ClinVar Miner

Variants from Integrated Genetics/Laboratory Corporation of America with conflicting interpretations

Location: United States — Primary collection method: clinical testing
Minimum review status of the submission from Integrated Genetics/Laboratory Corporation of America: Collection method of the submission from Integrated Genetics/Laboratory Corporation of America:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
7629 6701 222 3703 1892 56 424 5589

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
Integrated Genetics/Laboratory Corporation of America pathogenic likely pathogenic uncertain significance likely benign benign affects association drug response protective risk factor other
pathogenic 114 838 100 8 3 2 1 4 0 3 2
likely pathogenic 418 20 99 3 1 0 0 1 0 1 0
uncertain significance 73 133 33 526 88 0 0 3 0 5 14
likely benign 10 9 868 1 773 0 0 1 1 2 9
benign 10 6 441 1674 54 0 0 1 0 4 4

Submitter to submitter summary #

Total submitters: 179
Download table as spreadsheet
Submitter Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
GeneDx 0 4194 0 1123 777 1 79 1980
Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine 0 1368 0 553 223 1 3 780
EGL Genetic Diagnostics, Eurofins Clinical Diagnostics 0 993 0 289 320 7 21 637
Invitae 0 2554 0 442 97 1 62 602
Ambry Genetics 0 763 0 487 77 0 6 570
Counsyl 0 505 1 488 5 0 34 528
Quest Diagnostics Nichols Institute San Juan Capistrano 0 1492 0 274 239 0 15 527
CeGaT Praxis fuer Humangenetik Tuebingen 0 332 0 225 269 0 28 522
PreventionGenetics, PreventionGenetics 0 1192 0 376 111 0 2 489
ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories 0 1057 0 272 149 0 30 451
Genetic Services Laboratory, University of Chicago 0 333 0 282 94 1 3 380
Biesecker Lab/Clinical Genomics Section,National Institutes of Health 0 165 45 183 101 0 0 329
Illumina Clinical Services Laboratory,Illumina 0 304 2 120 109 0 22 252
Athena Diagnostics Inc 0 433 0 173 14 0 6 193
Department of Pathology and Laboratory Medicine,Sinai Health System 0 235 0 52 80 0 3 135
GeneReviews 0 183 113 10 0 0 2 125
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 0 87 0 80 12 0 9 101
Mayo Clinic Laboratories, Mayo Clinic 0 175 0 50 41 0 5 96
OMIM 0 534 0 23 4 34 19 79
LDLR-LOVD, British Heart Foundation 0 31 0 61 3 0 4 68
Mendelics 0 224 2 36 10 0 18 66
International Society for Gastrointestinal Hereditary Tumours (InSiGHT) 0 85 36 22 0 0 0 58
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute 0 65 0 43 14 1 0 58
Stanford Center for Inherited Cardiovascular Disease, Stanford University 0 44 0 8 42 0 3 53
Juha Muilu Group; Institute for Molecular Medicine Finland (FIMM) 0 1 18 30 0 0 0 48
Robarts Research Institute,Western University 0 6 0 41 3 0 2 46
Centre de Génétique Moléculaire et Chromosomique, Unité de génétique de l'Obésité et des Dyslipidémies,APHP, GH Hôpitaux Universitaires Pitié-Salpêtrière / Charles-Foix 0 14 0 35 2 0 9 46
CHEO Genetics Diagnostic Laboratory,Children's Hospital of Eastern Ontario 0 55 0 26 15 0 2 43
Broad Institute Rare Disease Group, Broad Institute 0 92 0 25 2 0 15 42
Baylor Genetics 0 289 0 36 1 0 4 41
Myriad Women's Health, Inc. 0 224 0 39 0 0 0 39
CSER _CC_NCGL, University of Washington 0 24 0 11 25 0 1 37
Leiden Open Variation Database 0 43 0 21 13 0 2 36
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics,Children's Hospital of Philadelphia 0 88 0 14 16 0 4 34
Fulgent Genetics,Fulgent Genetics 0 220 0 25 7 0 1 33
Fundacion Hipercolesterolemia Familiar 0 17 0 15 4 0 10 29
Molecular Genetics Laboratory,Centre for Cardiovascular Surgery and Transplantation 0 11 0 27 1 0 0 28
Color Health, Inc 0 66 0 15 3 0 8 26
CFTR-France 0 98 0 11 0 0 11 22
Foulkes Cancer Genetics LDI, Lady Davis Institute for Medical Research 0 21 0 3 16 0 2 21
Blueprint Genetics 0 46 0 12 5 0 4 21
Laboratory of Genetics and Molecular Cardiology, University of São Paulo 0 20 0 10 3 0 6 19
Research Molecular Genetics Laboratory,Women's College Hospital, University of Toronto 0 360 0 15 3 0 0 18
Brunham Lab, Centre for Heart and Lung Innovation,University of British Columbia 0 27 0 15 0 0 3 18
Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde,Academisch Medisch Centrum 0 72 0 13 3 0 1 17
Natera, Inc. 0 524 1 10 2 0 3 16
Institute of Human Genetics, University of Leipzig Medical Center 0 43 0 7 0 0 9 16
Genomic Research Center, Shahid Beheshti University of Medical Sciences 0 34 0 7 2 0 6 15
Iberoamerican FH Network 0 15 0 8 1 0 6 15
University of Washington Department of Laboratory Medicine, University of Washington 0 10 0 7 4 1 3 15
Human Genome Sequencing Center Clinical Lab, Baylor College of Medicine 0 32 0 14 0 0 0 14
Institute for Biomarker Research,Medical Diagnostic Laboratories, L.L.C. 0 3 0 14 0 0 0 14
Cardiovascular Research Group,Instituto Nacional de Saude Doutor Ricardo Jorge 0 24 0 8 3 0 3 14
Johns Hopkins Genomics, Johns Hopkins University 0 63 0 12 1 0 1 14
King Laboratory,University of Washington 0 4 0 3 10 0 0 13
Center for Medical Genetics Ghent,University of Ghent 0 4 1 7 2 0 3 13
Clinical Genetics Karolinska University Hospital,Karolinska University Hospital 0 13 0 0 0 0 13 13
Research and Development, ARUP Laboratories 0 60 1 9 1 0 2 13
CFTR2 0 116 0 12 0 0 0 12
Centre for Mendelian Genomics,University Medical Centre Ljubljana 0 47 0 7 4 1 0 12
SIB Swiss Institute of Bioinformatics 0 5 0 10 1 0 1 12
Soonchunhyang University Bucheon Hospital,Soonchunhyang University Medical Center 0 2 0 8 0 0 3 11
ClinGen PAH Variant Curation Expert Panel 0 61 0 11 0 0 0 11
Center for Human Genetics, Inc,Center for Human Genetics, Inc 0 29 0 6 2 0 1 9
Division of Human Genetics,Children's Hospital of Philadelphia 0 22 0 7 0 0 2 9
Biochemical Molecular Genetic Laboratory,King Abdulaziz Medical City 0 23 0 7 1 0 1 9
Greenwood Genetic Center Diagnostic Laboratories,Greenwood Genetic Center 0 8 0 0 6 0 2 8
PharmGKB 0 0 0 0 0 8 0 8
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen 0 32 0 5 3 0 0 8
Laboratory of Diagnosis and Therapy of Lysosomal Disorders,University of Padova 0 7 0 7 0 0 1 8
The ITHANET community portal, The Cyprus Institute of Neurology and Genetics 0 46 0 7 1 0 0 8
RettBASE 0 29 0 7 0 0 0 7
Department of Pathology and Molecular Medicine,Queen's University 0 51 0 2 5 0 0 7
Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen 0 11 0 1 0 0 6 7
UNC Molecular Genetics Laboratory,University of North Carolina at Chapel Hill 0 27 0 6 0 0 1 7
Department of Vascular Biology,Beijing Anzhen Hospital 0 3 0 5 1 0 1 7
Laboratory of Molecular Genetics,National Medical Research Center for Therapy and Preventive Medicine 0 2 0 3 0 0 4 7
Molecular Diagnostics Lab,Nemours Alfred I. duPont Hospital for Children 0 6 0 4 2 0 0 6
Institute of Human Genetics,Friedrich-Alexander-Universität Erlangen-Nürnberg 0 4 0 3 0 0 3 6
Institute for Integrative and Experimental Genomics,University of Luebeck 0 0 0 4 1 0 1 6
Knight Diagnostic Laboratories, Oregon Health and Sciences University 0 40 0 5 1 0 0 6
Forensic Genetics Laboratory,Harris County Institute of Forensic Sciences 0 0 0 1 0 0 5 6
Cancer Variant Interpretation Group UK, Institute of Cancer Research, London 0 6 0 6 0 0 0 6
ATS em Genética Clínica,Universidade Federal do Rio Grande do Sul 0 8 0 6 0 0 0 6
HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology 0 30 0 5 0 0 0 5
Cardiovascular Biomarker Research Laboratory,Mayo Clinic 0 0 0 0 4 0 1 5
NIHR Bioresource Rare Diseases, University of Cambridge 0 3 0 4 0 0 1 5
Cancer Genetics and Genomics Laboratory,British Columbia Cancer Agency 0 27 0 5 0 0 0 5
ClinGen CDH1 Variant Curation Expert Panel 0 2 0 5 0 0 0 5
Clinical Molecular Genetics Laboratory,Johns Hopkins All Children's Hospital 0 26 0 1 3 0 0 4
Developmental Genetics Unit,King Faisal Specialist Hospital & Research Centre 0 0 0 0 0 0 4 4
Institute of Human Genetics, Klinikum rechts der Isar 0 38 0 4 0 0 0 4
Wong Mito Lab, Molecular and Human Genetics, Baylor College of Medicine 0 12 0 4 0 0 0 4
SingHealth Duke-NUS Institute of Precision Medicine 0 5 0 2 0 0 2 4
Department of Genetics,Sultan Qaboos University Hospital, Oman 0 10 0 1 0 0 3 4
St. Jude Clinical Genomics Lab, St. Jude Children's Research Hospital 0 3 0 0 4 0 0 4
Gharavi Laboratory,Columbia University 0 8 0 0 2 0 2 4
Center for Advanced Laboratory Medicine, UC San Diego Health,University of California San Diego 0 6 0 3 1 0 0 4
Molecular Biology Laboratory, Fundació Puigvert 0 9 0 4 0 0 0 4
Constitutional Genetics Lab,Leon Berard Cancer Center 0 2 0 0 1 0 3 4
Collagen Diagnostic Laboratory,University of Washington 0 1 0 3 0 0 0 3
Elsea Laboratory,Baylor College of Medicine 0 4 0 1 0 0 2 3
ClinVar Staff, National Center for Biotechnology Information (NCBI) 0 25 0 0 0 0 3 3
UCLA Clinical Genomics Center, UCLA 0 1 0 3 0 0 0 3
Agnes Ginges Centre for Molecular Cardiology,Centenary Institute 0 3 0 3 0 0 0 3
Center of Genomic medicine, Geneva,University Hospital of Geneva 0 6 0 3 0 0 0 3
Database of Curated Mutations (DoCM) 0 0 0 3 0 0 0 3
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego 0 12 0 2 0 0 1 3
DNA and Cytogenetics Diagnostics Unit,Erasmus Medical Center 0 10 0 1 0 0 2 3
3DMed Clinical Laboratory Inc 0 6 0 1 2 0 0 3
Institute for Genomic Medicine (IGM) Clinical Laboratory,Nationwide Children's Hospital 0 10 0 3 0 0 0 3
Institute for Genomic Statistics and Bioinformatics, University Hospital Bonn 0 3 0 2 0 0 1 3
Practice for Gait Abnormalities, David Pomarino,Competency Network Toe Walking c/o Practice Pomarino 0 0 0 0 3 0 0 3
Centogene AG - the Rare Disease Company 0 27 0 2 0 0 0 2
Inserm U 954, Faculté de Médecine de Nancy 0 1 2 0 0 0 0 2
Centre for Human Genetics 0 0 0 2 0 0 0 2
GeneKor MSA 0 13 0 2 0 0 0 2
University of Washington Center for Mendelian Genomics, University of Washington 0 3 0 1 1 0 0 2
Foundation for Research in Genetics and Endocrinology, FRIGE's Institute of Human Genetics 0 13 0 2 0 0 0 2
Albrecht-Kossel-Institute,Medical University Rostock 0 1 0 0 0 2 0 2
Cancer Genetics Laboratory,Peter MacCallum Cancer Centre 0 0 0 2 0 0 0 2
U4M - Lille University & CHRU Lille, Université de Lille - CHRU de Lille 0 53 0 2 0 0 0 2
Equipe Genetique des Anomalies du Developpement, Université de Bourgogne 0 14 0 2 0 0 0 2
Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago 0 4 0 0 2 0 0 2
Department of Human Genetics, University Hospital Magdeburg 0 0 0 2 0 0 0 2
Molecular Diagnostics Laboratory, M Health Fairview: University of Minnesota 0 2 0 2 0 0 0 2
Department of Human Genetics,Laborarztpraxis Dres. Walther, Weindel und Kollegen 0 6 0 2 0 0 0 2
Department of Pediatrics, Gifu University 0 5 0 2 0 0 0 2
Genetic Testing Center for Deafness, Department of Otolaryngology Head & Neck Surgery,Institute of Otolaryngology, Chinese PLA General Hospital 0 7 0 2 0 0 0 2
Reproductive Health Research and Development,BGI Genomics 0 19 0 1 0 1 0 2
Cancer Genomics Group,Japanese Foundation For Cancer Research 0 2 0 1 0 0 1 2
New York Genome Center 0 4 0 1 1 0 0 2
Pediatrics,All India Institute of Medical Sciences, New Delhi 0 0 0 0 0 2 0 2
Genome Diagnostics Laboratory, The Hospital for Sick Children 0 8 0 0 0 0 1 1
Clinical Biochemistry Laboratory,Health Services Laboratory 0 3 0 1 0 0 0 1
Molecular Genetics Laboratory,BC Children's and BC Women's Hospitals 0 3 0 0 0 0 1 1
Sema4,Sema4 0 0 0 1 0 0 0 1
Victorian Clinical Genetics Services,Murdoch Childrens Research Institute 0 23 0 1 0 0 0 1
GenMed Metabolism Lab 0 0 0 0 0 0 1 1
National Institute of Mental Health and Neurosciences 0 0 0 1 0 0 0 1
Lupski Lab, Baylor-Hopkins CMG, Baylor College of Medicine 0 2 0 0 0 0 1 1
Hadassah Hebrew University Medical Center 0 6 0 1 0 0 0 1
NeuroMeGen,Hospital Clinico Santiago de Compostela 0 0 0 1 0 0 0 1
Medical Genetics, University of Parma 0 3 0 0 0 0 1 1
Centre for Genomic Medicine, Manchester,Central Manchester University Hospitals 0 3 0 1 0 0 0 1
Center for Human Genetics,University of Leuven 0 1 0 1 0 0 0 1
Centre de Biologie Pathologie Génétique, Centre Hospitalier Universitaire de Lille 0 2 0 1 0 0 0 1
Bioscientia Institut fuer Medizinische Diagnostik GmbH,Sonic Healthcare 0 6 0 1 0 0 0 1
Institute of Human Genetics, Univ. Regensburg,Univ. Regensburg 0 0 0 1 0 0 0 1
Neurogenetics Laboratory - MEYER,AOU Meyer 0 1 0 1 0 0 0 1
The Molecular Genetic Diagnosis Center, Children’s Hospital of Fudan University 0 3 0 0 0 0 1 1
Center of Medical Genetics and Primary Health Care 0 3 0 0 1 0 0 1
Geisinger Autism and Developmental Medicine Institute,Geisinger Health System 0 0 0 1 0 0 0 1
Sharon lab,Hadassah-Hebrew University Medical Center 0 3 0 1 0 0 0 1
Institute for Genomic Medicine, Nationwide Children's Hospital 0 1 0 0 0 0 1 1
Pediatric Metabolic Diseases,Hacettepe University 0 3 0 1 0 0 0 1
ClinGen RASopathy Variant Curation Expert Panel 0 12 0 1 0 0 0 1
Genome Diagnostics Laboratory,VU University Medical Center Amsterdam 0 5 0 1 0 0 0 1
CIViC knowledgebase,Washington University School of Medicine 0 0 0 1 0 0 0 1
Tehran Medical Genetics Laboratory 0 0 0 1 0 0 0 1
Department of Molecular Diagnostics, Institute of Oncology Ljubljana 0 10 0 1 0 0 0 1
Genomic Medicine Lab, University of California San Francisco 0 5 0 1 0 0 0 1
Immunology Clinic,UCLA 0 0 0 1 0 0 0 1
Lab. Molecular Oncology,VUB, Free University of Brussels 0 1 0 0 1 0 0 1
Center for Reproductive Medicine,Shandong Provincial Hospital Affiliated to Shandong University 0 0 0 0 0 0 1 1
CZECANCA consortium 0 0 0 0 0 0 1 1
Molecular Therapies Laboratory,Murdoch University 0 2 0 1 0 0 0 1
Diagnostics Lab (ASPIRE), CSIR - Centre for Cellular and Molecular Biology 0 0 0 0 0 0 1 1
Section for Clinical Neurogenetics,University of Tübingen 0 0 0 1 0 0 0 1
Pediatric Oncology, Johns Hopkins University 0 0 0 1 0 0 0 1
Cardiology unit,Meyer University Hospital 0 0 0 1 0 0 0 1
CeMIA 0 0 0 1 0 0 0 1
ClinGen Lysosomal Storage Disorder Variant Curation Expert Panel, ClinGen 0 24 0 1 0 0 0 1
MAGI's Lab - Research,MAGI Group 0 4 0 0 1 0 0 1
Nilou-Genome Lab 0 3 0 1 0 0 0 1
Laboratory of Molecular Genetics,Children's Memorial Health Institute 0 2 0 1 0 0 0 1
Paris Brain Institute,Inserm - ICM 0 2 0 1 0 0 0 1
Precision Medicine Center,Zhengzhou University 0 0 0 0 0 0 1 1
Neurogenetic Laboratory,Second Faculty of Medicine, Charles University 0 0 0 0 0 0 1 1

All variants with conflicting interpretations #

Total variants: 5589
Download table as spreadsheet
HGVS dbSNP
MSH6:c.3647-51_3647-35del17 rs267607687
MYH11:c.503-14_503-12del rs141564071
NC_000011.9:g.5248383C>A
NM_000016.5(ACADM):c.1114dup (p.Ala372fs) rs1057516278
NM_000016.5(ACADM):c.127G>A (p.Glu43Lys) rs147559466
NM_000016.5(ACADM):c.362C>T (p.Thr121Ile) rs121434283
NM_000016.5(ACADM):c.387+1del rs786204424
NM_000016.5(ACADM):c.443G>A (p.Arg148Lys) rs778906552
NM_000016.5(ACADM):c.583G>A (p.Gly195Arg) rs121434278
NM_000016.5(ACADM):c.678A>G (p.Ala226=) rs2229249
NM_000016.5(ACADM):c.799G>A (p.Gly267Arg) rs121434274
NM_000016.5(ACADM):c.928G>A (p.Gly310Arg) rs747268471
NM_000016.5(ACADM):c.999_1011dup (p.Gln338Ter) rs1225471006
NM_000016.6(ACADM):c.199T>C (p.Tyr67His) rs121434280
NM_000016.6(ACADM):c.985A>G (p.Lys329Glu) rs77931234
NM_000018.2(ACADVL):c.343delG (p.Glu115Lysfs) rs387906249
NM_000018.4(ACADVL):c.1066A>G (p.Ile356Val) rs150140386
NM_000018.4(ACADVL):c.1077+1G>T rs140989450
NM_000018.4(ACADVL):c.1077+2T>C rs1057516370
