ClinVar Miner

Variants with conflicting interpretations "uncertain significance" from EGL Genetic Diagnostics, Eurofins Clinical Diagnostics and "benign" from any submitter

Minimum review status of the submission from EGL Genetic Diagnostics, Eurofins Clinical Diagnostics: Collection method of the submission from EGL Genetic Diagnostics, Eurofins Clinical Diagnostics:
Minimum review status of the other submission: Collection method of the other submission:
ClinVar version:
Total variants with conflicting interpretations: 1333
Download table as spreadsheet
HGVS dbSNP
NM_000026.4(ADSL):c.357+7G>A rs199993991
NM_000026.4(ADSL):c.702-7T>C rs201509960
NM_000026.4(ADSL):c.735A>T (p.Arg245=) rs143977255
NM_000033.4(ABCD1):c.707G>A (p.Arg236His) rs201455322
NM_000038.6(APC):c.1005A>G (p.Leu335=) rs3797704
NM_000038.6(APC):c.2232T>G (p.Ser744=) rs145751759
NM_000038.6(APC):c.6724A>G (p.Ser2242Gly) rs201375478
NM_000047.2(ARSL):c.715G>A (p.Ala239Thr) rs144630754
NM_000051.3(ATM):c.1009C>T (p.Arg337Cys) rs138398778
NM_000051.3(ATM):c.2346A>G (p.Leu782=) rs730881285
NM_000051.3(ATM):c.3014A>G (p.Asn1005Ser) rs146531614
NM_000051.3(ATM):c.6234C>T (p.Ser2078=) rs569483748
NM_000051.3(ATM):c.6919C>T (p.Leu2307Phe) rs56009889
NM_000051.3(ATM):c.8987+3G>A rs56360226
NM_000051.4(ATM):c.1066-6T>G rs201686625
NM_000051.4(ATM):c.3925G>A (p.Ala1309Thr) rs149711770
NM_000051.4(ATM):c.4388T>G (p.Phe1463Cys) rs138327406
NM_000051.4(ATM):c.6988C>G (p.Leu2330Val) rs148432863
NM_000053.4(ATP7B):c.1620C>T (p.Leu540=) rs145798966
NM_000057.4(BLM):c.3625T>A (p.Ser1209Thr) rs1801256
NM_000057.4(BLM):c.3798T>G (p.Val1266=) rs138831180
NM_000059.3(BRCA2):c.1167G>A (p.Pro389=) rs148607710
NM_000059.3(BRCA2):c.4584C>T (p.Ser1528=) rs80359788
NM_000059.3(BRCA2):c.502C>A (p.Pro168Thr) rs80358726
NM_000059.3(BRCA2):c.6143A>T (p.Asn2048Ile) rs80358853
NM_000059.3(BRCA2):c.8573A>G (p.Gln2858Arg) rs80359114
NM_000059.3(BRCA2):c.9270C>T (p.Phe3090=) rs587780873
NM_000059.3(BRCA2):c.9720T>C (p.Val3240=) rs80359810
NM_000059.4(BRCA2):c.1011C>T (p.Asn337=) rs41293473
NM_000059.4(BRCA2):c.175C>G (p.Pro59Ala) rs56091799
NM_000059.4(BRCA2):c.2926_2927delinsAT (p.Ser976Ile) rs276174831
NM_000059.4(BRCA2):c.4614T>C (p.Ser1538=) rs45520945
NM_000059.4(BRCA2):c.5198C>T (p.Ser1733Phe) rs55639415
NM_000059.4(BRCA2):c.6513G>T (p.Val2171=) rs206076
NM_000059.4(BRCA2):c.7504C>T (p.Arg2502Cys) rs55716624
NM_000059.4(BRCA2):c.9875C>T (p.Pro3292Leu) rs56121817
NM_000070.3(CAPN3):c.2051-3C>A rs201294691
NM_000070.3(CAPN3):c.2235C>T (p.Tyr745=) rs147774793
NM_000082.3(ERCC8):c.66G>A (p.Glu22=) rs149130938
NM_000086.2(CLN3):c.1230G>A (p.Ala410=) rs201206239
