>C (p.Met53Ile) rs104894095
NM_000077.4(CDKN2A):c.167G>T (p.Ser56Ile) rs104894109
NM_000077.4(CDKN2A):c.176T>G (p.Val59Gly) rs104894099
NM_000077.4(CDKN2A):c.226_244del (p.Ala76Cysfs) rs587776716
NM_000077.4(CDKN2A):c.238C>T (p.Arg80Ter) rs121913388
NM_000077.4(CDKN2A):c.266G>A (p.Gly89Asp) rs137854599
NM_000077.4(CDKN2A):c.301G>T (p.Gly101Trp) rs104894094
NM_000077.4(CDKN2A):c.339_340delGCinsCT (p.Pro114Ser) rs387906410
NM_000077.4(CDKN2A):c.377T>A (p.Val126Asp) rs104894098
NM_000077.4(CDKN2A):c.71G>C (p.Arg24Pro) rs104894097
NM_000078.2(CETP):c.1264G>A (p.Val422Ile) rs5882
NM_000078.2(CETP):c.1376A>G (p.Asp459Gly) rs2303790
NM_000079.3(CHRNA1):c.805G>T (p.Val269Phe) rs137852803
NM_000080.3(CHRNE):c.37G>A (p.Gly13Arg) rs372635387
NM_000080.3(CHRNE):c.422C>T (p.Pro141Leu) rs121909512
NM_000080.3(CHRNE):c.488C>T (p.Ser163Leu) rs121909516
NM_000080.3(CHRNE):c.991C>T (p.Arg331Trp) rs121909515
NM_000081.3(LYST):c.118_119insG (p.Ala40Glyfs) rs80338642
NM_000081.3(LYST):c.1467del (p.Glu489Aspfs) rs80338644
NM_000081.3(LYST):c.148C>T (p.Arg50Ter) rs80338643
NM_000081.3(LYST):c.1902dupA (p.Ala635Serfs) rs80338646
NM_000081.3(LYST):c.2623delT (p.Tyr875Metfs) rs80338649
NM_000081.3(LYST):c.3085C>T (p.Gln1029Ter) rs80338651
NM_000081.3(LYST):c.3310C>T (p.Arg1104Ter) rs80338652
NM_000081.3(LYST):c.4688G>A (p.Arg1563His) rs80338657
NM_000081.3(LYST):c.5996T>A (p.Val1999Asp) rs28942077
NM_000081.3(LYST):c.9590del (p.Tyr3197Leufs) rs80338667
NM_000082.3(ERCC8):c.479C>T (p.Ala160Val) rs121434325
NM_000082.3(ERCC8):c.613G>C (p.Ala205Pro) rs121434326
NM_000083.2(CLCN1):c.1439C>T (p.Pro480Leu) rs80356694
NM_000083.2(CLCN1):c.1444G>A (p.Gly482Arg) rs746125212
NM_000083.2(CLCN1):c.1655A>G (p.Gln552Arg) rs80356696
NM_000083.2(CLCN1):c.2680C>T (p.Arg894Ter) rs55960271
NM_000083.2(CLCN1):c.2795C>T (p.Pro932Leu) rs80356706
NM_000083.2(CLCN1):c.2926C>T (p.Arg976Ter) rs142539932
NM_000083.2(CLCN1):c.382A>G (p.Met128Val) rs80356699
NM_000083.2(CLCN1):c.689G>A (p.Gly230Glu) rs80356700
NM_000083.2(CLCN1):c.870C>G (p.Ile290Met) rs80356690
NM_000083.2(CLCN1):c.950G>A (p.Arg317Gln) rs80356702
NM_000084.4(CLCN5):c.731C>T (p.Ser244Leu) rs151340626
NM_000084.4(CLCN5):c.779G>T (p.Gly260Val) rs151340630
NM_000085.4(CLCNKB):c.1312C>T (p.Arg438Cys) rs121909133
NM_000086.2(CLN3):c.883G>A (p.Glu295Lys) rs121434286
NM_000087.3(CNGA1):c.959C>T rs62625014
NM_000088.3(COL1A1):c.3040C>T (p.Arg1014Cys) rs72653170
NM_000088.3(COL1A1):c.934C>T (p.Arg312Cys) rs72645347
NM_000089.3(COL1A2):c.2123G>A (p.Arg708Gln) rs72658163
NM_000089.3(COL1A2):c.226-2A>G rs72656355
NM_000090.3(COL3A1):c.1744G>A (p.Gly582Ser) rs121912923
NM_000090.3(COL3A1):c.3554G>A (p.Gly1185Asp) rs121912917
NM_000091.4(COL4A3):c.2954G>T (p.Gly985Val) rs121912827
NM_000091.4(COL4A3):c.3499G>A (p.Gly1167Arg) rs267606745
NM_000091.4(COL4A3):c.4571C>G (p.Ser1524Ter) rs121912825
NM_000092.4(COL4A4):c.2690G>A (p.Gly897Glu) rs121912860
NM_000093.4(COL5A1):c.4916G>C (p.Cys1639Ser) rs80338764
NM_000095.2(COMP):c.1417_1419dupGAC (p.Asp473_Asn474insAsp)
NM_000095.2(COMP):c.2152C>T (p.Arg718Trp) rs28936368
NM_000095.2(COMP):c.2156G>A (p.Gly719Asp) rs137852655
NM_000096.3(CP):c.1286_1287insTACAC (p.Asp430Thrfs) rs386134145
NM_000096.3(CP):c.2389delG (p.Glu797Argfs) rs386134149
NM_000096.3(CP):c.2630G>A (p.Trp877Ter) rs121909579
NM_000096.3(CP):c.3019-1G>A rs386134142
NM_000096.3(CP):c.606dupA (p.Asp203Argfs) rs386134143
NM_000097.5(CPOX):c.1210A>G (p.Lys404Glu) rs121917868
NM_000098.2(CPT2):c.1148T>A (p.Phe383Tyr) rs74315295
NM_000098.2(CPT2):c.1507C>T (p.Arg503Cys) rs74315296
NM_000098.2(CPT2):c.1657G>A (p.Asp553Asn) rs28936376
NM_000098.2(CPT2):c.1883A>C (p.Tyr628Ser) rs28936673
NM_000098.2(CPT2):c.338C>T (p.Ser113Leu) rs74315294
NM_000098.2(CPT2):c.359A>G (p.Tyr120Cys) rs121918528
NM_000098.2(CPT2):c.520G>A (p.Glu174Lys) rs28936674
NM_000098.2(CPT2):c.680C>T (p.Pro227Leu) rs74315298
NM_000100.3(CSTB):c.67-1G>C rs147484110
NM_000101.4(CYBA):c.214T>C (p.Tyr72His) rs4673
NM_000102.3(CYP17A1):c.1435_1438dupATCC (p.Pro480Hisfs) rs556794126
NM_000102.3(CYP17A1):c.715C>T (p.Arg239Ter) rs104894136
NM_000104.3(CYP1B1):c.1103G>A (p.Arg368His) rs79204362
NM_000104.3(CYP1B1):c.1120G>A (p.Asp374Asn) rs104893622
NM_000104.3(CYP1B1):c.155C>T (p.Pro52Leu) rs201824781
NM_000104.3(CYP1B1):c.182G>A (p.Gly61Glu) rs28936700
NM_000104.3(CYP1B1):c.241T>A (p.Tyr81Asn) rs9282671
NM_000106.5(CYP2D6):c.454delT (p.Trp152Glyfs) rs5030655
NM_000106.5(CYP2D6):c.505G>T (p.Gly169Ter) rs5030865
NM_000106.5(CYP2D6):c.506-1G>A rs3892097
NM_000106.5(CYP2D6):c.775delA (p.Arg259Glyfs) rs35742686
NM_000106.6(CYP2D6):c.100C>T (p.Pro34Ser) rs1065852
NM_000108.3(DLD):c.1123G>A (p.Glu375Lys) rs121964992
NM_000108.4(DLD):c.104dupA (p.Tyr35Terfs) rs753234219
NM_000110.3(DPYD):c.1905+1G>A rs3918290
NM_000110.3(DPYD):c.2657G>A (p.Arg886His) rs1801267
NM_000110.3(DPYD):c.85T>C (p.Cys29Arg) rs1801265
NM_000111.2(SLC26A3):c.2024_2026dupTCA (p.Ile675_Arg676insIle) rs121913031
NM_000112.3(SLC26A2):c.-26+2T>C rs386833492
NM_000112.3(SLC26A2):c.1020_1022delTGT (p.Val341del) rs121908077
NM_000112.3(SLC26A2):c.1273A>G (p.Asn425Asp) rs104893920
NM_000112.3(SLC26A2):c.1361A>C (p.Gln454Pro) rs104893921
NM_000112.3(SLC26A2):c.1724delA (p.Lys575Serfs) rs386833498
NM_000112.3(SLC26A2):c.1957T>A (p.Cys653Ser) rs104893924
NM_000112.3(SLC26A2):c.2033G>T (p.Gly678Val) rs104893916
NM_000112.3(SLC26A2):c.2144C>T (p.Ala715Val) rs104893918
NM_000112.3(SLC26A2):c.391delC (p.Leu131Cysfs) rs786200881
NM_000112.3(SLC26A2):c.532C>T (p.Arg178Ter) rs104893919
NM_000112.3(SLC26A2):c.764G>A (p.Gly255Glu) rs104893917
NM_000112.3(SLC26A2):c.835C>T (p.Arg279Trp) rs104893915
NM_000113.2(TOR1A):c.613T>A (p.Phe205Ile) rs267607134
NM_000113.2(TOR1A):c.646G>C (p.Asp216His) rs1801968
NM_000113.2(TOR1A):c.863G>A (p.Arg288Gln) rs727502811
NM_000113.2(TOR1A):c.907_909delGAG (p.Glu303del) rs80358233
NM_000115.4(EDNRB):c.169G>A (p.Gly57Ser) rs1801710
NM_000115.4(EDNRB):c.828G>T (p.Trp276Cys) rs104894387
NM_000119.2(EPB42):c.424G>A (p.Ala142Thr) rs104894487
NM_000121.3(EPOR):c.1317G>A (p.Trp439Ter) rs121918116
NM_000121.3(EPOR):c.1460A>G (p.Asn487Ser) rs62638745
NM_000123.3(ERCC5):c.2375C>T (p.Ala792Val) rs121434571
NM_000123.3(ERCC5):c.2620G>A (p.Ala874Thr) rs121434576
NM_000124.3(ERCC6):c.1518delG (p.Lys506Asnfs) rs786205168
NM_000124.3(ERCC6):c.2047C>T (p.Arg683Ter) rs121917904
NM_000124.3(ERCC6):c.3284C>G (p.Pro1095Arg) rs4253208
NM_000124.3(ERCC6):c.643G>T (p.Glu215Ter) rs875989810
NM_000125.3(ESR1):c.1181G>A (p.Arg394His) rs1131692059
NM_000128.3(F11):c.1253G>T (p.Gly418Val) rs121965071
NM_000128.3(F11):c.166T>C (p.Cys56Arg) rs121965069
NM_000128.3(F11):c.809A>T (p.Lys270Ile) rs121965070
NM_000128.3(F11):c.901T>C (p.Phe301Leu) rs121965064
NM_000129.3(F13A1):c.103G>T (p.Val35Leu) rs5985
NM_000129.3(F13A1):c.782G>A (p.Arg261His) rs121913071
NM_000130.4(F5):c.1601G>A (p.Arg534Gln) rs6025
NM_000131.4(F7):c.1238G>A (p.Arg413Gln) rs6046
NM_000132.3(F8):c.1648C>G (p.Arg550Gly) rs137852417
NM_000132.3(F8):c.1660A>G (p.Ser554Gly) rs137852419
NM_000132.3(F8):c.3169G>A (p.Glu1057Lys) rs28933673
NM_000133.3(F9):c.224G>A (p.Arg75Gln) rs137852228
NM_000133.3(F9):c.580A>G (p.Thr194Ala) rs6048
NM_000133.3(F9):c.819T>C (p.Val273=) rs1800455
NM_000135.2(FANCA):c.1115_1118delTTGG (p.Val372Alafs) rs397507552
NM_000135.2(FANCA):c.3788_3790delTCT (p.Phe1263del) rs397507553
NM_000135.3(FANCA):c.2557C>T (p.Arg853Ter) rs752160950
NM_000135.4(FANCA):c.2639G>A (p.Arg880Gln) rs372254398
NM_000135.4(FANCA):c.3913C>T (p.Leu1305Phe) rs753700179
NM_000136.2(FANCC):c.1642C>T (p.Arg548Ter) rs104886457
NM_000136.2(FANCC):c.37C>T (p.Gln13Ter) rs121917784
NM_000137.2(FAH):c.1009G>A (p.Gly337Ser) rs80338900
NM_000137.2(FAH):c.1021C>T (p.Arg341Trp) rs11555096
NM_000137.2(FAH):c.1062+5G>A rs80338901
NM_000137.2(FAH):c.1069G>T (p.Glu357Ter) rs121965075
NM_000137.2(FAH):c.401C>A (p.Ala134Asp) rs121965074
NM_000137.2(FAH):c.554-1G>T rs80338895
NM_000137.2(FAH):c.786G>A (p.Trp262Ter) rs80338899
NM_000138.4(FBN1):c.1453C>T (p.Arg485Cys) rs137854485
NM_000138.4(FBN1):c.2261A>G (p.Tyr754Cys) rs137854479
NM_000138.4(FBN1):c.2920C>T (p.Arg974Cys) rs397514558
NM_000138.4(FBN1):c.3217G>A (p.Glu1073Lys) rs137854478
NM_000138.4(FBN1):c.3379G>A (p.Gly1127Ser) rs137854468
NM_000138.4(FBN1):c.3509G>A (p.Arg1170His) rs137854475
NM_000138.4(FBN1):c.364C>T (p.Arg122Cys) rs137854467
NM_000138.4(FBN1):c.3725G>A (p.Cys1242Tyr) rs137854471
NM_000138.4(FBN1):c.4781G>A (p.Gly1594Asp) rs267606798
NM_000138.4(FBN1):c.5284G>A (p.Gly1762Ser) rs387906623
NM_000138.4(FBN1):c.5788+5G>A rs193922219
NM_000138.4(FBN1):c.6354C>T (p.Ile2118=) rs112989722
NM_000138.4(FBN1):c.6431A>G (p.Asn2144Ser) rs137854461
NM_000138.4(FBN1):c.718C>T (p.Arg240Cys) rs137854480
NM_000138.4(FBN1):c.7339G>A (p.Glu2447Lys) rs137854464
NM_000138.4(FBN1):c.7726C>T (p.Arg2576Cys) rs147195031
NM_000138.4(FBN1):c.8176C>T (p.Arg2726Trp) rs61746008
NM_000138.4(FBN1):c.8226+1G>A rs398122833
NM_000138.4(FBN1):c.8326C>T (p.Arg2776Ter) rs137854466
NM_000140.3(FECH):c.315-48T>C rs2272783
NM_000140.4(FECH):c.163G>T (p.Gly55Cys) rs3848519
NM_000140.4(FECH):c.801G>A (p.Met267Ile) rs118204037
NM_000141.4(FGFR2):c.1025G>A (p.Cys342Tyr) rs121918487
NM_000141.4(FGFR2):c.1040C>G (p.Ser347Cys) rs121918494
NM_000141.4(FGFR2):c.1115C>G (p.Ser372Cys) rs121913477
NM_000141.4(FGFR2):c.1124A>G (p.Tyr375Cys) rs121913478
NM_000141.4(FGFR2):c.1694A>C (p.Glu565Ala) rs121918506
NM_000141.4(FGFR2):c.755_756delCGinsTT (p.Ser252Phe) rs121918498
NM_000141.4(FGFR2):c.758C>G (p.Pro253Arg) rs77543610
NM_000141.4(FGFR2):c.870G>C (p.Trp290Cys) rs121918499
NM_000142.4(FGFR3):c.1024G>T (p.Gly342Cys) rs587778775
NM_000142.4(FGFR3):c.1108G>T (p.Gly370Cys) rs121913479
NM_000142.4(FGFR3):c.1111A>T (p.Ser371Cys) rs121913484
NM_000142.4(FGFR3):c.1118A>G (p.Tyr373Cys) rs121913485
NM_000142.4(FGFR3):c.1138G>A (p.Gly380Arg) rs28931614
NM_000142.4(FGFR3):c.1172C>A (p.Ala391Glu) rs28931615
NM_000142.4(FGFR3):c.1612A>G (p.Ile538Val) rs80053154
NM_000142.4(FGFR3):c.1619A>C (p.Asn540Thr) rs77722678
NM_000142.4(FGFR3):c.1619A>G (p.Asn540Ser) rs77722678
NM_000142.4(FGFR3):c.1620C>A (p.Asn540Lys) rs28933068
NM_000142.4(FGFR3):c.1948A>C (p.Lys650Gln) rs78311289
NM_000142.4(FGFR3):c.1948A>G (p.Lys650Glu) rs78311289
NM_000142.4(FGFR3):c.1949A>T (p.Lys650Met) rs121913105
NM_000142.4(FGFR3):c.1950G>T (p.Lys650Asn) rs28928868
NM_000142.4(FGFR3):c.2419T>A (p.Ter807Arg) rs121913101
NM_000142.4(FGFR3):c.2419T>G (p.Ter807Gly) rs121913101
NM_000142.4(FGFR3):c.2421A>T (p.Ter807Cys) rs121913103
NM_000142.4(FGFR3):c.251C>T (p.Ser84Leu) rs121913116
NM_000142.4(FGFR3):c.742C>T (p.Arg248Cys) rs121913482
NM_000142.4(FGFR3):c.746C>G (p.Ser249Cys) rs121913483
NM_000143.3(FH):c.302G>C (p.Arg101Pro) rs75086406
NM_000143.3(FH):c.521C>G (p.Pro174Arg) rs199822819
NM_000143.3(FH):c.698G>T (p.Arg233Leu) rs121913123
NM_000145.3(FSHR):c.1760C>A (p.Pro587His) rs386833512
NM_000145.3(FSHR):c.479T>C (p.Ile160Thr) rs121909659
NM_000145.3(FSHR):c.919G>A (p.Ala307Thr) rs6165
NM_000148.3(FUT1):c.725T>G (p.Leu242Arg) rs28934588
NM_000150.2(FUT6):c.739G>A (p.Glu247Lys) rs17855739
NM_000151.3(G6PC):c.229T>C (p.Trp77Arg) rs104894566
NM_000151.3(G6PC):c.328G>A (p.Glu110Lys) rs104894567
NM_000151.3(G6PC):c.379_380dupTA (p.Tyr128Thrfs) rs80356488
NM_000151.3(G6PC):c.648G>T (p.Leu216=) rs80356484
NM_000151.3(G6PC):c.883C>T (p.Arg295Cys) rs104894563
NM_000152.3(GAA):c.2065G>A (p.Glu689Lys) rs1800309
NM_000152.3(GAA):c.2560C>T (p.Arg854Ter) rs121907943
NM_000152.3(GAA):c.271G>A (p.Asp91Asn) rs1800299
NM_000152.3(GAA):c.525delT (p.Glu176Argfs) rs386834235
NM_000152.3(GAA):c.953T>C (p.Met318Thr) rs121907936
NM_000152.4(GAA):c.-32-13T>G rs386834236
NM_000152.4(GAA):c.1561G>A (p.Glu521Lys) rs121907937
NM_000152.4(GAA):c.1935C>A (p.Asp645Glu) rs28940868
NM_000152.4(GAA):c.2173C>T (p.Arg725Trp) rs121907938
NM_000152.4(GAA):c.2482_2646del165 (p.Gly828_Asn882del) rs1555603048
NM_000152.4(GAA):c.710C>T (p.Ala237Val) rs121907944
NM_000153.3(GALC):c.857G>A (p.Gly286Asp) rs199847983
NM_000154.1(GALK1):c.593C>T (p.Ala198Val) rs80084721
NM_000154.1(GALK1):c.94G>A (p.Val32Met) rs104894576
NM_000155.2(GALT):c.-119_-116delGTCA rs111033640
NM_000155.3(GALT):c.404C>T (p.Ser135Leu) rs111033690
NM_000155.3(GALT):c.512T>C (p.Phe171Ser) rs111033715
NM_000155.3(GALT):c.547C>A (p.Pro183Thr) rs111033721
NM_000155.3(GALT):c.607G>A (p.Glu203Lys) rs111033736
NM_000155.3(GALT):c.940A>G (p.Asn314Asp) rs2070074