NM_000018.4(ACADVL):c.1077_1077+1delinsCAC rs1057516686
NM_000018.4(ACADVL):c.1182+1G>A rs113690956
NM_000018.4(ACADVL):c.1679-6G>A rs113994171
NM_000018.4(ACADVL):c.1730_1733dup (p.Met578fs)
NM_000018.4(ACADVL):c.1882del (p.Gln628fs) rs1597541142
NM_000018.4(ACADVL):c.385GAG[1] (p.Glu130del) rs387906251
NM_000018.4(ACADVL):c.520G>A (p.Val174Met) rs369560930
NM_000018.4(ACADVL):c.779C>T (p.Thr260Met) rs113994168
NM_000018.4(ACADVL):c.799_802del (p.Val267fs) rs761204548
NM_000018.4(ACADVL):c.887_888del (p.Pro296fs) rs753108198
NM_000019.4(ACAT1):c.444_445del (p.Met148fs) rs727503795
NM_000019.4(ACAT1):c.455G>C (p.Gly152Ala) rs762991875
NM_000019.4(ACAT1):c.473A>G (p.Asn158Ser) rs199524907
NM_000022.4(ADA):c.632G>A (p.Arg211His) rs121908716
NM_000022.4(ADA):c.956_960del (p.Glu319fs) rs771266745
NM_000027.4(AGA):c.488G>C (p.Cys163Ser) rs121964904
NM_000027.4(AGA):c.800dup (p.Pro268fs) rs386833436
NM_000030.3(AGXT):c.166-14C>T rs180177176
NM_000030.3(AGXT):c.32C>T (p.Pro11Leu) rs34116584
NM_000030.3(AGXT):c.866G>A (p.Arg289His) rs61729604
NM_000033.4(ABCD1):c.1166G>A (p.Arg389His) rs886044777
NM_000033.4(ABCD1):c.1780+4G>A rs193922095
NM_000033.4(ABCD1):c.1820_1823del (p.Gly607fs) rs1557055253
NM_000033.4(ABCD1):c.838C>T (p.Arg280Cys) rs193922098
NM_000033.4(ABCD1):c.880G>A (p.Ala294Thr) rs1131691954
NM_000035.4(ALDOB):c.-11+1G>C rs181639417
NM_000035.4(ALDOB):c.10C>T (p.Arg4Ter) rs118204428
NM_000035.4(ALDOB):c.113-1_115del rs786204598
NM_000035.4(ALDOB):c.178C>T (p.Arg60Ter) rs118204429
NM_000035.4(ALDOB):c.324G>A (p.Lys108=) rs750026492
NM_000035.4(ALDOB):c.360_363del (p.Asn120fs) rs387906225
NM_000035.4(ALDOB):c.612T>A (p.Tyr204Ter) rs370793608
NM_000035.4(ALDOB):c.612T>G (p.Tyr204Ter) rs370793608
NM_000035.4(ALDOB):c.865del (p.Leu289fs) rs864309533
NM_000038.6(APC):c.1005A>G (p.Leu335=) rs3797704
NM_000038.6(APC):c.1139G>A (p.Arg380Gln) rs587782886
NM_000038.6(APC):c.120G>A (p.Glu40=) rs142720069
NM_000038.6(APC):c.1240C>T (p.Arg414Cys) rs137854567
NM_000038.6(APC):c.1405C>T (p.Leu469=) rs746293695
NM_000038.6(APC):c.1419G>A (p.Gln473=) rs141579422
NM_000038.6(APC):c.1488A>T (p.Thr496=) rs9282599
NM_000038.6(APC):c.1495C>G (p.Arg499Gly) rs137854580
NM_000038.6(APC):c.1554G>A (p.Thr518=) rs546568052
NM_000038.6(APC):c.1604C>T (p.Ser535Phe) rs75870842
NM_000038.6(APC):c.1606G>A (p.Glu536Lys) rs138098808
NM_000038.6(APC):c.1626+4C>A rs1202435147
NM_000038.6(APC):c.1631T>C (p.Ile544Thr) rs144056494
NM_000038.6(APC):c.1686G>A (p.Thr562=) rs770256026
NM_000038.6(APC):c.1825G>A (p.Val609Ile) rs147863331
NM_000038.6(APC):c.1958+10G>T rs375175370
NM_000038.6(APC):c.1959G>A (p.Arg653=) rs72541809
NM_000038.6(APC):c.2204C>T (p.Ala735Val) rs147655929
NM_000038.6(APC):c.2205G>A (p.Ala735=) rs141001261
NM_000038.6(APC):c.221-5T>C rs1057524155
NM_000038.6(APC):c.2232T>G (p.Ser744=) rs145751759
NM_000038.6(APC):c.2262T>G (p.Val754=) rs148987776
NM_000038.6(APC):c.2297C>T (p.Ala766Val) rs200339830
NM_000038.6(APC):c.2438A>G (p.Asn813Ser) rs201522866
NM_000038.6(APC):c.2476T>G (p.Leu826Val) rs145245264
NM_000038.6(APC):c.2586C>G (p.Asn862Lys) rs147972247
NM_000038.6(APC):c.2593C>T (p.Pro865Ser) rs192620988
NM_000038.6(APC):c.2627G>A (p.Arg876Gln) rs373428732
NM_000038.6(APC):c.2640C>T (p.Ile880=) rs200184105
NM_000038.6(APC):c.2677G>A (p.Glu893Lys) rs199740875
NM_000038.6(APC):c.2778T>C (p.Ser926=) rs371526966
NM_000038.6(APC):c.295C>T (p.Arg99Trp) rs139196838
NM_000038.6(APC):c.3173A>G (p.Asp1058Gly) rs148725540
NM_000038.6(APC):c.317G>A (p.Arg106His) rs201764637
NM_000038.6(APC):c.3249T>G (p.Asp1083Glu) rs201629780
NM_000038.6(APC):c.3264G>A (p.Lys1088=) rs114774495
NM_000038.6(APC):c.3352A>G (p.Asn1118Asp) rs140493115
NM_000038.6(APC):c.3374T>C (p.Val1125Ala) rs377278397
NM_000038.6(APC):c.3386T>C (p.Leu1129Ser) rs143638171
NM_000038.6(APC):c.3462AGA[2] (p.Glu1157del) rs386833391
NM_000038.6(APC):c.3479C>A (p.Thr1160Lys) rs201004111
NM_000038.6(APC):c.3511C>T (p.Arg1171Cys) rs201830995
NM_000038.6(APC):c.3529A>G (p.Ile1177Val) rs369834416
NM_000038.6(APC):c.3624C>T (p.Thr1208=) rs730882125
NM_000038.6(APC):c.3632T>G (p.Met1211Arg) rs575268622
NM_000038.6(APC):c.3650A>C (p.Asn1217Thr) rs138933660
NM_000038.6(APC):c.3739G>A (p.Ala1247Thr) rs148223181
NM_000038.6(APC):c.3786T>C (p.Tyr1262=) rs147411334
NM_000038.6(APC):c.385G>C (p.Glu129Gln) rs376628500
NM_000038.6(APC):c.3875C>T (p.Thr1292Met) rs371113837
NM_000038.6(APC):c.388A>G (p.Ser130Gly) rs150973053
NM_000038.6(APC):c.3909A>G (p.Gln1303=) rs746289994
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000038.6(APC):c.4212C>A (p.Ser1404=) rs144655979
NM_000038.6(APC):c.4212C>T (p.Ser1404=) rs144655979
NM_000038.6(APC):c.4237A>G (p.Met1413Val) rs141519952
NM_000038.6(APC):c.4336G>A (p.Ala1446Thr) rs146572883
NM_000038.6(APC):c.4360A>G (p.Lys1454Glu) rs111866410
NM_000038.6(APC):c.4669A>G (p.Ile1557Val) rs763578917
NM_000038.6(APC):c.4732T>G (p.Cys1578Gly) rs138367627
NM_000038.6(APC):c.4893T>C (p.Ser1631=) rs35634377
NM_000038.6(APC):c.4905G>A (p.Gly1635=) rs137988845
NM_000038.6(APC):c.4913T>C (p.Met1638Thr) rs201797422
NM_000038.6(APC):c.5009C>T (p.Ala1670Val) rs202228932
NM_000038.6(APC):c.5026A>G (p.Arg1676Gly) rs370560998
NM_000038.6(APC):c.5027G>C (p.Arg1676Thr) rs143674116
NM_000038.6(APC):c.5140G>A (p.Asp1714Asn) rs148275069
NM_000038.6(APC):c.5250C>T (p.Val1750=) rs2229997
NM_000038.6(APC):c.5274T>A (p.Ser1758=) rs199600387
NM_000038.6(APC):c.5304G>A (p.Lys1768=) rs863224285
NM_000038.6(APC):c.5363G>A (p.Arg1788His) rs201472075
NM_000038.6(APC):c.5392A>G (p.Asn1798Asp) rs200794097
NM_000038.6(APC):c.5506G>A (p.Gly1836Arg) rs766739164
NM_000038.6(APC):c.5690A>C (p.His1897Pro) rs112610898
NM_000038.6(APC):c.5790A>G (p.Gln1930=) rs141152252
NM_000038.6(APC):c.5801C>T (p.Pro1934Leu) rs587780600
NM_000038.6(APC):c.5912C>G (p.Ser1971Cys) rs754691867
NM_000038.6(APC):c.5952T>C (p.Asn1984=) rs142019870
NM_000038.6(APC):c.607C>G (p.Gln203Glu) rs141576417
NM_000038.6(APC):c.6219T>G (p.Gly2073=) rs766559927
NM_000038.6(APC):c.6354TGC[5] (p.Ala2122dup) rs587780602
NM_000038.6(APC):c.6387G>A (p.Ser2129=) rs374310157
NM_000038.6(APC):c.6510A>C (p.Pro2170=) rs138571760
NM_000038.6(APC):c.6525A>G (p.Thr2175=) rs200151646
NM_000038.6(APC):c.6526T>C (p.Leu2176=) rs183468041
NM_000038.6(APC):c.6609T>C (p.Val2203=) rs149328018
NM_000038.6(APC):c.6669A>G (p.Ser2223=) rs372680843
NM_000038.6(APC):c.6679G>T (p.Gly2227Cys) rs367905430
NM_000038.6(APC):c.6724A>G (p.Ser2242Gly) rs201375478
NM_000038.6(APC):c.6873A>T (p.Gln2291His) rs148878262
NM_000038.6(APC):c.6921G>A (p.Ser2307=) rs2229993
NM_000038.6(APC):c.6985A>G (p.Ile2329Val) rs146048493
NM_000038.6(APC):c.7036C>T (p.Pro2346Ser) rs200756935
NM_000038.6(APC):c.7095A>G (p.Ser2365=) rs747844776
NM_000038.6(APC):c.7109G>T (p.Gly2370Val) rs140079759
NM_000038.6(APC):c.721G>A (p.Glu241Lys) rs777603154
NM_000038.6(APC):c.7399C>A (p.Pro2467Thr) rs372305287
NM_000038.6(APC):c.7415C>T (p.Ala2472Val) rs200399245
NM_000038.6(APC):c.7490C>T (p.Ser2497Leu) rs141010008
NM_000038.6(APC):c.7514G>A (p.Arg2505Gln) rs147549623
NM_000038.6(APC):c.7625A>G (p.Asn2542Ser) rs151163793
NM_000038.6(APC):c.777G>T (p.Arg259=) rs147704593
NM_000038.6(APC):c.7786T>G (p.Ser2596Ala) rs138137162
NM_000038.6(APC):c.7878T>G (p.Thr2626=) rs757020188
NM_000038.6(APC):c.7888G>A (p.Val2630Ile) rs199688874
NM_000038.6(APC):c.7929A>G (p.Leu2643=) rs138796072
NM_000038.6(APC):c.7986G>A (p.Glu2662=) rs571645304
NM_000038.6(APC):c.8042C>T (p.Pro2681Leu) rs182456139
NM_000038.6(APC):c.8043G>C (p.Pro2681=) rs149347068
NM_000038.6(APC):c.8061A>G (p.Ser2687=) rs746180965
NM_000038.6(APC):c.8100T>C (p.Asn2700=) rs761326128
NM_000038.6(APC):c.8199A>G (p.Gln2733=) rs372365378
NM_000038.6(APC):c.8261G>A (p.Ser2754Asn) rs369721828
NM_000038.6(APC):c.8266A>G (p.Ile2756Val) rs146115809
NM_000038.6(APC):c.8325G>A (p.Gly2775=) rs770719841
NM_000038.6(APC):c.8462A>G (p.Asp2821Gly) rs780049836
NM_000038.6(APC):c.848G>A (p.Arg283Gln) rs149154604
NM_000038.6(APC):c.993G>A (p.Ser331=) rs148343173
NM_000040.3(APOC3):c.55C>T (p.Arg19Ter) rs76353203
NM_000046.5(ARSB):c.113_121del (p.Gly38_Gly40del) rs550086186
NM_000046.5(ARSB):c.1534_1556del (p.Val512fs) rs1310996698
NM_000046.5(ARSB):c.215T>A (p.Leu72Gln) rs397514441
NM_000046.5(ARSB):c.215T>G (p.Leu72Arg) rs397514441
NM_000046.5(ARSB):c.438G>A (p.Trp146Ter) rs757061042
NM_000046.5(ARSB):c.765T>A (p.Tyr255Ter) rs1554086414
NM_000046.5(ARSB):c.944G>A (p.Arg315Gln) rs727503809
NM_000048.4(ASL):c.1060C>T (p.Gln354Ter) rs367543005
NM_000048.4(ASL):c.1153C>T (p.Arg385Cys) rs28940286
NM_000048.4(ASL):c.162C>T (p.Leu54=) rs140221164
NM_000048.4(ASL):c.299T>C (p.Ile100Thr) rs202142867
NM_000048.4(ASL):c.556C>A (p.Arg186=) rs111407265
NM_000050.4(ASS1):c.970+5G>A rs372128852
NM_000051.3(ATM):c.1003G>T (p.Gly335Ter) rs1555068471
NM_000051.3(ATM):c.1009C>T (p.Arg337Cys) rs138398778
NM_000051.3(ATM):c.1027_1030delGAAA rs587780612
NM_000051.3(ATM):c.1073A>G (p.Asn358Ser) rs149636614
NM_000051.3(ATM):c.1229T>C (p.Val410Ala) rs56128736
NM_000051.3(ATM):c.1272T>C (p.Pro424=) rs35578748
NM_000051.3(ATM):c.1339C>T (p.Arg447Ter) rs587779815
NM_000051.3(ATM):c.1380G>C (p.Thr460=) rs145333518
NM_000051.3(ATM):c.1524del (p.Gly509fs) rs786204737
NM_000051.3(ATM):c.157A>T (p.Lys53Ter) rs876659078
NM_000051.3(ATM):c.162T>C (p.Tyr54=) rs3218690
NM_000051.3(ATM):c.1695A>G (p.Glu565=) rs780932013
NM_000051.3(ATM):c.1744T>C (p.Phe582Leu) rs2235006
NM_000051.3(ATM):c.1773T>C (p.Asn591=) rs61734356
NM_000051.3(ATM):c.192del (p.Leu64fs) rs878853490
NM_000051.3(ATM):c.1953A>G (p.Leu651=) rs730881283
NM_000051.3(ATM):c.1986T>C (p.Phe662=) rs1800055
NM_000051.3(ATM):c.1A>C (p.Met1Leu) rs730881359
NM_000051.3(ATM):c.2040C>T (p.Phe680=) rs587780855
NM_000051.3(ATM):c.2085G>A (p.Leu695=) rs786202229
NM_000051.3(ATM):c.2096A>G (p.Glu699Gly) rs147934285
NM_000051.3(ATM):c.2187C>T (p.Tyr729=) rs373430058
NM_000051.3(ATM):c.2192dup (p.Tyr731Ter) rs1478081526
NM_000051.3(ATM):c.2251-10T>G rs730881346
NM_000051.3(ATM):c.237del (p.Lys79fs) rs730881303
NM_000051.3(ATM):c.2396C>T (p.Ala799Val) rs199954262
NM_000051.3(ATM):c.2466+7A>G rs55812024
NM_000051.3(ATM):c.2467-7C>T rs768850329
NM_000051.3(ATM):c.2522A>C (p.Asp841Ala) rs587781812
NM_000051.3(ATM):c.2572T>C (p.Phe858Leu) rs1800056
NM_000051.3(ATM):c.2577C>T (p.Asn859=) rs730881286
NM_000051.3(ATM):c.2598T>G (p.Val866=) rs730881350
NM_000051.3(ATM):c.2608A>G (p.Asn870Asp) rs61734354
NM_000051.3(ATM):c.2805G>C (p.Thr935=) rs55934812
NM_000051.3(ATM):c.2805G>T (p.Thr935=) rs55934812
NM_000051.3(ATM):c.2839-3_2839delinsGATACTA rs786202148
NM_000051.3(ATM):c.2921+1G>A rs587781558
NM_000051.3(ATM):c.2921+2dup rs1565424654
NM_000051.3(ATM):c.2967T>C (p.Thr989=) rs144145128
NM_000051.3(ATM):c.2T>C (p.Met1Thr) rs786203606
NM_000051.3(ATM):c.3014A>G (p.Asn1005Ser) rs146531614
NM_000051.3(ATM):c.3049C>T (p.Gln1017Ter) rs730881388
NM_000051.3(ATM):c.3077+4G>A rs201222237
NM_000051.3(ATM):c.3118A>G (p.Met1040Val) rs3092857
NM_000051.3(ATM):c.3154-4G>A rs199543313
NM_000051.3(ATM):c.3284+7G>C rs371629629
NM_000051.3(ATM):c.332-3T>C rs376116157
NM_000051.3(ATM):c.3342G>A (p.Lys1114=) rs138393322
NM_000051.3(ATM):c.3372C>G (p.Tyr1124Ter) rs587779833
NM_000051.3(ATM):c.3517T>C (p.Leu1173=) rs141460670
NM_000051.3(ATM):c.3577-6G>A rs56006345
NM_000051.3(ATM):c.3577-7C>T rs558667657
NM_000051.3(ATM):c.370A>G (p.Ile124Val) rs148590073
NM_000051.3(ATM):c.3963G>A (p.Met1321Ile) rs35184530
NM_000051.3(ATM):c.3G>A (p.Met1Ile) rs781404312
NM_000051.3(ATM):c.4109+6T>C rs368606937
NM_000051.3(ATM):c.4167A>G (p.Thr1389=) rs183214437
NM_000051.3(ATM):c.4394T>C (p.Leu1465Pro) rs730881391
NM_000051.3(ATM):c.4437-7A>G rs370354306
NM_000051.3(ATM):c.4437-9C>T rs766003804
NM_000051.3(ATM):c.4473C>T (p.Phe1491=) rs4988008
NM_000051.3(ATM):c.4611+9C>G rs760704159
NM_000051.3(ATM):c.4665C>T (p.Leu1555=) rs374431061
NM_000051.3(ATM):c.4776+2T>A rs587781927
NM_000051.3(ATM):c.4777-10dup rs1398289633
NM_000051.3(ATM):c.4949A>G (p.Asn1650Ser) rs55870064
NM_000051.3(ATM):c.4980C>T (p.Asn1660=) rs144338238
NM_000051.3(ATM):c.5005+7_5005+8del rs587780626
NM_000051.3(ATM):c.5005+9C>T rs730881291
NM_000051.3(ATM):c.5063T>C (p.Ile1688Thr) rs199836342
NM_000051.3(ATM):c.513C>G (p.Tyr171Ter) rs786201693
NM_000051.3(ATM):c.5320-5_5320-2del rs730881310
NM_000051.3(ATM):c.5675-4T>A rs56075338
NM_000051.3(ATM):c.5712dup (p.Ser1905fs) rs587781730
NM_000051.3(ATM):c.610G>A (p.Gly204Arg) rs147915571
NM_000051.3(ATM):c.6154G>A (p.Glu2052Lys) rs202206540
NM_000051.3(ATM):c.6347+1G>A rs1057517120
NM_000051.3(ATM):c.6382T>C (p.Leu2128=) rs753646931
NM_000051.3(ATM):c.6404_6405insTT (p.Leu2135_Arg2136insTer) rs587782554
NM_000051.3(ATM):c.640del (p.Ser214fs) rs786204543
NM_000051.3(ATM):c.6572+4T>C rs587780636
NM_000051.3(ATM):c.6919C>T (p.Leu2307Phe) rs56009889
NM_000051.3(ATM):c.6998C>A (p.Thr2333Lys) rs150503164
NM_000051.3(ATM):c.6998C>T (p.Thr2333Ile) rs150503164
NM_000051.3(ATM):c.7044G>A (p.Thr2348=) rs140104789
NM_000051.3(ATM):c.7096G>T (p.Glu2366Ter) rs587781672
NM_000051.3(ATM):c.7224G>A (p.Ser2408=) rs145747513
NM_000051.3(ATM):c.7271T>G (p.Val2424Gly) rs28904921
NM_000051.3(ATM):c.7327C>T (p.Arg2443Ter) rs121434220
NM_000051.3(ATM):c.7390T>C (p.Cys2464Arg) rs55801750
NM_000051.3(ATM):c.742C>T (p.Arg248Ter) rs730881336
NM_000051.3(ATM):c.7463G>A (p.Cys2488Tyr) rs774281788
NM_000051.3(ATM):c.7494T>C (p.Ser2498=) rs34393781
NM_000051.3(ATM):c.7516-9del rs573494809
NM_000051.3(ATM):c.7516-9dup rs573494809
NM_000051.3(ATM):c.7566A>G (p.Gln2522=) rs775621333
NM_000051.3(ATM):c.7592T>C (p.Met2531Thr) rs587781365
NM_000051.3(ATM):c.7788+7G>A rs749610251
NM_000051.3(ATM):c.7788+8G>T rs112775908
NM_000051.3(ATM):c.7928-10T>C rs188404773
NM_000051.3(ATM):c.7983T>C (p.Asp2661=) rs143972422
NM_000051.3(ATM):c.802C>T (p.Gln268Ter) rs557012154
NM_000051.3(ATM):c.8147T>C (p.Val2716Ala) rs587782652
NM_000051.3(ATM):c.8152-6C>T rs200389039
NM_000051.3(ATM):c.8266A>T (p.Lys2756Ter) rs371638537
NM_000051.3(ATM):c.8505C>A (p.Cys2835Ter) rs587781597
NM_000051.3(ATM):c.8532T>C (p.Ile2844=) rs730881278
NM_000051.3(ATM):c.8549T>A (p.Leu2850Ter) rs876658716
NM_000051.3(ATM):c.8584+10T>C rs373321041
NM_000051.3(ATM):c.8592C>T (p.Tyr2864=) rs56025670
NM_000051.3(ATM):c.8671+9T>G rs200190537
NM_000051.3(ATM):c.8730C>G (p.Leu2910=) rs551041839
NM_000051.3(ATM):c.8786+1G>A rs17174393
NM_000051.3(ATM):c.8814_8824del (p.Met2938fs) rs758814126
NM_000051.3(ATM):c.8876_8879del (p.Asp2959fs) rs786204726
NM_000051.3(ATM):c.8922G>A (p.Pro2974=) rs527248759
NM_000051.3(ATM):c.998C>T (p.Ser333Phe) rs28904919
NM_000051.4(ATM):c.1066-6T>G rs201686625
NM_000051.4(ATM):c.146C>G rs1800054
NM_000051.4(ATM):c.1595G>A (p.Cys532Tyr) rs35963548
NM_000051.4(ATM):c.1703G>T (p.Arg568Ile) rs200381392
NM_000051.4(ATM):c.1810C>T (p.Pro604Ser) rs2227922
NM_000051.4(ATM):c.2140del (p.Thr714fs)
NM_000051.4(ATM):c.2284_2285del (p.Leu762fs) rs587781658
NM_000051.4(ATM):c.2289T>A (p.Phe763Leu) rs34231402
NM_000051.4(ATM):c.2494C>T (p.Arg832Cys) rs2229022
NM_000051.4(ATM):c.2735A>G (p.Gln912Arg) rs730881353
NM_000051.4(ATM):c.2932T>C (p.Ser978Pro) rs139552233
NM_000051.4(ATM):c.295A>G (p.Ser99Gly) rs137882485
NM_000051.4(ATM):c.320G>A (p.Cys107Tyr) rs142358238
NM_000051.4(ATM):c.334G>A (p.Ala112Thr) rs146382972
NM_000051.4(ATM):c.3925G>A (p.Ala1309Thr) rs149711770
NM_000051.4(ATM):c.4060C>A (p.Pro1354Thr) rs145119475
NM_000051.4(ATM):c.4388T>G (p.Phe1463Cys) rs138327406