NM_000086.2(CLN3):c.831G>A (p.Val277=) rs1142183
NM_000087.4(CNGA1):c.1043A>G (p.Lys348Arg) rs140419673
NM_000089.3(COL1A2):c.2904C>T (p.Pro968=) rs142352627
NM_000089.3(COL1A2):c.304C>T (p.Pro102Ser) rs189557655
NM_000091.4(COL4A3):c.3825C>T (p.His1275=) rs143380907
NM_000091.4(COL4A3):c.4421T>C (p.Leu1474Pro) rs200302125
NM_000092.4(COL4A4):c.1776T>C (p.Ala592=) rs188655353
NM_000094.4(COL7A1):c.1907G>T rs116005007
NM_000095.3(COMP):c.763-8T>C rs374063820
NM_000098.3(CPT2):c.1806T>C (p.Phe602=) rs147953465
NM_000124.4(ERCC6):c.2124C>T (p.Ser708=) rs114832108
NM_000124.4(ERCC6):c.2479C>T (p.Leu827=) rs115875661
NM_000124.4(ERCC6):c.3122A>C (p.Gln1041Pro) rs139007661
NM_000124.4(ERCC6):c.438C>T (p.Ser146=) rs138756386
NM_000136.3(FANCC):c.345+4AG[2] rs755657969
NM_000138.4(FBN1):c.2148A>G (p.Gly716=) rs141039922
NM_000138.4(FBN1):c.4998C>T (p.Thr1666=) rs141925790
NM_000138.4(FBN1):c.5964C>T (p.Thr1988=) rs113022801
NM_000138.4(FBN1):c.6852T>C (p.Pro2284=) rs201226058
NM_000138.4(FBN1):c.7902C>T (p.Pro2634=) rs138621371
NM_000138.5(FBN1):c.510C>T (p.Tyr170=) rs111671429
NM_000138.5(FBN1):c.6700G>A (p.Val2234Met) rs112084407
NM_000142.5(FGFR3):c.1497C>T (p.Ala499=) rs140594137
NM_000151.4(G6PC1):c.340+10C>A rs368450665
NM_000163.5(GHR):c.535C>T (p.Arg179Cys) rs121909362
NM_000163.5(GHR):c.686G>A (p.Arg229His) rs6177
NM_000168.6(GLI3):c.1485G>A (p.Glu495=) rs149248727
NM_000179.2(MSH6):c.3246G>A (p.Pro1082=) rs3136351
NM_000193.4(SHH):c.1078C>T (p.Leu360=) rs191903572
NM_000195.5(HPS1):c.198G>A (p.Ser66=) rs115265574
NM_000208.4(INSR):c.2736G>A (p.Arg912=) rs147125937
NM_000208.4(INSR):c.2970G>A (p.Pro990=) rs41304772
NM_000209.4(PDX1):c.543C>T (p.Val181=) rs75498935
NM_000214.3(JAG1):c.1755C>T (p.Asn585=) rs142808131
NM_000214.3(JAG1):c.1826C>T (p.Ser609Leu) rs199505265
NM_000214.3(JAG1):c.1920C>T (p.Asn640=) rs372121353
NM_000214.3(JAG1):c.2329C>T (p.Pro777Ser) rs202063628
NM_000214.3(JAG1):c.2778C>T (p.Phe926=) rs147793030
NM_000214.3(JAG1):c.3329A>C (p.Asn1110Thr) rs150811951
NM_000214.3(JAG1):c.3521C>T (p.Pro1174Leu) rs775363555
NM_000214.3(JAG1):c.3651C>T (p.Ile1217=) rs542831744
NM_000217.3(KCNA1):c.611G>A (p.Arg204His) rs2229000
NM_000218.2(KCNQ1):c.386+14C>T rs370023636
NM_000218.3(KCNQ1):c.-5T>C rs532941548
NM_000227.5(LAMA3):c.4002G>A (p.Arg1334=) rs141472847
NM_000231.2(SGCG):c.579-21_579-20del rs769893030
NM_000238.4(KCNH2):c.1563C>T (p.Ile521=) rs143011005
NM_000238.4(KCNH2):c.3111C>T (p.Asp1037=) rs200799870
NM_000243.2(MEFV):c.1587+33C>G rs146820856
NM_000251.2(MSH2):c.-9G>C rs547444746
NM_000251.2(MSH2):c.1275A>G (p.Glu425=) rs63751650
NM_000251.2(MSH2):c.2400A>G (p.Leu800=) rs201298777