NM_000155.3(GALT):c.957C>A (p.His319Gln) rs111033792
NM_000155.3(GALT):c.997C>T (p.Arg333Trp) rs111033800
NM_000156.5(GAMT):c.59G>C (p.Trp20Ser) rs80338734
NM_000157.3(GBA):c.1246G>A (p.Gly416Ser) rs121908311
NM_000157.3(GBA):c.1342G>C (p.Asp448His) rs1064651
NM_000157.3(GBA):c.1448T>C rs421016
NM_000157.3(GBA):c.1604G>A (p.Arg535His) rs75822236
NM_000157.3(GBA):c.476G>A (p.Arg159Gln) rs79653797
NM_000157.3(GBA):c.509G>T (p.Arg170Leu) rs80356763
NM_000157.3(GBA):c.754T>A (p.Phe252Ile) rs381737
NM_000158.3(GBE1):c.143+1G>A rs397515343
NM_000158.3(GBE1):c.1543C>T (p.Arg515Cys) rs80338672
NM_000158.3(GBE1):c.1544G>A (p.Arg515His) rs201958741
NM_000158.3(GBE1):c.1570C>T (p.Arg524Ter) rs137852888
NM_000158.3(GBE1):c.1571G>A (p.Arg524Gln) rs80338673
NM_000158.3(GBE1):c.1634A>G (p.His545Arg) rs137852889
NM_000158.3(GBE1):c.1643G>A (p.Trp548Ter) rs137852894
NM_000158.3(GBE1):c.1774G>T (p.Glu592Ter) rs137852890
NM_000158.3(GBE1):c.1883A>G (p.His628Arg) rs137852891
NM_000158.3(GBE1):c.671T>C (p.Leu224Pro) rs137852886
NM_000158.3(GBE1):c.691+5G>C rs397515344
NM_000158.3(GBE1):c.771T>A (p.Phe257Leu) rs137852887
NM_000158.3(GBE1):c.986A>C (p.Tyr329Ser) rs80338671
NM_000158.3(GBE1):c.993-?_1618+?del
NM_000159.3(GCDH):c.1093G>A (p.Glu365Lys) rs121434370
NM_000159.3(GCDH):c.1198G>A (p.Val400Met) rs121434372
NM_000159.3(GCDH):c.1204C>T (p.Arg402Trp) rs121434369
NM_000159.3(GCDH):c.680G>C (p.Arg227Pro) rs121434373
NM_000159.3(GCDH):c.877G>A (p.Ala293Thr) rs121434371
NM_000161.2(GCH1):c.323G>A (p.Gly108Asp) rs104894435
NM_000161.2(GCH1):c.671A>G (p.Lys224Arg) rs41298442
NM_000161.2(GCH1):c.747G>C (p.Arg249Ser) rs104894442
NM_000162.3(GCK):c.629T>A (p.Met210Lys) rs80356654
NM_000162.3(GCK):c.683C>T (p.Thr228Met) rs80356655
NM_000163.4(GHR):c.1630A>C (p.Ile544Leu) rs6180
NM_000163.4(GHR):c.484G>A (p.Val162Ile) rs6413484
NM_000163.4(GHR):c.535C>T (p.Arg179Cys) rs121909362
NM_000165.5(GJA1):c.1085G>A (p.Arg362Gln) rs2227885
NM_000165.5(GJA1):c.226C>A (p.Arg76Ser) rs267606845
NM_000165.5(GJA1):c.65G>A (p.Gly22Glu) rs104893964
NM_000165.5(GJA1):c.681A>T (p.Glu227Asp) rs875989815
NM_000165.5(GJA1):c.716G>A (p.Arg239Gln) rs764670582
NM_000166.5(GJB1):c.164C>T (p.Thr55Ile) rs104894824
NM_000166.5(GJB1):c.407T>C (p.Val136Ala) rs104894826
NM_000166.5(GJB1):c.415G>A (p.Val139Met) rs104894812
NM_000166.5(GJB1):c.467T>G (p.Leu156Arg) rs104894818
NM_000166.5(GJB1):c.614A>G (p.Asn205Ser) rs104894822
NM_000166.5(GJB1):c.704T>G (p.Phe235Cys) rs104894825
NM_000168.5(GLI3):c.2012delG (p.Gly671Glufs) rs116840743
NM_000168.5(GLI3):c.2023delG (p.Glu675Serfs) rs116840744
NM_000168.5(GLI3):c.2119C>T (p.Pro707Ser) rs121917716
NM_000168.5(GLI3):c.2179G>A (p.Gly727Arg) rs121917710
NM_000168.5(GLI3):c.2188_2206delCTTCCTCTGACCGATGGAG (p.Leu730Valfs) rs116840754
NM_000168.5(GLI3):c.2770_2771insNC_012920.1:g.12243..12314
NM_000168.5(GLI3):c.3439G>T (p.Glu1147Ter) rs116840768
NM_000169.2(GLA):c.1066C>T (p.Arg356Trp) rs104894827
NM_000169.2(GLA):c.427G>A (p.Ala143Thr) rs104894845
NM_000169.2(GLA):c.427G>C (p.Ala143Pro) rs104894845
NM_000169.2(GLA):c.484T>C (p.Trp162Arg) rs28935196
NM_000169.2(GLA):c.639+919G>A rs199473684
NM_000169.2(GLA):c.937G>T (p.Asp313Tyr) rs28935490
NM_000170.2(GLDC):c.1166C>T (p.Ala389Val) rs121964979
NM_000170.2(GLDC):c.1545G>C (p.Arg515Ser) rs121964976
NM_000170.2(GLDC):c.1691G>T (p.Ser564Ile) rs121964974
NM_000170.2(GLDC):c.2267_2269delTCT (p.Phe756del) rs121964975
NM_000171.3(GLRA1):c.896G>T (p.Arg299Leu) rs121918408
NM_000171.3(GLRA1):c.920A>G (p.Tyr307Cys) rs121918410
NM_000174.4(GP9):c.182A>G (p.Asn61Ser) rs5030764
NM_000178.4(GSS):c.941C>T (p.Pro314Leu) rs75863437
NM_000179.2(MSH6):c.10C>T (p.Gln4Ter) rs786201042
NM_000179.2(MSH6):c.2633T>C (p.Val878Ala) rs2020912
NM_000179.2(MSH6):c.3386_3388delGTG (p.Cys1129_Val1130delinsLeu) rs587776705
NM_000180.3(GUCY2D):c.154G>T (p.Ala52Ser) rs61749665
NM_000180.3(GUCY2D):c.2513G>A (p.Arg838His) rs61750173
NM_000181.3(GUSB):c.1069C>T (p.Arg357Ter) rs121918185
NM_000181.3(GUSB):c.1144C>T (p.Arg382Cys) rs121918173
NM_000182.4(HADHA):c.1132C>T (p.Gln378Ter) rs137852770
NM_000182.4(HADHA):c.180+1G>A rs786205088
NM_000182.4(HADHA):c.914T>A (p.Ile305Asn) rs137852774
NM_000183.2(HADHB):c.182G>A (p.Arg61His) rs121913132
NM_000183.2(HADHB):c.740G>A (p.Arg247His) rs121913133
NM_000186.3(CFH):c.1204C= (p.His402=) rs1061170
NM_000186.3(CFH):c.184G>A (p.Val62Ile) rs800292
NM_000186.3(CFH):c.3572C>T (p.Ser1191Leu) rs460897
NM_000186.3(CFH):c.3628C>T (p.Arg1210Cys) rs121913059
NM_000187.3(HGD):c.1102A>G (p.Met368Val) rs120074173
NM_000187.3(HGD):c.16-1G>A rs397515347
NM_000187.3(HGD):c.175delA (p.Ser59Alafs) rs397515517
NM_000187.3(HGD):c.457dupG (p.Asp153Glyfs) rs397515346
NM_000187.3(HGD):c.481G>A (p.Gly161Arg) rs28941783
NM_000187.3(HGD):c.688C>T (p.Pro230Ser) rs28942100
NM_000187.3(HGD):c.808G>A (p.Gly270Arg) rs120074174
NM_000187.3(HGD):c.899T>G (p.Val300Gly) rs120074170
NM_000190.4(HMBS):c.500G>A (p.Arg167Gln) rs118204095
NM_000190.4(HMBS):c.601C>T (p.Arg201Trp) rs118204109
NM_000190.4(HMBS):c.667G>A (p.Glu223Lys) rs118204110
NM_000191.2(HMGCL):c.206_207delCT (p.Ser69Cysfs) rs752137615
NM_000191.2(HMGCL):c.208G>C (p.Val70Leu) rs121964996
NM_000192.3(TBX5):c.710G>A (p.Arg237Gln) rs104894378
NM_000193.3(SHH):c.1132_1140del (p.Ala378_Phe380del) rs397515376
NM_000193.3(SHH):c.1147G>A (p.Ala383Thr) rs137853341
NM_000193.3(SHH):c.1270C>G (p.Pro424Ala) rs104894048
NM_000193.3(SHH):c.263A>T (p.Asp88Val) rs104894050
NM_000193.3(SHH):c.298C>T (p.Gln100Ter) rs104894044
NM_000193.3(SHH):c.313A>T (p.Lys105Ter) rs104894045
NM_000193.3(SHH):c.345C>A (p.Asn115Lys) rs267607047
NM_000193.3(SHH):c.349T>C (p.Trp117Arg) rs104894040
NM_000193.3(SHH):c.349T>G (p.Trp117Gly) rs104894040
NM_000193.3(SHH):c.671T>A (p.Val224Glu) rs104894042
NM_000193.3(SHH):c.676G>A (p.Ala226Thr) rs104894043
NM_000193.3(SHH):c.766G>T (p.Glu256Ter) rs104894051
NM_000193.3(SHH):c.788_808del21 (p.Arg263_Ala269del) rs397515375
NM_000193.3(SHH):c.850G>T (p.Glu284Ter) rs104894046
NM_000193.3(SHH):c.869G>A (p.Gly290Asp) rs104894047
NM_000193.3(SHH):c.91G>A (p.Gly31Arg) rs28936675
NM_000194.2(HPRT1):c.122T>C (p.Leu41Pro) rs137852480
NM_000194.2(HPRT1):c.151C>G (p.Arg51Gly) rs137852494
NM_000194.2(HPRT1):c.151C>T (p.Arg51Ter) rs137852494
NM_000194.2(HPRT1):c.155A>G (p.Asp52Gly) rs137852502
NM_000194.2(HPRT1):c.170T>C (p.Met57Thr) rs137852495
NM_000194.2(HPRT1):c.172G>A (p.Gly58Arg) rs137852500
NM_000194.2(HPRT1):c.209G>A (p.Gly70Glu) rs137852487
NM_000194.2(HPRT1):c.211G>C (p.Gly71Arg) rs137852488
NM_000194.2(HPRT1):c.222C>A (p.Phe74Leu) rs137852481
NM_000194.2(HPRT1):c.232C>G (p.Leu78Val) rs137852501
NM_000194.2(HPRT1):c.239A>T (p.Asp80Val) rs137852478
NM_000194.2(HPRT1):c.312C>A (p.Ser104Arg) rs137852485
NM_000194.2(HPRT1):c.329C>T (p.Ser110Leu) rs137852482
NM_000194.2(HPRT1):c.389T>A (p.Val130Asp) rs137852483
NM_000194.2(HPRT1):c.396T>G (p.Ile132Met) rs137852477
NM_000194.2(HPRT1):c.419G>A (p.Gly140Asp) rs137852503
NM_000194.2(HPRT1):c.459T>G (p.Tyr153Ter) rs137852505
NM_000194.2(HPRT1):c.46G>A (p.Gly16Ser) rs137852499
NM_000194.2(HPRT1):c.481G>T (p.Ala161Ser) rs137852484
NM_000194.2(HPRT1):c.582C>G (p.Asp194Glu) rs137852504
NM_000194.2(HPRT1):c.595T>G (p.Phe199Val) rs137852486
NM_000194.2(HPRT1):c.602A>G (p.Asp201Gly) rs137852479
NM_000194.2(HPRT1):c.643_*6del21 (p.Lys215fs) rs387906428
NM_000195.3(HPS1):c.1996G>T (p.Glu666Ter) rs121908385
NM_000195.4(HPS1):c.1472_1487dup16 (p.His497Glnfs) rs281865163
NM_000195.4(HPS1):c.397G>T (p.Glu133Ter) rs121908386
NM_000195.4(HPS1):c.398+5G>A rs281865077
NM_000195.4(HPS1):c.972delC (p.Met325Trpfs) rs281865082
NM_000195.4(HPS1):c.972dupC (p.Met325Hisfs) rs281865082
NM_000196.3(HSD11B2):c.343_348del (p.Glu115_Leu116del) rs794726669
NM_000196.3(HSD11B2):c.622C>T (p.Arg208Cys) rs121917780
NM_000197.2(HSD17B3):c.238C>T (p.Arg80Trp) rs119481077
NM_000199.3(SGSH):c.1105G>A (p.Glu369Lys) rs104894640
NM_000199.3(SGSH):c.1298G>A (p.Arg433Gln) rs104894641
NM_000199.3(SGSH):c.1339G>A (p.Glu447Lys) rs104894639
NM_000199.3(SGSH):c.220C>T (p.Arg74Cys) rs104894636
NM_000199.3(SGSH):c.449G>A (p.Arg150Gln) rs104894638
NM_000199.3(SGSH):c.617G>C (p.Arg206Pro) rs104894643
NM_000203.4(IDUA):c.1855C>G (p.Arg619Gly) rs121965031
NM_000203.4(IDUA):c.300-3C>G rs1226056948
NM_000203.4(IDUA):c.898G>A (p.Ala300Thr) rs121965030
NM_000204.4(CFI):c.355G>A (p.Gly119Arg) rs141853578
NM_000207.2(INS):c.127T>G (p.Cys43Gly) rs80356666
NM_000207.2(INS):c.143T>G (p.Phe48Cys) rs80356668
NM_000207.2(INS):c.265C>T (p.Arg89Cys) rs80356669
NM_000207.2(INS):c.287G>A (p.Cys96Tyr) rs80356671
NM_000207.2(INS):c.71C>A (p.Ala24Asp) rs80356663
NM_000207.2(INS):c.94G>A (p.Gly32Ser) rs80356664
NM_000208.2(INSR):c.1195C>T (p.Arg399Ter) rs121913151
NM_000208.3(INSR):c.3034G>A (p.Val1012Met) rs1799816
NM_000209.3(PDX1):c.226G>A (p.Asp76Asn) rs137852783
NM_000209.3(PDX1):c.492G>T (p.Glu164Asp) rs80356661
NM_000209.3(PDX1):c.52T>C (p.Cys18Arg) rs137852785
NM_000209.3(PDX1):c.532G>A (p.Glu178Lys) rs80356662
NM_000209.3(PDX1):c.670G>A (p.Glu224Lys) rs137852787
NM_000211.4(ITGB2):c.1756C>T (p.Arg586Trp) rs5030672
NM_000211.4(ITGB2):c.817G>A (p.Gly273Arg) rs137852618
NM_000212.2(ITGB3):c.176T>C (p.Leu59Pro) rs5918
NM_000213.3(ITGB4):c.182G>A (p.Cys61Tyr) rs80338755
NM_000214.3(JAG1):c.701G>A (p.Cys234Tyr) rs121918353
NM_000214.3(JAG1):c.821G>A (p.Gly274Asp) rs28939668
NM_000217.3(KCNA1):c.1249C>T (p.Arg417Ter) rs104894358
NM_000217.3(KCNA1):c.676A>G (p.Thr226Ala) rs104894354
NM_000217.3(KCNA1):c.677C>G (p.Thr226Arg) rs28933383
NM_000218.2(KCNQ1):c.1552C>T (p.Arg518Ter) rs17215500
NM_000218.2(KCNQ1):c.1573G>A (p.Ala525Thr) rs120074188
NM_000218.2(KCNQ1):c.160_168dupATCGCGCCC (p.Pro56_Gly57insIleAlaPro) rs397515877
NM_000218.2(KCNQ1):c.1747C>T (p.Arg583Cys) rs17221854
NM_000218.2(KCNQ1):c.1893dupC (p.Arg632Glnfs) rs397508104
NM_000218.2(KCNQ1):c.211_219delGCCGCGCCC (p.Ala71_Pro73del) rs397508107
NM_000218.2(KCNQ1):c.421G>A (p.Val141Met) rs199472687
NM_000218.2(KCNQ1):c.760G>A (p.Val254Met) rs120074179
NM_000218.2(KCNQ1):c.898G>A (p.Ala300Thr) rs120074187
NM_000218.2(KCNQ1):c.914G>C (p.Trp305Ser) rs120074186
NM_000219.5(KCNE1):c.221C>T (p.Ser74Leu) rs74315446
NM_000219.5(KCNE1):c.226G>A (p.Asp76Asn) rs74315445
NM_000219.5(KCNE1):c.253G>A (p.Asp85Asn) rs1805128
NM_000222.2(KIT):c.1676T>A (p.Val559Asp) rs121913517
NM_000222.2(KIT):c.1676T>C (p.Val559Ala) rs121913517
NM_000222.2(KIT):c.1679_1681del (p.Val560del) rs121913685
NM_000222.2(KIT):c.1924A>G (p.Lys642Glu) rs121913512
NM_000222.2(KIT):c.2446G>C (p.Asp816His) rs121913506
NM_000222.2(KIT):c.2446G>T (p.Asp816Tyr) rs121913506
NM_000222.2(KIT):c.2447A>T (p.Asp816Val) rs121913507
NM_000222.2(KIT):c.2515G>A (p.Glu839Lys) rs121913509
NM_000224.2(KRT18):c.383A>T (p.His128Leu) rs57758506
NM_000226.3(KRT9):c.487C>T (p.Arg163Trp) rs59616921
NM_000226.3(KRT9):c.488G>A (p.Arg163Gln) rs57758262
NM_000227.4(LAMA3):c.151dup (p.Val51Glyfs) rs80356678
NM_000228.2(LAMB3):c.124C>T (p.Arg42Ter) rs80356680
NM_000228.2(LAMB3):c.1903C>T (p.Arg635Ter) rs80356682
NM_000228.2(LAMB3):c.596G>C (p.Gly199Ala) rs121912486
NM_000228.2(LAMB3):c.628+42G>A rs587776812
NM_000231.2(SGCG):c.787G>A (p.Glu263Lys) rs104894423
NM_000231.2(SGCG):c.848G>A (p.Cys283Tyr) rs104894422
NM_000232.4(SGCB):c.272G>T (p.Arg91Leu) rs104893869
NM_000232.4(SGCB):c.299T>A (p.Met100Lys) rs104893871
NM_000232.4(SGCB):c.452C>G (p.Thr151Arg) rs28936383
NM_000232.4(SGCB):c.552T>G (p.Tyr184Ter) rs104893868
NM_000233.3(LHCGR):c.1193T>C (p.Met398Thr) rs121912526
NM_000235.3(LIPA):c.482del (p.Asn161Ilefs) rs762559980
NM_000235.3(LIPA):c.599T>C (p.Leu200Pro) rs121965086
NM_000235.4(LIPA):c.594dup (p.Ala199Cysfs) rs780495201
NM_000236.2(LIPC):c.-293G>A rs2070895
NM_000236.2(LIPC):c.866C>T (p.Ser289Phe) rs121912502
NM_000237.3(LPL):c.*1671T>C rs13702
NM_000237.3(LPL):c.106G>A (p.Asp36Asn) rs1801177
NM_000237.3(LPL):c.1421C>G (p.Ser474Ter) rs328
NM_000237.3(LPL):c.953A>G (p.Asn318Ser) rs268
NM_000238.3(KCNH2):c.1682C>T (p.Ala561Val) rs121912504
NM_000238.3(KCNH2):c.1882G>A (p.Gly628Ser) rs121912507
NM_000238.3(KCNH2):c.2255G>A (p.Arg752Gln) rs121912512
NM_000238.3(KCNH2):c.2350C>T (p.Arg784Trp) rs12720441
NM_000238.3(KCNH2):c.2738C>T (p.Ala913Val) rs77331749
NM_000238.3(KCNH2):c.298C>G (p.Arg100Gly) rs121912515
NM_000240.3(MAOA):c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) rs1346551029
NM_000242.2(MBL2):c.170G>A (p.Gly57Glu) rs1800451
NM_000243.2(MEFV):c.1105C>T (p.Pro369Ser) rs11466023