NM_000051.4(ATM):c.4424A>G (p.Tyr1475Cys) rs34640941
NM_000051.4(ATM):c.496+4T>C rs587781375
NM_000051.4(ATM):c.5071A>C (p.Ser1691Arg) rs1800059
NM_000051.4(ATM):c.5821G>C (p.Val1941Leu) rs147187700
NM_000051.4(ATM):c.5975A>C (p.Lys1992Thr) rs150757822
NM_000051.4(ATM):c.6067G>A (p.Gly2023Arg) rs11212587
NM_000051.4(ATM):c.6095G>A (p.Arg2032Lys) rs139770721
NM_000051.4(ATM):c.6176C>T (p.Thr2059Ile) rs144761622
NM_000051.4(ATM):c.6543G>T (p.Glu2181Asp) rs138828590
NM_000051.4(ATM):c.6795C>T rs3218699
NM_000051.4(ATM):c.6820G>A (p.Ala2274Thr) rs567060474
NM_000051.4(ATM):c.6860G>C (p.Gly2287Ala) rs1800061
NM_000051.4(ATM):c.6988C>G (p.Leu2330Val) rs148432863
NM_000051.4(ATM):c.6997dup rs587781299
NM_000051.4(ATM):c.7313C>T (p.Thr2438Ile) rs147604227
NM_000051.4(ATM):c.749G>A (p.Arg250Gln) rs56123940
NM_000051.4(ATM):c.756_757del (p.Cys252_Glu253delinsTer) rs876659003
NM_000051.4(ATM):c.7705_7706del (p.Arg2568_Asp2569insTer) rs759965045
NM_000051.4(ATM):c.7740A>C (p.Arg2580Ser) rs199915459
NM_000051.4(ATM):c.7913G>A (p.Trp2638Ter) rs377349459
NM_000051.4(ATM):c.8395_8404del (p.Phe2799fs) rs786202800
NM_000051.4(ATM):c.8977C>T (p.Arg2993Ter) rs770641163
NM_000053.4(ATP7B):c.-123_-119dupCGCCG rs148013251
NM_000053.4(ATP7B):c.122A>G (p.Asn41Ser) rs201738967
NM_000053.4(ATP7B):c.1278C>T (p.Val426=) rs143556945
NM_000053.4(ATP7B):c.1470C>A (p.Cys490Ter) rs778675259
NM_000053.4(ATP7B):c.1543+13C>T rs200171850
NM_000053.4(ATP7B):c.1607T>C (p.Val536Ala) rs138427376
NM_000053.4(ATP7B):c.1620C>T (p.Leu540=) rs145798966
NM_000053.4(ATP7B):c.1708-1G>C rs137853280
NM_000053.4(ATP7B):c.1708-5T>G rs770829226
NM_000053.4(ATP7B):c.1716del (p.Gly572_Met573insTer) rs1057516893
NM_000053.4(ATP7B):c.1739del (p.His580fs) rs1555293357
NM_000053.4(ATP7B):c.1782del (p.Thr593_Tyr594insTer) rs780327716
NM_000053.4(ATP7B):c.1877G>C (p.Gly626Ala) rs587783299
NM_000053.4(ATP7B):c.1934T>G (p.Met645Arg) rs121907998
NM_000053.4(ATP7B):c.1946+6T>C rs751287778
NM_000053.4(ATP7B):c.1947-4C>T rs74904335
NM_000053.4(ATP7B):c.1995G>A (p.Met665Ile) rs72552259
NM_000053.4(ATP7B):c.19_20del (p.Gln7fs) rs749363958
NM_000053.4(ATP7B):c.2122-8T>G rs193922102
NM_000053.4(ATP7B):c.2131G>A (p.Gly711Arg) rs1394999756
NM_000053.4(ATP7B):c.2131G>T (p.Gly711Trp) rs1394999756
NM_000053.4(ATP7B):c.2175G>A (p.Arg725=) rs61733684
NM_000053.4(ATP7B):c.2227del (p.Tyr743fs)
NM_000053.4(ATP7B):c.2294A>G (p.Asp765Gly) rs1555291147
NM_000053.4(ATP7B):c.2297C>T (p.Thr766Met) rs121907997
NM_000053.4(ATP7B):c.2305A>G (p.Met769Val) rs193922103
NM_000053.4(ATP7B):c.2332C>G (p.Arg778Gly) rs137853284
NM_000053.4(ATP7B):c.2333G>T (p.Arg778Leu) rs28942074
NM_000053.4(ATP7B):c.2355+13T>G rs139211339
NM_000053.4(ATP7B):c.2383C>T (p.Leu795Phe) rs751710854
NM_000053.4(ATP7B):c.2448-11G>A rs200450017
NM_000053.4(ATP7B):c.2605G>A (p.Gly869Arg) rs191312027
NM_000053.4(ATP7B):c.2621C>T (p.Ala874Val) rs121907994
NM_000053.4(ATP7B):c.2668G>A (p.Val890Met) rs786204718
NM_000053.4(ATP7B):c.2731-2A>G rs367956522
NM_000053.4(ATP7B):c.2755C>T (p.Arg919Trp) rs121907993
NM_000053.4(ATP7B):c.2785A>G (p.Ile929Val) rs534960245
NM_000053.4(ATP7B):c.2804C>T (p.Thr935Met) rs750019452
NM_000053.4(ATP7B):c.2810del (p.Val937fs) rs1057516643
NM_000053.4(ATP7B):c.2827G>A (p.Gly943Ser) rs28942076
NM_000053.4(ATP7B):c.2828G>A (p.Gly943Asp) rs779323689
NM_000053.4(ATP7B):c.2905C>T (p.Arg969Trp) rs774028495
NM_000053.4(ATP7B):c.2953T>C (p.Cys985Arg) rs193922104
NM_000053.4(ATP7B):c.2972C>T (p.Thr991Met) rs41292782
NM_000053.4(ATP7B):c.3007G>A (p.Ala1003Thr) rs201497300
NM_000053.4(ATP7B):c.3008C>T (p.Ala1003Val) rs775055397
NM_000053.4(ATP7B):c.3015C>T (p.Asn1005=) rs74085888
NM_000053.4(ATP7B):c.3036dup (p.Lys1013fs) rs1555287300
NM_000053.4(ATP7B):c.3045G>A (p.Leu1015=) rs1801248
NM_000053.4(ATP7B):c.3060+16G>T rs76163470
NM_000053.4(ATP7B):c.3061-12T>A rs1045194246
NM_000053.4(ATP7B):c.3101A>G (p.His1034Arg) rs74085882
NM_000053.4(ATP7B):c.314C>A (p.Ser105Ter) rs753236073
NM_000053.4(ATP7B):c.3191A>C (p.Glu1064Ala) rs374094065
NM_000053.4(ATP7B):c.3207C>A (p.His1069Gln) rs76151636
NM_000053.4(ATP7B):c.3247C>T (p.Leu1083Phe) rs1286080173
NM_000053.4(ATP7B):c.3272G>A (p.Cys1091Tyr) rs778825095
NM_000053.4(ATP7B):c.3305T>C (p.Ile1102Thr) rs560952220
NM_000053.4(ATP7B):c.3369G>A (p.Pro1123=) rs61733679
NM_000053.4(ATP7B):c.3405A>G (p.Ala1135=) rs373081328
NM_000053.4(ATP7B):c.3517G>A (p.Glu1173Lys) rs756029120
NM_000053.4(ATP7B):c.3556+1G>A rs184388696
NM_000053.4(ATP7B):c.3557-6C>T rs140708492
NM_000053.4(ATP7B):c.3588C>T (p.Asp1196=) rs11840224
NM_000053.4(ATP7B):c.3620A>G (p.His1207Arg) rs7334118
NM_000053.4(ATP7B):c.3659C>T (p.Thr1220Met) rs193922107
NM_000053.4(ATP7B):c.3688A>G (p.Ile1230Val) rs200911496
NM_000053.4(ATP7B):c.3796G>A (p.Gly1266Arg) rs121907992
NM_000053.4(ATP7B):c.3889G>A (p.Val1297Ile) rs148399850
NM_000053.4(ATP7B):c.3891C>T (p.Val1297=) rs114771537
NM_000053.4(ATP7B):c.4022-19C>T rs369736734
NM_000053.4(ATP7B):c.4058G>A (p.Trp1353Ter) rs193922110
NM_000053.4(ATP7B):c.4088C>T (p.Ser1363Phe) rs776848753
NM_000053.4(ATP7B):c.4213G>A (p.Gly1405Ser) rs189601972
NM_000053.4(ATP7B):c.4301C>T (p.Thr1434Met) rs60986317
NM_000053.4(ATP7B):c.4311G>A (p.Lys1437=) rs73202048
NM_000053.4(ATP7B):c.51+4A>T rs369488210
NM_000053.4(ATP7B):c.524_525del (p.Lys175fs) rs558037268
NM_000053.4(ATP7B):c.628A>G (p.Ile210Val) rs61733680
NM_000053.4(ATP7B):c.778dup (p.Gln260fs) rs786204570
NM_000053.4(ATP7B):c.970A>T (p.Lys324Ter) rs911589273
NM_000055.2(BCHE):c.293A>G (p.Asp98Gly) rs1799807
NM_000055.4(BCHE):c.428G>A (p.Gly143Asp) rs201820739
NM_000057.4(BLM):c.1284G>A (p.Trp428Ter) rs1057516964
NM_000057.4(BLM):c.1722A>G (p.Leu574=) rs28385011
NM_000057.4(BLM):c.1928G>A (p.Arg643His) rs12720097
NM_000057.4(BLM):c.1968dup (p.Lys657fs) rs772785079
NM_000057.4(BLM):c.2250_2251insAAAT (p.Leu751fs) rs786204471
NM_000057.4(BLM):c.2407dup (p.Trp803fs) rs367543012
NM_000057.4(BLM):c.2580_2581del (p.His860fs) rs864622347
NM_000057.4(BLM):c.2603C>T (p.Pro868Leu) rs2227935
NM_000057.4(BLM):c.2695C>T (p.Arg899Ter) rs587779884
NM_000057.4(BLM):c.3028del (p.Asp1010fs) rs780379121
NM_000057.4(BLM):c.3164G>C (p.Cys1055Ser) rs367543029
NM_000057.4(BLM):c.3475_3476del (p.Leu1159fs) rs367543033
NM_000057.4(BLM):c.3798T>G (p.Val1266=) rs138831180
NM_000057.4(BLM):c.3849G>A (p.Gln1283=) rs140524886
NM_000057.4(BLM):c.4076+4T>G rs183176301
NM_000057.4(BLM):c.4077-10C>T rs145310008
NM_000057.4(BLM):c.410A>G (p.Lys137Arg) rs28384988
NM_000057.4(BLM):c.772_773del (p.Leu258fs) rs367543013
NM_000057.4(BLM):c.98+1G>T rs750293380
NM_000057.4(BLM):c.991_995del (p.Lys331fs) rs786204524
NM_000059.3(BRCA2):c.*14C>T rs373436334
NM_000059.3(BRCA2):c.10024G>A (p.Glu3342Lys) rs28897761
NM_000059.3(BRCA2):c.10024G>T (p.Glu3342Ter) rs28897761
NM_000059.3(BRCA2):c.10089A>G (p.Ile3363Met) rs80358390
NM_000059.3(BRCA2):c.10111A>G (p.Thr3371Ala) rs80358393
NM_000059.3(BRCA2):c.10127C>G (p.Ser3376Ter) rs1555290049
NM_000059.3(BRCA2):c.10160C>G (p.Thr3387Ser) rs863224584
NM_000059.3(BRCA2):c.1021T>C (p.Cys341Arg) rs55833327
NM_000059.3(BRCA2):c.10220A>G (p.Asn3407Ser) rs80358401
NM_000059.3(BRCA2):c.10222A>T (p.Lys3408Ter) rs80358402
NM_000059.3(BRCA2):c.10240A>G (p.Thr3414Ala) rs80358405
NM_000059.3(BRCA2):c.10250A>G (p.Tyr3417Cys) rs730881600
NM_000059.3(BRCA2):c.1040A>G (p.Gln347Arg) rs55800493
NM_000059.3(BRCA2):c.1054T>C (p.Tyr352His) rs542343726
NM_000059.3(BRCA2):c.1059A>G (p.Ser353=) rs730881585
NM_000059.3(BRCA2):c.1096T>G (p.Leu366Val) rs587779357
NM_000059.3(BRCA2):c.1123C>T (p.Pro375Ser) rs80358408
NM_000059.3(BRCA2):c.1124C>T (p.Pro375Leu) rs80358409
NM_000059.3(BRCA2):c.1127T>G (p.Phe376Cys) rs80358410
NM_000059.3(BRCA2):c.1166C>A (p.Pro389Gln) rs397507263
NM_000059.3(BRCA2):c.1166C>T (p.Pro389Leu) rs397507263
NM_000059.3(BRCA2):c.1167G>A (p.Pro389=) rs148607710
NM_000059.3(BRCA2):c.1202C>A (p.Ser401Ter) rs80358413
NM_000059.3(BRCA2):c.1219C>T (p.Gln407Ter) rs781079248
NM_000059.3(BRCA2):c.1254A>C (p.Ser418=) rs1052409595
NM_000059.3(BRCA2):c.1272A>G (p.Ser424=) rs587780531
NM_000059.3(BRCA2):c.1447G>C (p.Ala483Pro) rs80358432
NM_000059.3(BRCA2):c.1568A>G (p.His523Arg) rs80358443
NM_000059.3(BRCA2):c.1749G>A (p.Leu583=) rs780324598
NM_000059.3(BRCA2):c.1792dup (p.Thr598fs) rs886040389
NM_000059.3(BRCA2):c.1810A>G (p.Lys604Glu) rs80358467
NM_000059.3(BRCA2):c.1814T>C (p.Ile605Thr) rs80358468
NM_000059.3(BRCA2):c.1838T>G (p.Leu613Arg) rs587780646
NM_000059.3(BRCA2):c.1846del (p.Cys616fs) rs1566224496
NM_000059.3(BRCA2):c.1850C>A (p.Ser617Ter) rs397507278
NM_000059.3(BRCA2):c.1889C>T (p.Thr630Ile) rs80358479
NM_000059.3(BRCA2):c.2025A>G (p.Thr675=) rs147381487
NM_000059.3(BRCA2):c.2094A>G (p.Leu698=) rs28897714
NM_000059.3(BRCA2):c.2109C>T (p.Thr703=) rs762499878
NM_000059.3(BRCA2):c.2133C>T (p.Cys711=) rs535547513
NM_000059.3(BRCA2):c.2176del (p.Val726fs) rs1555282499
NM_000059.3(BRCA2):c.2208A>G (p.Ala736=) rs144984153
NM_000059.3(BRCA2):c.2320A>G (p.Thr774Ala) rs55968715
NM_000059.3(BRCA2):c.2412A>G (p.Glu804=) rs587780866
NM_000059.3(BRCA2):c.2459A>G (p.Asp820Gly) rs80358511
NM_000059.3(BRCA2):c.2484T>C (p.Tyr828=) rs45619134
NM_000059.3(BRCA2):c.2490C>T (p.Asn830=) rs56331088
NM_000059.3(BRCA2):c.2581C>T (p.Gln861Ter) rs773356478
NM_000059.3(BRCA2):c.2601T>G (p.Thr867=) rs730881589
NM_000059.3(BRCA2):c.2658_2659del (p.Asn886fs) rs397507291
NM_000059.3(BRCA2):c.267G>A (p.Pro89=) rs587780648
NM_000059.3(BRCA2):c.2680G>A (p.Val894Ile) rs28897715
NM_000059.3(BRCA2):c.2731del (p.Glu911fs) rs80359344
NM_000059.3(BRCA2):c.2739C>T (p.Asp913=) rs276174829
NM_000059.3(BRCA2):c.2779A>G (p.Met927Val) rs786201837
NM_000059.3(BRCA2):c.2803G>C (p.Asp935His) rs28897716
NM_000059.3(BRCA2):c.2817C>T (p.Thr939=) rs367921107
NM_000059.3(BRCA2):c.2819A>G (p.Gln940Arg) rs1057520249
NM_000059.3(BRCA2):c.28A>G (p.Thr10Ala) rs786203080
NM_000059.3(BRCA2):c.2944A>C (p.Ile982Leu) rs28897717
NM_000059.3(BRCA2):c.2946A>G (p.Ile982Met) rs80358541
NM_000059.3(BRCA2):c.2T>C (p.Met1Thr) rs80358547
NM_000059.3(BRCA2):c.3054G>A (p.Lys1018=) rs368404583
NM_000059.3(BRCA2):c.316+13A>G rs773097109
NM_000059.3(BRCA2):c.316+18G>A rs760439858
NM_000059.3(BRCA2):c.3173A>G (p.Lys1058Arg) rs431825302
NM_000059.3(BRCA2):c.3218A>G (p.Gln1073Arg) rs80358566
NM_000059.3(BRCA2):c.3254A>G (p.His1085Arg) rs80358570
NM_000059.3(BRCA2):c.3262C>T (p.Pro1088Ser) rs80358572
NM_000059.3(BRCA2):c.3304A>T (p.Asn1102Tyr) rs28897719
NM_000059.3(BRCA2):c.3326C>T (p.Ala1109Val) rs41293479
NM_000059.3(BRCA2):c.3385C>T (p.Gln1129Ter) rs1555283209
NM_000059.3(BRCA2):c.3395_3396delinsGG (p.Lys1132Arg) rs1060502496
NM_000059.3(BRCA2):c.3417G>A (p.Lys1139=) rs145625991
NM_000059.3(BRCA2):c.3436G>T (p.Glu1146Ter) rs1237049560
NM_000059.3(BRCA2):c.3445A>G (p.Met1149Val) rs80358589
NM_000059.3(BRCA2):c.3453C>G (p.Ile1151Met) rs80358592
NM_000059.3(BRCA2):c.3462C>T (p.Thr1154=) rs4986856
NM_000059.3(BRCA2):c.3495T>C (p.His1165=) rs776655838
NM_000059.3(BRCA2):c.3539A>G (p.Lys1180Arg) rs28897720
NM_000059.3(BRCA2):c.3562A>G (p.Ile1188Val) rs202230438
NM_000059.3(BRCA2):c.3568C>T (p.Arg1190Trp) rs80358604
NM_000059.3(BRCA2):c.3569G>A (p.Arg1190Gln) rs80358605
NM_000059.3(BRCA2):c.3575T>G (p.Phe1192Cys) rs80358606
NM_000059.3(BRCA2):c.3578C>T (p.Ala1193Val) rs431825310
NM_000059.3(BRCA2):c.3649del (p.Arg1217fs) rs864622134
NM_000059.3(BRCA2):c.3661T>C (p.Ser1221Pro) rs80358611
NM_000059.3(BRCA2):c.3672C>T (p.Gly1224=) rs587780650
NM_000059.3(BRCA2):c.3682A>G (p.Asn1228Asp) rs28897722
NM_000059.3(BRCA2):c.3703C>T (p.Gln1235Ter) rs1555283366
NM_000059.3(BRCA2):c.375T>A (p.Asp125Glu) rs80358616
NM_000059.3(BRCA2):c.376C>T (p.Gln126Ter) rs1555280859
NM_000059.3(BRCA2):c.3814A>G (p.Met1272Val) rs80358624
NM_000059.3(BRCA2):c.3874C>T (p.Leu1292=) rs587780867
NM_000059.3(BRCA2):c.3914_3915del (p.Phe1305fs) rs397507698
NM_000059.3(BRCA2):c.3937del (p.Tyr1313fs) rs1566229421
NM_000059.3(BRCA2):c.4007_4008insCATC (p.Asp1337fs) rs878853577
NM_000059.3(BRCA2):c.4037del (p.Thr1346fs) rs1162394508
NM_000059.3(BRCA2):c.4061C>T (p.Thr1354Met) rs80358656
NM_000059.3(BRCA2):c.4071A>C (p.Leu1357=) rs140556653
NM_000059.3(BRCA2):c.4092_4093insAA (p.Cys1365fs) rs876658329
NM_000059.3(BRCA2):c.4094G>A (p.Cys1365Tyr) rs80358657
NM_000059.3(BRCA2):c.4178C>T (p.Ala1393Val) rs398122776
NM_000059.3(BRCA2):c.4179G>A (p.Ala1393=) rs770531115
NM_000059.3(BRCA2):c.4218_4221del (p.Lys1406fs) rs80359435
NM_000059.3(BRCA2):c.4271C>G (p.Ser1424Cys) rs80358664
NM_000059.3(BRCA2):c.4314C>T (p.Val1438=) rs730881590
NM_000059.3(BRCA2):c.4320A>G (p.Lys1440=) rs769535925
NM_000059.3(BRCA2):c.441A>G (p.Gln147=) rs80358676
NM_000059.3(BRCA2):c.442T>C (p.Cys148Arg) rs80358677
NM_000059.3(BRCA2):c.4570T>G (p.Phe1524Val) rs56386506
NM_000059.3(BRCA2):c.4570_4573del (p.Phe1524fs) rs1057517565
NM_000059.3(BRCA2):c.4578A>G (p.Thr1526=) rs202022822
NM_000059.3(BRCA2):c.4591A>T (p.Lys1531Ter) rs1555283865
NM_000059.3(BRCA2):c.4698C>T (p.Thr1566=) rs750813972
NM_000059.3(BRCA2):c.4718G>A (p.Cys1573Tyr) rs56249050
NM_000059.3(BRCA2):c.476-3C>T rs371431745
NM_000059.3(BRCA2):c.476-9dup rs276174849
NM_000059.3(BRCA2):c.4828G>A (p.Val1610Met) rs80358705
NM_000059.3(BRCA2):c.4894_4895del (p.Ser1632fs) rs397507748
NM_000059.3(BRCA2):c.4921G>T (p.Glu1641Ter) rs1566231364
NM_000059.3(BRCA2):c.4977C>T (p.Ser1659=) rs45484897
NM_000059.3(BRCA2):c.502C>A (p.Pro168Thr) rs80358726
NM_000059.3(BRCA2):c.506A>G (p.Lys169Arg) rs80358730
NM_000059.3(BRCA2):c.5095G>A (p.Asp1699Asn) rs80358731
NM_000059.3(BRCA2):c.516+17G>C rs765435155
NM_000059.3(BRCA2):c.516+17G>T rs765435155
NM_000059.3(BRCA2):c.517-11T>C rs81002828
NM_000059.3(BRCA2):c.517-4C>G rs81002804
NM_000059.3(BRCA2):c.5171T>C (p.Ile1724Thr) rs80358743
NM_000059.3(BRCA2):c.5191C>A (p.His1731Asn) rs80358745
NM_000059.3(BRCA2):c.5200dup (p.Glu1734fs) rs1555284103
NM_000059.3(BRCA2):c.5268A>G (p.Val1756=) rs199879914
NM_000059.3(BRCA2):c.5278T>G (p.Ser1760Ala) rs28897735
NM_000059.3(BRCA2):c.5319G>A (p.Glu1773=) rs376257217
NM_000059.3(BRCA2):c.5344C>A (p.Gln1782Lys) rs80358757
NM_000059.3(BRCA2):c.534A>G (p.Lys178=) rs28897703
NM_000059.3(BRCA2):c.5362_5363delinsA (p.Ser1788fs) rs1566232310
NM_000059.3(BRCA2):c.5362dup (p.Ser1788fs) rs587781849
NM_000059.3(BRCA2):c.5414A>G (p.Asn1805Ser) rs80358765
NM_000059.3(BRCA2):c.5423T>C (p.Ile1808Thr) rs397507350
NM_000059.3(BRCA2):c.5455C>T (p.Pro1819Ser) rs80358768
NM_000059.3(BRCA2):c.5498A>G (p.Asn1833Ser) rs587782601
NM_000059.3(BRCA2):c.5529A>C (p.Ala1843=) rs372951842
NM_000059.3(BRCA2):c.5552T>G (p.Ile1851Ser) rs80358776
NM_000059.3(BRCA2):c.5631C>T (p.Asn1877=) rs374326934
NM_000059.3(BRCA2):c.5653del (p.Cys1885fs) rs886040602
NM_000059.3(BRCA2):c.5688A>G (p.Ala1896=) rs768907899
NM_000059.3(BRCA2):c.5710C>G (p.Leu1904Val) rs55875643
NM_000059.3(BRCA2):c.5737T>C (p.Cys1913Arg) rs80358799
NM_000059.3(BRCA2):c.575T>C (p.Met192Thr) rs80358805
NM_000059.3(BRCA2):c.5768A>C (p.Asp1923Ala) rs45491005
NM_000059.3(BRCA2):c.5879G>A (p.Cys1960Tyr) rs56157628
NM_000059.3(BRCA2):c.5882G>A (p.Ser1961Asn) rs80358820
NM_000059.3(BRCA2):c.5896C>T (p.His1966Tyr) rs80358822
NM_000059.3(BRCA2):c.5921C>T (p.Thr1974Ile) rs55730620
NM_000059.3(BRCA2):c.5969A>C (p.Asp1990Ala) rs148618542
NM_000059.3(BRCA2):c.6131G>T (p.Gly2044Val) rs56191579
NM_000059.3(BRCA2):c.6143A>T (p.Asn2048Ile) rs80358853
NM_000059.3(BRCA2):c.6155dup (p.Ser2053fs) rs1566234047
NM_000059.3(BRCA2):c.627C>T (p.Leu209=) rs28897704
NM_000059.3(BRCA2):c.6288T>G (p.Pro2096=) rs372527810