NM_000253.3(MTTP):c.1715A>G (p.Asn572Ser) rs772602972
NM_000253.3(MTTP):c.2025C>T (p.Ile675=) rs79023226
NM_000255.4(MMUT):c.205A>G (p.Ile69Val) rs115923556
NM_000255.4(MMUT):c.393G>A (p.Gln131=) rs145682249
NM_000257.4(MYH7):c.1191G>A (p.Lys397=) rs139506719
NM_000257.4(MYH7):c.2769C>T (p.Asn923=) rs36211716
NM_000257.4(MYH7):c.2945T>C (p.Met982Thr) rs145532615
NM_000257.4(MYH7):c.714C>T (p.Asn238=) rs202141819
NM_000260.4(MYO7A):c.1299C>T (p.Ile433=) rs782163200
NM_000260.4(MYO7A):c.1554+8G>A rs111033227
NM_000260.4(MYO7A):c.3404C>A (p.Ser1135Tyr) rs376688581
NM_000260.4(MYO7A):c.3503+17G>A rs369969967
NM_000260.4(MYO7A):c.3750+9G>A rs111033252
NM_000260.4(MYO7A):c.4441+7C>T rs372493678
NM_000260.4(MYO7A):c.5227C>T (p.Arg1743Trp) rs111033287
NM_000261.2(MYOC):c.366C>T (p.Gly122=) rs145354114
NM_000266.4(NDP):c.11A>T (p.His4Leu) rs149708528
NM_000273.3(GPR143):c.250+11G>C rs375563631
NM_000275.3(OCA2):c.1153T>A (p.Phe385Ile) rs137956605
NM_000275.3(OCA2):c.2293G>A (p.Ala765Thr) rs145968118
NM_000275.3(OCA2):c.45G>A (p.Pro15=) rs202091837
NM_000275.3(OCA2):c.574-19A>G rs145242923
NM_000275.3(OCA2):c.593C>T (p.Pro198Leu) rs183487020
NM_000276.4(OCRL):c.39+10G>A rs765141317
NM_000283.3(PDE6B):c.905G>A (p.Gly302Asp) rs146646008
NM_000288.4(PEX7):c.339+10A>G rs374668045
NM_000310.3(PPT1):c.*6G>A rs113082671
NM_000325.6(PITX2):c.639A>T (p.Ser213=) rs141176394
NM_000326.5(RLBP1):c.141+6G>A rs181321141
NM_000328.3(RPGR):c.1145A>T (p.Asp382Val) rs757714144
NM_000334.4(SCN4A):c.4690G>A (p.Val1564Ile) rs202106192
NM_000334.4(SCN4A):c.5367G>A (p.Ser1789=) rs189230866
NM_000335.5(SCN5A):c.3870G>A (p.Leu1290=) rs41313033
NM_000337.5(SGCD):c.213G>A (p.Arg71=) rs74846539
NM_000337.5(SGCD):c.402T>C (p.Ala134=) rs190935424
NM_000337.5(SGCD):c.510G>A (p.Glu170=) rs368838376
NM_000346.4(SOX9):c.531G>A (p.Arg177=) rs144824678
NM_000350.3(ABCA4):c.1411G>A (p.Glu471Lys) rs1800548
NM_000350.3(ABCA4):c.1532G>A (p.Arg511His) rs140482171
NM_000350.3(ABCA4):c.1932C>T (p.Asp644=) rs117400594
NM_000350.3(ABCA4):c.3759G>A (p.Thr1253=) rs147884766
NM_000350.3(ABCA4):c.4611G>A (p.Thr1537=) rs138475920
NM_000350.3(ABCA4):c.769-3C>T rs368010652
NM_000352.6(ABCC8):c.2610C>T (p.Ala870=) rs111967655
NM_000352.6(ABCC8):c.279C>A (p.Ile93=) rs550990673
NM_000352.6(ABCC8):c.824G>A (p.Arg275Gln) rs185040406
NM_000356.4(TCOF1):c.803A>G (p.Glu268Gly) rs150637771
NM_000368.4(TSC1):c.201A>G (p.Pro67=) rs371555137
NM_000368.4(TSC1):c.2115G>A (p.Glu705=) rs142662480
NM_000368.4(TSC1):c.346T>G (p.Leu116Val) rs199620268
NM_000371.3(TTR):c.384C>T (p.Ala128=) rs143906738
NM_000372.5(TYR):c.1205G>A (p.Arg402Gln) rs1126809