NM_000243.2(MEFV):c.1223G>A (p.Arg408Gln) rs11466024
NM_000243.2(MEFV):c.2080A>G (p.Met694Val) rs61752717
NM_000243.2(MEFV):c.2082G>A (p.Met694Ile) rs28940578
NM_000243.2(MEFV):c.2084A>G rs104895094
NM_000243.2(MEFV):c.2177T>C (p.Val726Ala) rs28940579
NM_000243.2(MEFV):c.2230G>T rs61732874
NM_000243.2(MEFV):c.2282G>A (p.Arg761His) rs104895097
NM_000243.2(MEFV):c.442G>C (p.Glu148Gln) rs3743930
NM_000243.2(MEFV):c.443A>T (p.Glu148Val) rs104895076
NM_000243.2(MEFV):c.501G>C (p.Glu167Asp) rs104895079
NM_000243.2(MEFV):c.800C>T (p.Thr267Ile) rs104895081
NM_000248.3(MITF):c.952G>A (p.Glu318Lys) rs149617956
NM_000249.3(MLH1):c.-42C>T rs41285097
NM_000249.3(MLH1):c.-93G>A rs1800734
NM_000249.3(MLH1):c.1733A>G (p.Glu578Gly) rs63751612
NM_000249.3(MLH1):c.1852_1853delAAinsGC (p.Lys618Ala) rs35502531
NM_000249.3(MLH1):c.2041G>A (p.Ala681Thr) rs63750217
NM_000249.3(MLH1):c.218T>G (p.Leu73Arg) rs397514684
NM_000249.3(MLH1):c.394G>C (p.Asp132His) rs28930073
NM_000249.3(MLH1):c.793C>T (p.Arg265Cys) rs63751194
NM_000250.1(MPO):c.1555_1568delATGGAACCCAACCC (p.Met519Profs) rs536522394
NM_000251.2(MSH2):c.1571G>C (p.Arg524Pro) rs63751207
NM_000251.2(MSH2):c.1915C>T (p.His639Tyr) rs28929484
NM_000251.2(MSH2):c.2006-5T>A rs267607990
NM_000251.2(MSH2):c.965G>A (p.Gly322Asp) rs4987188
NM_000253.3(MTTP):c.383T>C (p.Ile128Thr) rs3816873
NM_000254.2(MTR):c.2756A>G (p.Asp919Gly) rs1805087
NM_000254.2(MTR):c.2758C>G (p.His920Asp) rs121913579
NM_000254.2(MTR):c.3518C>T (p.Pro1173Leu) rs121913578
NM_000255.3(MMUT):c.313T>C (p.Trp105Arg) rs121918249
NM_000255.3(MMUT):c.52C>T (p.Gln18Ter) rs121918248
NM_000256.3(MYBPC3):c.1224-19G>A rs587776699
NM_000256.3(MYBPC3):c.1468G>A (p.Gly490Arg) rs200625851
NM_000256.3(MYBPC3):c.1624G>C (p.Glu542Gln) rs121909374
NM_000256.3(MYBPC3):c.2234A>G (p.Asp745Gly) rs727503190
NM_000256.3(MYBPC3):c.2459G>A (p.Arg820Gln) rs2856655
NM_000256.3(MYBPC3):c.2497G>A (p.Ala833Thr) rs199865688
NM_000256.3(MYBPC3):c.2618C>A (p.Pro873His) rs371401403
NM_000256.3(MYBPC3):c.2618C>T (p.Pro873Leu) rs371401403
NM_000256.3(MYBPC3):c.2864_2865delCT (p.Pro955Argfs) rs397515990
NM_000256.3(MYBPC3):c.3286G>T (p.Glu1096Ter) rs121909377
NM_000256.3(MYBPC3):c.3330+2T>G rs387906397
NM_000256.3(MYBPC3):c.3373G>A (p.Val1125Met) rs121909378
NM_000256.3(MYBPC3):c.3742_3759dup18 (p.Cys1253_Arg1254insGlyGlyIleTyrValCys) rs193922384
NM_000256.3(MYBPC3):c.3791G>T (p.Cys1264Phe) rs397514751
NM_000256.3(MYBPC3):c.821+5G>A rs397516077
NM_000256.3(MYBPC3):c.913_914delTT (p.Phe305Profs) rs397516080
NM_000257.2(MYH7):c.1208G>T (p.Arg403Leu) rs121913624
NM_000257.2(MYH7):c.2845G>A (p.Glu949Lys) rs121913629
NM_000257.2(MYH7):c.5378T>C (p.Leu1793Pro) rs121913654
NM_000257.2(MYH7):c.5647G>A (p.Glu1883Lys) rs121913652
NM_000257.3(MYH7):c.1046T>C (p.Met349Thr) rs121913640
NM_000257.3(MYH7):c.1322C>T (p.Thr441Met) rs121913653
NM_000257.3(MYH7):c.1357C>A (p.Arg453Ser) rs121913625
NM_000257.3(MYH7):c.1491G>T (p.Glu497Asp) rs267606911
NM_000257.3(MYH7):c.1816G>A (p.Val606Met) rs121913627
NM_000257.3(MYH7):c.2229G>C (p.Glu743Asp) rs397516139
NM_000257.3(MYH7):c.2770G>A (p.Glu924Lys) rs121913628
NM_000257.3(MYH7):c.5134C>T (p.Arg1712Trp) rs121913650
NM_000257.3(MYH7):c.5186_5188delAGA (p.Lys1729del) rs367543052
NM_000257.3(MYH7):c.5458C>T (p.Arg1820Trp) rs145734640
NM_000257.3(MYH7):c.728G>A (p.Arg243His) rs267606910
NM_000257.3(MYH7):c.732+1G>A rs730880850
NM_000257.3(MYH7):c.746G>A (p.Arg249Gln) rs3218713
NM_000257.3(MYH7):c.767G>A (p.Gly256Glu) rs121913633
NM_000257.4(MYH7):c.1357C>T (p.Arg453Cys) rs121913625
NM_000257.4(MYH7):c.1594T>C (p.Ser532Pro) rs121913642
NM_000257.4(MYH7):c.1750G>C (p.Gly584Arg) rs121913626
NM_000257.4(MYH7):c.2146G>A (p.Gly716Arg) rs121913638
NM_000257.4(MYH7):c.2156G>A (p.Arg719Gln) rs121913641
NM_000257.4(MYH7):c.2167C>T (p.Arg723Cys) rs121913630
NM_000257.4(MYH7):c.2221G>C (p.Gly741Arg) rs121913632
NM_000258.2(MYL3):c.427G>A (p.Glu143Lys) rs104893750
NM_000258.2(MYL3):c.461G>A (p.Arg154His) rs104893749
NM_000260.3(MYO7A):c.2011G>A (p.Gly671Ser) rs387906699
NM_000260.3(MYO7A):c.635G>A (p.Arg212His) rs28934610
NM_000260.3(MYO7A):c.652G>A (p.Asp218Asn) rs201539845
NM_000260.4(MYO7A):c.905G>A (p.Arg302His) rs41298135
NM_000261.1(MYOC):c.1102C>T (p.Gln368Ter) rs74315329
NM_000262.2(NAGA):c.479C>G (p.Ser160Cys) rs121434532
NM_000262.2(NAGA):c.973G>A (p.Glu325Lys) rs121434529
NM_000262.2(NAGA):c.986G>A (p.Arg329Gln) rs121434533
NM_000263.3(NAGLU):c.1444C>T (p.Arg482Trp) rs104894596
NM_000263.3(NAGLU):c.1562C>T (p.Pro521Leu) rs104894595
NM_000263.3(NAGLU):c.1694G>A (p.Arg565Gln) rs104894598
NM_000263.3(NAGLU):c.1694G>C (p.Arg565Pro) rs104894598
NM_000263.3(NAGLU):c.1928G>A (p.Arg643His) rs104894593
NM_000263.3(NAGLU):c.2021G>A (p.Arg674His) rs104894590
NM_000263.3(NAGLU):c.889C>T (p.Arg297Ter) rs104894592
NM_000264.3(PTCH1):c.1177G>A (p.Ala393Thr) rs199476091
NM_000264.3(PTCH1):c.2183C>T (p.Thr728Met) rs115556836
NM_000264.3(PTCH1):c.2479A>G (p.Ser827Gly) rs199476092
NM_000264.3(PTCH1):c.3155C>T (p.Thr1052Met) rs138911275
NM_000265.5(NCF1):c.75_76del (p.Tyr26Hisfs) rs4029402
NM_000266.3(NDP):c.125A>G (p.His42Arg) rs104894874
NM_000266.3(NDP):c.361C>T (p.Arg121Trp) rs104894878
NM_000267.3(NF1):c.1466A>G (p.Tyr489Cys) rs137854557
NM_000267.3(NF1):c.3104T>G (p.Met1035Arg) rs137854553
NM_000267.3(NF1):c.3728T>C (p.Leu1243Pro) rs137854564
NM_000267.3(NF1):c.4168C>T (p.Leu1390Phe) rs199474789
NM_000267.3(NF1):c.4173A>T (p.Arg1391Ser) rs137854554
NM_000267.3(NF1):c.4267A>G (p.Lys1423Glu) rs137854550
NM_000267.3(NF1):c.4312_4314delGAA (p.Glu1438del) rs267606607
NM_000267.3(NF1):c.574C>T (p.Arg192Ter) rs397514641
NM_000270.3(PNP):c.701G>C (p.Arg234Pro) rs104894451
NM_000271.4(NPC1):c.1553G>A (p.Arg518Gln) rs483352886
NM_000271.4(NPC1):c.2848G>A (p.Val950Met) rs120074135
NM_000271.4(NPC1):c.2932C>T (p.Arg978Cys) rs28942108
NM_000271.4(NPC1):c.2974G>C (p.Gly992Arg) rs80358254
NM_000271.4(NPC1):c.2974G>T (p.Gly992Trp) rs80358254
NM_000271.4(NPC1):c.3019C>G (p.Pro1007Ala) rs80358257
NM_000271.4(NPC1):c.3044_3097del rs797044431
NM_000271.4(NPC1):c.3104C>T (p.Ala1035Val) rs28942107
NM_000271.4(NPC1):c.3107C>T (p.Thr1036Met) rs28942104
NM_000271.4(NPC1):c.3182T>C (p.Ile1061Thr) rs80358259
NM_000271.4(NPC1):c.3591+1G>A rs786200877
NM_000271.4(NPC1):c.530G>A (p.Cys177Tyr) rs80358252
NM_000274.3(OAT):c.1172G>A (p.Trp391Ter) rs386833596
NM_000274.3(OAT):c.1186C>T (p.Arg396Ter) rs121965036
NM_000274.3(OAT):c.1250C>T (p.Pro417Leu) rs121965044
NM_000274.3(OAT):c.159delC (p.His53Glnfs) rs386833599
NM_000274.3(OAT):c.192_193delAG (p.Gly65Lysfs) rs386833600
NM_000274.3(OAT):c.425_520del (p.Gly142_Ala173del) rs386833609
NM_000274.3(OAT):c.722C>T (p.Pro241Leu) rs121965051
NM_000274.3(OAT):c.994G>A (p.Val332Met) rs121965047
NM_000275.2(OCA2):c.1256G>A (p.Arg419Gln) rs1800407
NM_000275.2(OCA2):c.1327G>A (p.Val443Ile) rs121918166
NM_000275.2(OCA2):c.1441G>A (p.Ala481Thr) rs74653330
NM_000275.2(OCA2):c.2228C>T (p.Pro743Leu) rs121918167
NM_000275.2(OCA2):c.913C>T (p.Arg305Trp) rs1800401
NM_000276.3(OCRL):c.952C>T (p.Arg318Cys) rs137853263
NM_000277.1(PAH):c.1045T>C (p.Ser349Pro) rs62508646
NM_000277.1(PAH):c.611A>G (p.Tyr204Cys) rs62514927
NM_000277.1(PAH):c.896T>G (p.Phe299Cys) rs62642933
NM_000277.2(PAH):c.1066-3C>T rs62507344
NM_000277.2(PAH):c.165delT (p.Phe55Leufs) rs199475566
NM_000277.2(PAH):c.227A>G (p.Glu76Gly) rs62507347
NM_000277.2(PAH):c.261C>A (p.Ser87Arg) rs62516151
NM_000277.2(PAH):c.284_286delTCA (p.Ile95del) rs62508727
NM_000277.2(PAH):c.764T>C (p.Leu255Ser) rs62642930
NM_000277.2(PAH):c.776C>T (p.Ala259Val) rs118203921
NM_000277.2(PAH):c.932T>C (p.Leu311Pro) rs62642936
NM_000277.2(PAH):c.965C>G (p.Ala322Gly) rs62514958
NM_000277.3(PAH):c.1065+3A>G rs62508689
NM_000277.3(PAH):c.1068C>G (p.Tyr356Ter) rs62516095
NM_000277.3(PAH):c.1139C>T (p.Thr380Met) rs62642937
NM_000277.3(PAH):c.1169A>G (p.Glu390Gly) rs5030856
NM_000277.3(PAH):c.1243G>A (p.Asp415Asn) rs62644499
NM_000277.3(PAH):c.194T>C (p.Ile65Thr) rs75193786
NM_000277.3(PAH):c.1A>G (p.Met1Val) rs62514891
NM_000277.3(PAH):c.293T>C (p.Leu98Ser) rs62517167
NM_000277.3(PAH):c.734T>C (p.Val245Ala) rs76212747
NM_000277.3(PAH):c.754C>T (p.Arg252Trp) rs5030847
NM_000277.3(PAH):c.782G>A (p.Arg261Gln) rs5030849
NM_000277.3(PAH):c.818C>T (p.Ser273Phe) rs62514953
NM_000277.3(PAH):c.842+1G>A rs5030852
NM_000277.3(PAH):c.842C>T (p.Pro281Leu) rs5030851
NM_000277.3(PAH):c.916A>G (p.Ile306Val) rs62642934
NM_000278.3(PAX2):c.221_226dupAGACCG (p.Thr75_Gly76insGluThr) rs387906530
NM_000280.4(PAX6):c.1268A>T (p.Ter423Leu) rs121907922
NM_000281.2(PCBD1):c.259G>T (p.Glu87Ter) rs104894172
NM_000283.3(PDE6B):c.1678C>T (p.Arg560Cys) rs201541131
NM_000284.3(PDHA1):c.844A>C (p.Met282Leu) rs2229137
NM_000285.3(PEPD):c.692_694delACT (p.Tyr231del) rs745834191
NM_000286.2(PEX12):c.949C>T (p.Leu317Phe) rs61752112
NM_000286.2(PEX12):c.959C>T (p.Ser320Phe) rs28936697
NM_000287.3(PEX6):c.1802G>A (p.Arg601Gln) rs34324426
NM_000287.3(PEX6):c.821C>T (p.Pro274Leu) rs61753219
NM_000287.4(PEX6):c.1841del (p.Leu614Argfs) rs863225083
NM_000288.3(PEX7):c.13_19dup (p.Gly7Valfs) rs62636519
NM_000288.3(PEX7):c.340-10A>G rs267608255
NM_000288.3(PEX7):c.345T>G (p.Tyr115Ter) rs121909154
NM_000288.3(PEX7):c.40A>C (p.Thr14Pro) rs61753233
NM_000288.3(PEX7):c.45_52dupGGGACGCC (p.His18Argfs) rs63535662
NM_000288.3(PEX7):c.649G>A (p.Gly217Arg) rs121909152
NM_000288.3(PEX7):c.653C>T (p.Ala218Val) rs121909151
NM_000288.3(PEX7):c.694C>T (p.Arg232Ter) rs121909153
NM_000288.3(PEX7):c.875T>A (p.Leu292Ter) rs1805137
NM_000288.3(PEX7):c.903+1G>C rs148591292
NM_000290.3(PGAM2):c.233G>A (p.Trp78Ter) rs10250779
NM_000290.3(PGAM2):c.268C>T (p.Arg90Trp) rs104894034
NM_000290.3(PGAM2):c.290G>A (p.Gly97Asp) rs77938727
NM_000292.2(PHKA2):c.3341C>T (p.Thr1114Ile) rs137852293
NM_000292.2(PHKA2):c.556C>T (p.Arg186Cys) rs137852294
NM_000292.2(PHKA2):c.557G>A (p.Arg186His) rs137852290
NM_000293.2(PHKB):c.1969C>T (p.Gln657Ter) rs34667348
NM_000293.2(PHKB):c.352G>C (p.Ala118Pro) rs121918022
NM_000294.2(PHKG2):c.926G>A (p.Arg309Gln) rs572115942
NM_000295.4(SERPINA1):c.1078G>A (p.Ala360Thr) rs1802959
NM_000295.4(SERPINA1):c.1093G>A (p.Asp365Asn) rs143370956
NM_000295.4(SERPINA1):c.721A>T (p.Lys241Ter) rs199422211
NM_000296.3(PKD1):c.2534T>C (p.Leu845Ser) rs199476100
NM_000296.3(PKD1):c.971G>T (p.Arg324Leu) rs199476099
NM_000298.5(PKLR):c.1456C>T (p.Arg486Trp) rs116100695
NM_000301.3(PLG):c.1858G>A (p.Ala620Thr) rs121918027
NM_000302.3(PLOD1):c.2032G>A (p.Gly678Arg) rs121913551
NM_000303.2(PMM2):c.131T>C (p.Val44Ala) rs104894534
NM_000303.2(PMM2):c.26G>A (p.Cys9Tyr) rs104894532
NM_000303.2(PMM2):c.317A>T (p.Tyr106Phe) rs387906824
NM_000303.2(PMM2):c.338C>T (p.Pro113Leu) rs80338700
NM_000303.2(PMM2):c.357C>A (p.Phe119Leu) rs80338701
NM_000303.2(PMM2):c.385G>A (p.Val129Met) rs104894525
NM_000303.2(PMM2):c.395T>C (p.Ile132Thr) rs80338702
NM_000303.2(PMM2):c.422G>A (p.Arg141His) rs28936415
NM_000303.2(PMM2):c.484C>T (p.Arg162Trp) rs104894526
NM_000303.2(PMM2):c.563A>G (p.Asp188Gly) rs80338704
NM_000303.2(PMM2):c.640-15479C>T rs1258107584
NM_000303.2(PMM2):c.677C>G (p.Thr226Ser) rs80338706
NM_000303.2(PMM2):c.691G>A (p.Val231Met) rs80338707
NM_000303.2(PMM2):c.710C>G (p.Thr237Arg) rs80338708
NM_000303.2(PMM2):c.722G>C (p.Cys241Ser) rs80338709
NM_000304.3(PMP22):c.199G>C (p.Ala67Pro) rs104894623
NM_000304.3(PMP22):c.353C>T (p.Thr118Met) rs104894619
NM_000304.3(PMP22):c.448G>T (p.Gly150Cys) rs104894624
NM_000304.3(PMP22):c.47T>C (p.Leu16Pro) rs104894617
NM_000304.3(PMP22):c.65C>T (p.Ser22Phe) rs104894625
NM_000304.3(PMP22):c.82T>C (p.Trp28Arg) rs104894626
NM_000304.4(PMP22):c.281dup (p.Arg95Glnfs) rs80338763
NM_000304.4(PMP22):c.469C>T (p.Arg157Trp) rs28936682
NM_000306.3(POU1F1):c.515G>A (p.Arg172Gln) rs104893765
NM_000310.3(PPT1):c.29T>A (p.Leu10Ter) rs137852699
NM_000310.3(PPT1):c.364A>T (p.Arg122Trp) rs137852695
NM_000310.3(PPT1):c.451C>T (p.Arg151Ter) rs137852700
NM_000311.3(PRNP):c.538G>A (p.Val180Ile) rs74315408
NM_000311.4(PRNP):c.160_183GGTGGTGGCTGGGGGCAGCCTCAT(4) (p.Gln59_Pro60insGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGln) rs193922906
NM_000311.4(PRNP):c.305C>T (p.Pro102Leu) rs74315401
NM_000311.4(PRNP):c.313C>A (p.Pro105Thr) rs74315414
NM_000311.4(PRNP):c.313C>T (p.Pro105Ser) rs74315414
NM_000311.4(PRNP):c.314C>T (p.Pro105Leu) rs11538758
NM_000311.4(PRNP):c.350C>T (p.Ala117Val) rs74315402
NM_000311.4(PRNP):c.385A>G (p.Met129Val) rs1799990