NM_000059.3(BRCA2):c.632-13T>G rs775947267
NM_000059.3(BRCA2):c.6323G>T (p.Arg2108Leu) rs35029074
NM_000059.3(BRCA2):c.6325G>A (p.Val2109Ile) rs79456940
NM_000059.3(BRCA2):c.6338A>G (p.Asn2113Ser) rs80358874
NM_000059.3(BRCA2):c.6393del (p.Lys2131fs) rs886038145
NM_000059.3(BRCA2):c.6423T>G (p.Gly2141=) rs780721021
NM_000059.3(BRCA2):c.6455C>A (p.Ser2152Tyr) rs80358881
NM_000059.3(BRCA2):c.6487C>T (p.Gln2163Ter) rs398122559
NM_000059.3(BRCA2):c.6531T>A (p.Ile2177=) rs587780658
NM_000059.3(BRCA2):c.6540G>C (p.Leu2180Phe) rs398122560
NM_000059.3(BRCA2):c.6541G>C (p.Gly2181Arg) rs371067421
NM_000059.3(BRCA2):c.67+16A>G rs529148674
NM_000059.3(BRCA2):c.67+19T>C rs587780865
NM_000059.3(BRCA2):c.6739A>G (p.Ser2247Gly) rs80358896
NM_000059.3(BRCA2):c.6762del (p.Phe2254fs) rs80359624
NM_000059.3(BRCA2):c.68-7dup rs276174878
NM_000059.3(BRCA2):c.6803G>A (p.Arg2268Lys) rs80358906
NM_000059.3(BRCA2):c.681+4A>G rs397507884
NM_000059.3(BRCA2):c.6841+11A>G rs730881592
NM_000059.3(BRCA2):c.6842-14A>G rs81002821
NM_000059.3(BRCA2):c.6842-20T>C rs81002811
NM_000059.3(BRCA2):c.6877T>C (p.Phe2293Leu) rs80358912
NM_000059.3(BRCA2):c.6892G>A (p.Glu2298Lys) rs80358914
NM_000059.3(BRCA2):c.6915G>A (p.Lys2305=) rs1555285156
NM_000059.3(BRCA2):c.6921A>G (p.Ser2307=) rs181183366
NM_000059.3(BRCA2):c.6935A>T (p.Asp2312Val) rs80358916
NM_000059.3(BRCA2):c.6937+13T>G rs587780868
NM_000059.3(BRCA2):c.6938-25_6938-19del rs762815401
NM_000059.3(BRCA2):c.6943A>C (p.Ile2315Leu) rs80358918
NM_000059.3(BRCA2):c.6960G>A (p.Leu2320=) rs373134168
NM_000059.3(BRCA2):c.6986C>T (p.Pro2329Leu) rs80358925
NM_000059.3(BRCA2):c.7007+18T>A rs377471435
NM_000059.3(BRCA2):c.7021C>T (p.Arg2341Cys) rs41293505
NM_000059.3(BRCA2):c.7050C>T (p.Thr2350=) rs587780870
NM_000059.3(BRCA2):c.7052C>G (p.Ala2351Gly) rs80358932
NM_000059.3(BRCA2):c.7097dup (p.Thr2367fs) rs786202600
NM_000059.3(BRCA2):c.7102T>G (p.Leu2368Val) rs397507382
NM_000059.3(BRCA2):c.7110dup (p.Ser2371fs) rs80359638
NM_000059.3(BRCA2):c.7147dup (p.Tyr2383fs) rs878853599
NM_000059.3(BRCA2):c.7188G>A (p.Leu2396=) rs587780871
NM_000059.3(BRCA2):c.7188G>T (p.Leu2396Phe) rs587780871
NM_000059.3(BRCA2):c.718_719del (p.Leu240fs) rs1555281459
NM_000059.3(BRCA2):c.7239A>G (p.Lys2413=) rs763727386
NM_000059.3(BRCA2):c.7252A>G (p.Arg2418Gly) rs80358953
NM_000059.3(BRCA2):c.7307A>T (p.Asn2436Ile) rs80358955
NM_000059.3(BRCA2):c.7317A>G (p.Gly2439=) rs587780660
NM_000059.3(BRCA2):c.7354A>G (p.Asn2452Asp) rs398122580
NM_000059.3(BRCA2):c.7413A>G (p.Thr2471=) rs138067005
NM_000059.3(BRCA2):c.7414_7415del (p.Lys2472fs) rs80359650
NM_000059.3(BRCA2):c.7436-20A>G rs878853604
NM_000059.3(BRCA2):c.7466A>G (p.Asp2489Gly) rs80358970
NM_000059.3(BRCA2):c.7499G>C (p.Arg2500Thr) rs80358976
NM_000059.3(BRCA2):c.750G>A (p.Val250=) rs143214959
NM_000059.3(BRCA2):c.7522G>A (p.Gly2508Ser) rs80358978
NM_000059.3(BRCA2):c.7525dup (p.Ser2509fs) rs80359656
NM_000059.3(BRCA2):c.7534C>T (p.Leu2512Phe) rs80358980
NM_000059.3(BRCA2):c.7559G>A (p.Arg2520Gln) rs80358982
NM_000059.3(BRCA2):c.7565C>T (p.Ser2522Phe) rs80358985
NM_000059.3(BRCA2):c.7601C>T (p.Ala2534Val) rs74047012
NM_000059.3(BRCA2):c.7618-6G>T rs1057520251
NM_000059.3(BRCA2):c.7626G>A (p.Thr2542=) rs61754138
NM_000059.3(BRCA2):c.7630G>A (p.Gly2544Ser) rs587781485
NM_000059.3(BRCA2):c.7651A>C (p.Lys2551Gln) rs398122587
NM_000059.3(BRCA2):c.7786G>A (p.Gly2596Arg) rs398122591
NM_000059.3(BRCA2):c.7805+8A>G rs81002847
NM_000059.3(BRCA2):c.796T>C (p.Phe266Leu) rs587782433
NM_000059.3(BRCA2):c.799G>T (p.Gly267Ter) rs786202796
NM_000059.3(BRCA2):c.8023A>G (p.Ile2675Val) rs397507954
NM_000059.3(BRCA2):c.8036A>G (p.Asp2679Gly) rs80359041
NM_000059.3(BRCA2):c.8063T>C (p.Leu2688Pro) rs80359045
NM_000059.3(BRCA2):c.8124T>G (p.Thr2708=) rs587780662
NM_000059.3(BRCA2):c.8154T>C (p.Ile2718=) rs148880015
NM_000059.3(BRCA2):c.8188G>C (p.Ala2730Pro) rs80359066
NM_000059.3(BRCA2):c.8215G>A (p.Val2739Ile) rs80359069
NM_000059.3(BRCA2):c.8298A>G (p.Thr2766=) rs730881594
NM_000059.3(BRCA2):c.8331+16C>G rs730881595
NM_000059.3(BRCA2):c.8331+16C>T rs730881595
NM_000059.3(BRCA2):c.8332-6G>T rs587780872
NM_000059.3(BRCA2):c.8350C>T (p.Arg2784Trp) rs80359075
NM_000059.3(BRCA2):c.8352G>T (p.Arg2784=) rs747664806
NM_000059.3(BRCA2):c.8356G>A (p.Ala2786Thr) rs80359077
NM_000059.3(BRCA2):c.8359C>T (p.Arg2787Cys) rs41293517
NM_000059.3(BRCA2):c.8386C>T (p.Pro2796Ser) rs146120136
NM_000059.3(BRCA2):c.8417C>T (p.Ser2806Leu) rs587782785
NM_000059.3(BRCA2):c.8487+4T>C rs81002801
NM_000059.3(BRCA2):c.8487+8G>A rs81002838
NM_000059.3(BRCA2):c.8488-5T>C rs533806629
NM_000059.3(BRCA2):c.8573A>G (p.Gln2858Arg) rs80359114
NM_000059.3(BRCA2):c.8632+14T>C rs730881596
NM_000059.3(BRCA2):c.8633-16C>G rs81002818
NM_000059.3(BRCA2):c.8633-19_8633-17del rs770871854
NM_000059.3(BRCA2):c.865A>G (p.Asn289Asp) rs766173
NM_000059.3(BRCA2):c.8687G>A (p.Arg2896His) rs80359128
NM_000059.3(BRCA2):c.8702G>A (p.Gly2901Asp) rs80359129
NM_000059.3(BRCA2):c.8755-12A>G rs863224317
NM_000059.3(BRCA2):c.8755-19A>G rs398122713
NM_000059.3(BRCA2):c.8764A>G (p.Ser2922Gly) rs80359132
NM_000059.3(BRCA2):c.8918G>A (p.Arg2973His) rs80359143
NM_000059.3(BRCA2):c.8953+16C>T rs81002892
NM_000059.3(BRCA2):c.9085G>A (p.Ala3029Thr) rs56179254
NM_000059.3(BRCA2):c.9087G>A (p.Ala3029=) rs368576266
NM_000059.3(BRCA2):c.9118-14T>C rs81002815
NM_000059.3(BRCA2):c.9118-18T>C rs1555288527
NM_000059.3(BRCA2):c.9118-6C>T rs81002890
NM_000059.3(BRCA2):c.9190G>A (p.Asp3064Asn) rs80359177
NM_000059.3(BRCA2):c.9234C>T (p.Val3078=) rs587782428
NM_000059.3(BRCA2):c.9253A>C (p.Thr3085Pro) rs397507423
NM_000059.3(BRCA2):c.9256_9256+1delinsTA rs587781422
NM_000059.3(BRCA2):c.9257-10del rs276174919
NM_000059.3(BRCA2):c.9257-2A>G rs886040954
NM_000059.3(BRCA2):c.9257G>C (p.Gly3086Ala) rs574271678
NM_000059.3(BRCA2):c.9270C>T (p.Phe3090=) rs587780873
NM_000059.3(BRCA2):c.927A>G (p.Ser309=) rs80359806
NM_000059.3(BRCA2):c.9285C>T (p.Asp3095=) rs80359198
NM_000059.3(BRCA2):c.939T>C (p.Ser313=) rs1593891536
NM_000059.3(BRCA2):c.9411T>G (p.Thr3137=) rs1799968
NM_000059.3(BRCA2):c.9433G>C (p.Val3145Leu) rs587776476
NM_000059.3(BRCA2):c.943T>A (p.Cys315Ser) rs79483201
NM_000059.3(BRCA2):c.9454G>A (p.Glu3152Lys) rs80359218
NM_000059.3(BRCA2):c.9509A>G (p.Asp3170Gly) rs80359224
NM_000059.3(BRCA2):c.9581C>A (p.Pro3194Gln) rs28897760
NM_000059.3(BRCA2):c.9583A>G (p.Thr3195Ala) rs80359227
NM_000059.3(BRCA2):c.9592T>C (p.Cys3198Arg) rs80359229
NM_000059.3(BRCA2):c.9605C>T (p.Pro3202Leu) rs397507432
NM_000059.3(BRCA2):c.9613_9614delinsCT (p.Ala3205Leu) rs276174926
NM_000059.3(BRCA2):c.9649-6del rs276174929
NM_000059.3(BRCA2):c.9649-6dup rs276174929
NM_000059.3(BRCA2):c.9720T>C (p.Val3240=) rs80359810
NM_000059.3(BRCA2):c.9728C>T (p.Pro3243Leu) rs80359241
NM_000059.3(BRCA2):c.9738C>T (p.Ala3246=) rs80359811
NM_000059.3(BRCA2):c.9770A>G (p.Lys3257Arg) rs55847618
NM_000059.3(BRCA2):c.9770_9771del (p.Lys3257fs) rs1566260997
NM_000059.3(BRCA2):c.9837A>G (p.Leu3279=) rs730881598
NM_000059.3(BRCA2):c.9838C>T (p.Pro3280Ser) rs55835607
NM_000059.3(BRCA2):c.9839C>A (p.Pro3280His) rs80359246
NM_000059.3(BRCA2):c.987G>A (p.Arg329=) rs561002197
NM_000059.3(BRCA2):c.9924C>T (p.Tyr3308=) rs4987049
NM_000059.4(BRCA2):c.10045A>G (p.Thr3349Ala) rs80358387
NM_000059.4(BRCA2):c.10095delinsGAATTATATCT (p.Ser3366fs) rs276174803
NM_000059.4(BRCA2):c.10110G>A (p.Arg3370=) rs28897762
NM_000059.4(BRCA2):c.1011C>T (p.Asn337=) rs41293473
NM_000059.4(BRCA2):c.10150C>T (p.Arg3384Ter) rs397507568
NM_000059.4(BRCA2):c.10154G>A (p.Arg3385His) rs80358398
NM_000059.4(BRCA2):c.10202C>T (p.Thr3401Met) rs55853199
NM_000059.4(BRCA2):c.10203G>A (p.Thr3401=) rs147854265
NM_000059.4(BRCA2):c.1181A>C (p.Glu394Ala) rs56016241
NM_000059.4(BRCA2):c.1514T>C (p.Ile505Thr) rs28897708
NM_000059.4(BRCA2):c.1538A>G (p.Lys513Arg) rs28897709
NM_000059.4(BRCA2):c.1564G>C (p.Gly522Arg) rs80358442
NM_000059.4(BRCA2):c.162CAA[1] (p.Asn56del) rs11571587
NM_000059.4(BRCA2):c.1662T>G (p.Cys554Trp) rs80358451
NM_000059.4(BRCA2):c.1744A>C (p.Thr582Pro) rs80358457
NM_000059.4(BRCA2):c.1798T>C (p.Tyr600His) rs75419644
NM_000059.4(BRCA2):c.179A>G (p.Asn60Ser) rs80358463
NM_000059.4(BRCA2):c.1804G>A (p.Gly602Arg) rs80358466
NM_000059.4(BRCA2):c.1938C>T (p.Ser646=) rs28897711
NM_000059.4(BRCA2):c.2233A>G (p.Lys745Glu) rs374691587
NM_000059.4(BRCA2):c.2416G>C (p.Asp806His) rs56404215
NM_000059.4(BRCA2):c.2883G>A (p.Gln961=) rs11571655
NM_000059.4(BRCA2):c.2886_3144del (p.His962fs)
NM_000059.4(BRCA2):c.2919G>A (p.Ser973=) rs45525041
NM_000059.4(BRCA2):c.2926_2927delinsAT (p.Ser976Ile) rs276174831
NM_000059.4(BRCA2):c.2957A>G (p.Asn986Ser) rs28897718
NM_000059.4(BRCA2):c.2987T>G (p.Leu996Arg) rs80358545
NM_000059.4(BRCA2):c.2999T>C (p.Ile1000Thr) rs374769365
NM_000059.4(BRCA2):c.3059_3060del (p.Leu1019_Ser1020insTer) rs876661270
NM_000059.4(BRCA2):c.3073A>G (p.Lys1025Glu) rs80358550
NM_000059.4(BRCA2):c.3100_3101del (p.Asp1033_Ile1034insTer) rs1555283051
NM_000059.4(BRCA2):c.3225T>C (p.Ser1075=) rs779228375
NM_000059.4(BRCA2):c.322A>C (p.Asn108His) rs80358567
NM_000059.4(BRCA2):c.3256A>G (p.Ile1086Val) rs80358571
NM_000059.4(BRCA2):c.3264T>C (p.Pro1088=) rs36060526
NM_000059.4(BRCA2):c.3481_3482dup (p.Asp1161fs) rs878853569
NM_000059.4(BRCA2):c.353G>A (p.Arg118His) rs80358603
NM_000059.4(BRCA2):c.3581G>A (p.Gly1194Asp) rs28897721
NM_000059.4(BRCA2):c.3839A>T (p.Asp1280Val) rs56337919
NM_000059.4(BRCA2):c.4068G>A (p.Leu1356=) rs28897724
NM_000059.4(BRCA2):c.4143AGA[1] (p.Glu1382del) rs80359432
NM_000059.4(BRCA2):c.4187A>G (p.Gln1396Arg) rs55969723
NM_000059.4(BRCA2):c.425G>T (p.Ser142Ile) rs397507713
NM_000059.4(BRCA2):c.430GTT[1] (p.Val145del) rs80359442
NM_000059.4(BRCA2):c.4312_4313dup (p.Ala1439fs) rs1064794168
NM_000059.4(BRCA2):c.4436G>C (p.Ser1479Thr) rs80358678
NM_000059.4(BRCA2):c.4614T>C (p.Ser1538=) rs45520945
NM_000059.4(BRCA2):c.4656T>C (p.Gly1552=) rs41293491
NM_000059.4(BRCA2):c.4670C>G (p.Thr1557Ser) rs80358698
NM_000059.4(BRCA2):c.467A>G (p.Asp156Gly) rs68071147
NM_000059.4(BRCA2):c.4850G>A (p.Ser1617Asn) rs397507341
NM_000059.4(BRCA2):c.5070A>C (p.Lys1690Asn) rs56087561
NM_000059.4(BRCA2):c.5312G>A (p.Gly1771Asp) rs80358755
NM_000059.4(BRCA2):c.5612G>A (p.Ser1871Asn) rs80358782
NM_000059.4(BRCA2):c.5634C>G (p.Asn1878Lys) rs80358784
NM_000059.4(BRCA2):c.5635G>A (p.Glu1879Lys) rs55996097
NM_000059.4(BRCA2):c.5752C>T (p.His1918Tyr) rs80358803
NM_000059.4(BRCA2):c.5813G>C (p.Gly1938Ala) rs41293499
NM_000059.4(BRCA2):c.5869A>G (p.Ile1957Val) rs80358817
NM_000059.4(BRCA2):c.5897A>G (p.His1966Arg) rs80358823
NM_000059.4(BRCA2):c.5986G>A (p.Ala1996Thr) rs80358833
NM_000059.4(BRCA2):c.6100C>T (p.Arg2034Cys) rs1799954
NM_000059.4(BRCA2):c.6131G>C (p.Gly2044Ala) rs56191579
NM_000059.4(BRCA2):c.6220C>A (p.His2074Asn) rs34309943
NM_000059.4(BRCA2):c.6244del (p.Glu2082fs)
NM_000059.4(BRCA2):c.627C>A (p.Leu209=) rs28897704
NM_000059.4(BRCA2):c.6290C>T (p.Thr2097Met) rs80358866
NM_000059.4(BRCA2):c.6317T>C (p.Leu2106Pro) rs56172926
NM_000059.4(BRCA2):c.631G>A (p.Val211Ile) rs80358871
NM_000059.4(BRCA2):c.6748A>G (p.Thr2250Ala) rs80358899
NM_000059.4(BRCA2):c.68-7T>A rs81002830
NM_000059.4(BRCA2):c.7017G>C (p.Lys2339Asn) rs45574331
NM_000059.4(BRCA2):c.7057G>C (p.Gly2353Arg) rs80358935
NM_000059.4(BRCA2):c.708T>C (p.His236=) rs185506536
NM_000059.4(BRCA2):c.7319A>G (p.His2440Arg) rs4986860
NM_000059.4(BRCA2):c.7436-1G>T
NM_000059.4(BRCA2):c.7436-4A>G rs81002904
NM_000059.4(BRCA2):c.7448G>A (p.Ser2483Asn) rs80358967
NM_000059.4(BRCA2):c.7463G>A (p.Arg2488Lys) rs80358968
NM_000059.4(BRCA2):c.7504C>T (p.Arg2502Cys) rs55716624
NM_000059.4(BRCA2):c.7521A>G (p.Pro2507=) rs759383358
NM_000059.4(BRCA2):c.7805+13A>G rs149769332
NM_000059.4(BRCA2):c.794-11T>C rs81002822
NM_000059.4(BRCA2):c.7988A>T (p.Glu2663Val) rs80359031
NM_000059.4(BRCA2):c.7994A>G (p.Asp2665Gly) rs28897745
NM_000059.4(BRCA2):c.8009C>T (p.Ser2670Leu) rs80359035
NM_000059.4(BRCA2):c.8010G>A (p.Ser2670=) rs146430937
NM_000059.4(BRCA2):c.8092G>A (p.Ala2698Thr) rs80359052
NM_000059.4(BRCA2):c.831T>G (p.Asn277Lys) rs28897705
NM_000059.4(BRCA2):c.8377G>A (p.Gly2793Arg) rs80359082
NM_000059.4(BRCA2):c.8486A>G (p.Gln2829Arg) rs80359100
NM_000059.4(BRCA2):c.8487+19A>G rs11571743
NM_000059.4(BRCA2):c.8488-1G>A rs397507404
NM_000059.4(BRCA2):c.8525G>A (p.Arg2842His) rs80359105
NM_000059.4(BRCA2):c.8567A>C (p.Glu2856Ala) rs11571747
NM_000059.4(BRCA2):c.8755-1G>A rs81002812
NM_000059.4(BRCA2):c.8850G>T (p.Lys2950Asn) rs28897754
NM_000059.4(BRCA2):c.8917C>T (p.Arg2973Cys) rs45469092
NM_000059.4(BRCA2):c.8954-5A>G rs886040949
NM_000059.4(BRCA2):c.8972G>A (p.Arg2991His) rs80359150
NM_000059.4(BRCA2):c.9004G>A (p.Glu3002Lys) rs80359152
NM_000059.4(BRCA2):c.9041C>G (p.Ser3014Ter) rs80359156
NM_000059.4(BRCA2):c.9096_9097del (p.Lys3032fs) rs397507419
NM_000059.4(BRCA2):c.9242T>C (p.Val3081Ala) rs80359189
NM_000059.4(BRCA2):c.9257-18C>A rs81002807
NM_000059.4(BRCA2):c.9271G>A (p.Val3091Ile) rs80359194
NM_000059.4(BRCA2):c.9285C>G (p.Asp3095Glu) rs80359198
NM_000059.4(BRCA2):c.9371A>T (p.Asn3124Ile) rs28897759
NM_000059.4(BRCA2):c.9458G>C (p.Gly3153Ala) rs80359220
NM_000059.4(BRCA2):c.9501+3A>T rs61757642
NM_000059.4(BRCA2):c.9502-12T>G rs81002803
NM_000059.4(BRCA2):c.956A>G (p.Asn319Ser) rs55939572
NM_000059.4(BRCA2):c.9586A>G (p.Lys3196Glu) rs80359228
NM_000059.4(BRCA2):c.964A>C (p.Lys322Gln) rs11571640
NM_000059.4(BRCA2):c.9699_9702del rs80359775
NM_000059.4(BRCA2):c.9730G>A (p.Val3244Ile) rs11571831
NM_000059.4(BRCA2):c.9875C>T (p.Pro3292Leu) rs56121817
NM_000059.4(BRCA2):c.9976A>T (p.Lys3326Ter) rs11571833
NM_000059.4(BRCA2):c.9986A>G (p.Asn3329Ser) rs76635144
NM_000061.2(BTK):c.1773C>A (p.Tyr591Ter) rs128621207
NM_000061.3(BTK):c.1442G>C rs1057519825
NM_000069.3(CACNA1S):c.4060A>T (p.Thr1354Ser) rs145910245
NM_000071.3(CBS):c.573G>A (p.Thr191=) rs73906420
NM_000075.4(CDK4):c.122A>G (p.Asn41Ser) rs144890720
NM_000075.4(CDK4):c.219-10C>T rs759302811
NM_000075.4(CDK4):c.523-4T>A rs587780667
NM_000075.4(CDK4):c.625C>T (p.Arg209Cys) rs140644696
NM_000075.4(CDK4):c.633-8C>A rs536249985
NM_000075.4(CDK4):c.661G>A (p.Asp221Asn) rs587778187
NM_000075.4(CDK4):c.684-4A>T rs370609910
NM_000075.4(CDK4):c.776C>T (p.Ser259Leu) rs201617914
NM_000075.4(CDK4):c.777G>A (p.Ser259=) rs3211622
NM_000075.4(CDK4):c.834T>C (p.Phe278=) rs115576923
NM_000077.4(CDKN2A):c.-2G>A rs191394143
NM_000077.4(CDKN2A):c.146T>C (p.Ile49Thr) rs199907548
NM_000077.4(CDKN2A):c.149A>G (p.Gln50Arg) rs587778189
NM_000077.4(CDKN2A):c.170C>T (p.Ala57Val) rs372266620
NM_000077.4(CDKN2A):c.197A>G (p.His66Arg) rs756750256
NM_000077.4(CDKN2A):c.219C>G (p.Ala73=) rs730881679
NM_000077.4(CDKN2A):c.261G>A (p.Arg87=) rs546300971
NM_000077.4(CDKN2A):c.273G>A (p.Leu91=) rs4987127
NM_000077.4(CDKN2A):c.298G>T (p.Ala100Ser) rs200863613
NM_000077.4(CDKN2A):c.318G>A (p.Val106=) rs199888003
NM_000077.4(CDKN2A):c.341C>T (p.Pro114Leu) rs121913386
NM_000077.4(CDKN2A):c.369T>A (p.His123Gln) rs6413463
NM_000077.4(CDKN2A):c.373G>C (p.Asp125His) rs146179135
NM_000077.4(CDKN2A):c.384G>A (p.Arg128=) rs199901898
NM_000077.4(CDKN2A):c.405G>A (p.Gly135=) rs751586391
NM_000077.4(CDKN2A):c.95T>C (p.Leu32Pro) rs878853650
NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[1] (p.Ala4_Pro11del) rs587780668
NM_000079.4(CHRNA1):c.2T>C (p.Met1Thr)
NM_000086.2(CLN3):c.1000C>T (p.Arg334Cys) rs386833694
NM_000086.2(CLN3):c.1001G>A (p.Arg334His) rs386833695
NM_000086.2(CLN3):c.1268C>A (p.Ser423Ter) rs386833706