NM_000372.5(TYR):c.504C>T (p.Asn168=) rs148813091
NM_000381.4(MID1):c.1988C>T (p.Thr663Ile) rs138558359
NM_000382.3(ALDH3A2):c.1108-3C>T rs148944691
NM_000388.4(CASR):c.2064C>T (p.Phe688=) rs150869744
NM_000388.4(CASR):c.60C>T (p.Tyr20=) rs201564143
NM_000390.4(CHM):c.1244+8T>A rs369829791
NM_000390.4(CHM):c.957A>G (p.Thr319=) rs373242750
NM_000391.4(TPP1):c.1552-9C>T rs369699167
NM_000391.4(TPP1):c.796C>T (p.Arg266Trp) rs200138397
NM_000392.5(ABCC2):c.3492C>T (p.Ser1164=) rs144192700
NM_000393.5(COL5A2):c.322+8T>C rs372227642
NM_000393.5(COL5A2):c.3471+8A>T rs367643805
NM_000393.5(COL5A2):c.75A>G (p.Lys25=) rs549894501
NM_000399.5(EGR2):c.665T>C (p.Met222Thr) rs530614586
NM_000409.4(GUCA1A):c.142C>T (p.Leu48=) rs35969994
NM_000426.3(LAMA2):c.1621A>G (p.Ser541Gly) rs141363186
NM_000426.3(LAMA2):c.2115T>G (p.Leu705=) rs149753273
NM_000426.3(LAMA2):c.2304C>T (p.Asp768=) rs142126511
NM_000426.3(LAMA2):c.2462C>T (p.Thr821Met) rs117422805
NM_000426.3(LAMA2):c.4487C>T (p.Ala1496Val) rs147077184
NM_000426.3(LAMA2):c.6161A>G (p.Gln2054Arg) rs56035053
NM_000426.3(LAMA2):c.7965C>A (p.Ile2655=) rs141101234
NM_000430.4(PAFAH1B1):c.387T>C (p.Asp129=) rs140936904
NM_000431.4(MVK):c.441C>T (p.Ala147=) rs138342076
NM_000435.3(NOTCH3):c.3569G>A (p.Arg1190His) rs372241697
NM_000443.4(ABCB4):c.3037A>C (p.Arg1013=) rs2230029
NM_000444.6(PHEX):c.1202C>T (p.Pro401Leu) rs145778165
NM_000444.6(PHEX):c.1344C>T (p.Asp448=) rs144911719
NM_000444.6(PHEX):c.2214G>A (p.Thr738=) rs140742016
NM_000451.3(SHOX):c.144G>A (p.Glu48=) rs750638027
NM_000451.3(SHOX):c.702G>A (p.Ala234=) rs576542942
NM_000455.4(STK11):c.357C>T (p.Asn119=) rs372511774
NM_000455.4(STK11):c.579C>T (p.Ser193=) rs730881961
NM_000455.5(STK11):c.1211C>T (p.Ser404Phe) rs200078204
NM_000458.4(HNF1B):c.244G>A (p.Asp82Asn)
NM_000458.4(HNF1B):c.780G>C (p.Glu260Asp)
NM_000460.4(THPO):c.639T>A (p.Thr213=) rs1042348
NM_000478.6(ALPL):c.1002C>T (p.Gly334=) rs370122334
NM_000478.6(ALPL):c.818C>T (p.Thr273Met) rs148405563
NM_000489.5(ATRX):c.5968T>A (p.Ser1990Thr) rs142180002
NM_000492.3(CFTR):c.1312A>G (p.Thr438Ala) rs201434579
NM_000492.3(CFTR):c.1920T>C (p.Phe640=) rs145877746
NM_000492.3(CFTR):c.2245C>T (p.Leu749=) rs151235408
NM_000492.3(CFTR):c.2506G>T (p.Asp836Tyr) rs201386642
NM_000492.3(CFTR):c.2735C>T (p.Ser912Leu) rs121909034
NM_000492.3(CFTR):c.3485G>T (p.Arg1162Leu) rs1800120
NM_000492.3(CFTR):c.91C>T (p.Arg31Cys) rs1800073
NM_000492.4(CFTR):c.1052C>G (p.Thr351Ser) rs1800086
NM_000492.4(CFTR):c.2260G>A (p.Val754Met) rs150157202
NM_000500.9(CYP21A2):c.1439G>T (p.Arg480Leu) rs184649564
NM_000535.7(PMS2):c.383C>T (p.Ser128Leu) rs116373169
NM_000535.7(PMS2):c.830C>A (p.Thr277Lys) rs1805322