NM_000311.4(PRNP):c.435T>G (p.Tyr145Ter) rs80356710
NM_000311.4(PRNP):c.478C>T (p.Gln160Ter) rs80356711
NM_000311.4(PRNP):c.512A>G (p.Asn171Ser) rs16990018
NM_000311.4(PRNP):c.547A>G (p.Thr183Ala) rs74315411
NM_000311.4(PRNP):c.560A>G (p.His187Arg) rs74315413
NM_000311.4(PRNP):c.593T>C (p.Phe198Ser) rs74315405
NM_000311.4(PRNP):c.598G>A (p.Glu200Lys) rs28933385
NM_000311.4(PRNP):c.623G>A (p.Arg208His) rs74315412
NM_000311.4(PRNP):c.628G>A (p.Val210Ile) rs74315407
NM_000311.4(PRNP):c.650A>G (p.Gln217Arg) rs74315406
NM_000311.4(PRNP):c.655G>A (p.Glu219Lys) rs1800014
NM_000311.4(PRNP):c.695T>G (p.Met232Arg) rs74315409
NM_000312.3(PROC):c.629C>T (p.Pro210Leu) rs121918145
NM_000312.3(PROC):c.631C>T (p.Arg211Trp) rs121918143
NM_000312.3(PROC):c.935C>T (p.Ser312Leu) rs121918160
NM_000313.3(PROS1):c.1501T>C (p.Ser501Pro) rs121918472
NM_000314.4(PTEN):c.-764G>A rs587776674
NM_000314.6(PTEN):c.1003C>T (p.Arg335Ter) rs121909231
NM_000314.6(PTEN):c.253+1G>A rs587776667
NM_000314.6(PTEN):c.388C>T (p.Arg130Ter) rs121909224
NM_000314.6(PTEN):c.395G>T (p.Gly132Val) rs121909241
NM_000314.6(PTEN):c.564T>A (p.Tyr188Ter) rs606231170
NM_000314.6(PTEN):c.761_765delAAGTA (p.Lys254Argfs) rs606231169
NM_000314.6(PTEN):c.802delG (p.Asp268Thrfs) rs587776672
NM_000314.7(PTEN):c.181C>G (p.His61Asp) rs121909236
NM_000314.7(PTEN):c.209T>C (p.Leu70Pro) rs121909226
NM_000314.7(PTEN):c.278A>G (p.His93Arg) rs121909238
NM_000314.7(PTEN):c.368A>G (p.His123Arg) rs121909222
NM_000314.7(PTEN):c.389G>A (p.Arg130Gln) rs121909229
NM_000314.7(PTEN):c.500C>A (p.Thr167Asn) rs397514559
NM_000314.7(PTEN):c.510T>A (p.Ser170Arg) rs121909221
NM_000314.7(PTEN):c.701G>A (p.Arg234Gln) rs121909235
NM_000314.7(PTEN):c.722T>C (p.Phe241Ser) rs121909240
NM_000314.7(PTEN):c.755A>G (p.Asp252Gly) rs121909239
NM_000316.3(PTH1R):c.103G>A (p.Glu35Lys)
NM_000317.2(PTS):c.155A>G (p.Asn52Ser) rs104894275
NM_000317.2(PTS):c.166G>A (p.Val56Met) rs104894277
NM_000317.2(PTS):c.347A>G (p.Asp116Gly) rs104894279
NM_000317.2(PTS):c.46C>T (p.Arg16Cys) rs104894274
NM_000321.2(RB1):c.1072C>T (p.Arg358Ter) rs121913301
NM_000321.2(RB1):c.1439_1441delACA (p.Asn480del) rs587776788
NM_000321.2(RB1):c.1666C>T (p.Arg556Ter) rs121913304
NM_000321.2(RB1):c.1981C>T (p.Arg661Trp) rs137853294
NM_000321.2(RB1):c.2134T>C (p.Cys712Arg) rs137853296
NM_000321.2(RB1):c.2242G>T (p.Glu748Ter) rs121913297
NM_000322.4(PRPH2):c.629C>G (p.Pro210Arg) rs61755798
NM_000326.4(RLBP1):c.677T>A (p.Met226Lys) rs137853291
NM_000328.2(RPGR):c.1905+500_1905+501delAG rs398122960
NM_000329.2(RPE65):c.11+5G>A rs61751276
NM_000329.2(RPE65):c.394G>A (p.Ala132Thr) rs61752878
NM_000331.5(SAA1):c.209C>T (p.Ala70Val) rs1136743
NM_000334.4(SCN4A):c.2006G>A (p.Arg669His) rs80338784
NM_000334.4(SCN4A):c.2014C>A (p.Arg672Ser) rs80338785
NM_000334.4(SCN4A):c.2014C>G (p.Arg672Gly) rs80338785
NM_000334.4(SCN4A):c.2015G>A (p.Arg672His) rs80338788
NM_000334.4(SCN4A):c.2411C>T (p.Ser804Phe) rs121908546
NM_000334.4(SCN4A):c.3395G>A (p.Arg1132Gln) rs80338789
NM_000334.4(SCN4A):c.4343G>A (p.Arg1448His) rs121908545
NM_000334.4(SCN4A):c.737C>T (p.Ser246Leu) rs80338951
NM_000335.4(SCN5A):c.1282G>A (p.Glu428Lys) rs199473111
NM_000335.4(SCN5A):c.3575G>A (p.Arg1192Gln) rs41261344
NM_000335.4(SCN5A):c.4516_4524del (p.Gln1506_Pro1508del) rs397514251
NM_000335.4(SCN5A):c.4531C>T (p.Arg1511Trp) rs137854602
NM_000335.4(SCN5A):c.5126C>T (p.Ser1709Leu) rs137854604
NM_000335.4(SCN5A):c.5474G>A (p.Arg1825His) rs137854610
NM_000335.4(SCN5A):c.5504T>C (p.Ile1835Thr) rs45563942
NM_000335.4(SCN5A):c.5958C>A (p.Asn1986Lys) rs199473335
NM_000335.4(SCN5A):c.659C>T (p.Thr220Ile) rs45620037
NM_000336.2(SCNN1B):c.109G>A (p.Gly37Ser) rs137852706
NM_000336.2(SCNN1B):c.245C>G (p.Ser82Cys) rs35731153
NM_000336.2(SCNN1B):c.880G>A (p.Gly294Ser) rs72654338
NM_000337.5(SGCD):c.451T>G (p.Ser151Ala) rs121909298
NM_000339.2(SLC12A3):c.1964G>A (p.Arg655His) rs121909380
NM_000339.2(SLC12A3):c.2576T>C (p.Leu859Pro) rs121909379
NM_000340.1(SLC2A2):c.589G>A (p.Val197Ile) rs121909741
NM_000342.3(SLC4A1):c.118G>A (p.Glu40Lys) rs45562031
NM_000342.3(SLC4A1):c.166A>G (p.Lys56Glu) rs5036
NM_000342.3(SLC4A1):c.2561C>T (p.Pro854Leu) rs2285644
NM_000342.3(SLC4A1):c.2573C>A (p.Ala858Asp) rs121912751
NM_000342.4(SLC4A1):c.1199_1225del (p.Ala400_Ala408del) rs769664228
NM_000344.3(SMN1):c.785G>T (p.Ser262Ile) rs1554066659
NM_000344.3(SMN1):c.815A>G (p.Tyr272Cys) rs104893922
NM_000344.3(SMN1):c.821C>T (p.Thr274Ile) rs1554066666
NM_000345.3(SNCA):c.150T>G (p.His50Gln) rs201106962
NM_000346.3(SOX9):c.1320C>G (p.Tyr440Ter) rs80338688
NM_000346.3(SOX9):c.507C>G (p.His169Gln) rs2229989
NM_000348.3(SRD5A2):c.145G>A (p.Ala49Thr) rs9282858
NM_000348.3(SRD5A2):c.586G>A (p.Gly196Ser) rs121434250
NM_000348.3(SRD5A2):c.680G>A (p.Arg227Gln) rs9332964
NM_000348.3(SRD5A2):c.682G>A (p.Ala228Thr) rs121434249
NM_000349.2(STAR):c.466-11T>A rs1053284504
NM_000349.2(STAR):c.545G>A (p.Arg182His) rs104894086
NM_000349.2(STAR):c.559G>A (p.Val187Met) rs104894089
NM_000350.2(ABCA4):c.1715G>A (p.Arg572Gln) rs61748559
NM_000350.2(ABCA4):c.2588G>C rs76157638
NM_000350.2(ABCA4):c.2791G>A (p.Val931Met) rs58331765
NM_000350.2(ABCA4):c.2828G>A (p.Arg943Gln) rs1801581
NM_000350.2(ABCA4):c.3113C>T (p.Ala1038Val) rs61751374
NM_000350.2(ABCA4):c.3364G>A (p.Glu1122Lys) rs61751399
NM_000350.2(ABCA4):c.3602T>G (p.Leu1201Arg) rs61750126
NM_000350.2(ABCA4):c.4139C>T (p.Pro1380Leu) rs61750130
NM_000350.2(ABCA4):c.52C>T (p.Arg18Trp) rs121909205
NM_000350.2(ABCA4):c.5338C>G (p.Pro1780Ala) rs121909207
NM_000350.2(ABCA4):c.5461-10T>C rs1800728
NM_000350.2(ABCA4):c.5714+5G>A rs61751407
NM_000350.2(ABCA4):c.5882G>A rs1800553
NM_000350.2(ABCA4):c.5908C>T (p.Leu1970Phe) rs28938473
NM_000350.2(ABCA4):c.6148G>C (p.Val2050Leu) rs41292677
NM_000350.2(ABCA4):c.634C>T (p.Arg212Cys) rs61750200
NM_000350.2(ABCA4):c.6529G>A (p.Asp2177Asn) rs1800555
NM_000352.4(ABCC8):c.1144G>A (p.Glu382Lys) rs80356651
NM_000352.4(ABCC8):c.1672-20A>G
NM_000352.4(ABCC8):c.215A>G (p.Asn72Ser) rs80356634
NM_000352.4(ABCC8):c.257T>G (p.Val86Gly) rs193929360
NM_000352.4(ABCC8):c.3554C>A (p.Ser1185Tyr) rs193929369
NM_000352.4(ABCC8):c.394T>C (p.Phe132Leu) rs80356637
NM_000352.4(ABCC8):c.4198G>A (p.Gly1400Arg) rs137852676
NM_000352.4(ABCC8):c.4270A>G (p.Ile1424Val) rs80356653
NM_000352.4(ABCC8):c.4477C>T (p.Arg1493Trp) rs28936371
NM_000352.4(ABCC8):c.638T>G (p.Leu213Arg) rs80356642
NM_000353.2(TAT):c.169C>T (p.Arg57Ter) rs118203914
NM_000354.5(SERPINA7):c.631G>A (p.Ala211Thr) rs2234036
NM_000358.2(TGFBI):c.1501C>A (p.Pro501Thr) rs121909212
NM_000359.2(TGM1):c.1075G>A (p.Val359Met) rs202037016
NM_000359.2(TGM1):c.1166G>A (p.Arg389His) rs121918723
NM_000359.2(TGM1):c.1187G>A (p.Arg396His) rs121918721
NM_000359.2(TGM1):c.1187G>T (p.Arg396Leu) rs121918721
NM_000359.2(TGM1):c.1223_1227delACACA (p.Asp408Valfs) rs398122905
NM_000359.2(TGM1):c.125C>A (p.Ser42Tyr) rs41295338
NM_000359.2(TGM1):c.1469A>G (p.Asp490Gly) rs121918724
NM_000359.2(TGM1):c.1552G>A (p.Val518Met) rs35312232
NM_000359.2(TGM1):c.1744C>T (p.Gln582Ter) rs397514522
NM_000359.2(TGM1):c.281G>A (p.Gly94Asp) rs121918729
NM_000359.2(TGM1):c.376C>T (p.Arg126Cys) rs397514524
NM_000359.2(TGM1):c.424C>T (p.Arg142Cys) rs121918716
NM_000359.2(TGM1):c.428G>A (p.Arg143His) rs121918719
NM_000359.2(TGM1):c.652G>A (p.Gly218Ser) rs121918732
NM_000359.2(TGM1):c.832G>A (p.Gly278Arg) rs121918725
NM_000359.2(TGM1):c.919C>T (p.Arg307Trp) rs121918731
NM_000359.2(TGM1):c.943C>T (p.Arg315Cys) rs397514525
NM_000359.2(TGM1):c.944G>T (p.Arg315Leu) rs143473912
NM_000359.2(TGM1):c.968G>A (p.Arg323Gln) rs121918717
NM_000361.2(THBD):c.127G>A (p.Ala43Thr) rs1800576
NM_000361.2(THBD):c.1456G>T (p.Asp486Tyr) rs41348347
NM_000363.4(TNNI3):c.244C>T (p.Pro82Ser) rs77615401
NM_000363.4(TNNI3):c.433C>T (p.Arg145Trp) rs104894724
NM_000363.4(TNNI3):c.575G>A (p.Arg192His) rs104894729
NM_000363.4(TNNI3):c.586G>A (p.Asp196Asn) rs104894727
NM_000364.3(TNNT2):c.853C>T (p.Arg285Cys) rs121964857
NM_000367.4(TPMT):c.460G>A (p.Ala154Thr) rs1800460
NM_000367.4(TPMT):c.719A>G (p.Tyr240Cys) rs1142345
NM_000368.4(TSC1):c.1760A>G (p.Lys587Arg) rs118203576
NM_000368.4(TSC1):c.2194C>T (p.His732Tyr) rs118203657
NM_000368.4(TSC1):c.610C>T (p.Arg204Cys) rs1060505021
NM_000368.4(TSC1):c.64C>T (p.Arg22Trp) rs749030456
NM_000369.2(TSHR):c.106G>C (p.Asp36His) rs61747482
NM_000369.2(TSHR):c.1637G>A (p.Trp546Ter) rs121908866
NM_000369.2(TSHR):c.1657G>A (p.Ala553Thr) rs121908872
NM_000370.3(TTPA):c.303T>G (p.His101Gln) rs121917849
NM_000370.3(TTPA):c.400C>T (p.Arg134Ter) rs121917851
NM_000370.3(TTPA):c.487delT (p.Trp163Glyfs) rs397515378
NM_000370.3(TTPA):c.513_514insTT (p.Thr172Leufs) rs397515379
NM_000370.3(TTPA):c.575G>A (p.Arg192His) rs121917850
NM_000370.3(TTPA):c.744delA (p.Glu249Asnfs) rs397515377
NM_000371.3(TTR):c.238A>G (p.Thr80Ala) rs121918070
NM_000371.3(TTR):c.250T>C (p.Phe84Leu) rs121918091
NM_000371.3(TTR):c.262A>T (p.Ile88Leu) rs121918085
NM_000371.3(TTR):c.265T>C (p.Tyr89His) rs121918100
NM_000371.3(TTR):c.328C>A (p.His110Asn) rs121918074
NM_000371.3(TTR):c.349G>T (p.Ala117Ser) rs267607161
NM_000371.3(TTR):c.371G>A (p.Arg124His) rs121918095
NM_000371.3(TTR):c.379A>G (p.Ile127Val) rs121918089
NM_000371.3(TTR):c.386C>T (p.Ala129Val) rs121918092
NM_000371.3(TTR):c.416C>T (p.Thr139Met) rs28933981
NM_000371.3(TTR):c.424_426delGTC (p.Val142del) rs121918096
NM_000371.3(TTR):c.88T>C (p.Cys30Arg) rs121918083
NM_000372.4(TYR):c.1147G>A (p.Asp383Asn) rs121908011
NM_000372.4(TYR):c.1205G>A (p.Arg402Gln) rs1126809
NM_000372.4(TYR):c.1209G>T (p.Arg403Ser) rs104894316
NM_000372.4(TYR):c.1217C>T (p.Pro406Leu) rs104894313
NM_000372.4(TYR):c.1255G>A (p.Gly419Arg) rs61754392
NM_000372.4(TYR):c.1336G>A (p.Gly446Ser) rs104894317
NM_000372.4(TYR):c.140G>A (p.Gly47Asp) rs61753180
NM_000372.4(TYR):c.230G>A (p.Arg77Gln) rs61753185
NM_000372.4(TYR):c.242C>T (p.Pro81Leu) rs28940876
NM_000372.4(TYR):c.575C>A (p.Ser192Tyr) rs1042602
NM_000372.4(TYR):c.649C>T (p.Arg217Trp) rs63159160
NM_000372.4(TYR):c.823G>T (p.Val275Phe) rs104894314
NM_000372.4(TYR):c.896G>A (p.Arg299His) rs61754375
NM_000375.2(UROS):c.197C>T (p.Ala66Val) rs28941774
NM_000375.2(UROS):c.217T>C (p.Cys73Arg) rs121908012
NM_000375.2(UROS):c.244G>T (p.Val82Phe) rs121908016
NM_000375.2(UROS):c.673G>A (p.Gly225Ser) rs121908020
NM_000380.3(XPA):c.323G>T (p.Cys108Phe) rs104894131
NM_000382.2(ALDH3A2):c.1157A>G (p.Asn386Ser)
NM_000382.2(ALDH3A2):c.1297_1298delGA (p.Glu433Argfs) rs387906256
NM_000382.2(ALDH3A2):c.1307_1311dupACAAA (p.Leu438Thrfs) rs387906257
NM_000382.2(ALDH3A2):c.798G>C (p.Lys266Asn) rs72547569
NM_000383.3(AIRE):c.967_979delCTGTCCCCTCCGC (p.Leu323Serfs) rs386833675
NM_000384.2(APOB):c.10580G>A (p.Arg3527Gln) rs5742904
NM_000384.2(APOB):c.10672C>T (p.Arg3558Cys) rs12713559
NM_000388.3(CASR):c.1394G>A (p.Arg465Gln) rs104893716
NM_000388.3(CASR):c.1745G>A (p.Cys582Tyr) rs104893690
NM_000388.3(CASR):c.196C>T (p.Arg66Cys) rs121909266
NM_000388.3(CASR):c.2641T>C (p.Phe881Leu) rs104893704
NM_000388.3(CASR):c.2657G>C (p.Arg886Pro) rs1057520791
NM_000388.3(CASR):c.2693G>A (p.Arg898Gln) rs121909269
NM_000388.3(CASR):c.2915C>T (p.Thr972Met) rs200620134
NM_000388.3(CASR):c.413C>T (p.Thr138Met) rs121909263
NM_000388.3(CASR):c.428G>A (p.Gly143Glu) rs121909264
NM_000391.3(TPP1):c.1094G>A (p.Cys365Tyr) rs119455954
NM_000391.3(TPP1):c.509-1G>C rs56144125
NM_000391.3(TPP1):c.622C>T (p.Arg208Ter) rs119455955
NM_000391.3(TPP1):c.857A>G (p.Asn286Ser) rs119455958
NM_000391.3(TPP1):c.887-10A>G rs755445790
NM_000392.5(ABCC2):c.3196C>T (p.Arg1066Ter) rs72558199
NM_000396.3(CTSK):c.721C>T (p.Arg241Ter) rs74315303
NM_000396.3(CTSK):c.830C>T (p.Ala277Val) rs74315304
NM_000396.3(CTSK):c.926T>C (p.Leu309Pro) rs29001685
NM_000399.3(EGR2):c.1075C>T (p.Arg359Trp) rs104894161
NM_000399.4(EGR2):c.1225C>T (p.Arg409Trp) rs104894159
NM_000399.4(EGR2):c.803T>A (p.Ile268Asn) rs104894158
NM_000400.3(ERCC2):c.2047C>T (p.Arg683Trp) rs41556519
NM_000402.4(G6PD):c.1054T>C (p.Tyr352His) rs137852347
NM_000402.4(G6PD):c.1058T>C (p.Leu353Pro) rs76723693
NM_000402.4(G6PD):c.1093G>A (p.Ala365Thr) rs5030869
NM_000402.4(G6PD):c.1114C>T (p.Leu372Phe) rs137852342
NM_000402.4(G6PD):c.1172C>T (p.Ala391Val) rs137852345
NM_000402.4(G6PD):c.1179C>A (p.Asn393Lys) rs137852329
NM_000402.4(G6PD):c.1192G>A (p.Glu398Lys) rs387906468
NM_000402.4(G6PD):c.1246A>G (p.Lys416Glu) rs137852320
NM_000402.4(G6PD):c.1249C>T (p.Arg417Cys) rs137852334
NM_000402.4(G6PD):c.1268G>A (p.Arg423His) rs137852316