NM_000086.2(CLN3):c.214C>T (p.Gln72Ter) rs386833709
NM_000086.2(CLN3):c.265C>T (p.Arg89Ter) rs386833713
NM_000086.2(CLN3):c.944dup (p.His315fs) rs386833740
NM_000088.3(COL1A1):c.1768-8C>T rs193922142
NM_000088.3(COL1A1):c.1984-5C>A rs66592376
NM_000088.3(COL1A1):c.2595C>T (p.Arg865=) rs117672175
NM_000088.3(COL1A1):c.904-9G>T rs141726413
NM_000089.3(COL1A2):c.1350+11A>T rs193922160
NM_000089.3(COL1A2):c.1383C>T (p.Pro461=) rs139726213
NM_000089.3(COL1A2):c.3018C>T (p.Gly1006=) rs62001059
NM_000089.3(COL1A2):c.3336C>T (p.Tyr1112=) rs34691365
NM_000089.3(COL1A2):c.948C>T (p.Gly316=) rs34511999
NM_000090.3(COL3A1):c.114C>G (p.Ser38=) rs141241764
NM_000090.3(COL3A1):c.1617C>T (p.Pro539=) rs141091206
NM_000090.3(COL3A1):c.1804C>A (p.Pro602Thr) rs35795890
NM_000090.3(COL3A1):c.1815+5G>A rs146652498
NM_000090.3(COL3A1):c.1864C>T (p.Pro622Ser) rs772638774
NM_000090.3(COL3A1):c.1927T>C (p.Leu643=) rs41263757
NM_000090.3(COL3A1):c.2002C>T (p.Pro668Ser) rs1801183
NM_000090.3(COL3A1):c.2035G>A (p.Ala679Thr) rs41263773
NM_000090.3(COL3A1):c.2056C>G (p.Pro686Ala) rs41263775
NM_000090.3(COL3A1):c.226A>G (p.Asn76Asp) rs142045411
NM_000090.3(COL3A1):c.2445T>G (p.Pro815=) rs199727625
NM_000090.3(COL3A1):c.2498A>G (p.Lys833Arg) rs371344739
NM_000090.3(COL3A1):c.2805T>C (p.Pro935=) rs111567071
NM_000090.3(COL3A1):c.2914G>A (p.Gly972Ser) rs587779723
NM_000090.3(COL3A1):c.3228C>T (p.Pro1076=) rs200917999
NM_000090.3(COL3A1):c.3437G>A (p.Gly1146Glu) rs587779495
NM_000090.3(COL3A1):c.4021G>A (p.Gly1341Ser) rs140646380
NM_000090.3(COL3A1):c.4086C>T (p.Ser1362=) rs779774302
NM_000090.3(COL3A1):c.560C>T (p.Thr187Ile) rs371583734
NM_000090.3(COL3A1):c.745-7T>C rs776306752
NM_000090.3(COL3A1):c.812G>A (p.Arg271Gln) rs112185887
NM_000090.3(COL3A1):c.998G>A (p.Gly333Asp) rs587779673
NM_000090.4(COL3A1):c.2002C>A (p.Pro668Thr) rs1801183
NM_000090.4(COL3A1):c.3133G>A (p.Ala1045Thr) rs149722210
NM_000090.4(COL3A1):c.3938A>G (p.Lys1313Arg) rs111840783
NM_000091.4(COL4A3):c.1216C>T (p.Arg406Ter) rs371334239
NM_000091.4(COL4A3):c.346C>A (p.Pro116Thr) rs115324397
NM_000091.4(COL4A3):c.391G>T (p.Glu131Ter) rs1346138010
NM_000091.4(COL4A3):c.4295G>A (p.Arg1432His) rs200509072
NM_000091.4(COL4A3):c.4486C>T (p.Arg1496Ter) rs769863513
NM_000091.4(COL4A3):c.4793T>G (p.Leu1598Arg) rs752452590
NM_000091.5(COL4A3):c.2371C>T rs1060499654
NM_000091.5(COL4A3):c.4484A>G (p.Gln1495Arg) rs77964815
NM_000093.5(COL5A1):c.1588G>A (p.Gly530Ser) rs61735045
NM_000098.3(CPT2):c.1569_1570del (p.His523fs) rs1572385947
NM_000098.3(CPT2):c.1806T>C (p.Phe602=) rs147953465
NM_000098.3(CPT2):c.338C>T (p.Ser113Leu) rs74315294
NM_000098.3(CPT2):c.886C>T (p.Arg296Ter) rs727503887
NM_000104.3(CYP1B1):c.1103G>A (p.Arg368His) rs79204362
NM_000108.5(DLD):c.1123G>A (p.Glu375Lys) rs121964992
NM_000109.4(DMD):c.1294G>A (p.Glu432Lys) rs189143447
NM_000110.3(DPYD):c.1475C>T (p.Ser492Leu) rs72549304
NM_000110.3(DPYD):c.2275C>T (p.Arg759Ter) rs759372918
NM_000110.3(DPYD):c.661G>T (p.Glu221Ter) rs146170505
NM_000110.3(DPYD):c.775A>G (p.Lys259Glu) rs45589337
NM_000110.4(DPYD):c.1905+1G>A rs3918290
NM_000110.4(DPYD):c.2846A>T (p.Asp949Val) rs67376798
NM_000112.3(SLC26A2):c.1707C>G (p.Tyr569Ter) rs766836061
NM_000112.3(SLC26A2):c.1957T>A (p.Cys653Ser) rs104893924
NM_000112.4(SLC26A2):c.1011TGT[3] (p.Val341del) rs121908077
NM_000112.4(SLC26A2):c.1655C>A (p.Ser552Ter)
NM_000116.5(TAFAZZIN):c.634C>T (p.Leu212=) rs587781186
NM_000116.5(TAFAZZIN):c.873G>A (p.Gly291=) rs35902788
NM_000117.3(EMD):c.144C>T (p.Leu48=) rs200537612
NM_000117.3(EMD):c.396C>T (p.His132=) rs145985318
NM_000123.4(ERCC5):c.3157= (p.Gly1053=)
NM_000123.4(ERCC5):c.3238= (p.Gly1080=)
NM_000136.3(FANCC):c.1155-1G>C
NM_000136.3(FANCC):c.1156T>C (p.Ser386Pro) rs41281202
NM_000136.3(FANCC):c.1345G>A (p.Val449Met) rs1800367
NM_000136.3(FANCC):c.1394A>G (p.Gln465Arg) rs1800368
NM_000136.3(FANCC):c.1534-5del rs748342368
NM_000136.3(FANCC):c.1642C>T (p.Arg548Ter) rs104886457
NM_000136.3(FANCC):c.1661T>C (p.Leu554Pro) rs104886458
NM_000136.3(FANCC):c.178G>A (p.Val60Ile) rs138629441
NM_000136.3(FANCC):c.377_378del (p.Arg126fs) rs1564720637
NM_000136.3(FANCC):c.37C>T (p.Gln13Ter) rs121917784
NM_000136.3(FANCC):c.408A>G (p.Gln136=) rs1800360
NM_000136.3(FANCC):c.416G>A (p.Gly139Glu) rs1800362
NM_000136.3(FANCC):c.455dup (p.Asn152fs) rs774170058
NM_000136.3(FANCC):c.487_490del (p.Glu163fs) rs730881708
NM_000136.3(FANCC):c.520C>T (p.Arg174Ter) rs781542763
NM_000136.3(FANCC):c.521+1G>A rs145394391
NM_000136.3(FANCC):c.65G>A (p.Trp22Ter) rs377294947
NM_000136.3(FANCC):c.672C>T (p.Asn224=) rs150647141
NM_000136.3(FANCC):c.77C>T (p.Ser26Phe) rs1800361
NM_000136.3(FANCC):c.816C>T (p.Ile272=) rs55719336
NM_000136.3(FANCC):c.843+1G>A rs587779909
NM_000136.3(FANCC):c.843+4C>T rs4647506
NM_000136.3(FANCC):c.844-1G>C rs774209201
NM_000136.3(FANCC):c.973G>A (p.Ala325Thr) rs201407189
NM_000136.3(FANCC):c.996+1G>A rs370510954
NM_000137.3(FAH):c.1009G>A (p.Gly337Ser) rs80338900
NM_000137.3(FAH):c.192+1G>T rs786204683
NM_000137.3(FAH):c.192G>T (p.Gln64His) rs80338894
NM_000137.3(FAH):c.1A>G (p.Met1Val) rs1057517972
NM_000137.3(FAH):c.520C>T (p.Arg174Ter) rs781496816
NM_000137.3(FAH):c.554-1G>T rs80338895
NM_000137.3(FAH):c.782C>T (p.Pro261Leu) rs80338898
NM_000137.4(FAH):c.1062+5G>A rs80338901
NM_000138.4(FBN1):c.1027G>A (p.Gly343Arg) rs146726731
NM_000138.4(FBN1):c.1090C>T (p.Arg364Ter) rs794728165
NM_000138.4(FBN1):c.1323A>G (p.Pro441=) rs202030761
NM_000138.4(FBN1):c.1379G>A (p.Cys460Tyr) rs1597581001
NM_000138.4(FBN1):c.1817C>A (p.Ser606Ter) rs794728176
NM_000138.4(FBN1):c.1961-14T>C rs373918202
NM_000138.4(FBN1):c.1A>C (p.Met1Leu) rs730880097
NM_000138.4(FBN1):c.2093C>T (p.Pro698Leu) rs764827921
NM_000138.4(FBN1):c.2113+19A>T rs541501178
NM_000138.4(FBN1):c.2148A>G (p.Gly716=) rs141039922
NM_000138.4(FBN1):c.2243G>A (p.Cys748Tyr) rs1064794282
NM_000138.4(FBN1):c.2287T>C (p.Cys763Arg) rs1555399361
NM_000138.4(FBN1):c.2581C>T (p.Arg861Ter) rs140583
NM_000138.4(FBN1):c.2682del (p.Ile895fs) rs193922194
NM_000138.4(FBN1):c.2723G>A (p.Cys908Tyr) rs1057523406
NM_000138.4(FBN1):c.2746G>A (p.Val916Met) rs373644734
NM_000138.4(FBN1):c.2892C>T (p.Asp964=) rs116945525
NM_000138.4(FBN1):c.2926C>T (p.Arg976Cys) rs548296552
NM_000138.4(FBN1):c.3082+8del rs193922196
NM_000138.4(FBN1):c.3216C>T (p.Asp1072=) rs757177349
NM_000138.4(FBN1):c.3379G>A (p.Gly1127Ser) rs137854468
NM_000138.4(FBN1):c.3463G>A (p.Asp1155Asn) rs794728204
NM_000138.4(FBN1):c.3464-6C>T rs375596551
NM_000138.4(FBN1):c.3890A>G (p.Glu1297Gly) rs200342067
NM_000138.4(FBN1):c.4095C>T (p.Asp1365=) rs375402043
NM_000138.4(FBN1):c.4096G>A (p.Glu1366Lys) rs763449629
NM_000138.4(FBN1):c.4146T>A (p.Asn1382Lys) rs794728218
NM_000138.4(FBN1):c.4214T>G (p.Leu1405Arg) rs767606368
NM_000138.4(FBN1):c.4460-8G>A rs193922204
NM_000138.4(FBN1):c.4562del (p.Pro1521fs) rs886039035
NM_000138.4(FBN1):c.4747+5G>C rs193922209
NM_000138.4(FBN1):c.4930C>T (p.Arg1644Ter) rs140630
NM_000138.4(FBN1):c.4998C>G (p.Thr1666=) rs141925790
NM_000138.4(FBN1):c.4998C>T (p.Thr1666=) rs141925790
NM_000138.4(FBN1):c.5296+14G>A rs140650
NM_000138.4(FBN1):c.5372G>A (p.Cys1791Tyr) rs886038848
NM_000138.4(FBN1):c.538+4A>G rs375721252
NM_000138.4(FBN1):c.5788+5G>T rs193922219
NM_000138.4(FBN1):c.5874C>A (p.Cys1958Ter) rs1555395750
NM_000138.4(FBN1):c.6032G>A (p.Cys2011Tyr) rs886038967
NM_000138.4(FBN1):c.6073G>T (p.Ala2025Ser) rs113577372
NM_000138.4(FBN1):c.6164-3C>T rs571365493
NM_000138.4(FBN1):c.6541T>C (p.Cys2181Arg) rs1131691373
NM_000138.4(FBN1):c.6740A>G (p.Asp2247Gly) rs1060501032
NM_000138.4(FBN1):c.6970G>A (p.Ala2324Thr) rs148831709
NM_000138.4(FBN1):c.7051G>A (p.Gly2351Ser) rs746127796
NM_000138.4(FBN1):c.7056C>T (p.Ser2352=) rs149697299
NM_000138.4(FBN1):c.7072G>A (p.Val2358Ile) rs140537304
NM_000138.4(FBN1):c.7204+7C>G rs371763964
NM_000138.4(FBN1):c.7383C>G (p.Asn2461Lys) rs754047254
NM_000138.4(FBN1):c.75G>A (p.Ala25=) rs543230518
NM_000138.4(FBN1):c.7708G>A (p.Glu2570Lys) rs886038786
NM_000138.4(FBN1):c.7726C>T (p.Arg2576Cys) rs147195031
NM_000138.4(FBN1):c.7775G>T (p.Cys2592Phe) rs112118237
NM_000138.4(FBN1):c.7964C>T (p.Ala2655Val) rs202240409
NM_000138.4(FBN1):c.8005G>A (p.Gly2669Ser) rs794728281
NM_000138.4(FBN1):c.8176C>T (p.Arg2726Trp) rs61746008
NM_000138.4(FBN1):c.8326C>T (p.Arg2776Ter) rs137854466
NM_000138.4(FBN1):c.8363C>T (p.Thr2788Met) rs143007898
NM_000138.4(FBN1):c.902G>T (p.Gly301Val) rs142888621
NM_000138.5(FBN1):c.1148-2A>G rs397515756
NM_000138.5(FBN1):c.1277C>T (p.Pro426Leu)
NM_000138.5(FBN1):c.1746C>T (p.Cys582=) rs112366266
NM_000138.5(FBN1):c.1846G>A (p.Glu616Lys) rs397515764
NM_000138.5(FBN1):c.2055C>G (p.Cys685Trp) rs140603
NM_000138.5(FBN1):c.2645C>T rs794728195
NM_000138.5(FBN1):c.2927G>A (p.Arg976His) rs140954477
NM_000138.5(FBN1):c.2956G>A (p.Ala986Thr) rs112287730
NM_000138.5(FBN1):c.3423G>A (p.Pro1141=) rs140396599
NM_000138.5(FBN1):c.3509G>A (p.Arg1170His) rs137854475
NM_000138.5(FBN1):c.364C>T rs137854467
NM_000138.5(FBN1):c.3675G>A (p.Pro1225=) rs148147223
NM_000138.5(FBN1):c.3712G>A rs794728208
NM_000138.5(FBN1):c.4243dup (p.Cys1415fs)
NM_000138.5(FBN1):c.4270C>G (p.Pro1424Ala) rs201273753
NM_000138.5(FBN1):c.4441A>G (p.Ser1481Gly) rs61730054
NM_000138.5(FBN1):c.4467T>A (p.Asn1489Lys) rs193922205
NM_000138.5(FBN1):c.4588C>T (p.Arg1530Cys) rs111401431
NM_000138.5(FBN1):c.4640C>T (p.Thr1547Ile) rs183306990
NM_000138.5(FBN1):c.4905C>G (p.Thr1635=) rs113115949
NM_000138.5(FBN1):c.510C>T (p.Tyr170=) rs111671429
NM_000138.5(FBN1):c.5442C>T (p.Asn1814=) rs397515822
NM_000138.5(FBN1):c.59A>G (p.Tyr20Cys) rs201309310
NM_000138.5(FBN1):c.6354C>T (p.Ile2118=) rs112989722
NM_000138.5(FBN1):c.6594C>T (p.Pro2198=) rs111844882
NM_000138.5(FBN1):c.6658C>T (p.Arg2220Ter) rs113001196
NM_000138.5(FBN1):c.6700G>A (p.Val2234Met) rs112084407
NM_000138.5(FBN1):c.6806T>C (p.Ile2269Thr) rs193922228
NM_000138.5(FBN1):c.6832C>T (p.Pro2278Ser) rs363835
NM_000138.5(FBN1):c.7039_7040del (p.Met2347fs) rs794728319
NM_000138.5(FBN1):c.7754T>C (p.Ile2585Thr) rs727503054
NM_000138.5(FBN1):c.79G>A (p.Ala27Thr) rs25397
NM_000138.5(FBN1):c.8502T>C (p.Thr2834=) rs363847
NM_000138.5(FBN1):c.986T>C (p.Ile329Thr) rs12324002
NM_000143.3(FH):c.53C>T (p.Pro18Leu) rs201887750
NM_000143.3(FH):c.738+2T>C rs1060500901
NM_000143.4(FH):c.1431_1433dup (p.Lys477dup) rs367543046
NM_000151.4(G6PC1):c.1012G>T (p.Val338Phe) rs367727229
NM_000151.4(G6PC1):c.113A>T (p.Asp38Val) rs104894565
NM_000151.4(G6PC1):c.132C>T (p.Tyr44=) rs202190197
NM_000151.4(G6PC1):c.161A>C (p.Gln54Pro) rs1057517008
NM_000151.4(G6PC1):c.247C>T (p.Arg83Cys) rs1801175
NM_000151.4(G6PC1):c.328G>A (p.Glu110Lys) rs104894567
NM_000151.4(G6PC1):c.340+10C>A rs368450665
NM_000151.4(G6PC1):c.562G>A (p.Gly188Ser) rs80356482
NM_000151.4(G6PC1):c.648G>T (p.Leu216=) rs80356484
NM_000151.4(G6PC1):c.724C>T (p.Gln242Ter) rs80356485
NM_000151.4(G6PC1):c.809G>T (p.Gly270Val) rs80356483
NM_000151.4(G6PC1):c.883C>T (p.Arg295Cys) rs104894563
NM_000151.4(G6PC1):c.969C>A (p.Tyr323Ter) rs780226142
NM_000151.4(G6PC1):c.980_982del (p.Phe327del) rs80356486
NM_000152.5(GAA):c.-2C>T rs560511228
NM_000152.5(GAA):c.-32-13T>G rs386834236
NM_000152.5(GAA):c.1075+9T>C rs751918816
NM_000152.5(GAA):c.1099T>C (p.Trp367Arg) rs1555600061
NM_000152.5(GAA):c.1115A>T (p.His372Leu) rs1057516520
NM_000152.5(GAA):c.1195-15G>A rs373840229
NM_000152.5(GAA):c.1222A>G (p.Met408Val) rs560575383
NM_000152.5(GAA):c.1285C>G (p.Gln429Glu) rs528369909
NM_000152.5(GAA):c.1286A>G (p.Gln429Arg) rs200294882
NM_000152.5(GAA):c.1309C>T (p.Arg437Cys) rs770610356
NM_000152.5(GAA):c.1343G>C (p.Ser448Thr) rs145712232
NM_000152.5(GAA):c.1411_1414del (p.Glu471fs) rs770276275
NM_000152.5(GAA):c.1437+1G>A rs1555600575
NM_000152.5(GAA):c.1438-1G>C rs147804176
NM_000152.5(GAA):c.1441T>C (p.Trp481Arg) rs772883420
NM_000152.5(GAA):c.1447G>A (p.Gly483Arg) rs770590394
NM_000152.5(GAA):c.1465G>A (p.Asp489Asn) rs398123169
NM_000152.5(GAA):c.1548G>A (p.Trp516Ter) rs140826989
NM_000152.5(GAA):c.1551+1G>T rs770780848
NM_000152.5(GAA):c.1552-13G>A rs111261964
NM_000152.5(GAA):c.1552-3C>G rs375470378
NM_000152.5(GAA):c.1564C>T (p.Pro522Ser)
NM_000152.5(GAA):c.1726G>A (p.Gly576Ser) rs1800307
NM_000152.5(GAA):c.1735G>A (p.Glu579Lys) rs991082382
NM_000152.5(GAA):c.1755-18T>C rs201399518
NM_000152.5(GAA):c.1799G>A (p.Arg600His) rs377544304
NM_000152.5(GAA):c.1827del (p.Arg608_Tyr609insTer) rs781088002
NM_000152.5(GAA):c.1841C>A (p.Thr614Lys) rs369531647
NM_000152.5(GAA):c.1843G>A (p.Gly615Arg) rs549029029
NM_000152.5(GAA):c.1856G>A (p.Ser619Asn) rs753269119
NM_000152.5(GAA):c.1888+10_1888+11insC rs748036956
NM_000152.5(GAA):c.1905C>A (p.Asn635Lys) rs1414146587
NM_000152.5(GAA):c.1933G>A (p.Asp645Asn) rs368438393
NM_000152.5(GAA):c.1935C>A (p.Asp645Glu) rs28940868
NM_000152.5(GAA):c.1942G>A (p.Gly648Ser) rs536906561
NM_000152.5(GAA):c.1952del (p.Gly651fs) rs1567835775
NM_000152.5(GAA):c.1978C>T (p.Arg660Cys) rs759518659
NM_000152.5(GAA):c.1979G>A (p.Arg660His) rs374143224
NM_000152.5(GAA):c.2014C>T (p.Arg672Trp) rs757111744
NM_000152.5(GAA):c.2015G>A (p.Arg672Gln) rs778418246
NM_000152.5(GAA):c.2040+17G>A rs534129336
NM_000152.5(GAA):c.2064C>T (p.Ser688=) rs140996643
NM_000152.5(GAA):c.2104C>T (p.Arg702Cys) rs786204645
NM_000152.5(GAA):c.2105G>A (p.Arg702His) rs398123172
NM_000152.5(GAA):c.2105G>C (p.Arg702Pro) rs398123172
NM_000152.5(GAA):c.2140del (p.His714fs) rs786204549
NM_000152.5(GAA):c.2190-4G>A rs759974338
NM_000152.5(GAA):c.2236T>C (p.Trp746Arg) rs1479740763
NM_000152.5(GAA):c.2236T>G (p.Trp746Gly) rs1479740763
NM_000152.5(GAA):c.2238G>C (p.Trp746Cys) rs1800312
NM_000152.5(GAA):c.2297A>C (p.Tyr766Ser) rs144016984
NM_000152.5(GAA):c.2297A>G (p.Tyr766Cys) rs144016984
NM_000152.5(GAA):c.2332-12A>T rs200965268
NM_000152.5(GAA):c.2400C>T (p.Ser800=) rs115705591
NM_000152.5(GAA):c.2501_2502del (p.Thr834fs) rs886043343
NM_000152.5(GAA):c.2560C>T (p.Arg854Ter) rs121907943
NM_000152.5(GAA):c.2561G>A (p.Arg854Gln) rs149968110
NM_000152.5(GAA):c.2571G>T (p.Leu857=) rs17853996
NM_000152.5(GAA):c.257C>G (p.Pro86Arg) rs2229222
NM_000152.5(GAA):c.2580C>T (p.Asp860=) rs61736894
NM_000152.5(GAA):c.258C>A (p.Pro86=) rs146615896
NM_000152.5(GAA):c.2608C>T (p.Arg870Ter) rs780321415
NM_000152.5(GAA):c.2647-8C>T rs139201641
NM_000152.5(GAA):c.2800-15CT[3] rs770227589
NM_000152.5(GAA):c.307T>G (p.Cys103Gly) rs398123174
NM_000152.5(GAA):c.324T>C (p.Cys108=) rs1800300
NM_000152.5(GAA):c.32G>A (p.Arg11Gln) rs138812846
NM_000152.5(GAA):c.365del (p.Met122fs) rs786204661
NM_000152.5(GAA):c.368G>A (p.Gly123Glu) rs138034915
NM_000152.5(GAA):c.525del (p.Glu176fs) rs386834235
NM_000152.5(GAA):c.546+18G>A rs190153982
NM_000152.5(GAA):c.546G>A (p.Thr182=) rs143523371
NM_000152.5(GAA):c.569G>A (p.Arg190His) rs528367092
NM_000152.5(GAA):c.655G>A (p.Gly219Arg) rs370950728
NM_000152.5(GAA):c.670C>T (p.Arg224Trp) rs757700700
NM_000152.5(GAA):c.671G>A (p.Arg224Gln) rs200210219
NM_000152.5(GAA):c.784G>A (p.Glu262Lys) rs201896815
NM_000152.5(GAA):c.853C>T (p.Pro285Ser) rs886042086
NM_000152.5(GAA):c.875A>G (p.Tyr292Cys) rs1057516600
NM_000152.5(GAA):c.953T>C (p.Met318Thr) rs121907936
NM_000152.5(GAA):c.971C>T (p.Pro324Leu) rs750030887
NM_000153.4(GALC):c.1162-4del rs11300320
NM_000153.4(GALC):c.1586C>T (p.Thr529Met) rs200960659
NM_000153.4(GALC):c.1657G>A (p.Gly553Arg) rs748573754
NM_000153.4(GALC):c.1700A>C (p.Tyr567Ser) rs752537626
NM_000153.4(GALC):c.1814dup (p.Tyr605Ter) rs766007316