NM_000539.3(RHO):c.480C>A (p.Thr160=) rs151063543
NM_000540.2(RYR1):c.10119G>A (p.Val3373=) rs140689610
NM_000540.2(RYR1):c.12879G>C (p.Ala4293=) rs193922854
NM_000540.2(RYR1):c.13680T>C (p.Phe4560=) rs377664510
NM_000540.2(RYR1):c.2121C>A (p.Gly707=) rs146104858
NM_000540.2(RYR1):c.2319C>T (p.Asp773=) rs374924686
NM_000540.2(RYR1):c.271-7C>G rs192495718
NM_000540.2(RYR1):c.3111C>T (p.Ser1037=) rs145434723
NM_000540.2(RYR1):c.7923C>G (p.Leu2641=) rs142558977
NM_000540.2(RYR1):c.9685+16C>T rs45496799
NM_000540.2(RYR1):c.9723C>T (p.Pro3241=) rs199828145
NM_000540.3(RYR1):c.12852CACGGCGGC[3] (p.4285TAA[3]) rs398123469
NM_000540.3(RYR1):c.13513G>C (p.Asp4505His) rs150396398
NM_000542.5(SFTPB):c.403G>A (p.Gly135Ser) rs35373464
NM_000546.5(TP53):c.704A>G (p.Asn235Ser) rs144340710
NM_000548.5(TSC2):c.1860G>A (p.Leu620=) rs45492397
NM_000548.5(TSC2):c.3610+6G>A rs45517301
NM_000548.5(TSC2):c.3723C>T (p.Phe1241=) rs45486193
NM_000548.5(TSC2):c.4077C>T (p.Ile1359=) rs150999168
NM_000548.5(TSC2):c.4493+7C>A rs199943270
NM_000548.5(TSC2):c.5068+9G>A rs45445593
NM_000548.5(TSC2):c.681C>T (p.Cys227=) rs45443205
NM_000551.3(VHL):c.183C>G (p.Pro61=) rs63650860
NM_000601.6(HGF):c.1008G>A (p.Glu336=) rs148714837
NM_000618.5(IGF1):c.207G>A (p.Arg69=) rs147960415
NM_000660.7(TGFB1):c.918C>T (p.Leu306=) rs72480429
NM_000702.4(ATP1A2):c.1092G>A (p.Thr364=) rs55741021
NM_000702.4(ATP1A2):c.2751G>A (p.Thr917=) rs146839867
NM_000702.4(ATP1A2):c.3034+6C>A rs574788908
NM_000719.7(CACNA1C):c.1359C>T (p.Asp453=) rs200330469
NM_000719.7(CACNA1C):c.1468G>A (p.Gly490Arg) rs121912775
NM_000719.7(CACNA1C):c.2280G>A (p.Glu760=) rs141633456
NM_000719.7(CACNA1C):c.3049-10C>T rs186741807
NM_000719.7(CACNA1C):c.3234C>T (p.Asp1078=) rs111606207
NM_000719.7(CACNA1C):c.3531C>T (p.Tyr1177=) rs754527651
NM_000719.7(CACNA1C):c.3780C>A (p.Gly1260=) rs201258230
NM_000719.7(CACNA1C):c.3969C>T (p.Ile1323=) rs201345843
NM_000719.7(CACNA1C):c.4624-8G>A rs529345041
NM_000719.7(CACNA1C):c.4659C>T (p.Asp1553=) rs563090568
NM_000719.7(CACNA1C):c.5214C>A (p.Gly1738=) rs199538058
NM_000719.7(CACNA1C):c.5424G>A (p.Ala1808=) rs587780881
NM_000719.7(CACNA1C):c.5529T>C (p.His1843=) rs371831239
NM_000726.4(CACNB4):c.288C>T (p.Ala96=) rs558998873
NM_000742.4(CHRNA2):c.1530C>T (p.Ile510=) rs149142237
NM_000742.4(CHRNA2):c.745G>A (p.Ala249Thr) rs77710085
NM_000744.6(CHRNA4):c.77-4G>A rs201123897
NM_000744.7(CHRNA4):c.1203G>C (p.Leu401=) rs56142348
NM_000744.7(CHRNA4):c.1560C>T (p.Leu520=) rs142646795
NM_000744.7(CHRNA4):c.1635G>A (p.Thr545=) rs121912283
NM_000744.7(CHRNA4):c.681C>A (p.Ala227=) rs45588436
NM_000748.3(CHRNB2):c.1485C>T (p.Asp495=) rs144813907