NM_000402.4(G6PD):c.1270G>C (p.Val424Leu) rs137852335
NM_000402.4(G6PD):c.1319G>A (p.Gly440Asp) rs137852336
NM_000402.4(G6PD):c.1406G>C (p.Arg469Pro) rs137852337
NM_000402.4(G6PD):c.1429G>A (p.Gly477Arg) rs137852317
NM_000402.4(G6PD):c.1466G>C (p.Arg489Pro) rs72554665
NM_000402.4(G6PD):c.1466G>T (p.Arg489Leu) rs72554665
NM_000402.4(G6PD):c.1478G>A (p.Arg493His) rs72554664
NM_000402.4(G6PD):c.193_195delATC (p.Ile66del) rs137852338
NM_000402.4(G6PD):c.221C>G (p.Ala74Gly) rs78478128
NM_000402.4(G6PD):c.233T>C (p.Ile78Thr) rs76645461
NM_000402.4(G6PD):c.292G>A (p.Val98Met) rs1050828
NM_000402.4(G6PD):c.466A>G (p.Asn156Asp) rs1050829
NM_000402.4(G6PD):c.577G>A (p.Gly193Ser) rs137852314
NM_000402.4(G6PD):c.583A>G (p.Asn195Asp) rs137852331
NM_000402.4(G6PD):c.632A>T (p.Asp211Val) rs5030872
NM_000402.4(G6PD):c.653C>T (p.Ser218Phe) rs5030868
NM_000402.4(G6PD):c.683G>C (p.Arg228Pro) rs137852332
NM_000402.4(G6PD):c.727G>T (p.Val243Leu) rs137852326
NM_000402.4(G6PD):c.896G>A (p.Cys299Tyr) rs137852346
NM_000402.4(G6PD):c.934G>C (p.Asp312His) rs137852318
NM_000402.4(G6PD):c.961G>A (p.Val321Met) rs137852327
NM_000403.3(GALE):c.101A>G (p.Asn34Ser) rs121908046
NM_000403.3(GALE):c.269G>A (p.Gly90Glu) rs28940882
NM_000403.3(GALE):c.280G>A (p.Val94Met) rs121908047
NM_000403.3(GALE):c.548T>C (p.Leu183Pro) rs121908045
NM_000403.3(GALE):c.770A>G (p.Lys257Arg) rs28940884
NM_000403.3(GALE):c.956G>A (p.Gly319Glu) rs28940885
NM_000404.2(GLB1):c.245C>T rs72555393
NM_000404.2(GLB1):c.367G>A rs28934274
NM_000404.3(GLB1):c.1051C>T (p.Arg351Ter) rs72555372
NM_000404.3(GLB1):c.1223A>C (p.Gln408Pro) rs72555369
NM_000404.3(GLB1):c.1444C>T (p.Arg482Cys) rs72555365
NM_000404.3(GLB1):c.145C>T (p.Arg49Cys) rs72555358
NM_000404.3(GLB1):c.1498A>G (p.Thr500Ala) rs72555368
NM_000404.3(GLB1):c.1772A>G (p.Tyr591Cys) rs72555371
NM_000404.3(GLB1):c.947A>G (p.Tyr316Cys) rs72555361
NM_000405.4(GM2A):c.164C>T (p.Pro55Leu) rs730882196
NM_000406.2(GNRHR):c.30T>A (p.Asn10Lys) rs104893843
NM_000406.2(GNRHR):c.317A>G (p.Gln106Arg) rs104893836
NM_000409.4(GUCA1A):c.149C>T (p.Pro50Leu) rs104893968
NM_000409.4(GUCA1A):c.296A>G (p.Tyr99Cys) rs104893967
NM_000410.3(HFE):c.187C>G (p.His63Asp) rs1799945
NM_000410.3(HFE):c.193A>T (p.Ser65Cys) rs1800730
NM_000410.3(HFE):c.845G>A (p.Cys282Tyr) rs1800562
NM_000411.6(HLCS):c.1648G>A (p.Val550Met) rs119103231
NM_000411.6(HLCS):c.647T>G (p.Leu216Arg) rs28934602
NM_000411.6(HLCS):c.710T>C (p.Leu237Pro) rs119103227
NM_000411.7(HLCS):c.1519+5G>A rs753887925
NM_000412.4(HRG):c.271C>T (p.Pro91Ser) rs761776963
NM_000414.3(HSD17B4):c.101C>T (p.Ala34Val) rs587777442
NM_000414.3(HSD17B4):c.1369A>T (p.Asn457Tyr) rs137853097
NM_000414.3(HSD17B4):c.1538C>T (p.Pro513Leu) rs587777444
NM_000414.3(HSD17B4):c.1547T>C (p.Ile516Thr) rs587777443
NM_000414.3(HSD17B4):c.1628G>C (p.Arg543Pro) rs201009485
NM_000414.3(HSD17B4):c.46G>A (p.Gly16Ser) rs137853096
NM_000416.2(IFNGR1):c.260T>C (p.Ile87Thr) rs104893973
NM_000418.3(IL4R):c.223A>G (p.Ile75Val) rs1805010
NM_000419.4(ITGA2B):c.2621T>G (p.Ile874Ser) rs5911
NM_000420.2(KEL):c.1790T>C (p.Leu597Pro) rs8176038
NM_000424.3(KRT5):c.1649delG (p.Gly550Alafs) rs61126080
NM_000424.3(KRT5):c.74C>T (p.Pro25Leu) rs57499817
NM_000425.4(L1CAM):c.924C>T (p.Gly308=) rs797044787
NM_000426.3(LAMA2):c.1580G>A (p.Cys527Tyr) rs121913574
NM_000426.3(LAMA2):c.2584T>C (p.Cys862Arg) rs121913573
NM_000426.3(LAMA2):c.2901C>A (p.Cys967Ter) rs121913577
NM_000426.3(LAMA2):c.3718C>T (p.Gln1240Ter) rs121913569
NM_000426.3(LAMA2):c.4487C>T (p.Ala1496Val) rs147077184
NM_000426.3(LAMA2):c.7750-1713_7899-2153del4987
NM_000426.3(LAMA2):c.9253C>T rs121913571
NM_000430.3(PAFAH1B1):c.484G>A (p.Gly162Ser) rs121434487
NM_000431.2(MVK):c.500C>T (p.Pro167Leu) rs104895300
NM_000432.3(MYL2):c.173G>A (p.Arg58Gln) rs104894369
NM_000432.3(MYL2):c.37G>A (p.Ala13Thr) rs104894363
NM_000432.3(MYL2):c.52T>C (p.Phe18Leu) rs104894370
NM_000432.3(MYL2):c.64G>A (p.Glu22Lys) rs104894368
NM_000433.3(NCF2):c.1183C>T (p.Arg395Trp) rs13306575
NM_000434.3(NEU1):c.649G>A (p.Val217Met) rs28940583
NM_000434.3(NEU1):c.893C>T (p.Ala298Val) rs104893981
NM_000435.2(NOTCH3):c.3058G>C (p.Ala1020Pro) rs35769976
NM_000435.2(NOTCH3):c.397C>T (p.Arg133Cys) rs137852642
NM_000439.4(PCSK1):c.661A>G (p.Asn221Asp) rs6232
NM_000441.1(SLC26A4):c.-103T>C rs60284988
NM_000441.1(SLC26A4):c.1001+1G>A rs80338849
NM_000441.1(SLC26A4):c.1003T>C (p.Phe335Leu) rs111033212
NM_000441.1(SLC26A4):c.1151A>G (p.Glu384Gly) rs111033244
NM_000441.1(SLC26A4):c.1246A>C (p.Thr416Pro) rs28939086
NM_000441.1(SLC26A4):c.1588T>C (p.Tyr530His) rs111033254
NM_000441.1(SLC26A4):c.2162C>T (p.Thr721Met) rs121908363
NM_000441.1(SLC26A4):c.2168A>G (p.His723Arg) rs121908362
NM_000441.1(SLC26A4):c.279delT (p.Ser93Argfs) rs786204421
NM_000441.1(SLC26A4):c.397T>A (p.Ser133Thr) rs121908365
NM_000441.1(SLC26A4):c.578C>T rs111033348
NM_000441.1(SLC26A4):c.707T>C (p.Leu236Pro) rs80338848
NM_000441.1(SLC26A4):c.85G>C (p.Glu29Gln) rs111033205
NM_000441.1(SLC26A4):c.919-2A>G rs111033313
NM_000443.3(ABCB4):c.1769G>A (p.Arg590Gln) rs45575636
NM_000443.3(ABCB4):c.2869C>T (p.Arg957Ter) rs121918440
NM_000443.3(ABCB4):c.523A>G (p.Thr175Ala) rs58238559
NM_000443.3(ABCB4):c.959C>T (p.Ser320Phe) rs72552778
NM_000445.4(PLEC):c.2677_2685delCAGGAGGCC (p.Gln893_Ala895del) rs786205252
NM_000446.6(PON1):c.163T>A (p.Leu55Met) rs854560
NM_000446.6(PON1):c.575A>G (p.Gln192Arg) rs662
NM_000447.2(PSEN2):c.1316A>C (p.Asp439Ala) rs63750110
NM_000447.2(PSEN2):c.364A>C (p.Thr122Pro) rs63749851
NM_000447.2(PSEN2):c.389C>T (p.Ser130Leu) rs63750197
NM_000447.2(PSEN2):c.422A>T (p.Asn141Ile) rs63750215
NM_000447.2(PSEN2):c.717G>A (p.Met239Ile) rs63749884
NM_000448.2(RAG1):c.1566G>T (p.Trp522Cys) rs193922461
NM_000449.3(RFX5):c.446G>A (p.Arg149Gln) rs137853099
NM_000454.4(SOD1):c.272A>C (p.Asp91Ala) rs80265967
NM_000455.4(STK11):c.1062C>G (p.Phe354Leu) rs59912467
NM_000455.4(STK11):c.200T>C (p.Leu67Pro) rs137853077
NM_000455.4(STK11):c.508C>T (p.Gln170Ter) rs121913323
NM_000455.4(STK11):c.580G>T (p.Asp194Tyr) rs121913315
NM_000455.4(STK11):c.717G>C (p.Trp239Cys) rs137853082
NM_000456.2(SUOX):c.650G>A (p.Arg217Gln) rs121908007
NM_000459.4(TEK):c.2545C>T (p.Arg849Trp) rs80338908
NM_000459.4(TEK):c.2690A>C (p.Tyr897Ser) rs80338909
NM_000461.4(THRB):c.1324A>G (p.Met442Val) rs121918691
NM_000463.2(UGT1A1):c.1021C>T (p.Arg341Ter) rs72551349
NM_000463.2(UGT1A1):c.1198A>G (p.Asn400Asp) rs28934877
NM_000463.2(UGT1A1):c.1456T>G (p.Tyr486Asp) rs34993780
NM_000463.2(UGT1A1):c.524T>A (p.Leu175Gln) rs72551341
NM_000463.2(UGT1A1):c.686C>A (p.Pro229Gln) rs35350960
NM_000465.3(BARD1):c.1670G>C (p.Cys557Ser) rs28997576
NM_000466.2(PEX1):c.1991T>C (p.Leu664Pro) rs121434455
NM_000466.2(PEX1):c.2114T>G (p.Leu705Trp) rs863225084
NM_000477.6(ALB):c.725G>A (p.Arg242His) rs75002628
NM_000478.4(ALPL):c.346G>A (p.Ala116Thr) rs121918013
NM_000478.4(ALPL):c.571G>A (p.Glu191Lys) rs121918007
NM_000478.4(ALPL):c.979T>C (p.Phe327Leu) rs121918010
NM_000478.5(ALPL):c.1001G>A (p.Gly334Asp) rs121918009
NM_000478.5(ALPL):c.1250A>G (p.Asn417Ser) rs121918014
NM_000478.5(ALPL):c.211C>T (p.Arg71Cys) rs121918001
NM_000478.5(ALPL):c.485G>T (p.Gly162Val) rs121918012
NM_000478.5(ALPL):c.526G>A (p.Ala176Thr) rs121918019
NM_000478.5(ALPL):c.535G>A (p.Ala179Thr) rs121918000
NM_000478.5(ALPL):c.746G>T (p.Gly249Val) rs121918018
NM_000478.6(ALPL):c.407G>A (p.Arg136His) rs121918011
NM_000481.3(AMT):c.125A>G (p.His42Arg) rs121964983
NM_000481.3(AMT):c.139G>A (p.Gly47Arg) rs121964982
NM_000481.3(AMT):c.350C>T (p.Ser117Leu) rs769468125
NM_000481.3(AMT):c.574C>T (p.Gln192Ter) rs121964986
NM_000481.3(AMT):c.826G>C (p.Asp276His) rs121964984
NM_000481.3(AMT):c.878-1G>A rs181134220
NM_000481.3(AMT):c.959G>A (p.Arg320His) rs121964985
NM_000484.3(APP):c.1995G>C (p.Glu665Asp) rs63750363
NM_000484.3(APP):c.2010_2011delGAinsTC (p.Lys670_Met671delinsAsnLeu) rs281865161
NM_000484.3(APP):c.2075C>G (p.Ala692Gly) rs63750671
NM_000484.3(APP):c.2078A>G (p.Glu693Gly) rs63751039
NM_000484.3(APP):c.2124C>T (p.Gly708=) rs148888161
NM_000484.3(APP):c.2137G>A (p.Ala713Thr) rs63750066
NM_000484.3(APP):c.2143G>A (p.Val715Met) rs63750734
NM_000484.3(APP):c.2149G>A (p.Val717Ile) rs63750264
NM_000485.2(APRT):c.321+2_321+3insT rs281860263
NM_000486.5(AQP2):c.190G>A (p.Gly64Arg) rs104894326
NM_000487.5(ARSA):c.*96A>G rs6151429
NM_000487.5(ARSA):c.1010A>T (p.Asp337Val) rs74315475
NM_000487.5(ARSA):c.1055A>G (p.Asn352Ser) rs2071421
NM_000487.5(ARSA):c.1114C>T (p.Arg372Trp) rs74315476
NM_000487.5(ARSA):c.1115G>A (p.Arg372Gln) rs74315477
NM_000487.5(ARSA):c.1150G>A (p.Glu384Lys) rs74315479
NM_000487.5(ARSA):c.1174C>T (p.Arg392Trp) rs74315480
NM_000487.5(ARSA):c.1210+1G>A rs80338820
NM_000487.5(ARSA):c.1232C>T (p.Thr411Ile) rs74315481
NM_000487.5(ARSA):c.1283C>T (p.Pro428Leu) rs28940893
NM_000487.5(ARSA):c.257G>A (p.Arg86Gln) rs74315458
NM_000487.5(ARSA):c.293C>T (p.Ser98Phe) rs74315456
NM_000487.5(ARSA):c.302G>A (p.Gly101Asp) rs74315455
NM_000487.5(ARSA):c.370G>A (p.Gly124Ser) rs74315461
NM_000487.5(ARSA):c.413C>T (p.Pro138Leu) rs74315462
NM_000487.5(ARSA):c.465+1G>A rs80338815
NM_000487.5(ARSA):c.511G>A (p.Asp171Asn) rs74315466
NM_000487.5(ARSA):c.542T>G (p.Ile181Ser) rs74315457
NM_000487.5(ARSA):c.641C>T (p.Ala214Val) rs74315467
NM_000487.5(ARSA):c.677C>T (p.Ala226Val) rs74315468
NM_000487.5(ARSA):c.736C>T (p.Arg246Cys) rs74315470
NM_000487.5(ARSA):c.739G>A (p.Gly247Arg) rs74315471
NM_000487.5(ARSA):c.763G>A (p.Glu255Lys) rs74315483
NM_000487.5(ARSA):c.827C>T (p.Thr276Met) rs74315472
NM_000487.5(ARSA):c.868C>T (p.Arg290Cys) rs74315473
NM_000487.5(ARSA):c.931G>A (p.Gly311Ser) rs74315459
NM_000488.3(SERPINC1):c.1246G>T (p.Ala416Ser) rs121909548
NM_000488.3(SERPINC1):c.1256C>T (p.Ala419Val) rs121909568
NM_000488.3(SERPINC1):c.166C>T (p.Arg56Cys) rs28929469
NM_000488.3(SERPINC1):c.218C>T (p.Pro73Leu) rs121909551
NM_000488.3(SERPINC1):c.236G>A (p.Arg79His) rs121909552
NM_000488.3(SERPINC1):c.482G>A (p.Arg161Gln) rs121909563
NM_000488.3(SERPINC1):c.89T>A (p.Val30Glu) rs2227624
NM_000489.3(ATRX):c.6149T>C (p.Ile2050Thr) rs122445110
NM_000489.4(ATRX):c.5579A>G (p.Asn1860Ser) rs45439799
NM_000489.4(ATRX):c.568C>G (p.Pro190Ala) rs122445103
NM_000492.3(CFTR):c.1021_1022dupTC (p.Phe342Hisfs) rs387906360
NM_000492.3(CFTR):c.1040G>A (p.Arg347His) rs77932196
NM_000492.3(CFTR):c.1046C>T (p.Ala349Val) rs121909021
NM_000492.3(CFTR):c.1055G>A (p.Arg352Gln) rs121908753
NM_000492.3(CFTR):c.1210-12T[5] rs1805177
NM_000492.3(CFTR):c.1364C>A (p.Ala455Glu) rs74551128
NM_000492.3(CFTR):c.1408G>A (p.Val470Met) rs213950
NM_000492.3(CFTR):c.1438G>T (p.Gly480Cys) rs79282516
NM_000492.3(CFTR):c.1475C>T (p.Ser492Phe) rs121909017
NM_000492.3(CFTR):c.1516A>G (p.Ile506Val) rs1800091
NM_000492.3(CFTR):c.1521_1523delCTT (p.Phe508delPhe) rs113993960
NM_000492.3(CFTR):c.1523T>G (p.Phe508Cys) rs74571530
NM_000492.3(CFTR):c.1572C>A (p.Cys524Ter) rs121908754
NM_000492.3(CFTR):c.1601C>A (p.Ala534Glu) rs387906368
NM_000492.3(CFTR):c.1624G>T (p.Gly542Ter) rs113993959
NM_000492.3(CFTR):c.1645A>C (p.Ser549Arg) rs121908757
NM_000492.3(CFTR):c.1646G>A (p.Ser549Asn) rs121908755
NM_000492.3(CFTR):c.1651G>A (p.Gly551Ser) rs121909013
NM_000492.3(CFTR):c.1652G>A (p.Gly551Asp) rs75527207
NM_000492.3(CFTR):c.1658G>A (p.Arg553Gln) rs121909044
NM_000492.3(CFTR):c.1666A>G (p.Ile556Val) rs75789129
NM_000492.3(CFTR):c.1679G>A (p.Arg560Lys) rs80055610
NM_000492.3(CFTR):c.1682C>A (p.Ala561Glu) rs121909047
NM_000492.3(CFTR):c.1721C>A (p.Pro574His) rs121908758
NM_000492.3(CFTR):c.1727G>C (p.Gly576Ala) rs1800098
NM_000492.3(CFTR):c.1820_1903del84 (p.Met607_Gln634del) rs121908777
NM_000492.3(CFTR):c.2490+1G>A rs141158996
NM_000492.3(CFTR):c.2551C>T (p.Arg851Ter) rs121909012
NM_000492.3(CFTR):c.2735C>T (p.Ser912Leu) rs121909034
NM_000492.3(CFTR):c.2991G>C (p.Leu997Phe) rs1800111
NM_000492.3(CFTR):c.3199G>A (p.Ala1067Thr) rs121909020
NM_000492.3(CFTR):c.3254A>G (p.His1085Arg) rs79635528
NM_000492.3(CFTR):c.328G>C (p.Asp110His) rs113993958
NM_000492.3(CFTR):c.3469-20T>C rs373002889
NM_000492.3(CFTR):c.350G>A (p.Arg117His) rs78655421
NM_000492.3(CFTR):c.3659C>T (p.Thr1220Ile) rs1800123
NM_000492.3(CFTR):c.3712C>T (p.Gln1238Ter) rs121908766
NM_000492.3(CFTR):c.3717+4A>G rs387906362
NM_000492.3(CFTR):c.3746G>A (p.Gly1249Glu) rs121909040
NM_000492.3(CFTR):c.3752G>A (p.Ser1251Asn) rs74503330
NM_000492.3(CFTR):c.3763T>C (p.Ser1255Pro) rs121909041
NM_000492.3(CFTR):c.3808G>A (p.Asp1270Asn) rs11971167