NM_000153.4(GALC):c.1896_1900del (p.Thr633fs) rs749708827
NM_000153.4(GALC):c.1901T>C (p.Leu634Ser) rs138577661
NM_000153.4(GALC):c.195+19G>A rs189853941
NM_000153.4(GALC):c.205C>T (p.Arg69Ter) rs771111145
NM_000153.4(GALC):c.334A>G (p.Thr112Ala) rs147313927
NM_000153.4(GALC):c.433dup (p.Thr145fs) rs1555383679
NM_000153.4(GALC):c.628A>T (p.Arg210Ter) rs202131052
NM_000153.4(GALC):c.850G>A (p.Gly284Ser) rs377274761
NM_000153.4(GALC):c.857G>A (p.Gly286Asp) rs199847983
NM_000153.4(GALC):c.908+1G>A rs750524447
NM_000153.4(GALC):c.956A>G (p.Tyr319Cys) rs183105855
NM_000154.2(GALK1):c.1031C>T (p.Thr344Met) rs371517491
NM_000155.2(GALT):c.-119_-116delGTCA rs111033640
NM_000155.4(GALT):c.1030C>A (p.Gln344Lys) rs111033814
NM_000155.4(GALT):c.1052del (p.Pro351fs) rs111033813
NM_000155.4(GALT):c.1060-1G>A rs367543268
NM_000155.4(GALT):c.203A>C (p.His68Pro) rs193922247
NM_000155.4(GALT):c.221T>C (p.Leu74Pro) rs111033663
NM_000155.4(GALT):c.290A>G (p.Asn97Ser) rs111033669
NM_000155.4(GALT):c.292G>A (p.Asp98Asn) rs111033670
NM_000155.4(GALT):c.292G>C (p.Asp98His) rs111033670
NM_000155.4(GALT):c.329G>A (p.Gly110Glu) rs1057523885
NM_000155.4(GALT):c.379A>G (p.Lys127Glu) rs111033682
NM_000155.4(GALT):c.404C>T (p.Ser135Leu) rs111033690
NM_000155.4(GALT):c.413C>T (p.Thr138Met) rs111033686
NM_000155.4(GALT):c.414G>T (p.Thr138=) rs116479817
NM_000155.4(GALT):c.443G>A (p.Arg148Gln) rs111033694
NM_000155.4(GALT):c.512T>C (p.Phe171Ser) rs111033715
NM_000155.4(GALT):c.563A>G (p.Gln188Arg) rs75391579
NM_000155.4(GALT):c.564+7G>A rs760189807
NM_000155.4(GALT):c.598C>T (p.Gln200Ter) rs1564101619
NM_000155.4(GALT):c.598del (p.Gln200fs) rs111033738
NM_000155.4(GALT):c.610C>T (p.Arg204Ter) rs111033737
NM_000155.4(GALT):c.619C>T (p.Gln207Ter) rs111033743
NM_000155.4(GALT):c.626A>G (p.Tyr209Cys) rs111033744
NM_000155.4(GALT):c.691C>T (p.Arg231Cys) rs111033749
NM_000155.4(GALT):c.776G>A (p.Arg259Gln) rs886042070
NM_000155.4(GALT):c.82G>A (p.Asp28Asn) rs111033636
NM_000155.4(GALT):c.940A>G (p.Asn314Asp) rs2070074
NM_000155.4(GALT):c.945T>C (p.His315=) rs61735982
NM_000155.4(GALT):c.947G>A (p.Trp316Ter) rs111033790
NM_000155.4(GALT):c.974C>T (p.Pro325Leu) rs111033794
NM_000155.4(GALT):c.982C>T (p.Arg328Cys) rs144993986
NM_000155.4(GALT):c.983G>A (p.Arg328His) rs111033802
NM_000155.4(GALT):c.98G>A (p.Arg33His) rs111033829
NM_000155.4(GALT):c.997C>T (p.Arg333Trp) rs111033800
NM_000156.6(GAMT):c.327G>A (p.Lys109=) rs80338735
NM_000156.6(GAMT):c.59G>C (p.Trp20Ser) rs80338734
NM_000156.6(GAMT):c.626C>T (p.Thr209Met) rs17851582
NM_000157.3(GBA):c.1448T>C rs421016
NM_000157.4(GBA):c.1060G>C (p.Asp354His) rs398123526
NM_000157.4(GBA):c.1093G>A (p.Glu365Lys) rs2230288
NM_000157.4(GBA):c.115+1G>A rs104886460
NM_000157.4(GBA):c.1223C>T (p.Thr408Met) rs75548401
NM_000157.4(GBA):c.1246G>A (p.Gly416Ser) rs121908311
NM_000157.4(GBA):c.1265_1319del (p.Leu422fs) rs80356768
NM_000157.4(GBA):c.1297G>T (p.Val433Leu) rs80356769
NM_000157.4(GBA):c.1342G>C (p.Asp448His) rs1064651
NM_000157.4(GBA):c.1448T>G (p.Leu483Arg) rs421016
NM_000157.4(GBA):c.1504C>T (p.Arg502Cys) rs80356771
NM_000157.4(GBA):c.1505G>A (p.Arg502His) rs80356772
NM_000157.4(GBA):c.1604G>A (p.Arg535His) rs75822236
NM_000157.4(GBA):c.535G>C (p.Asp179His) rs147138516
NM_000157.4(GBA):c.667T>C (p.Trp223Arg) rs61748906
NM_000157.4(GBA):c.680A>G (p.Asn227Ser) rs364897
NM_000157.4(GBA):c.703T>C (p.Ser235Pro) rs1064644
NM_000157.4(GBA):c.754T>A (p.Phe252Ile) rs381737
NM_000157.4(GBA):c.882T>G (p.His294Gln) rs367968666
NM_000157.4(GBA):c.887G>A (p.Arg296Gln) rs78973108
NM_000158.4(GBE1):c.986A>G (p.Tyr329Cys) rs80338671
NM_000159.4(GCDH):c.1173del (p.Asn392fs) rs754002357
NM_000159.4(GCDH):c.1198G>A (p.Val400Met) rs121434372
NM_000159.4(GCDH):c.1204C>T (p.Arg402Trp) rs121434369
NM_000159.4(GCDH):c.262C>A (p.Arg88Ser) rs142967670
NM_000159.4(GCDH):c.329_332del (p.Ile110fs) rs1555749434
NM_000159.4(GCDH):c.572T>C (p.Met191Thr) rs149120354
NM_000159.4(GCDH):c.877G>A (p.Ala293Thr) rs121434371
NM_000159.4(GCDH):c.892G>A (p.Ala298Thr) rs761765983
NM_000162.5(GCK):c.1020-10C>A rs193922257
NM_000162.5(GCK):c.1207C>G (p.Arg403Gly) rs193922271
NM_000162.5(GCK):c.208+11G>A rs77440690
NM_000162.5(GCK):c.209-8G>A rs144798843
NM_000162.5(GCK):c.339C>T (p.Asp113=) rs149412035
NM_000162.5(GCK):c.46-12C>T rs142829768
NM_000162.5(GCK):c.605T>C (p.Met202Thr) rs193922311
NM_000162.5(GCK):c.618G>A (p.Thr206=) rs142817246
NM_000162.5(GCK):c.666C>T (p.Val222=) rs193922318
NM_000162.5(GCK):c.676G>A (p.Val226Met) rs148311934
NM_000169.2(GLA):c.1088G>A (p.Arg363His) rs111422676
NM_000169.2(GLA):c.119C>T (p.Pro40Leu) rs398123199
NM_000169.2(GLA):c.239G>A (p.Gly80Asp) rs781838005
NM_000169.2(GLA):c.335G>A (p.Arg112His) rs372966991
NM_000169.2(GLA):c.593T>C (p.Ile198Thr) rs727503950
NM_000169.2(GLA):c.640-1G>A rs398123216
NM_000169.2(GLA):c.770C>T (p.Ala257Val) rs1569303218
NM_000169.2(GLA):c.782G>T (p.Gly261Val) rs869312401
NM_000169.2(GLA):c.870G>C (p.Met290Ile) rs869312438
NM_000169.2(GLA):c.899T>C (p.Leu300Pro) rs398123223
NM_000169.3(GLA):c.1117G>A (p.Gly373Ser) rs727504348
NM_000169.3(GLA):c.129C>T (p.Gly43=) rs146177035
NM_000169.3(GLA):c.153G>A (p.Met51Ile)
NM_000169.3(GLA):c.196G>C (p.Glu66Gln) rs104894833
NM_000169.3(GLA):c.352C>T (p.Arg118Cys) rs148158093
NM_000169.3(GLA):c.376A>G (p.Ser126Gly) rs149391489
NM_000169.3(GLA):c.386T>C (p.Leu129Pro) rs727503072
NM_000169.3(GLA):c.427G>A (p.Ala143Thr) rs104894845
NM_000169.3(GLA):c.427G>C (p.Ala143Pro) rs104894845
NM_000169.3(GLA):c.824_825del (p.Leu275fs)
NM_000169.3(GLA):c.8T>C (p.Leu3Pro) rs150547672
NM_000169.3(GLA):c.937G>T (p.Asp313Tyr) rs28935490
NM_000169.3(GLA):c.945C>T (p.Asp315=) rs151208856
NM_000169.3(GLA):c.978G>A (p.Lys326=) rs151195362
NM_000170.2(GLDC):c.1009C>T (p.Arg337Ter) rs386833517
NM_000170.2(GLDC):c.1054del (p.Thr352fs) rs386833518
NM_000170.2(GLDC):c.1270C>T (p.Arg424Ter) rs386833521
NM_000170.2(GLDC):c.128del (p.Asp43fs) rs1251443902
NM_000170.2(GLDC):c.1545G>C (p.Arg515Ser) rs121964976
NM_000170.2(GLDC):c.1705G>A (p.Ala569Thr) rs151268759
NM_000170.2(GLDC):c.1786C>T (p.Arg596Ter) rs386833531
NM_000170.2(GLDC):c.2186del (p.Ala729fs) rs386833543
NM_000170.2(GLDC):c.2216G>A (p.Arg739His) rs121964980
NM_000170.2(GLDC):c.2281G>A (p.Gly761Arg) rs386833549
NM_000170.2(GLDC):c.2316-1G>A rs386833554
NM_000170.2(GLDC):c.2380G>A (p.Ala794Thr) rs141933811
NM_000170.2(GLDC):c.2423_2426dup (p.Ile810fs) rs755313904
NM_000170.2(GLDC):c.2614A>T (p.Lys872Ter) rs1430968530
NM_000170.2(GLDC):c.2891dup (p.Tyr964Ter) rs386833572
NM_000170.2(GLDC):c.499G>T (p.Glu167Ter) rs191905539
NM_000170.2(GLDC):c.806C>T (p.Thr269Met) rs386833587
NM_000174.4(GP9):c.70T>C (p.Cys24Arg) rs28933378
NM_000178.4(GSS):c.4del (p.Ala2fs) rs752560204
NM_000178.4(GSS):c.709C>T (p.Arg237Ter)
NM_000179.2(MSH6):c.-2G>T rs374748889
NM_000179.2(MSH6):c.-8C>T rs565211544
NM_000179.2(MSH6):c.1049C>T (p.Ala350Val) rs587782331
NM_000179.2(MSH6):c.1050C>T (p.Ala350=) rs730881802
NM_000179.2(MSH6):c.1063G>A (p.Gly355Ser) rs587778531
NM_000179.2(MSH6):c.1132A>C (p.Arg378=) rs781572949
NM_000179.2(MSH6):c.115G>C (p.Gly39Arg) rs751838296
NM_000179.2(MSH6):c.1176T>C (p.Asp392=) rs587779912
NM_000179.2(MSH6):c.1186C>G (p.Leu396Val) rs2020908
NM_000179.2(MSH6):c.1295T>C (p.Phe432Ser) rs750528093
NM_000179.2(MSH6):c.1508C>G (p.Ser503Cys) rs63750897
NM_000179.2(MSH6):c.1509C>T (p.Ser503=) rs545020313
NM_000179.2(MSH6):c.1665A>G (p.Ala555=) rs146785465
NM_000179.2(MSH6):c.1696G>A (p.Gly566Arg) rs63749973
NM_000179.2(MSH6):c.1776A>T (p.Val592=) rs56132616
NM_000179.2(MSH6):c.178T>C (p.Leu60=) rs35819209
NM_000179.2(MSH6):c.1867C>G (p.Pro623Ala) rs3136334
NM_000179.2(MSH6):c.1917G>A (p.Glu639=) rs368059229
NM_000179.2(MSH6):c.2187C>A (p.Ala729=) rs375610656
NM_000179.2(MSH6):c.2239C>T (p.Leu747=) rs63751305
NM_000179.2(MSH6):c.2253T>C (p.Asn751=) rs2020913
NM_000179.2(MSH6):c.2319C>T (p.Leu773=) rs63749895
NM_000179.2(MSH6):c.2384T>C (p.Ile795Thr) rs202127474
NM_000179.2(MSH6):c.2418C>T (p.Ser806=) rs770992427
NM_000179.2(MSH6):c.2561_2562delinsTT (p.Lys854Ile) rs587780673
NM_000179.2(MSH6):c.260+7G>A rs774479750
NM_000179.2(MSH6):c.2633T>C (p.Val878Ala) rs2020912
NM_000179.2(MSH6):c.2765G>A (p.Arg922Gln) rs752839086
NM_000179.2(MSH6):c.2904C>G (p.Val968=) rs150683226
NM_000179.2(MSH6):c.3024C>T (p.Thr1008=) rs587780675
NM_000179.2(MSH6):c.3151G>A (p.Val1051Ile) rs576269342
NM_000179.2(MSH6):c.3162C>T (p.Ile1054=) rs149605979
NM_000179.2(MSH6):c.3173-10C>T rs587780559
NM_000179.2(MSH6):c.3244C>T (p.Pro1082Ser) rs186240214
NM_000179.2(MSH6):c.3246G>A (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3284G>A (p.Arg1095His) rs63750253
NM_000179.2(MSH6):c.3306T>A (p.Thr1102=) rs2020910
NM_000179.2(MSH6):c.3399T>C (p.Thr1133=) rs61748084
NM_000179.2(MSH6):c.33C>G (p.Phe11Leu) rs747802641
NM_000179.2(MSH6):c.3438+11_3438+14del rs377746844
NM_000179.2(MSH6):c.3439-10T>A rs730881819
NM_000179.2(MSH6):c.3439-1G>T rs587779263
NM_000179.2(MSH6):c.3456A>G (p.Val1152=) rs750998416
NM_000179.2(MSH6):c.3557-7_3557-4del rs267608102
NM_000179.2(MSH6):c.3647-10A>C rs756569687
NM_000179.2(MSH6):c.3647-6T>A rs182871847
NM_000179.2(MSH6):c.364G>A (p.Glu122Lys) rs143036974
NM_000179.2(MSH6):c.3727A>T (p.Thr1243Ser) rs147453999
NM_000179.2(MSH6):c.3801+17T>C rs3136365
NM_000179.2(MSH6):c.3802-40C>G rs3136367
NM_000179.2(MSH6):c.3832C>A (p.Pro1278Thr) rs587782109
NM_000179.2(MSH6):c.3852G>A (p.Thr1284=) rs2229018
NM_000179.2(MSH6):c.3960A>G (p.Ala1320=) rs373425206
NM_000179.2(MSH6):c.3980A>G (p.Asn1327Ser) rs780187989
NM_000179.2(MSH6):c.4001+11_4001+15dup rs587779302
NM_000179.2(MSH6):c.457+7G>C rs781280171
NM_000179.2(MSH6):c.491A>C (p.His164Pro) rs146469162
NM_000179.2(MSH6):c.628-7C>A rs373129248
NM_000179.2(MSH6):c.628-7C>T rs373129248
NM_000179.2(MSH6):c.660A>C (p.Glu220Asp) rs1800938
NM_000179.2(MSH6):c.926C>G (p.Ser309Cys) rs544222338
NM_000179.2(MSH6):c.984C>T (p.Ser328=) rs138143769
NM_000179.3(MSH6):c.1054G>A (p.Val352Ile) rs730881787
NM_000179.3(MSH6):c.107C>T (p.Ala36Val) rs61756469
NM_000179.3(MSH6):c.116G>A (p.Gly39Glu) rs1042821
NM_000179.3(MSH6):c.1730G>A (p.Arg577His) rs376220212
NM_000179.3(MSH6):c.186C>A (p.Arg62=) rs1042820
NM_000179.3(MSH6):c.2398G>C (p.Val800Leu) rs61748083
NM_000179.3(MSH6):c.2555AGA[2] (p.Lys854del) rs587782858
NM_000179.3(MSH6):c.2561A>T (p.Lys854Met) rs34374438
NM_000179.3(MSH6):c.276A>G (p.Pro92=) rs1800932
NM_000179.3(MSH6):c.2983G>T rs63750258
NM_000179.3(MSH6):c.3217C>T (p.Pro1073Ser) rs142254875
NM_000179.3(MSH6):c.3245C>T (p.Pro1082Leu) rs191109849
NM_000179.3(MSH6):c.3259C>T (p.Pro1087Ser) rs63750998
NM_000179.3(MSH6):c.3260C>G (p.Pro1087Arg) rs63750753
NM_000179.3(MSH6):c.3261dup (p.Phe1088fs) rs267608078
NM_000179.3(MSH6):c.3439-2A>G rs267608098
NM_000179.3(MSH6):c.3478G>A (p.Val1160Ile) rs376799914
NM_000179.3(MSH6):c.3488A>T (p.Glu1163Val) rs63750252
NM_000179.3(MSH6):c.3851C>T (p.Thr1284Met) rs63750836
NM_000179.3(MSH6):c.3961A>G (p.Arg1321Gly) rs41295278
NM_000179.3(MSH6):c.3986C>T (p.Ser1329Leu) rs199594809
NM_000179.3(MSH6):c.4001+2TAAC[2] rs267608132
NM_000179.3(MSH6):c.4001+2TAAC[4] rs267608132
NM_000179.3(MSH6):c.4002-10T>A rs545466048
NM_000179.3(MSH6):c.4004A>C (p.Glu1335Ala) rs564434147
NM_000179.3(MSH6):c.4068_4071dup (p.Lys1358delinsAspTer) rs55740729
NM_000179.3(MSH6):c.431G>T (p.Ser144Ile) rs3211299
NM_000179.3(MSH6):c.540T>C (p.Asp180=) rs1800935
NM_000179.3(MSH6):c.59C>T (p.Ala20Val) rs63750664
NM_000179.3(MSH6):c.642C>T (p.Tyr214=) rs1800937
NM_000179.3(MSH6):c.663A>C (p.Glu221Asp) rs41557217
NM_000179.3(MSH6):c.73G>T (p.Ala25Ser) rs267608026
NM_000179.3(MSH6):c.866_867delinsAA (p.Gly289Glu) rs267608079
NM_000179.3(MSH6):c.884A>G (p.Lys295Arg) rs267608051
NM_000179.3(MSH6):c.892C>T (p.Arg298Ter) rs146816935
NM_000181.4(GUSB):c.1069C>T (p.Arg357Ter) rs121918185
NM_000182.5(HADHA):c.1195C>T (p.Arg399Ter) rs1243779049
NM_000182.5(HADHA):c.1793_1794del (p.His598fs) rs769580842
NM_000182.5(HADHA):c.180+1G>A rs786205088
NM_000182.5(HADHA):c.180+3A>G rs781222705
NM_000182.5(HADHA):c.1967del (p.Ile655_Leu656insTer) rs779113356
NM_000182.5(HADHA):c.1981C>T (p.Leu661=) rs142348718
NM_000182.5(HADHA):c.274_278del (p.Ser92fs) rs781205883
NM_000182.5(HADHA):c.871C>T (p.Arg291Ter) rs137852775
NM_000191.3(HMGCL):c.698A>G (p.His233Arg) rs727503963
NM_000191.3(HMGCL):c.853del (p.Met284_Leu285insTer) rs779339230
NM_000192.3(TBX5):c.1234G>A (p.Val412Ile) rs114124210
NM_000192.3(TBX5):c.787G>A (p.Val263Met) rs147405081
NM_000192.3(TBX5):c.827G>A (p.Ser276Asn) rs147977741
NM_000199.5(SGSH):c.1166A>G (p.Asn389Ser) rs1555620214
NM_000199.5(SGSH):c.1297C>T (p.Arg433Trp) rs777267343
NM_000199.5(SGSH):c.1298G>A (p.Arg433Gln) rs104894641
NM_000199.5(SGSH):c.1A>G (p.Met1Val) rs1250300189
NM_000199.5(SGSH):c.268G>A (p.Gly90Arg) rs774010006
NM_000199.5(SGSH):c.449G>A (p.Arg150Gln) rs104894638
NM_000202.8(IDS):c.1402C>T (p.Arg468Trp) rs199422231
NM_000202.8(IDS):c.253G>A (p.Ala85Thr) rs113993949
NM_000202.8(IDS):c.419-1G>A rs1557339927
NM_000203.5(IDUA):c.1174C>T (p.Leu392=) rs201682298
NM_000203.5(IDUA):c.1487C>G (p.Pro496Arg) rs772416503
NM_000203.5(IDUA):c.235G>A (p.Ala79Thr) rs58037052
NM_000203.5(IDUA):c.246C>G (p.His82Gln) rs148775298
NM_000203.5(IDUA):c.296C>T (p.Thr99Ile) rs147490060
NM_000203.5(IDUA):c.299+6C>T rs147498923
NM_000203.5(IDUA):c.979G>C (p.Ala327Pro) rs199801029
NM_000206.2(IL2RG):c.455T>C (p.Val152Ala) rs193922348
NM_000209.4(PDX1):c.725C>T (p.Pro242Leu) rs193922358
NM_000209.4(PDX1):c.97C>A (p.Pro33Thr) rs192902098
NM_000214.3(JAG1):c.601C>T (p.Arg201Cys) rs794727618
NM_000218.2(KCNQ1):c.160_168dup (p.Ile54_Pro56dup) rs397515877
NM_000218.3(KCNQ1):c.-5T>C rs532941548
NM_000218.3(KCNQ1):c.1179G>T (p.Lys393Asn) rs12720457
NM_000218.3(KCNQ1):c.1394-8C>T rs371488379
NM_000218.3(KCNQ1):c.1552C>T (p.Arg518Ter) rs17215500
NM_000218.3(KCNQ1):c.1800G>A (p.Thr600=) rs147091980
NM_000218.3(KCNQ1):c.513C>T (p.Tyr171=) rs139042529
NM_000218.3(KCNQ1):c.573_577del (p.Arg192fs) rs397508118
NM_000219.6(KCNE1):c.253G>A (p.Asp85Asn) rs1805128
NM_000219.6(KCNE1):c.84G>A (p.Ser28=) rs17173510
NM_000227.5(LAMA3):c.3001C>T (p.Arg1001Ter) rs768415785
NM_000228.3(LAMB3):c.1439C>T (p.Pro480Leu) rs61734494
NM_000228.3(LAMB3):c.1705C>T (p.Arg569Ter) rs201551805
NM_000228.3(LAMB3):c.1903C>T (p.Arg635Ter) rs80356682
NM_000233.4(LHCGR):c.458+3A>G rs76210637
NM_000237.3(LPL):c.1135A>G (p.Thr379Ala) rs300
NM_000237.3(LPL):c.1136C>T (p.Thr379Ile) rs76708715
NM_000237.3(LPL):c.1279G>A (p.Ala427Thr) rs5934
NM_000237.3(LPL):c.213C>G (p.His71Gln) rs11542065
NM_000238.3(KCNH2):c.2617G>A (p.Gly873Ser) rs41314354
NM_000238.3(KCNH2):c.2660G>A (p.Arg887His) rs199473432
NM_000238.3(KCNH2):c.3140G>T (p.Arg1047Leu) rs36210421
NM_000238.4(KCNH2):c.1129-18C>T
NM_000238.4(KCNH2):c.1563C>T (p.Ile521=) rs143011005
NM_000238.4(KCNH2):c.2738C>T (p.Ala913Val) rs77331749
NM_000238.4(KCNH2):c.2750C>T (p.Pro917Leu) rs76420733
NM_000238.4(KCNH2):c.2843G>A (p.Arg948His) rs199473011
NM_000238.4(KCNH2):c.2860C>T (p.Arg954Cys) rs141401803
NM_000238.4(KCNH2):c.3111C>T (p.Asp1037=) rs200799870
NM_000238.4(KCNH2):c.551GCGCGGGCG[1] (p.184GAG[1]) rs551056698
NM_000243.2(MEFV):c.-15C>G rs11466015
NM_000243.2(MEFV):c.124C>T (p.Arg42Trp) rs61754767
NM_000243.2(MEFV):c.1459G>C (p.Val487Leu) rs104895100
NM_000243.2(MEFV):c.1467G>A (p.Gln489=) rs61732424
NM_000243.2(MEFV):c.1518C>T (p.Ile506=) rs104895099
NM_000243.2(MEFV):c.1587+18C>T rs11466030
NM_000243.2(MEFV):c.1759+8C>T rs77380520