NM_000492.3(CFTR):c.3846G>A (p.Trp1282Ter) rs77010898
NM_000492.3(CFTR):c.3873G>C (p.Gln1291His) rs121909015
NM_000492.3(CFTR):c.3937C>T (p.Gln1313Ter) rs121909026
NM_000492.3(CFTR):c.4056G>C (p.Gln1352His) rs113857788
NM_000492.3(CFTR):c.617T>G (p.Leu206Trp) rs121908752
NM_000492.3(CFTR):c.650A>G (p.Glu217Gly) rs121909046
NM_000495.4(COL4A5):c.161G>A (p.Gly54Asp) rs104886043
NM_000495.4(COL4A5):c.4613G>C (p.Trp1538Ser) rs104886293
NM_000495.4(COL4A5):c.4946T>G (p.Leu1649Arg) rs104886303
NM_000495.4(COL4A5):c.5030G>A (p.Arg1677Gln) rs104886308
NM_000495.4(COL4A5):c.973G>A (p.Gly325Arg) rs104886088
NM_000496.2(CRYBB2):c.463C>T (p.Gln155Ter) rs74315489
NM_000497.3(CYP11B1):c.1269T>G (p.Tyr423Ter) rs267606755
NM_000497.3(CYP11B1):c.1343G>A (p.Arg448His) rs28934586
NM_000497.3(CYP11B1):c.281C>T (p.Pro94Leu) rs104894070
NM_000500.7(CYP21A2):c.1069C>T (p.Arg357Trp) rs7769409
NM_000500.7(CYP21A2):c.1360C>T (p.Pro454Ser) rs6445
NM_000500.7(CYP21A2):c.188A>T (p.His63Leu) rs9378252
NM_000500.7(CYP21A2):c.293-13C>G rs6467
NM_000500.7(CYP21A2):c.332_339delGAGACTAC (p.Gly111Valfs) rs387906510
NM_000500.7(CYP21A2):c.518T>A (p.Ile173Asn) rs6475
NM_000500.7(CYP21A2):c.806G>C (p.Ser269Thr) rs6472
NM_000500.7(CYP21A2):c.844G>T (p.Val282Leu) rs6471
NM_000500.7(CYP21A2):c.92C>T (p.Pro31Leu) rs9378251
NM_000500.7(CYP21A2):c.955C>T (p.Gln319Ter) rs7755898
NM_000500.9(CYP21A2):c.25_27dup (p.Leu10_Pro11insLeu) rs61338903
NM_000503.5(EYA1):c.1276G>A (p.Gly426Ser) rs121909199
NM_000504.3(F10):c.424G>A (p.Glu142Lys) rs61753266
NM_000505.3(F12):c.158A>G (p.Tyr53Cys) rs118204455
NM_000505.3(F12):c.1681-1G>A rs199988476
NM_000506.4(F2):c.*97G>A rs1799963
NM_000506.4(F2):c.1787G>T (p.Arg596Leu) rs387907201
NM_000508.4(FGA):c.991A>G (p.Thr331Ala) rs6050
NM_000510.2(FSHB):c.236_237delTG (p.Val79Glufs) rs5030646
NM_000511.5(FUT2):c.461G>A (p.Trp154Ter) rs601338
NM_000512.4(GALNS):c.1156C>T (p.Arg386Cys) rs118204437
NM_000512.4(GALNS):c.337A>T (p.Ile113Phe) rs118204438
NM_000512.4(GALNS):c.935C>G (p.Thr312Ser) rs118204446
NM_000514.3(GDNF):c.277C>T (p.Arg93Trp) rs36119840
NM_000516.5(GNAS):c.1A>G (p.Met1Val) rs137854530
NM_000516.5(GNAS):c.601C>T (p.Arg201Cys) rs11554273
NM_000516.5(GNAS):c.602G>A (p.Arg201His) rs121913495
NM_000516.5(GNAS):c.772C>T (p.Arg258Trp) rs137854535
NM_000517.4(HBA2):c.122A>T (p.Lys41Met) rs281864828
NM_000517.4(HBA2):c.142G>C (p.Asp48His) rs281864834
NM_000517.4(HBA2):c.420del (p.Lys140Asnfs) rs63750520
NM_000517.4(HBA2):c.427T>A (p.Ter143Lys) rs41464951
NM_000517.4(HBA2):c.427T>C (p.Ter143Gln) rs41464951
NM_000517.4(HBA2):c.427T>G (p.Ter143Glu) rs41464951
NM_000517.6(HBA2):c.*92A>G rs63750067
NM_000517.6(HBA2):c.146T>G (p.Leu49Arg) rs41392146
NM_000517.6(HBA2):c.178G>C (p.Gly60Arg) rs41328049
NM_000517.6(HBA2):c.186G>C (p.Lys62Asn) rs33985574
NM_000517.6(HBA2):c.257A>T (p.Asp86Val) rs41331747
NM_000517.6(HBA2):c.266C>T (p.Ala89Val) rs33983416
NM_000517.6(HBA2):c.301-1G>A rs587776827
NM_000517.6(HBA2):c.314G>A (p.Cys105Tyr) rs41417548
NM_000517.6(HBA2):c.377T>C (p.Leu126Pro) rs41397847
NM_000517.6(HBA2):c.391G>C (p.Ala131Pro) rs41529844
NM_000517.6(HBA2):c.418A>G (p.Lys140Glu) rs41361546
NM_000517.6(HBA2):c.428A>C (p.Ter143Ser) rs41321345
NM_000517.6(HBA2):c.69C>T (p.Gly23=) rs63751457
NM_000517.6(HBA2):c.89T>C (p.Leu30Pro) rs41341344
NM_000518.4(HBB):c.125T>C (p.Phe42Ser) rs33926796
NM_000518.4(HBB):c.126_129delCTTT (p.Phe42fs) rs80356821
NM_000518.4(HBB):c.137T>C (p.Phe46Ser) rs33978338
NM_000518.4(HBB):c.157G>A (p.Asp53Asn) rs33961886
NM_000518.4(HBB):c.157G>C (p.Asp53His) rs33961886
NM_000518.4(HBB):c.182T>A (p.Val61Glu) rs33931779
NM_000518.4(HBB):c.184A>G (p.Lys62Glu) rs33995148
NM_000518.4(HBB):c.19G>A (p.Glu7Lys) rs33930165
NM_000518.4(HBB):c.203T>A (p.Val68Glu) rs33918343
NM_000518.4(HBB):c.206T>A (p.Leu69His) rs33972593
NM_000518.4(HBB):c.208G>A (p.Gly70Ser) rs33947415
NM_000518.4(HBB):c.220G>A (p.Asp74Asn) rs33945705
NM_000518.4(HBB):c.230delC (p.Ala77Valfs) rs281864901
NM_000518.4(HBB):c.238G>A (p.Asp80Asn) rs33990858
NM_000518.4(HBB):c.23A>G (p.Glu8Gly) rs34387455
NM_000518.4(HBB):c.248A>C (p.Lys83Thr) rs33987903
NM_000518.4(HBB):c.248A>T (p.Lys83Met) rs33987903
NM_000518.4(HBB):c.249G>Y (p.Lys83Asn) rs33991993
NM_000518.4(HBB):c.263C>A (p.Thr88Lys) rs33993568
NM_000518.4(HBB):c.266T>C (p.Leu89Pro) rs33940204
NM_000518.4(HBB):c.269G>A (p.Ser90Asn) rs33917628
NM_000518.4(HBB):c.271G>A (p.Glu91Lys) rs33913712
NM_000518.4(HBB):c.275T>C (p.Leu92Pro) rs33917785
NM_000518.4(HBB):c.277C>T (p.His93Tyr) rs33924775
NM_000518.4(HBB):c.283G>C (p.Asp95His) rs33959340
NM_000518.4(HBB):c.293A>T (p.His98Leu) rs33951978
NM_000518.4(HBB):c.298G>A (p.Asp100Asn) rs33954595
NM_000518.4(HBB):c.298G>C (p.Asp100His) rs33954595
NM_000518.4(HBB):c.298G>T (p.Asp100Tyr) rs33954595
NM_000518.4(HBB):c.299A>C (p.Asp100Ala) rs33971048
NM_000518.4(HBB):c.299A>G (p.Asp100Gly) rs33971048
NM_000518.4(HBB):c.299A>T (p.Asp100Val) rs33971048
NM_000518.4(HBB):c.29C>G (p.Ser10Cys) rs33918131
NM_000518.4(HBB):c.302C>T (p.Pro101Leu) rs33965000
NM_000518.4(HBB):c.304G>A (p.Glu102Lys) rs33966487
NM_000518.4(HBB):c.320T>G (p.Leu107Arg) rs33941844
NM_000518.4(HBB):c.332T>C (p.Leu111Pro) rs35256489
NM_000518.4(HBB):c.34G>A (p.Val12Ile) rs33974228
NM_000518.4(HBB):c.34G>T (p.Val12Phe) rs33974228
NM_000518.4(HBB):c.364G>A (p.Glu122Lys) rs33946267
NM_000518.4(HBB):c.364G>C (p.Glu122Gln) rs33946267
NM_000518.4(HBB):c.371C>T (p.Thr124Ile) rs33935383
NM_000518.4(HBB):c.374C>A (p.Pro125Gln) rs33983276
NM_000518.4(HBB):c.374C>G (p.Pro125Arg) rs33983276
NM_000518.4(HBB):c.374C>T (p.Pro125Leu) rs33983276
NM_000518.4(HBB):c.404T>C (p.Val135Ala) rs33966761
NM_000518.4(HBB):c.410G>A (p.Gly137Asp) rs33949486
NM_000518.4(HBB):c.422C>A (p.Ala141Asp) rs33927093
NM_000518.4(HBB):c.428C>A (p.Ala143Asp) rs33921821
NM_000518.4(HBB):c.439C>G (p.His147Asp) rs33961444
NM_000518.4(HBB):c.440A>C (p.His147Pro) rs33954264
NM_000518.4(HBB):c.440A>T (p.His147Leu) rs33954264
NM_000518.4(HBB):c.440_441dup (p.Ter148Thrfs) rs33999427
NM_000518.4(HBB):c.44T>C (p.Leu15Pro) rs33935445
NM_000518.4(HBB):c.44T>G (p.Leu15Arg) rs33935445
NM_000518.4(HBB):c.64G>T (p.Asp22Tyr) rs33950093
NM_000518.4(HBB):c.67G>A (p.Glu23Lys) rs33959855
NM_000518.4(HBB):c.67G>C (p.Glu23Gln) rs33959855
NM_000518.4(HBB):c.68A>C (p.Glu23Ala) rs33936254
NM_000518.4(HBB):c.68A>G (p.Glu23Gly) rs33936254
NM_000518.4(HBB):c.68A>T (p.Glu23Val) rs33936254
NM_000518.4(HBB):c.70G>T (p.Val24Phe) rs33929459
NM_000518.4(HBB):c.86T>A (p.Leu29Gln) rs33916412
NM_000518.5(HBB):c.*113A>G rs33985472
NM_000518.5(HBB):c.-137C>G rs33941377
NM_000518.5(HBB):c.-138C>T rs33944208
NM_000518.5(HBB):c.-140C>T rs34999973
NM_000518.5(HBB):c.-142C>T rs34883338
NM_000518.5(HBB):c.-78A>G rs33931746
NM_000518.5(HBB):c.100G>A (p.Val34Met) rs1141370
NM_000518.5(HBB):c.114G>A (p.Trp38Ter) rs33974936
NM_000518.5(HBB):c.122G>A (p.Arg41Lys) rs34831026
NM_000518.5(HBB):c.128T>C (p.Phe43Ser) rs34378160
NM_000518.5(HBB):c.131A>C (p.Glu44Ala) rs35262412
NM_000518.5(HBB):c.16C>T (p.Pro6Ser) rs33912272
NM_000518.5(HBB):c.170G>A (p.Gly57Asp) rs34439278
NM_000518.5(HBB):c.174C>A (p.Asn58Lys) rs35278874
NM_000518.5(HBB):c.179A>C (p.Lys60Thr) rs35537181
NM_000518.5(HBB):c.190C>T (p.His64Tyr) rs33922873
NM_000518.5(HBB):c.200A>C (p.Lys67Thr) rs35939489
NM_000518.5(HBB):c.209G>A (p.Gly70Asp) rs34718174
NM_000518.5(HBB):c.20A>T (p.Glu7Val) rs334
NM_000518.5(HBB):c.217dup (p.Ser73Lysfs) rs33969853
NM_000518.5(HBB):c.253A>G (p.Thr85Ala) rs35960772
NM_000518.5(HBB):c.262A>C (p.Thr88Pro) rs35553496
NM_000518.5(HBB):c.268A>C (p.Ser90Arg) rs35351128
NM_000518.5(HBB):c.286A>G (p.Lys96Glu) rs33914359
NM_000518.5(HBB):c.2T>C (p.Met1Thr) rs33941849
NM_000518.5(HBB):c.305A>G (p.Glu102Gly) rs33937393
NM_000518.5(HBB):c.306G>C (p.Glu102Asp) rs35209591
NM_000518.5(HBB):c.312C>G (p.Phe104Leu) rs35067717
NM_000518.5(HBB):c.314G>C (p.Arg105Thr) rs33911434
NM_000518.5(HBB):c.315G>C (p.Arg105Ser) rs33914944
NM_000518.5(HBB):c.316C>T (p.Leu106Phe) rs34022507
NM_000518.5(HBB):c.328G>A (p.Val110Met) rs33969677
NM_000518.5(HBB):c.337T>C (p.Cys113Arg) rs35849199
NM_000518.5(HBB):c.344T>C (p.Leu115Pro) rs36015961
NM_000518.5(HBB):c.363A>C (p.Lys121Asn) rs34726542
NM_000518.5(HBB):c.380T>A (p.Val127Glu) rs33925391
NM_000518.5(HBB):c.380T>G (p.Val127Gly) rs33925391
NM_000518.5(HBB):c.389C>T (p.Ala130Val) rs111645889
NM_000518.5(HBB):c.394C>A (p.Gln132Lys) rs33910209
NM_000518.5(HBB):c.397A>C (p.Lys133Gln) rs33953406
NM_000518.5(HBB):c.421G>A (p.Ala141Thr) rs34980264
NM_000518.5(HBB):c.431A>C (p.His144Pro) rs33918338
NM_000518.5(HBB):c.435G>C (p.Lys145Asn) rs35020585
NM_000518.5(HBB):c.436T>C (p.Tyr146His) rs33949869
NM_000518.5(HBB):c.437A>G (p.Tyr146Cys) rs35117167
NM_000518.5(HBB):c.438T>A (p.Tyr146Ter) rs35291591
NM_000518.5(HBB):c.4G>A (p.Val2Met) rs33958358
NM_000518.5(HBB):c.50G>A (p.Gly17Asp) rs33962676
NM_000518.5(HBB):c.59A>G (p.Asn20Ser) rs33972047
NM_000518.5(HBB):c.5T>C (p.Val2Ala) rs33949930
NM_000518.5(HBB):c.61G>A (p.Val21Met) rs35890959
NM_000518.5(HBB):c.75T>A (p.Gly25=) rs33951465
NM_000518.5(HBB):c.79G>A (p.Glu27Lys) rs33950507
NM_000518.5(HBB):c.82G>T (p.Ala28Ser) rs35424040
NM_000518.5(HBB):c.85dup (p.Leu29Profs) rs35532010
NM_000518.5(HBB):c.92+1G>T rs33971440
NM_000518.5(HBB):c.92+5G>A rs33915217
NM_000518.5(HBB):c.93-15T>G rs35456885
NM_000519.3(HBD):c.226C>G (p.Leu76Val) rs34430836
NM_000519.3(HBD):c.82G>T (p.Ala28Ser) rs35152987
NM_000520.5(HEXA):c.-207-2357_253+5128delinsG
NM_000520.5(HEXA):c.1351C>G (p.Leu451Val) rs28940871
NM_000520.5(HEXA):c.1444G>A (p.Glu482Lys) rs121907952
NM_000520.5(HEXA):c.1453T>C (p.Trp485Arg) rs121907968
NM_000520.5(HEXA):c.1495C>T (p.Arg499Cys) rs121907966
NM_000520.5(HEXA):c.1496G>A (p.Arg499His) rs121907956
NM_000520.5(HEXA):c.1510C>T (p.Arg504Cys) rs28942071
NM_000520.5(HEXA):c.346+1G>C rs797044432
NM_000520.5(HEXA):c.508C>T (p.Arg170Trp) rs121907972
NM_000520.5(HEXA):c.509G>A (p.Arg170Gln) rs121907957
NM_000520.5(HEXA):c.590A>C (p.Lys197Thr) rs121907973
NM_000520.5(HEXA):c.611A>G (p.His204Arg) rs121907976
NM_000520.5(HEXA):c.672+1G>A rs387906311
NM_000520.5(HEXA):c.739C>T (p.Arg247Trp) rs121907970
NM_000520.5(HEXA):c.805+1G>A rs121907980
NM_000520.5(HEXA):c.806-7G>A rs770932296
NM_000520.5(HEXA):c.915_917del (p.Phe305del) rs121907960
NM_000521.3(HEXB):c.1250C>T (p.Pro417Leu) rs28942073
NM_000521.3(HEXB):c.1367A>C (p.Tyr456Ser) rs121907982
NM_000521.3(HEXB):c.1514G>A (p.Arg505Gln) rs121907983
NM_000521.3(HEXB):c.1627G>A (p.Ala543Thr) rs121907984
NM_000521.3(HEXB):c.362A>G (p.Lys121Arg) rs11556045
NM_000521.3(HEXB):c.619A>G (p.Ile207Val) rs10805890
NM_000523.3(HOXD13):c.32G>C (p.Gly11Ala) rs536639583
NM_000525.3(KCNJ11):c.124T>C (p.Cys42Arg) rs80356610
NM_000525.3(KCNJ11):c.149G>C (p.Arg50Pro) rs80356611
NM_000525.3(KCNJ11):c.157G>A (p.Gly53Ser) rs80356613
NM_000525.3(KCNJ11):c.157G>C (p.Gly53Arg) rs80356613
NM_000525.3(KCNJ11):c.158G>A (p.Gly53Asp) rs80356615
NM_000525.3(KCNJ11):c.175G>A (p.Val59Met) rs80356616
NM_000525.3(KCNJ11):c.176T>G (p.Val59Gly) rs80356617
NM_000525.3(KCNJ11):c.497G>T (p.Cys166Phe) rs80356618
NM_000525.3(KCNJ11):c.499A>C (p.Ile167Leu) rs80356620
NM_000525.3(KCNJ11):c.509A>G (p.Lys170Arg) rs80356621
NM_000525.3(KCNJ11):c.510G>C (p.Lys170Asn) rs80356622
NM_000525.3(KCNJ11):c.601C>T (p.Arg201Cys) rs80356625
NM_000525.3(KCNJ11):c.602G>A (p.Arg201His) rs80356624
NM_000525.3(KCNJ11):c.67A>G (p.Lys23Glu) rs5219
NM_000525.3(KCNJ11):c.844G>A (p.Glu282Lys) rs267607196
NM_000525.3(KCNJ11):c.902G>A (p.Arg301His) rs74339576
NM_000526.4(KRT14):c.356T>C (p.Met119Thr) rs28928893
NM_000526.4(KRT14):c.368A>G (p.Asn123Ser) rs60171927
NM_000526.4(KRT14):c.373C>T (p.Arg125Cys) rs60399023
NM_000526.4(KRT14):c.374G>A (p.Arg125His) rs58330629
NM_000527.4(LDLR):c.-138delT rs387906307
NM_000527.4(LDLR):c.1202T>A (p.Leu401His) rs121908038
NM_000527.4(LDLR):c.1285G>A (p.Val429Met) rs28942078
NM_000527.4(LDLR):c.1291G>A (p.Ala431Thr) rs28942079
NM_000527.4(LDLR):c.1297G>C (p.Asp433His) rs121908036
NM_000527.4(LDLR):c.131G>A (p.Trp44Ter) rs267607213
NM_000527.4(LDLR):c.137G>C (p.Cys46Ser) rs121908041
NM_000527.4(LDLR):c.139_144del (p.Asp47_Gly48del) rs387906301
NM_000527.4(LDLR):c.1567G>A (p.Val523Met) rs28942080
NM_000527.4(LDLR):c.1637G>A (p.Gly546Asp) rs28942081
NM_000527.4(LDLR):c.1646G>A (p.Gly549Asp) rs28941776
NM_000527.4(LDLR):c.1694G>T (p.Gly565Val) rs28942082
NM_000527.4(LDLR):c.1891_2311+1062del (p.(?))
NM_000527.4(LDLR):c.2000G>A (p.Cys667Tyr) rs28942083
NM_000527.4(LDLR):c.2043C>A (p.Cys681Ter) rs121908031
NM_000527.4(LDLR):c.2054C>T (p.Pro685Leu) rs28942084
NM_000527.4(LDLR):c.2140+1G>A rs145787161
NM_000527.4(LDLR):c.2140+86C>G rs587776886
NM_000527.4(LDLR):c.2483A>G (p.Tyr828Cys) rs28942085
NM_000527.4(LDLR):c.2531G>A (p.Gly844Asp) rs121908037
NM_000527.4(LDLR):c.259T>G (p.Trp87Gly) rs121908025
NM_000527.4(LDLR):c.313+1G>A rs112029328
NM_000527.4(LDLR):c.326G>C (p.Cys109Ser) rs121908042
NM_000527.4(LDLR):c.523G>A (p.Asp175Asn) rs121908033
NM_000527.4(LDLR):c.530C>T (p.Ser177Leu) rs121908026
NM_000527.4(LDLR):c.551G>A (p.Cys184Tyr) rs121908039
NM_000527.4(LDLR):c.564C>G (p.Tyr188Ter) rs121908034
NM_000527.4(LDLR):c.621C>T (p.Gly207=) rs121908044
NM_000527.4(LDLR):c.654_656delTGG (p.Gly219del) rs121908027
NM_000527.4(LDLR):c.664_681dup18 (p.Asp227_Glu228insCysLysAspLysSerAsp) rs387906306
NM_000527.4(LDLR):c.670G>A (p.Asp224Asn) rs387906303
NM_000527.4(LDLR):c.680_681delAC (p.Asp227Glyfs) rs387906305
NM_000527.4(LDLR):c.681C>G (p.Asp227Glu) rs121908028
NM_000527.4(LDLR):c.682G>A (p.Glu228Lys) rs121908029
NM_000527.4(LDLR):c.693C>A (p.Cys231Ter) rs121908035
NM_000527.4(LDLR):c.694+2T>C rs200238879
NM_000527.4(LDLR):c.782G>T (p.Cys261Phe) rs121908040
NM_000527.4(LDLR):c.910G>A (p.Asp304Asn) rs121908030
NM_000528.3(MAN2B1):c.1067C>G (p.Pro356Arg) rs121434333
NM_000528.3(MAN2B1):c.1830+1G>C rs80338677
NM_000528.3(MAN2B1):c.215A>T (p.His72Leu) rs387906261
NM_000528.3(MAN2B1):c.2248C>T (p.Arg750Trp) rs80338680
NM_000528.3(MAN2B1):c.2278C>T (p.Arg760Ter) rs121434331
NM_000528.3(MAN2B1):c.2426T>C (p.Leu809Pro) rs80338681
NM_000530.6(MPZ):c.293G>A (p.Arg98His) rs121913589
NM_000530.6(MPZ):c.313C>A (p.Pro105Thr) rs121913609
NM_000530.7(MPZ):c.103G>T (p.Asp35Tyr) rs121913596
NM_000530.7(MPZ):c.242A>G (p.His81Arg) rs121913594
NM_000530.7(MPZ):c.308G>A (p.Gly103Glu) rs121913600
NM_000530.7(MPZ):c.409G>A (p.Gly137Ser) rs121913588
NM_000530.7(MPZ):c.499G>C (p.Gly167Arg) rs121913586
NM_000531.5(OTC):c.118C>T (p.Arg40Cys) rs72554307
NM_000531.5(OTC):c.137A>G (p.Lys46Arg) rs1800321
NM_000531.5(OTC):c.674C>T (p.Pro225Leu) rs67120076
NM_000532.4(PCCB):c.1228C>T (p.Arg410Trp) rs121964959
NM_000532.4(PCCB):c.1283C>T (p.Thr428Ile) rs111033542
NM_000532.4(PCCB):c.1304A>G (p.Tyr435Cys) rs121964961
NM_000532.4(PCCB):c.1539_1540insCCC (p.Ala513_Arg514insPro) rs202247821
NM_000532.4(PCCB):c.502G>A (p.Glu168Lys) rs121964960
NM_000533.4(PLP1):c.409C>T (p.Arg137Trp) rs132630295
NM_000535.5(PMS2):c.2186_2187delTC (p.Leu729Glnfs) rs587779335
NM_000535.6(PMS2):c.1144+2T>A rs267608158
NM_000535.6(PMS2):c.1237_1239del (p.Lys413del) rs267608159
NM_000535.6(PMS2):c.137G>T (p.Ser46Ile) rs121434629
NM_000535.6(PMS2):c.1731_1732delGCinsAGT (p.Arg578Valfs) rs1057515572
NM_000535.6(PMS2):c.2002A>G (p.Ile668Val) rs869320619
NM_000536.3(RAG2):c.115A>G (p.Arg39Gly) rs121917897
NM_000536.3(RAG2):c.123C>G (p.Cys41Trp) rs121917895
NM_000536.3(RAG2):c.1352G>C (p.Gly451Ala) rs121918575
NM_000536.3(RAG2):c.1433G>A (p.Cys478Tyr) rs121918573
NM_000536.3(RAG2):c.230C>A (p.Thr77Asn) rs121918574
NM_000536.3(RAG2):c.644C>T (p.Thr215Ile) rs35691292
NM_000536.3(RAG2):c.686G>A (p.Arg229Gln) rs121917894
NM_000536.3(RAG2):c.854T>G (p.Met285Arg) rs121917896
NM_000539.3(RHO):c.1040C>T (p.Pro347Leu) rs29001566
NM_000539.3(RHO):c.158C>G (p.Pro53Arg) rs28933395
NM_000539.3(RHO):c.568G>T (p.Asp190Tyr) rs104893779
NM_000540.2(RYR1):c.1021G>A (p.Gly341Arg) rs121918592
NM_000540.2(RYR1):c.11941C>T (p.His3981Tyr) rs148772854
NM_000540.2(RYR1):c.1209C>G (p.Ile403Met) rs118192116
NM_000540.2(RYR1):c.13909A>G (p.Thr4637Ala) rs118192166
NM_000540.2(RYR1):c.14387A>G (p.Tyr4796Cys) rs118192167
NM_000540.2(RYR1):c.14477C>T (p.Thr4826Ile) rs121918595
NM_000540.2(RYR1):c.14545G>A (p.Val4849Ile) rs118192168
NM_000540.2(RYR1):c.14582G>A (p.Arg4861His) rs63749869
NM_000540.2(RYR1):c.14693T>C (p.Ile4898Thr) rs118192170
NM_000540.2(RYR1):c.1565A>C (p.Tyr522Ser) rs118192162
NM_000540.2(RYR1):c.1840C>T (p.Arg614Cys) rs118192172
NM_000540.2(RYR1):c.325C>T (p.Arg109Trp) rs118192173
NM_000540.2(RYR1):c.487C>T (p.Arg163Cys) rs118192161
NM_000540.2(RYR1):c.6487C>T (p.Arg2163Cys) rs118192175
NM_000540.2(RYR1):c.6488G>A (p.Arg2163His) rs118192163
NM_000540.2(RYR1):c.6502G>A (p.Val2168Met) rs118192176
NM_000540.2(RYR1):c.6617C>T (p.Thr2206Met) rs118192177
NM_000540.2(RYR1):c.6721C>T rs200563280
NM_000540.2(RYR1):c.7042_7044delGAG (p.Glu2348del) rs121918596
NM_000540.2(RYR1):c.7300G>A (p.Gly2434Arg) rs121918593
NM_000540.2(RYR1):c.7304G>A (p.Arg2435His) rs28933396
NM_000540.2(RYR1):c.7372C>T (p.Arg2458Cys) rs28933397
NM_000540.2(RYR1):c.7373G>A (p.Arg2458His) rs121918594
NM_000540.2(RYR1):c.742G>A (p.Gly248Arg) rs1801086
NM_000540.2(RYR1):c.97A>G (p.Lys33Glu) rs193922746
NM_000543.4(SMPD1):c.1267C>T (p.His423Tyr) rs120074126
NM_000545.6(HNF1A):c.1720G>A (p.Gly574Ser) rs1169305
NM_000545.6(HNF1A):c.1748G>A (p.Arg583Gln) rs137853242
NM_000545.6(HNF1A):c.79A>C (p.Ile27Leu) rs1169288
NM_000545.6(HNF1A):c.827C>A (p.Ala276Asp) rs137853245
NM_000545.6(HNF1A):c.92G>A (p.Gly31Asp) rs137853247
NM_000546.5(TP53):c.*1175A>C rs78378222
NM_000546.5(TP53):c.215C>G (p.Pro72Arg) rs1042522
NM_000546.5(TP53):c.412G>C (p.Ala138Pro) rs28934875
NM_000546.5(TP53):c.451C>A (p.Pro151Thr) rs28934874
NM_000546.5(TP53):c.451C>T (p.Pro151Ser) rs28934874
NM_000546.5(TP53):c.469G>T (p.Val157Phe) rs121912654
NM_000546.5(TP53):c.524G>A (p.Arg175His) rs28934578
NM_000546.5(TP53):c.542G>T (p.Arg181Leu) rs397514495
NM_000546.5(TP53):c.566C>T (p.Ala189Val) rs121912665
NM_000546.5(TP53):c.659A>C (p.Tyr220Ser) rs121912666
NM_000546.5(TP53):c.722C>T (p.Ser241Phe) rs28934573
NM_000546.5(TP53):c.725G>A (p.Cys242Tyr) rs121912655
NM_000546.5(TP53):c.733G>A (p.Gly245Ser) rs28934575
NM_000546.5(TP53):c.733G>T (p.Gly245Cys) rs28934575
NM_000546.5(TP53):c.734G>A (p.Gly245Asp) rs121912656
NM_000546.5(TP53):c.742C>T (p.Arg248Trp) rs121912651
NM_000546.5(TP53):c.743G>A (p.Arg248Gln) rs11540652
NM_000546.5(TP53):c.747G>T (p.Arg249Ser) rs28934571
NM_000546.5(TP53):c.770T>A (p.Leu257Gln) rs28934577
NM_000546.5(TP53):c.772G>A (p.Glu258Lys) rs121912652
NM_000546.5(TP53):c.814G>T (p.Val272Leu) rs121912657
NM_000546.5(TP53):c.818G>A (p.Arg273His) rs28934576
NM_000546.5(TP53):c.839G>C (p.Arg280Thr) rs121912660
NM_000546.5(TP53):c.844C>T (p.Arg282Trp) rs28934574
NM_000546.5(TP53):c.974G>T (p.Gly325Val) rs121912659
NM_000547.5(TPO):c.1978C>G (p.Gln660Glu) rs121908088
NM_000548.3(TSC2):c.4508A>C (p.Gln1503Pro) rs45516293
NM_000548.4(TSC2):c.4639G>A (p.Val1547Ile) rs745895675
NM_000549.4(TSHB):c.205C>T (p.Gln69Ter) rs121918670
NM_000550.2(TYRP1):c.1067G>A (p.Arg356Gln) rs281865424
NM_000550.2(TYRP1):c.497C>G (p.Ser166Ter) rs104894130
NM_000551.3(VHL):c.188T>C (p.Leu63Pro) rs104893827
NM_000551.3(VHL):c.191G>C (p.Arg64Pro) rs104893826
NM_000551.3(VHL):c.241C>T (p.Pro81Ser) rs104893829
NM_000551.3(VHL):c.481C>T (p.Arg161Ter) rs5030818
NM_000551.3(VHL):c.499C>G (p.Arg167Gly) rs5030820
NM_000551.3(VHL):c.499C>T (p.Arg167Trp) rs5030820
NM_000551.3(VHL):c.562C>G (p.Leu188Val) rs5030824
NM_000551.3(VHL):c.574C>T (p.Pro192Ser) rs28940300
NM_000551.3(VHL):c.598C>T (p.Arg200Trp) rs28940298
NM_000552.4(VWF):c.3797C>T (p.Pro1266Leu) rs61749370
NM_000552.4(VWF):c.3922C>T (p.Arg1308Cys) rs61749387
NM_000552.4(VWF):c.4196G>A (p.Arg1399His) rs1800382
NM_000552.4(VWF):c.4751A>G (p.Tyr1584Cys) rs1800386
NM_000552.4(VWF):c.4789C>T (p.Arg1597Trp) rs61750117
NM_000553.4(WRN):c.3139-1G>C rs113993961
NM_000553.5(WRN):c.1105C>T (p.Arg369Ter) rs17847577
NM_000554.5(CRX):c.122G>A (p.Arg41Gln) rs61748436
NM_000557.4(GDF5):c.-275T>C rs143383
NM_000558.3(HBA1):c.134C>T (p.Pro45Leu) rs33978134
NM_000558.3(HBA1):c.179G>A (p.Gly60Asp) rs28928878
NM_000558.3(HBA1):c.187_189delGTG (p.Val63del) rs35672478
NM_000558.3(HBA1):c.20A>G (p.Asp7Gly) rs33986902
NM_000558.3(HBA1):c.278G>A (p.Arg93Gln) rs33991779
NM_000558.3(HBA1):c.278G>T (p.Arg93Leu) rs33991779
NM_000558.3(HBA1):c.287C>T (p.Pro96Leu) rs33931314
NM_000558.3(HBA1):c.389T>C (p.Leu130Pro) rs35993655
NM_000558.3(HBA1):c.424C>T (p.Arg142Cys) rs33991910
NM_000558.3(HBA1):c.425G>A (p.Arg142His) rs33935328
NM_000558.3(HBA1):c.425G>T (p.Arg142Leu) rs33935328
NM_000558.3(HBA1):c.49A>G (p.Lys17Glu) rs41407250
NM_000558.5(HBA1):c.17C>A (p.Ala6Asp) rs34090856
NM_000558.5(HBA1):c.223G>C (p.Asp75His) rs28928875
NM_000558.5(HBA1):c.265G>T (p.Ala89Ser) rs35239527
NM_000558.5(HBA1):c.362C>A (p.Ala121Glu) rs63749927
NM_000558.5(HBA1):c.364G>A (p.Val122Met) rs63751008
NM_000558.5(HBA1):c.379G>C (p.Asp127His) rs63750950
NM_000558.5(HBA1):c.410T>G (p.Leu137Arg) rs34635364
NM_000558.5(HBA1):c.421T>C (p.Tyr141His) rs35723200
NM_000558.5(HBA1):c.84G>T (p.Glu28Asp) rs41530750
NM_000559.2(HBG1):c.227C>T (p.Thr76Ile) rs1061234
NM_000572.3(IL10):c.-627A>C rs1800872
NM_000579.3(CCR5):c.-301+246A>G rs1799987
NM_000579.3(CCR5):c.554_585del32 (p.Ser185Ilefs) rs333
NM_000593.5(TAP1):c.2156G>A (p.Arg719Gln) rs121917702
NM_000602.4(SERPINE1):c.-820_-817G(4_5) rs1799762
NM_000602.4(SERPINE1):c.43G>A (p.Ala15Thr) rs6092
NM_000603.4(NOS3):c.894T>G (p.Asp298Glu) rs1799983
NM_000617.2(SLC11A2):c.1197G>C (p.Glu399Asp) rs121918365
NM_000621.4(HTR2A):c.614-2211T>C rs7997012
NM_000628.4(IL10RB):c.139A>G (p.Lys47Glu) rs2834167
NM_000642.2(AGL):c.1222C>T (p.Arg408Ter) rs113994128
NM_000642.2(AGL):c.16C>T (p.Gln6Ter) rs113994126
NM_000642.2(AGL):c.1735+1G>T rs199922945
NM_000642.2(AGL):c.18_19delGA (p.Gln6Hisfs) rs113994127
NM_000642.2(AGL):c.2039G>A (p.Trp680Ter) rs113994129
NM_000642.2(AGL):c.3965delT (p.Val1322Alafs) rs113994132
NM_000642.2(AGL):c.3980G>A (p.Trp1327Ter) rs267606640
NM_000642.2(AGL):c.4260-12A>G rs369973784
NM_000642.2(AGL):c.4456delT (p.Ser1486Profs) rs113994134
NM_000642.2(AGL):c.4529dupA (p.Tyr1510Terfs) rs387906244
NM_000660.6(TGFB1):c.29C>T (p.Pro10Leu) rs1800470
NM_000666.2(ACY1):c.1178G>A (p.Arg393His) rs121912701
NM_000684.2(ADRB1):c.145A>G (p.Ser49Gly) rs1801252
NM_000686.4(AGTR2):c.402del (p.Phe134Leufs) rs387906503
NM_000686.4(AGTR2):c.62G>T (p.Gly21Val) rs121917810
NM_000687.3(AHCY):c.428A>G (p.Tyr143Cys) rs121918608
NM_000690.3(ALDH2):c.1510G>A (p.Glu504Lys) rs671
NM_000702.3(ATP1A2):c.1244C>T (p.Thr415Met) rs121918618
NM_000702.3(ATP1A2):c.193C>T (p.Arg65Trp) rs121918619
NM_000702.3(ATP1A2):c.2066G>A (p.Arg689Gln) rs28933401
NM_000702.3(ATP1A2):c.2936C>T (p.Pro979Leu) rs121918615
NM_000709.3(BCKDHA):c.1312T>A (p.Tyr438Asn) rs137852870
NM_000709.3(BCKDHA):c.793C>T (p.Arg265Trp) rs137852873
NM_000709.3(BCKDHA):c.861_868delAGGCCCCG (p.Gly288Valfs) rs794727847