NM_000243.2(MEFV):c.1760-4G>A rs79662406
NM_000243.2(MEFV):c.1772T>C (p.Ile591Thr) rs11466045
NM_000243.2(MEFV):c.1894G>A (p.Gly632Ser) rs104895128
NM_000243.2(MEFV):c.1958G>A (p.Arg653His) rs104895085
NM_000243.2(MEFV):c.195C>T (p.Tyr65=) rs104895077
NM_000243.2(MEFV):c.2084A>G rs104895094
NM_000243.2(MEFV):c.2118G>A (p.Pro706=) rs2234939
NM_000243.2(MEFV):c.2230G>T rs61732874
NM_000243.2(MEFV):c.297C>T (p.Asn99=) rs104895175
NM_000243.2(MEFV):c.333G>A (p.Gly111=) rs61732425
NM_000243.2(MEFV):c.372C>T (p.Pro124=) rs104895078
NM_000243.2(MEFV):c.42G>A (p.Glu14=) rs113314808
NM_000243.2(MEFV):c.501G>C (p.Glu167Asp) rs104895079
NM_000243.2(MEFV):c.549G>A (p.Pro183=) rs587781035
NM_000243.2(MEFV):c.586G>T (p.Gly196Trp) rs104895179
NM_000243.2(MEFV):c.800C>T (p.Thr267Ile) rs104895081
NM_000243.2(MEFV):c.910G>A (p.Gly304Arg) rs75977701
NM_000243.2(MEFV):c.911-12G>A rs372016564
NM_000243.2(MEFV):c.97G>T (p.Val33Leu) rs11466016
NM_000243.2(MEFV):c.986G>A (p.Arg329His) rs104895112
NM_000243.3(MEFV):c.1105C>T rs11466023
NM_000243.3(MEFV):c.1223G>A rs11466024
NM_000243.3(MEFV):c.2040G>A rs28940580
NM_000243.3(MEFV):c.2078TGA[1] (p.Met694del) rs104895091
NM_000243.3(MEFV):c.2080A>G rs61752717
NM_000243.3(MEFV):c.2082G>A rs28940578
NM_000243.3(MEFV):c.2177T>C (p.Val726Ala) rs28940579
NM_000243.3(MEFV):c.2282G>A (p.Arg761His) rs104895097
NM_000243.3(MEFV):c.329T>C rs11466018
NM_000243.3(MEFV):c.442G>C rs3743930
NM_000243.3(MEFV):c.585G>A rs200766991
NM_000244.3(MEN1):c.-20G>A rs386134244
NM_000244.3(MEN1):c.1A>G (p.Met1Val) rs386134250
NM_000244.3(MEN1):c.252dup (p.Ile85fs) rs386134253
NM_000245.4(MET):c.1124A>G (p.Asn375Ser) rs33917957
NM_000245.4(MET):c.1306G>C (p.Glu436Gln) rs200740468
NM_000245.4(MET):c.2975C>T (p.Thr992Ile) rs56391007
NM_000245.4(MET):c.504G>T (p.Glu168Asp) rs55985569
NM_000245.4(MET):c.607T>A (p.Ser203Thr) rs200861145
NM_000245.4(MET):c.654G>A (p.Arg218=) rs35284565
NM_000249.3(MLH1):c.1038G>A (p.Gln346=) rs63751715
NM_000249.3(MLH1):c.1050A>G (p.Pro350=) rs137937003
NM_000249.3(MLH1):c.1104G>A (p.Ser368=) rs769364808
NM_000249.3(MLH1):c.1128T>C (p.Asp376=) rs267607824
NM_000249.3(MLH1):c.116+8G>A rs904872305
NM_000249.3(MLH1):c.117-10G>A rs576724240
NM_000249.3(MLH1):c.1269G>A (p.Arg423=) rs373076967
NM_000249.3(MLH1):c.1558+10C>T rs765913871
NM_000249.3(MLH1):c.1558+14G>A rs41562513
NM_000249.3(MLH1):c.1569G>T (p.Glu523Asp) rs63751680
NM_000249.3(MLH1):c.1731+8T>C rs370108219
NM_000249.3(MLH1):c.1744C>T (p.Leu582Phe) rs63751713
NM_000249.3(MLH1):c.1808C>G (p.Pro603Arg) rs63750876
NM_000249.3(MLH1):c.1896+7C>T rs863224339
NM_000249.3(MLH1):c.1964T>C (p.Ile655Thr) rs63751225
NM_000249.3(MLH1):c.1989+1G>T rs267607879
NM_000249.3(MLH1):c.1990-6G>A rs117221851
NM_000249.3(MLH1):c.2084C>A (p.Ser695Ter) rs63749995
NM_000249.3(MLH1):c.2101C>A (p.Gln701Lys) rs63750114
NM_000249.3(MLH1):c.2174G>A (p.Arg725His) rs566928243
NM_000249.3(MLH1):c.24T>A (p.Ile8=) rs748406142
NM_000249.3(MLH1):c.277A>G (p.Ser93Gly) rs41295282
NM_000249.3(MLH1):c.303T>G (p.Gly101=) rs4647220
NM_000249.3(MLH1):c.30G>T (p.Arg10=) rs876660759
NM_000249.3(MLH1):c.380+10T>C rs1553641403
NM_000249.3(MLH1):c.381-41A>G rs4647245
NM_000249.3(MLH1):c.42A>C (p.Thr14=) rs369737664
NM_000249.3(MLH1):c.453+20G>T rs759417195
NM_000249.3(MLH1):c.453+25A>G rs4647246
NM_000249.3(MLH1):c.545+19G>T rs41285099
NM_000249.3(MLH1):c.588+11G>C rs4647258
NM_000249.3(MLH1):c.589-15C>T rs55658850
NM_000249.3(MLH1):c.589-8T>C rs1017112753
NM_000249.3(MLH1):c.69A>G (p.Glu23=) rs63750555
NM_000249.3(MLH1):c.702G>A (p.Glu234=) rs35908749
NM_000249.3(MLH1):c.83C>T (p.Pro28Leu) rs63750792
NM_000249.3(MLH1):c.843A>C (p.Ala281=) rs146796765
NM_000249.3(MLH1):c.884+16A>G rs377598055
NM_000249.3(MLH1):c.954C>T (p.His318=) rs146777069
NM_000249.3(MLH1):c.974G>A (p.Arg325Gln) rs63750268
NM_000249.4(MLH1):c.-7C>T rs104894994
NM_000249.4(MLH1):c.1013A>G (p.Asn338Ser) rs63751467
NM_000249.4(MLH1):c.1040C>A (p.Thr347Asn) rs201541505
NM_000249.4(MLH1):c.1166G>A (p.Arg389Gln) rs63750361
NM_000249.4(MLH1):c.1217G>A (p.Ser406Asn) rs41294980
NM_000249.4(MLH1):c.1360G>C (p.Gly454Arg) rs63750527
NM_000249.4(MLH1):c.1668-19A>G rs9876116
NM_000249.4(MLH1):c.1733A>G (p.Glu578Gly) rs63751612
NM_000249.4(MLH1):c.1742C>T (p.Pro581Leu) rs63751684
NM_000249.4(MLH1):c.1820T>A (p.Leu607His) rs41295284
NM_000249.4(MLH1):c.1959G>T (p.Leu653=) rs1800146
NM_000249.4(MLH1):c.2066A>G (p.Gln689Arg) rs63750702
NM_000249.4(MLH1):c.2152C>T (p.His718Tyr) rs2020873
NM_000249.4(MLH1):c.394G>C (p.Asp132His) rs28930073
NM_000249.4(MLH1):c.649C>T (p.Arg217Cys) rs4986984
NM_000249.4(MLH1):c.655A>G (p.Ile219Val) rs1799977
NM_000249.4(MLH1):c.803A>G (p.Glu268Gly) rs63750650
NM_000249.4(MLH1):c.977T>C (p.Val326Ala) rs63751049
NM_000251.2(MSH2):c.-9G>A rs547444746
NM_000251.2(MSH2):c.1076+12G>C rs755616171
NM_000251.2(MSH2):c.1076G>C (p.Arg359Thr) rs63751604
NM_000251.2(MSH2):c.1077-10T>C rs17224360
NM_000251.2(MSH2):c.1077-7A>G rs370807334
NM_000251.2(MSH2):c.1077-80G>A rs2347794
NM_000251.2(MSH2):c.1121A>G (p.Gln374Arg) rs749660228
NM_000251.2(MSH2):c.115C>A (p.Arg39=) rs786202334
NM_000251.2(MSH2):c.1217G>A (p.Arg406Gln) rs146567853
NM_000251.2(MSH2):c.1255C>A (p.Gln419Lys) rs63750006
NM_000251.2(MSH2):c.1275A>G (p.Glu425=) rs63751650
NM_000251.2(MSH2):c.1276+16G>A rs368120695
NM_000251.2(MSH2):c.1276+7A>G rs748554540
NM_000251.2(MSH2):c.1277-16T>C rs368653974
NM_000251.2(MSH2):c.1311G>T (p.Val437=) rs730881781
NM_000251.2(MSH2):c.1387-4G>C rs376796243
NM_000251.2(MSH2):c.1488A>G (p.Leu496=) rs267607960
NM_000251.2(MSH2):c.1511-1G>A rs267607964
NM_000251.2(MSH2):c.1560A>G (p.Gly520=) rs63750820
NM_000251.2(MSH2):c.1662-10C>T rs752606387
NM_000251.2(MSH2):c.1662-2A>G rs267607971
NM_000251.2(MSH2):c.1666T>C (p.Leu556=) rs61756466
NM_000251.2(MSH2):c.1680T>C (p.Asn560=) rs200056411
NM_000251.2(MSH2):c.1737A>G (p.Lys579=) rs61756467
NM_000251.2(MSH2):c.1827del (p.His610fs) rs587779112
NM_000251.2(MSH2):c.1886A>G (p.Gln629Arg) rs61756468
NM_000251.2(MSH2):c.1915C>T (p.His639Tyr) rs28929484
NM_000251.2(MSH2):c.1963G>A (p.Val655Ile) rs549467183
NM_000251.2(MSH2):c.2021G>A (p.Gly674Asp) rs267607996
NM_000251.2(MSH2):c.211+8C>T rs267607916
NM_000251.2(MSH2):c.2120G>A (p.Cys707Tyr) rs373226409
NM_000251.2(MSH2):c.2154A>G (p.Gln718=) rs63750810
NM_000251.2(MSH2):c.2164G>A (p.Val722Ile) rs587781996
NM_000251.2(MSH2):c.2205C>T (p.Ile735=) rs533553381
NM_000251.2(MSH2):c.2211-6C>A rs267608003
NM_000251.2(MSH2):c.2211-7G>A rs764972956
NM_000251.2(MSH2):c.2271C>T (p.Tyr757=) rs56076152
NM_000251.2(MSH2):c.2335dup (p.Met779fs) rs63750149
NM_000251.2(MSH2):c.2400A>G (p.Leu800=) rs201298777
NM_000251.2(MSH2):c.2425G>A (p.Glu809Lys) rs202145681
NM_000251.2(MSH2):c.2458+10A>G rs1269379998
NM_000251.2(MSH2):c.2458+4T>C rs1038735071
NM_000251.2(MSH2):c.2458+8C>G rs189025757
NM_000251.2(MSH2):c.2580G>T (p.Ser860=) rs752428475
NM_000251.2(MSH2):c.2634+1G>A rs267608019
NM_000251.2(MSH2):c.2634+7C>G rs905179122
NM_000251.2(MSH2):c.301_306del (p.Glu101_Val102del) rs587779157
NM_000251.2(MSH2):c.317G>A (p.Arg106Lys) rs41295286
NM_000251.2(MSH2):c.336C>A (p.Ser112=) rs34312619
NM_000251.2(MSH2):c.366+4A>C rs876659880
NM_000251.2(MSH2):c.367-19A>T rs730881783
NM_000251.2(MSH2):c.499G>C (p.Asp167His) rs63750255
NM_000251.2(MSH2):c.4G>A (p.Ala2Thr) rs63750466
NM_000251.2(MSH2):c.505A>G (p.Ile169Val) rs63750716
NM_000251.2(MSH2):c.557A>G (p.Asn186Ser) rs151129360
NM_000251.2(MSH2):c.642A>G (p.Arg214=) rs768931909
NM_000251.2(MSH2):c.67T>C (p.Phe23Leu) rs372619120
NM_000251.2(MSH2):c.792+5A>G rs267607935
NM_000251.2(MSH2):c.819A>G (p.Val273=) rs146577635
NM_000251.2(MSH2):c.965G>A (p.Gly322Asp) rs4987188
NM_000251.2(MSH2):c.972G>A (p.Gln324=) rs63750505
NM_000251.3(MSH2):c.1168C>T (p.Leu390Phe) rs17224367
NM_000251.3(MSH2):c.1251_1268delinsAGTT (p.Ile418fs) rs863225388
NM_000251.3(MSH2):c.1387-14_1387-11del rs370436680
NM_000251.3(MSH2):c.138C>G (p.His46Gln) rs33946261
NM_000251.3(MSH2):c.1511-9A>T rs12998837
NM_000251.3(MSH2):c.1661+12G>A rs3732183
NM_000251.3(MSH2):c.1690A>G (p.Thr564Ala) rs55778204
NM_000251.3(MSH2):c.1730T>C (p.Ile577Thr) rs63749910
NM_000251.3(MSH2):c.1787A>G (p.Asn596Ser) rs41295288
NM_000251.3(MSH2):c.2006-6T>C rs2303428
NM_000251.3(MSH2):c.211+9C>G rs2303426
NM_000251.3(MSH2):c.273TCT[2] (p.Leu94del) rs267607919
NM_000251.3(MSH2):c.2785C>T (p.Arg929Ter) rs551060742
NM_000251.3(MSH2):c.304G>A (p.Val102Ile) rs193922373
NM_000251.3(MSH2):c.339G>A (p.Lys113=) rs35898375
NM_000251.3(MSH2):c.380A>G (p.Asn127Ser) rs17217772
NM_000251.3(MSH2):c.382C>G (p.Leu128Val) rs145649774
NM_000251.3(MSH2):c.435T>G (p.Ile145Met) rs63750124
NM_000251.3(MSH2):c.55T>C (p.Phe19Leu) rs141711342
NM_000251.3(MSH2):c.815C>T (p.Ala272Val) rs34136999
NM_000251.3(MSH2):c.913G>A (p.Ala305Thr) rs63751454
NM_000252.2(MTM1):c.688T>C (p.Trp230Arg) rs398123274
NM_000253.3(MTTP):c.383T>C (p.Ile128Thr) rs3816873
NM_000253.3(MTTP):c.453T>C (p.Gly151=) rs991811
NM_000253.3(MTTP):c.522T>C (p.Cys174=) rs982424
NM_000253.3(MTTP):c.969T>C (p.Ala323=) rs17533489
NM_000256.3(MYBPC3):c.1286C>T (p.Ala429Val) rs370412052
NM_000256.3(MYBPC3):c.13G>C (p.Gly5Arg) rs201278114
NM_000256.3(MYBPC3):c.1484G>A (p.Arg495Gln) rs200411226
NM_000256.3(MYBPC3):c.1504C>T (p.Arg502Trp) rs375882485
NM_000256.3(MYBPC3):c.1519G>A (p.Gly507Arg) rs35736435
NM_000256.3(MYBPC3):c.1564G>A (p.Ala522Thr) rs11570082
NM_000256.3(MYBPC3):c.1602G>A (p.Ala534=) rs370945942
NM_000256.3(MYBPC3):c.1624G>C (p.Glu542Gln) rs121909374
NM_000256.3(MYBPC3):c.1812C>T (p.Asp604=) rs397515929
NM_000256.3(MYBPC3):c.1831G>A (p.Glu611Lys) rs730880555
NM_000256.3(MYBPC3):c.2490dup (p.His831fs) rs397515966
NM_000256.3(MYBPC3):c.2686G>A (p.Val896Met) rs35078470
NM_000256.3(MYBPC3):c.2870C>G (p.Thr957Ser) rs193922380
NM_000256.3(MYBPC3):c.2997C>T (p.Gly999=) rs377283955
NM_000256.3(MYBPC3):c.3102C>T (p.Ala1034=) rs200663253
NM_000256.3(MYBPC3):c.3106C>T (p.Arg1036Cys) rs61729664
NM_000256.3(MYBPC3):c.3392T>C (p.Ile1131Thr) rs370890951
NM_000256.3(MYBPC3):c.3535G>A (p.Glu1179Lys) rs199669878
NM_000256.3(MYBPC3):c.3628-41_3628-17del rs36212066
NM_000256.3(MYBPC3):c.3815-1G>A rs397516044
NM_000256.3(MYBPC3):c.471C>T (p.Phe157=) rs150291001
NM_000256.3(MYBPC3):c.478C>T (p.Arg160Trp) rs193068692
NM_000256.3(MYBPC3):c.646G>A (p.Ala216Thr) rs201098973
NM_000256.3(MYBPC3):c.649A>G (p.Ser217Gly) rs138753870
NM_000256.3(MYBPC3):c.909-8T>C rs1260212325
NM_000256.3(MYBPC3):c.94G>A (p.Glu32Lys) rs730880575
NM_000256.3(MYBPC3):c.977G>A (p.Arg326Gln) rs34580776
NM_000257.4(MYH7):c.1048T>C (p.Tyr350His) rs730880863
NM_000257.4(MYH7):c.1063G>A (p.Ala355Thr) rs397516088
NM_000257.4(MYH7):c.1408-42del rs45490796
NM_000257.4(MYH7):c.1482T>C (p.Phe494=) rs587781088
NM_000257.4(MYH7):c.1750G>A (p.Gly584Ser) rs121913626
NM_000257.4(MYH7):c.2162+9G>A rs765279420
NM_000257.4(MYH7):c.2360G>A (p.Arg787His) rs376754645
NM_000257.4(MYH7):c.2539A>G (p.Lys847Glu) rs727504310
NM_000257.4(MYH7):c.2606G>A (p.Arg869His) rs202141173
NM_000257.4(MYH7):c.261C>T (p.Ile87=) rs148560996
NM_000257.4(MYH7):c.2631G>C (p.Met877Ile) rs1060505018
NM_000257.4(MYH7):c.2890G>C (p.Val964Leu) rs45496496
NM_000257.4(MYH7):c.2907C>T (p.His969=) rs142573531
NM_000257.4(MYH7):c.2945T>C (p.Met982Thr) rs145532615
NM_000257.4(MYH7):c.297C>T (p.Pro99=) rs140245862
NM_000257.4(MYH7):c.3036C>T (p.Ala1012=) rs145379951
NM_000257.4(MYH7):c.3337G>A (p.Ala1113Thr) rs193922388
NM_000257.4(MYH7):c.3402G>A (p.Lys1134=) rs587781083
NM_000257.4(MYH7):c.3854-5C>T rs752385694
NM_000257.4(MYH7):c.3883G>A (p.Glu1295Lys) rs730880785
NM_000257.4(MYH7):c.3981C>A (p.Asn1327Lys) rs141764279
NM_000257.4(MYH7):c.4135G>A (p.Ala1379Thr) rs397516202
NM_000257.4(MYH7):c.4188G>A (p.Arg1396=) rs200852418
NM_000257.4(MYH7):c.4239G>A (p.Ser1413=) rs3729821
NM_000257.4(MYH7):c.4399C>G (p.Leu1467Val) rs397516214
NM_000257.4(MYH7):c.4806C>T (p.Asp1602=) rs142034311
NM_000257.4(MYH7):c.4911C>T (p.Ala1637=) rs151113658
NM_000257.4(MYH7):c.5135G>A (p.Arg1712Gln) rs193922390
NM_000257.4(MYH7):c.5519T>C (p.Met1840Thr) rs149193520
NM_000257.4(MYH7):c.5559+4C>T rs727504319
NM_000257.4(MYH7):c.633G>A (p.Pro211=) rs587781087
NM_000258.3(MYL3):c.170C>G (p.Ala57Gly) rs139794067
NM_000258.3(MYL3):c.307+15C>T rs184025552
NM_000258.3(MYL3):c.482-14C>A rs201780962
NM_000258.3(MYL3):c.532G>A (p.Asp178Asn) rs145520567
NM_000258.3(MYL3):c.81T>C (p.Pro27=) rs147584015
NM_000262.3(NAGA):c.973G>A (p.Glu325Lys) rs121434529
NM_000263.4(NAGLU):c.1447dup (p.Tyr483fs) rs778021009
NM_000263.4(NAGLU):c.1562C>T (p.Pro521Leu) rs104894595
NM_000263.4(NAGLU):c.1694G>C (p.Arg565Pro) rs104894598
NM_000263.4(NAGLU):c.1900G>A (p.Glu634Lys) rs147036053
NM_000263.4(NAGLU):c.2116C>T (p.Gln706Ter) rs752527478
NM_000263.4(NAGLU):c.384-1G>A rs764134891
NM_000263.4(NAGLU):c.419A>G (p.Tyr140Cys) rs753520553
NM_000264.5(PTCH1):c.-24_-22GGC[5] rs71366293
NM_000264.5(PTCH1):c.2833C>T (p.Arg945Ter) rs1064794260
NM_000264.5(PTCH1):c.3583A>T (p.Thr1195Ser) rs2236405
NM_000264.5(PTCH1):c.3944C>T (p.Pro1315Leu) rs357564
NM_000264.5(PTCH1):c.3947A>G (p.Tyr1316Cys) rs147067171
NM_000264.5(PTCH1):c.4141G>A (p.Val1381Met) rs187104739
NM_000267.3(NF1):c.*4T>C rs201044568
NM_000267.3(NF1):c.2540T>C (p.Leu847Pro) rs199474747
NM_000267.3(NF1):c.2764G>A (p.Gly922Ser) rs1135402831
NM_000267.3(NF1):c.3198-4T>C rs587782218
NM_000267.3(NF1):c.340C>T (p.Leu114=) rs7207410
NM_000267.3(NF1):c.3468C>T (p.Asn1156=) rs147955381
NM_000267.3(NF1):c.354C>T (p.Cys118=) rs768777585
NM_000267.3(NF1):c.3826C>G (p.Arg1276Gly) rs199474742
NM_000267.3(NF1):c.3916C>T (p.Arg1306Ter) rs376576925
NM_000267.3(NF1):c.4686A>G (p.Glu1562=) rs144091165
NM_000267.3(NF1):c.4986C>T (p.Asn1662=) rs140994965
NM_000267.3(NF1):c.5097G>T (p.Glu1699Asp) rs773378630
NM_000267.3(NF1):c.731-6A>C rs369366499
NM_000267.3(NF1):c.7347T>C (p.Asn2449=) rs17881903
NM_000267.3(NF1):c.7491C>G (p.Ala2497=) rs141897690
NM_000267.3(NF1):c.7532C>T (p.Ala2511Val) rs148154172
NM_000271.5(NPC1):c.2819C>T (p.Ser940Leu) rs143124972
NM_000271.5(NPC1):c.2972_2973del (p.Gln991fs) rs756815030
NM_000271.5(NPC1):c.2974G>C (p.Gly992Arg) rs80358254
NM_000271.5(NPC1):c.3019C>G (p.Pro1007Ala) rs80358257
NM_000271.5(NPC1):c.3107C>T (p.Thr1036Met) rs28942104
NM_000271.5(NPC1):c.3175C>T (p.Arg1059Ter) rs786204455
NM_000271.5(NPC1):c.3182T>C (p.Ile1061Thr) rs80358259
NM_000271.5(NPC1):c.3591+1G>A rs786200877
NM_000271.5(NPC1):c.3742_3745del (p.Leu1248fs) rs774943545
NM_000271.5(NPC1):c.395del (p.Pro132fs) rs1057516462
NM_000271.5(NPC1):c.423_424dup (p.Lys142fs) rs773941375
NM_000271.5(NPC1):c.665A>G (p.Asn222Ser) rs55680026
NM_000271.5(NPC1):c.973_974dup (p.Asp325fs) rs886044580
NM_000277.3(PAH):c.1033G>T (p.Ala345Ser) rs62516062
NM_000277.3(PAH):c.1045T>C (p.Ser349Pro) rs62508646
NM_000277.3(PAH):c.1066-3C>T rs62507344
NM_000277.3(PAH):c.1068C>G (p.Tyr356Ter) rs62516095
NM_000277.3(PAH):c.1089del (p.Lys363fs) rs5030654
NM_000277.3(PAH):c.1097C>A (p.Pro366His) rs62516098
NM_000277.3(PAH):c.1099del (p.Leu367fs) rs62506951
NM_000277.3(PAH):c.113TCT[1] (p.Phe39del) rs199475565
NM_000277.3(PAH):c.1157A>G (p.Tyr386Cys) rs62516141
NM_000277.3(PAH):c.1184C>G (p.Ala395Gly) rs62508736
NM_000277.3(PAH):c.1199+1G>C rs62509015
NM_000277.3(PAH):c.1200-1G>A rs62507322
NM_000277.3(PAH):c.1208C>T (p.Ala403Val) rs5030857
NM_000277.3(PAH):c.1242C>T (p.Tyr414=) rs1801152
NM_000277.3(PAH):c.1278T>C (p.Asn426=) rs59326968
NM_000277.3(PAH):c.1315+2T>C rs1799970
NM_000277.3(PAH):c.194T>C (p.Ile65Thr) rs75193786
NM_000277.3(PAH):c.1A>G (p.Met1Val) rs62514891
NM_000277.3(PAH):c.204A>T (p.Arg68Ser) rs76394784
NM_000277.3(PAH):c.241A>C (p.Thr81Pro) rs62509017
NM_000277.3(PAH):c.281TCA[1] (p.Ile95del) rs62508727
NM_000277.3(PAH):c.283A>T (p.Ile95Phe) rs62508682
NM_000277.3(PAH):c.301G>A (p.Asp101Asn) rs1555207979
NM_000277.3(PAH):c.355C>T (p.Pro119Ser) rs398123292
NM_000277.3(PAH):c.434A>T (p.Asp145Val) rs140175796
NM_000277.3(PAH):c.441+1G>A rs62517166
NM_000277.3(PAH):c.441+5G>T rs62507321
NM_000277.3(PAH):c.441+6T>A rs199475698
NM_000277.3(PAH):c.47_48del (p.Leu15_Ser16insTer) rs62642906
NM_000277.3(PAH):c.500A>T (p.Asn167Ile) rs77554925
NM_000277.3(PAH):c.506G>A (p.Arg169His) rs199475679
NM_000277.3(PAH):c.510-2A>G rs1555204750
NM_000277.3(PAH):c.520A>G (p.Ile174Val) rs199475632
NM_000277.3(PAH):c.529G>C (p.Val177Leu) rs199475602
NM_000277.3(PAH):c.556del (p.Thr186fs) rs62507328
NM_000277.3(PAH):c.561G>A (p.Trp187Ter) rs62507336
NM_000277.3(PAH):c.58C>T (p.Gln20Ter) rs199475585
NM_000277.3(PAH):c.592_613del (p.Tyr198fs) rs199475697
NM_000277.3(PAH):c.632C>T (p.Pro211Leu) rs281865443
NM_000277.3(PAH):c.664_665del (p.Glu221_Asp222insTer) rs62514936
NM_000277.3(PAH):c.688G>A (p.Val230Ile) rs62516152
NM_000277.3(PAH):c.707-7A>T rs62508624
NM_000277.3(PAH):c.733G>C (p.Val245Leu) rs62508694
NM_000277.3(PAH):c.740G>T (p.Gly247Val) rs199475579
NM_000277.3(PAH):c.770G>T (p.Gly257Val) rs62642908
NM_000277.3(PAH):c.782G>A (p.Arg261Gln) rs5030849
NM_000277.3(PAH):c.805A>C (p.Ile269Leu) rs62508692
NM_000277.3(PAH):c.806del (p.Ile269fs) rs62508687
NM_000277.3(PAH):c.833C>A (p.Thr278Asn) rs62507262
NM_000277.3(PAH):c.842+1G>A rs5030852
NM_000277.3(PAH):c.842+5G>A rs62516146
NM_000277.3(PAH):c.842C>T (p.Pro281Leu) rs5030851
NM_000277.3(PAH):c.910C>T (p.Gln304Ter) rs1555204295
NM_000277.3(PAH):c.912+1G>A rs62514956
NM_000277.3(PAH):c.913-7A>G rs62517165
NM_000277.3(PAH):c.916A>G (p.Ile306Val) rs62642934
NM_000277.3(PAH):c.932T>C (p.Leu311Pro) rs62642936
NM_000277.3(PAH):c.941C>A (p.Pro314His) rs62642940
NM_000277.3(PAH):c.968_970del (p.Thr323del) rs199475618
NM_000282.4(PCCA):c.1284+1G>A rs752761437
NM_000282.4(PCCA):c.1423A>G (p.Ile475Val) rs35719359
NM_000282.4(PCCA):c.1746G>A (p.Ser582=) rs192171304
NM_000282.4(PCCA):c.229C>T (p.Arg77Trp) rs141371306
NM_000282.4(PCCA):c.231+15C>T rs202049874
NM_000282.4(PCCA):c.437T>C (p.Leu146Pro) rs774457925
NM_000282.4(PCCA):c.722del (p.Gly241fs) rs745571507
NM_000282.4(PCCA):c.937C>T (p.Arg313Ter) rs138149179
NM_000287.4(PEX6):c.1360C>T (p.Gln454Ter) rs1554127491
NM_000287.4(PEX6):c.1802G>A (p.Arg601Gln) rs34324426
NM_000287.4(PEX6):c.1962-1G>A rs267608229
NM_000287.4(PEX6):c.210G>A (p.Gly70=) rs398123304
NM_000287.4(PEX6):c.2364_2365del (p.Phe789Cysfs) rs755716911
NM_000287.4(PEX6):c.2426C>T (p.Ala809Val) rs35830695
NM_000287.4(PEX6):c.2770G>T (p.Ala924Ser) rs34551839
NM_000287.4(PEX6):c.813G>T (p.Ala271=) rs35503676
NM_000288.4(PEX7):c.345T>G (p.Tyr115Ter) rs121909154
NM_000288.4(PEX7):c.618G>A (p.Trp206Ter) rs61753245
NM_000288.4(PEX7):c.649G>A (p.Gly217Arg) rs121909152
NM_000288.4(PEX7):c.653C>T (p.Ala218Val) rs121909151
NM_000288.4(PEX7):c.694C>T (p.Arg232Ter) rs121909153
NM_000288.4(PEX7):c.875T>A (p.Leu292Ter) rs1805137
NM_000288.4(PEX7):c.903+1G>C rs148591292
NM_000303.3(PMM2):c.104T>A (p.Leu35Ter) rs1555448899
NM_000303.3(PMM2):c.109C>T (p.Gln37Ter) rs764353860
NM_000303.3(PMM2):c.131T>C (p.Val44Ala) rs104894534
NM_000303.3(PMM2):c.24del (p.Cys9fs) rs768021123
NM_000303.3(PMM2):c.255+1G>A rs1060499598
NM_000303.3(PMM2):c.255+2T>C rs139716296
NM_000303.3(PMM2):c.26G>A (p.Cys9Tyr) rs104894532
NM_000303.3(PMM2):c.324G>A (p.Ala108=) rs62031146
NM_000303.3(PMM2):c.324del (p.Ile110fs) rs1555449314
NM_000303.3(PMM2):c.338C>T (p.Pro113Leu) rs80338700
NM_000303.3(PMM2):c.357C>A (p.Phe119Leu) rs80338701
NM_000303.3(PMM2):c.368G>A (p.Arg123Gln) rs141498002
NM_000303.3(PMM2):c.385G>A (p.Val129Met) rs104894525
NM_000303.3(PMM2):c.415G>A (p.Glu139Lys) rs80338703
NM_000303.3(PMM2):c.422G>A (p.Arg141His) rs28936415
NM_000303.3(PMM2):c.458T>C (p.Ile153Thr) rs150577656
NM_000303.3(PMM2):c.470T>C (p.Phe157Ser) rs190521996
NM_000303.3(PMM2):c.580C>T (p.Arg194Ter) rs199562225
NM_000303.3(PMM2):c.623G>C (p.Gly208Ala) rs398123309
NM_000303.3(PMM2):c.640-9T>G rs370160676
NM_000303.3(PMM2):c.66+1G>T rs937726878
NM_000303.3(PMM2):c.691G>A (p.Val231Met) rs80338707
NM_000303.3(PMM2):c.710C>G (p.Thr237Arg) rs80338708
NM_000303.3(PMM2):c.710C>T (p.Thr237Met) rs80338708
NM_000303.3(PMM2):c.722G>C (p.Cys241Ser) rs80338709
NM_000303.3(PMM2):c.91T>C (p.Phe31Leu) rs749720760
NM_000310.3(PPT1):c.29T>A (p.Leu10Ter) rs137852699
NM_000310.3(PPT1):c.364A>T (p.Arg122Trp) rs137852695
NM_000310.3(PPT1):c.837G>C (p.Gln279His) rs72937434
NM_000310.3(PPT1):c.871C>T (p.Gln291Ter) rs386833668
NM_000310.4(PPT1):c.541G>A rs148412181
NM_000314.6(PTEN):c.-1059C>G rs144620057
NM_000314.7(PTEN):c.-837C>T rs786201900
NM_000314.7(PTEN):c.-909T>C rs550385924
NM_000314.7(PTEN):c.132C>T (p.Gly44=) rs150651961
NM_000314.7(PTEN):c.321T>C (p.Asp107=) rs372876243
NM_000314.7(PTEN):c.395G>A (p.Gly132Asp) rs121909241
NM_000314.7(PTEN):c.579G>A (p.Leu193=) rs568851024
NM_000314.7(PTEN):c.80-8del rs1060503844
NM_000314.8(PTEN):c.165-24TTTG[2] rs786204877
NM_000314.8(PTEN):c.210-7_210-3del rs587780544
NM_000314.8(PTEN):c.80-1_80del rs1554893747
NM_000314.8(PTEN):c.882T>G (p.Ser294Arg) rs143335584
NM_000321.2(RB1):c.2521-11G>A rs4151624
NM_000321.2(RB1):c.380+12T>C rs3092881
NM_000321.3(RB1):c.920C>T (p.Thr307Ile) rs183898408
NM_000335.5(SCN5A):c.1044C>T (p.Pro348=) rs370346797
NM_000335.5(SCN5A):c.1152C>T (p.Ser384=) rs372970828
NM_000335.5(SCN5A):c.1236C>T (p.Val412=) rs45565936
NM_000335.5(SCN5A):c.1479G>A (p.Arg493=) rs138870926
NM_000335.5(SCN5A):c.1587T>C (p.Ile529=) rs45624133
NM_000335.5(SCN5A):c.1681C>T (p.Leu561=) rs45522138
NM_000335.5(SCN5A):c.1715C>A (p.Ala572Asp) rs36210423
NM_000335.5(SCN5A):c.1734C>T (p.Pro578=) rs200868190
NM_000335.5(SCN5A):c.1844G>A (p.Gly615Glu) rs12720452
NM_000335.5(SCN5A):c.1852C>T (p.Leu618Phe) rs45488304
NM_000335.5(SCN5A):c.1891-8G>A rs12720064
NM_000335.5(SCN5A):c.1967C>T (p.Pro656Leu) rs41313681
NM_000335.5(SCN5A):c.2437-13C>T rs45455099
NM_000335.5(SCN5A):c.2437-5C>A rs72549411
NM_000335.5(SCN5A):c.2440C>T (p.Arg814Trp) rs199473161
NM_000335.5(SCN5A):c.2770G>A (p.Val924Ile) rs199473177
NM_000335.5(SCN5A):c.3068G>A (p.Arg1023His) rs199473592
NM_000335.5(SCN5A):c.3243G>A (p.Val1081=) rs41312407
NM_000335.5(SCN5A):c.3246C>T (p.Ser1082=) rs111422496
NM_000335.5(SCN5A):c.3305C>A (p.Ser1102Tyr) rs7626962
NM_000335.5(SCN5A):c.3360G>A (p.Ala1120=) rs9858585
NM_000335.5(SCN5A):c.3663+10T>C rs200656652
NM_000335.5(SCN5A):c.3748G>A (p.Val1250Met) rs199473600
NM_000335.5(SCN5A):c.3875T>C (p.Phe1292Ser) rs41311127
NM_000335.5(SCN5A):c.4297-14T>C rs56104887
NM_000335.5(SCN5A):c.486C>T (p.Tyr162=) rs45489099
NM_000335.5(SCN5A):c.5199C>T (p.Asn1733=) rs368980118
NM_000335.5(SCN5A):c.5708C>T (p.Ser1903Leu) rs150264233
NM_000335.5(SCN5A):c.6007T>C (p.Phe2003Leu) rs41311117
NM_000335.5(SCN5A):c.6013C>G (p.Pro2005Ala) rs45489199
NM_000335.5(SCN5A):c.647C>T (p.Ser216Leu) rs41276525
NM_000335.5(SCN5A):c.659C>T (p.Thr220Ile) rs45620037
NM_000335.5(SCN5A):c.717C>T (p.Ile239=) rs41285129
NM_000335.5(SCN5A):c.856G>T (p.Ala286Ser) rs61746118
NM_000337.5(SGCD):c.105G>C (p.Leu35=) rs193922392
NM_000337.5(SGCD):c.144G>C (p.Val48=) rs372152495
NM_000337.5(SGCD):c.213G>A (p.Arg71=) rs74846539
NM_000337.5(SGCD):c.402T>C (p.Ala134=) rs190935424
NM_000337.5(SGCD):c.451T>G (p.Ser151Ala) rs121909298
NM_000337.5(SGCD):c.507G>A (p.Ala169=) rs10071079
NM_000337.5(SGCD):c.699+13_699+15del rs397517924
NM_000337.5(SGCD):c.793G>A (p.Val265Ile) rs772185467
NM_000350.3(ABCA4):c.5318C>T (p.Ala1773Val) rs760549861
NM_000352.6(ABCC8):c.1252T>C (p.Cys418Arg) rs67254669
NM_000352.6(ABCC8):c.1920G>A (p.Ala640=) rs146156937
NM_000352.6(ABCC8):c.2506C>T (p.Arg836Ter) rs72559722
NM_000352.6(ABCC8):c.2797C>T (p.Arg933Ter) rs570388861
NM_000352.6(ABCC8):c.2835_2838del (p.Arg946fs) rs1554913069
NM_000352.6(ABCC8):c.4306C>T (p.Arg1436Ter) rs193922402
NM_000352.6(ABCC8):c.563A>G (p.Asn188Ser) rs797045213
NM_000360.4(TH):c.90+7dup rs780485650
NM_000363.5(TNNI3):c.12-7del rs370714315
NM_000363.5(TNNI3):c.244C>T (p.Pro82Ser) rs77615401
NM_000363.5(TNNI3):c.273G>A (p.Ala91=) rs75491697
NM_000363.5(TNNI3):c.372+7C>T rs367809676
NM_000363.5(TNNI3):c.484C>T (p.Arg162Trp) rs368861241
NM_000363.5(TNNI3):c.562G>A (p.Val188Met) rs193922409
NM_000364.3(TNNT2):c.113C>T (p.Ala38Val) rs200754249
NM_000368.4(TSC1):c.1079C>A (p.Thr360Asn) rs118203493
NM_000368.4(TSC1):c.250G>A (p.Ala84Thr) rs118203357
NM_000368.4(TSC1):c.3103G>A (p.Gly1035Ser) rs118203742
NM_000368.4(TSC1):c.346T>G (p.Leu116Val) rs199620268
NM_000368.4(TSC1):c.615T>C (p.Ser205=) rs118203414
NM_000368.5(TSC1):c.1335A>G (p.Glu445=) rs7862221
NM_000368.5(TSC1):c.2829C>T (p.Ala943=) rs4962081
NM_000368.5(TSC1):c.3324C>T rs35593170
NM_000368.5(TSC1):c.965T>C (p.Met322Thr) rs1073123
NM_000370.3(TTPA):c.205-1G>C rs886040963
NM_000370.3(TTPA):c.400C>T (p.Arg134Ter) rs121917851
NM_000370.3(TTPA):c.487del (p.Trp163fs) rs397515378
NM_000370.3(TTPA):c.513_514insTT (p.Thr172fs) rs397515379
NM_000370.3(TTPA):c.744del (p.Glu249fs) rs397515377
NM_000371.3(TTR):c.244G>A (p.Glu82Lys) rs1555631402
NM_000371.3(TTR):c.372C>G (p.Arg124=) rs780119793
NM_000371.3(TTR):c.437A>G (p.Lys146Arg) rs536294863
NM_000371.3(TTR):c.88T>C (p.Cys30Arg) rs121918083
NM_000371.4(TTR):c.328C>A (p.His110Asn) rs121918074
NM_000371.4(TTR):c.371G>A (p.Arg124His) rs121918095
NM_000371.4(TTR):c.417G>A (p.Thr139=) rs2276382
NM_000371.4(TTR):c.421GTC[1] (p.Val142del) rs121918096
NM_000377.2(WAS):c.273+10_273+11dup rs58371799
NM_000382.3(ALDH3A2):c.25_50del (p.Arg9fs) rs767751416
NM_000382.3(ALDH3A2):c.28C>G (p.Gln10Glu) rs72547554
NM_000382.3(ALDH3A2):c.471+1del
NM_000382.3(ALDH3A2):c.472-2A>G
NM_000382.3(ALDH3A2):c.529C>T (p.Arg177Ter) rs72547561
NM_000382.3(ALDH3A2):c.710G>A (p.Cys237Tyr)
NM_000382.3(ALDH3A2):c.901_903delinsCC (p.Ala301fs)
NM_000383.4(AIRE):c.1265del (p.Pro422fs) rs764878471
NM_000383.4(AIRE):c.1404G>A (p.Thr468=) rs7281600
NM_000383.4(AIRE):c.1411C>T (p.Arg471Cys) rs74203920
NM_000383.4(AIRE):c.1566+8C>T rs72650680
NM_000383.4(AIRE):c.1567-5C>T rs192215705
NM_000383.4(AIRE):c.274C>T (p.Arg92Trp) rs140630532
NM_000383.4(AIRE):c.342G>T (p.Lys114Asn) rs142788946
NM_000383.4(AIRE):c.371C>T (p.Pro124Leu) rs193922417
NM_000383.4(AIRE):c.652+14C>T rs41277546
NM_000383.4(AIRE):c.755C>T (p.Pro252Leu) rs34397615
NM_000383.4(AIRE):c.967_979del (p.Leu323fs) rs386833675
NM_000384.3(APOB):c.10520G>C (p.Arg3507Pro) rs201156840
NM_000384.3(APOB):c.10579C>T (p.Arg3527Trp) rs144467873
NM_000384.3(APOB):c.10580G>A (p.Arg3527Gln)
NM_000384.3(APOB):c.10740C>T (p.Asn3580=) rs150312765
NM_000384.3(APOB):c.10780T>C (p.Trp3594Arg)
NM_000387.6(SLC25A20):c.804del (p.Phe269fs) rs753414360
NM_000388.4(CASR):c.3091G>A (p.Gly1031Ser) rs142704083
NM_000391.4(TPP1):c.1076-18A>G rs78676565
NM_000391.4(TPP1):c.1542A>T (p.Gly514=) rs1128396
NM_000391.4(TPP1):c.972_979del (p.Ser324fs) rs778232650
NM_000393.5(COL5A2):c.1081A>C (p.Met361Leu) rs76148000
NM_000393.5(COL5A2):c.1378C>T (p.Pro460Ser) rs35830636
NM_000393.5(COL5A2):c.1535T>C (p.Val512Ala) rs35852101
NM_000393.5(COL5A2):c.3690A>C (p.Thr1230=) rs10197596
NM_000393.5(COL5A2):c.3720T>C (p.Tyr1240=) rs10208525
NM_000393.5(COL5A2):c.568-10G>A rs58106884
NM_000393.5(COL5A2):c.852+14C>T rs56310996
NM_000397.3(CYBB):c.1551T>A (p.Asp517Glu) rs151344452
NM_000397.3(CYBB):c.389G>C (p.Arg130Pro) rs193922448
NM_000397.3(CYBB):c.607G>T (p.Glu203Ter) rs193922449
NM_000397.3(CYBB):c.654C>A (p.Gly218=) rs35080474
NM_000402.4(G6PD):c.466A>G (p.Asn156Asp) rs1050829
NM_000404.4(GLB1):c.29C>T (p.Pro10Leu) rs7637099
NM_000414.4(HSD17B4):c.1369A>T (p.Asn457Tyr) rs137853097
NM_000414.4(HSD17B4):c.1516C>T (p.Arg506Cys) rs766199971
NM_000414.4(HSD17B4):c.2029C>T (p.Gln677Ter) rs751646311
NM_000414.4(HSD17B4):c.46G>A (p.Gly16Ser) rs137853096
NM_000414.4(HSD17B4):c.742C>T (p.Arg248Cys) rs969485098
NM_000414.4(HSD17B4):c.868+1del rs749532705
NM_000432.4(MYL2):c.243G>T (p.Val81=) rs368851472
NM_000432.4(MYL2):c.279G>A (p.Ala93=) rs28645088
NM_000432.4(MYL2):c.342G>A (p.Leu114=) rs199572927
NM_000432.4(MYL2):c.353+12C>A rs186323458
NM_000432.4(MYL2):c.36C>T (p.Gly12=) rs139794370
NM_000432.4(MYL2):c.401A>C (p.Glu134Ala) rs143139258
NM_000441.2(SLC26A4):c.1001G>T (p.Gly334Val) rs146281367
NM_000441.2(SLC26A4):c.716T>A (p.Val239Asp) rs111033256
NM_000441.2(SLC26A4):c.919-2A>G rs111033313
NM_000443.4(ABCB4):c.2800G>A (p.Ala934Thr) rs61730509
NM_000448.2(RAG1):c.1566G>T (p.Trp522Cys) rs193922461
NM_000455.4(STK11):c.-1C>T rs759284466
NM_000455.4(STK11):c.-2G>T rs774072752
NM_000455.4(STK11):c.1039G>A (p.Ala347Thr) rs369744528
NM_000455.4(STK11):c.1041G>A (p.Ala347=) rs537906142
NM_000455.4(STK11):c.1045G>A (p.Glu349Lys) rs553752236
NM_000455.4(STK11):c.1108+3G>A rs755746417
NM_000455.4(STK11):c.1109-4C>T rs1407794756
NM_000455.4(STK11):c.1185A>G (p.Thr395=) rs370207155
NM_000455.4(STK11):c.1190C>T (p.Ala397Val) rs558040549
NM_000455.4(STK11):c.1194G>A (p.Ala398=) rs184271025
NM_000455.4(STK11):c.1257C>T (p.Ser419=) rs375328708
NM_000455.4(STK11):c.1284G>A (p.Ser428=) rs369097329
NM_000455.4(STK11):c.1296G>A (p.Gln432=) rs587781179
NM_000455.4(STK11):c.237C>T (p.Ile79=) rs751859508
NM_000455.4(STK11):c.357C>T (p.Asn119=) rs372511774
NM_000455.4(STK11):c.375-7G>A rs587781176
NM_000455.4(STK11):c.407T>C (p.Met136Thr) rs1060499958
NM_000455.4(STK11):c.426C>T (p.Ser142=) rs758448869
NM_000455.4(STK11):c.464+10C>T rs587782445
NM_000455.4(STK11):c.464+9G>A rs376313955
NM_000455.4(STK11):c.594C>T (p.Ala198=) rs772940660
NM_000455.4(STK11):c.597+8C>T rs565387911
NM_000455.4(STK11):c.598-8C>T rs373610101
NM_000455.4(STK11):c.615G>A (p.Ala205=) rs532889728
NM_000455.4(STK11):c.632G>A (p.Arg211Gln) rs730881982
NM_000455.4(STK11):c.666C>T (p.Pro222=) rs542189325
NM_000455.4(STK11):c.723T>C (p.Ala241=) rs533550278
NM_000455.4(STK11):c.735-10C>T rs553975112
NM_000455.4(STK11):c.735-9G>A rs201899557
NM_000455.4(STK11):c.735C>G (p.Leu245=) rs773147894
NM_000455.4(STK11):c.825G>A (p.Pro275=) rs202011521
NM_000455.4(STK11):c.876C>T (p.Tyr292=) rs148928808
NM_000455.4(STK11):c.910C>T (p.Arg304Trp) rs786201090
NM_000455.4(STK11):c.920+6C>T rs730881964
NM_000455.4(STK11):c.920+7G>A rs2075607
NM_000455.4(STK11):c.920+7G>T rs2075607
NM_000455.4(STK11):c.921-10G>A rs183406870
NM_000455.4(STK11):c.921-9C>T rs761688641
NM_000455.4(STK11):c.970C>G (p.Pro324Ala) rs549474196
NM_000455.5(STK11):c.1038C>T (p.Gly346=) rs767565606
NM_000455.5(STK11):c.1211C>T (p.Ser404Phe) rs200078204
NM_000455.5(STK11):c.1225C>T (p.Arg409Trp) rs368466538
NM_000455.5(STK11):c.559G>A (p.Gly187Ser) rs587782032
NM_000455.5(STK11):c.842C>T (p.Pro281Leu) rs121913322
NM_000455.5(STK11):c.894C>A (p.Phe298Leu) rs199681533
NM_000457.4(HNF4A):c.1203C>T (p.Asn401=) rs61737145
NM_000457.4(HNF4A):c.459T>C (p.Asn153=) rs113308087
NM_000457.4(HNF4A):c.810C>T (p.Asp270=) rs6031592
NM_000458.4(HNF1B):c.1006C>T (p.His336Tyr)
NM_000458.4(HNF1B):c.1045+12T>C rs141166864
NM_000458.4(HNF1B):c.221T>A (p.Leu74Ter)
NM_000458.4(HNF1B):c.345-1G>T
NM_000458.4(HNF1B):c.477del (p.Pro159_Met160insTer)
NM_000458.4(HNF1B):c.949G>T (p.Ala317Ser)
NM_000458.4(HNF1B):c.962A>G (p.Asn321Ser)
NM_000465.4(BARD1):c.1059C>G