NM_000709.3(BCKDHA):c.868G>A (p.Gly290Arg) rs137852871
NM_000719.6(CACNA1C):c.1204G>A (p.Gly402Ser) rs80315385
NM_000719.6(CACNA1C):c.1216G>A (p.Gly406Arg) rs79891110
NM_000719.6(CACNA1C):c.1468G>A (p.Gly490Arg) rs121912775
NM_000719.6(CACNA1C):c.2573G>A (p.Arg858His) rs786205753
NM_000720.3(CACNA1D):c.1208G>A (p.Gly403Asp) rs386834264
NM_000721.3(CACNA1E):c.1807A>C (p.Ile603Leu) rs778291283
NM_000726.4(CACNB4):c.311G>T (p.Cys104Phe) rs1805031
NM_000742.3(CHRNA2):c.836T>A (p.Ile279Asn) rs104894063
NM_000744.6(CHRNA4):c.1629C>T (p.Ser543=) rs1044396
NM_000744.6(CHRNA4):c.1659G>A (p.Ala553=) rs1044397
NM_000744.6(CHRNA4):c.839C>T (p.Ser280Phe) rs121909580
NM_000744.6(CHRNA4):c.851C>T (p.Ser284Leu) rs28931591
NM_000745.3(CHRNA5):c.1192G>A (p.Asp398Asn) rs16969968
NM_000747.2(CHRNB1):c.865G>A (p.Val289Met) rs137852810
NM_000748.2(CHRNB2):c.859G>A (p.Val287Met) rs74315291
NM_000748.2(CHRNB2):c.859G>C (p.Val287Leu) rs74315291
NM_000754.3(COMT):c.472G>A (p.Val158Met) rs4680
NM_000756.3(CRH):c.89C>G (p.Pro30Arg) rs748404250
NM_000767.5(CYP2B6):c.785A>G (p.Lys262Arg) rs2279343
NM_000769.1(CYP2C19):c.1297C>T (p.Arg433Trp) rs56337013
NM_000769.1(CYP2C19):c.1A>G (p.Met1Val) rs28399504
NM_000769.1(CYP2C19):c.636G>A (p.Trp212Ter) rs4986893
NM_000769.1(CYP2C19):c.681G>A (p.Pro227=) rs4244285
NM_000771.3(CYP2C9):c.1075A>C (p.Ile359Leu) rs1057910
NM_000771.3(CYP2C9):c.430C>T (p.Arg144Cys) rs1799853
NM_000782.4(CYP24A1):c.1226T>C (p.Leu409Ser) rs6068812
NM_000782.4(CYP24A1):c.428_430delAAG (p.Glu143del) rs777676129
NM_000784.3(CYP27A1):c.1016C>T (p.Thr339Met) rs121908102
NM_000784.3(CYP27A1):c.1183C>A (p.Arg395Ser) rs121908096
NM_000784.3(CYP27A1):c.1214G>A (p.Arg405Gln) rs121908099
NM_000784.3(CYP27A1):c.1263+1G>A rs397515355
NM_000784.3(CYP27A1):c.1420C>T (p.Arg474Trp) rs121908098
NM_000784.3(CYP27A1):c.1421G>A (p.Arg474Gln) rs121908097
NM_000784.3(CYP27A1):c.1435C>G (p.Arg479Gly) rs72551322
NM_000784.3(CYP27A1):c.1435C>T (p.Arg479Cys) rs72551322
NM_000784.3(CYP27A1):c.434G>A (p.Gly145Glu) rs72551313
NM_000784.3(CYP27A1):c.844+1G>A rs397515354
NM_000784.3(CYP27A1):c.845-1G>A rs397515353
NM_000784.3(CYP27A1):c.944_948delTGGCC (p.Leu315Glnfs) rs397515356
NM_000784.4(CYP27A1):c.1183C>T (p.Arg395Cys) rs121908096
NM_000785.3(CYP27B1):c.1166G>A (p.Arg389His) rs118204009
NM_000785.3(CYP27B1):c.320G>A (p.Arg107His) rs28934604
NM_000789.3(ACE):c.2306-117_2306-116insAF118569.1:g.14094_14382
NM_000796.5(DRD3):c.25G>A (p.Gly9Ser) rs6280
NM_000806.5(GABRA1):c.335G>A (p.Arg112Gln) rs587777308
NM_000814.5(GABRB3):c.-719C>T rs121913126
NM_000814.6(GABRB3):c.94G>A (p.Gly32Arg) rs71651682
NM_000815.4(GABRD):c.659G>A (p.Arg220His) rs41307846
NM_000816.3(GABRG2):c.245G>A (p.Arg82Gln) rs121909673
NM_000816.3(GABRG2):c.316G>A (p.Ala106Thr) rs796052505
NM_000824.4(GLRB):c.610+5G>A rs281864922
NM_000824.4(GLRB):c.752G>A (p.Gly251Asp) rs121909749
NM_000829.3(GRIA4):c.1915A>T (p.Thr639Ser) rs1555050158
NM_000829.3(GRIA4):c.1921A>G (p.Asn641Asp) rs1555050165
NM_000829.3(GRIA4):c.1928C>G (p.Ala643Gly) rs1555050171
NM_000829.3(GRIA4):c.1931C>T (p.Ala644Val) rs1555050174
NM_000829.3(GRIA4):c.2090G>C (p.Arg697Pro) rs765556214
NM_000833.4(GRIN2A):c.1553G>A (p.Arg518His) rs397518470
NM_000834.4(GRIN2B):c.99dup (p.Ser34Glnfs) rs398122823
NM_000843.4(GRM6):c.1214T>C (p.Ile405Thr) rs121434304
NM_000843.4(GRM6):c.137C>T (p.Pro46Leu) rs62638197
NM_000875.4(IGF1R):c.1532G>A (p.Arg511Gln) rs33958176
NM_000890.3(KCNJ5):c.1159G>C (p.Gly387Arg) rs199830292
NM_000890.3(KCNJ5):c.451G>A (p.Gly151Arg) rs386352319
NM_000891.2(KCNJ2):c.277G>A (p.Val93Ile) rs147750704
NM_000892.3(KLKB1):c.1643G>A (p.Cys548Tyr) rs121964951
NM_000900.4(MGP):c.94+1G>A rs111320759
NM_000901.4(NR3C2):c.2017C>T (p.Arg673Ter) rs121912571
NM_000903.2(NQO1):c.559C>T (p.Pro187Ser) rs1800566
NM_000920.3(PC):c.1351C>T (p.Arg451Cys) rs113994143
NM_000920.3(PC):c.1828G>A (p.Ala610Thr) rs28940589
NM_000920.3(PC):c.2229G>T (p.Met743Ile) rs28940590
NM_000920.3(PC):c.434T>C (p.Val145Ala) rs28940591
NM_000920.3(PC):c.467G>A (p.Arg156Gln) rs119103241
NM_000927.4(ABCB1):c.2677T>G (p.Ser893Ala) rs2032582
NM_000927.4(ABCB1):c.3435T>C (p.Ile1145=) rs1045642
NM_000933.3(PLCB4):c.1862G>A (p.Arg621His) rs397514481
NM_000941.2(POR):c.1370G>A (p.Arg457His) rs28931608
NM_000941.2(POR):c.15A>G (p.Gly5=) rs10262966
NM_000944.4(PPP3CA):c.844G>A (p.Glu282Lys) rs1553923787
NM_000965.4(RARB):c.1159C>T (p.Arg387Cys) rs397518483
NM_000969.5(RPL5):c.418G>A (p.Gly140Ser) rs121434406
NM_000996.2(RPL35A):c.304C>T (p.Arg102Ter) rs116840809
NM_000996.2(RPL35A):c.82_84delCTT (p.Leu28del) rs116840807
NM_000996.2(RPL35A):c.97G>A (p.Val33Ile) rs116840808
NM_001001344.2(ATP2B3):c.3320G>A (p.Gly1107Asp) rs397514619
NM_001001430.2(TNNT2):c.275G>A (p.Arg92Gln) rs121964856
NM_001001430.2(TNNT2):c.391C>T (p.Arg131Trp) rs74315380
NM_001001547.2(CD36):c.120+399TG[12]
NM_001001547.2(CD36):c.949dup (p.Ile317Asnfs) rs70961716
NM_001001547.2(CD36):c.975T>G (p.Tyr325Ter) rs3211938
NM_001001557.2(GDF6):c.746C>A (p.Ala249Glu) rs121909352
NM_001001557.2(GDF6):c.866T>C (p.Leu289Pro) rs63751220
NM_001001557.3(GDF6):c.1271A>G (p.Lys424Arg) rs121909353
NM_001001557.4(GDF6):c.1287C>A (p.Ser429Arg) rs1554571225
NM_001002261.3(ZFYVE27):c.572G>T (p.Gly191Val) rs35077384
NM_001003722.1(GLE1):c.1706G>A (p.Arg569His) rs121434407
NM_001003800.1(BICD2):c.2108C>T (p.Thr703Met) rs371707778
NM_001003800.2(BICD2):c.2080C>T (p.Arg694Cys) rs797045412
NM_001003841.2(SLC6A19):c.517G>A (p.Asp173Asn) rs121434346
NM_001004334.3(GPR179):c.984delC (p.Ser329Leufs) rs770066665
NM_001005271.2(CHD3):c.3130C>T (p.Arg1044Trp) rs1555611722
NM_001005273.2(CHD3):c.2745G>T (p.Leu915Phe)
NM_001005273.2(CHD3):c.3472T>C (p.Trp1158Arg)
NM_001005273.2(CHD3):c.3505C>T (p.Arg1169Trp)
NM_001005273.2(CHD3):c.3515G>A (p.Arg1172Gln)
NM_001005360.2(DNM2):c.1856C>T (p.Ser619Leu) rs121909095
NM_001005463.2(EBF3):c.488G>A (p.Arg163Gln) rs1057519389
NM_001005741.2(GBA):c.1090G>A (p.Gly364Arg) rs121908305
NM_001005741.2(GBA):c.115+1G>A rs104886460
NM_001005741.2(GBA):c.1192C>T (p.Arg398Ter) rs121908309
NM_001005741.2(GBA):c.1226A>G (p.Asn409Ser) rs76763715
NM_001005741.2(GBA):c.1265_1319del55 (p.Leu422Profs) rs80356768
NM_001005741.2(GBA):c.1297G>T (p.Val433Leu) rs80356769
NM_001005741.2(GBA):c.1343A>T (p.Asp448Val) rs77369218
NM_001005741.2(GBA):c.1504C>T (p.Arg502Cys) rs80356771
NM_001005741.2(GBA):c.680A>G (p.Asn227Ser) rs364897
NM_001005741.2(GBA):c.764T>A (p.Phe255Tyr) rs74500255
NM_001005741.2(GBA):c.887G>A (p.Arg296Gln) rs78973108
NM_001005862.2(ERBB2):c.2173_2174delTTinsCC (p.Leu725Pro) rs121913469
NM_001005862.2(ERBB2):c.2236G>A (p.Gly746Ser) rs28933369
NM_001005862.2(ERBB2):c.2480A>G (p.Asn827Ser) rs28933370
NM_001006657.1(WDR35):c.1501delC (p.Gln501Lysfs) rs886044119
NM_001006657.1(WDR35):c.1592T>C (p.Leu531Pro) rs397515533
NM_001006657.1(WDR35):c.1877A>G (p.Glu626Gly) rs267607174
NM_001006657.1(WDR35):c.1922T>G (p.Leu641Ter) rs199952377
NM_001006657.1(WDR35):c.2623G>A (p.Ala875Thr) rs267607175
NM_001006657.1(WDR35):c.2891del (p.Pro964Leufs) rs397515334
NM_001006657.1(WDR35):c.3091C>T (p.His1031Tyr) rs1553316264
NM_001006657.1(WDR35):c.3203A>G (p.Tyr1068Cys) rs541910371
NM_001006657.1(WDR35):c.932G>T (p.Trp311Leu) rs200649783
NM_001007792.1(NTRK1):c.1730G>T (p.Gly577Val) rs6339
NM_001008211.1(OPTN):c.1634G>A (p.Arg545Gln) rs75654767
NM_001008211.1(OPTN):c.293T>A (p.Met98Lys) rs11258194
NM_001008503.2(OPRM1):c.118A>G (p.Asn40Asp) rs1799971
NM_001009994.2(RIPPLY2):c.238A>T (p.Arg80Ter) rs201419367
NM_001009994.2(RIPPLY2):c.299delT (p.Leu100Argfs) rs864309489
NM_001009999.2(KDM1A):c.1739A>G (p.Asp580Gly) rs864309716
NM_001010867.3(IBA57):c.436C>T (p.Arg146Trp) rs73095427
NM_001010874.4(TECRL):c.587G>A (p.Arg196Gln) rs773204795
NM_001010892.2(RSPH4A):c.1468C>T (p.Arg490Ter) rs118204043
NM_001010892.2(RSPH4A):c.325C>T (p.Gln109Ter) rs118204042
NM_001010892.2(RSPH4A):c.460C>T (p.Gln154Ter) rs118204041
NM_001010986.2(ATP11C):c.1253C>A (p.Thr418Asn) rs1556323334
NM_001011.4(RPS7):c.147+1G>A rs397507554
NM_001012331.1(NTRK1):c.2028+3A>C
NM_001012415.2(SOHLH1):c.27C>G (p.Tyr9Ter) rs864309646
NM_001012415.2(SOHLH1):c.705delT (p.Lys236Argfs) rs864309645
NM_001012515.3(FECH):c.68-23C>T rs2269219
NM_001012763.1(GNRHR):c.30_31delTCinsAA (p.Asn10_Gln11delinsLysLys) rs281865427
NM_001017420.2(ESCO2):c.1269G>A (p.Trp423Ter) rs80359864
NM_001017420.2(ESCO2):c.1615T>G (p.Trp539Gly) rs80359868
NM_001017420.2(ESCO2):c.505C>T (p.Arg169Ter) rs80359849
NM_001017420.2(ESCO2):c.604C>T (p.Gln202Ter) rs80359850
NM_001017420.2(ESCO2):c.751dupG (p.Glu251Glyfs) rs1554554098
NM_001017420.2(ESCO2):c.760delA (p.Thr254Leufs) rs80359852
NM_001017420.2(ESCO2):c.760dupA (p.Thr254Asnfs) rs80359852
NM_001017535.1(VDR):c.218G>A (p.Arg73Gln) rs121909791
NM_001017995.2(SH3PXD2B):c.969delG (p.Arg324Glyfs) rs794728006
NM_001018005.1(TPM1):c.284T>C (p.Val95Ala) rs104894504
NM_001018005.1(TPM1):c.337C>G (p.Leu113Val) rs397516369
NM_001018005.1(TPM1):c.475G>A (p.Asp159Asn) rs397516373
NM_001018005.1(TPM1):c.574G>A (p.Glu192Lys) rs199476315
NM_001018077.1(NR3C1):c.1088A>G (p.Asn363Ser) rs56149945
NM_001018077.1(NR3C1):c.66G>A (p.Glu22=) rs6189
NM_001018115.2(FANCD2):c.904C>T (p.Arg302Trp) rs121917787
NM_001021.5(RPS17):c.200_201delGA (p.Gly68Tyrfs) rs116840812
NM_001021.6(RPS17):c.2T>G (p.Met1Arg) rs116840811
NM_001024465.2(SOD2):c.47T>C (p.Val16Ala) rs4880
NM_001024630.3(RUNX2):c.598A>G (p.Thr200Ala) rs104893993
NM_001024943.1(ASL):c.1153C>T (p.Arg385Cys) rs28940286
NM_001025295.2(IFITM5):c.-14C>T rs587776916
NM_001025389.1(AMPD3):c.1717C>T (p.Arg573Cys) rs3741040
NM_001031717.3(CRELD1):c.320G>A (p.Arg107His) rs28941780
NM_001031717.3(CRELD1):c.985C>T (p.Arg329Cys) rs28942091
NM_001031726.3(C19orf12):c.187G>C (p.Ala63Pro) rs376103979
NM_001031726.3(C19orf12):c.424A>G (p.Lys142Glu) rs146170087
NM_001031847.2(CPT1A):c.948delG (p.Ile317Serfs) rs80356800
NM_001032393.2(HNRNPH2):c.616C>T (p.Arg206Trp) rs886039763
NM_001033053.2(NLRP1):c.2176C>T (p.Arg726Trp) rs776245016
NM_001033503.2(SAR1B):c.409G>A (p.Asp137Asn) rs28942109
NM_001033855.1(DCLRE1C):c.103C>G (p.His35Asp) rs121908159
NM_001034850.2(RETREG1):c.433C>T (p.Gln145Ter) rs137852737
NM_001034850.2(RETREG1):c.926C>G (p.Ser309Ter) rs137852739
NM_001035.2(RYR2):c.12602A>G (p.Gln4201Arg) rs121918605
NM_001035.2(RYR2):c.1298T>C (p.Leu433Pro) rs121918602
NM_001035.2(RYR2):c.13489C>T (p.Arg4497Cys) rs121918600
NM_001035.2(RYR2):c.13957G>T (p.Val4653Phe) rs121918604
NM_001035.2(RYR2):c.6982C>T (p.Pro2328Ser) rs121918603
NM_001035256.2(POMC):c.706C>G (p.Arg23