NM_000843.4(GRM6):c.1944G>T (p.Ala648=) rs62638619
NM_000843.4(GRM6):c.2610C>T (p.Gly870=) rs61731186
NM_000843.4(GRM6):c.504+20G>C rs572890701
NM_000875.5(IGF1R):c.1956T>G (p.Pro652=) rs45598332
NM_000875.5(IGF1R):c.3187-5C>T rs45495500
NM_000875.5(IGF1R):c.3918C>T (p.Asp1306=) rs34364279
NM_000883.4(IMPDH1):c.624C>G (p.Pro208=) rs758909916
NM_000929.3(PLA2G5):c.312T>C (p.His104=) rs149833360
NM_001004334.4(GPR179):c.2410C>T (p.Arg804Trp) rs201086495
NM_001008388.5(CISD2):c.12G>A (p.Glu4=) rs145312923
NM_001008537.3(NEXMIF):c.133G>A (p.Ala45Thr) rs199960807
NM_001008537.3(NEXMIF):c.2672A>G (p.Asn891Ser) rs186535459
NM_001015877.2(PHF6):c.414C>T (p.Ser138=) rs200423380
NM_001017420.3(ESCO2):c.1013+7A>G rs149494070
NM_001017995.3(SH3PXD2B):c.1063-7G>T rs186443822
NM_001017995.3(SH3PXD2B):c.1602G>A (p.Gly534=) rs144228973
NM_001017995.3(SH3PXD2B):c.2541C>T (p.Ala847=) rs143850475
NM_001029883.3(PCARE):c.1215C>T (p.Gly405=) rs754808908
NM_001029883.3(PCARE):c.2418C>T (p.Pro806=) rs189042259
NM_001029883.3(PCARE):c.3058C>A (p.Gln1020Lys) rs201355503
NM_001029883.3(PCARE):c.3059A>G (p.Gln1020Arg) rs200367963
NM_001035.3(RYR2):c.10231-4T>C rs117180147
NM_001035.3(RYR2):c.10641G>A (p.Thr3547=) rs144256966
NM_001035.3(RYR2):c.12705C>T (p.Phe4235=) rs373606009
NM_001035.3(RYR2):c.3038G>A (p.Arg1013Gln) rs149514924
NM_001035.3(RYR2):c.3180C>T (p.Tyr1060=) rs398123540
NM_001035.3(RYR2):c.5712G>A (p.Leu1904=) rs377763336
NM_001035.3(RYR2):c.8831-9A>C rs187977513
NM_001037.5(SCN1B):c.561C>T (p.Ala187=) rs587781152
NM_001038603.3(MARVELD2):c.1407C>T (p.Tyr469=) rs61736168
NM_001038603.3(MARVELD2):c.898T>A (p.Leu300Met) rs72773422
NM_001039141.3(TRIOBP):c.6472+14G>T rs45503898
NM_001039348.3(EFEMP1):c.146A>C (p.Asp49Ala) rs55849640
NM_001039876.3(SYNE4):c.1102G>A (p.Val368Met) rs141202530
NM_001040142.2(SCN2A):c.100G>A (p.Ala34Thr) rs144814658
NM_001040142.2(SCN2A):c.2019C>G (p.Gly673=) rs587781156
NM_001040142.2(SCN2A):c.3456C>T (p.Ala1152=) rs144325450
NM_001040142.2(SCN2A):c.3457G>A (p.Glu1153Lys) rs200138205
NM_001040142.2(SCN2A):c.3579C>A (p.Leu1193=) rs367546924
NM_001040142.2(SCN2A):c.4257C>T (p.Ala1419=) rs141153302
NM_001040142.2(SCN2A):c.5505C>T (p.Asn1835=) rs6706924
NM_001042413.2(GLIS3):c.232C>G (p.Arg78Gly) rs148168366
NM_001042472.3(ABHD12):c.1113G>A (p.Arg371=) rs146028040
NM_001042472.3(ABHD12):c.787+3G>A rs202150912
NM_001042472.3(ABHD12):c.788-10_788-7del rs565270893
NM_001048166.1(STIL):c.1024-4T>C rs188900275
NM_001048166.1(STIL):c.3581C>T (p.Pro1194Leu) rs144746030
NM_001061.6(TBXAS1):c.1159G>A (p.Glu387Lys) rs3735354
NM_001065.4(TNFRSF1A):c.362G>A (p.Arg121Gln) rs4149584
NM_001072.4(UGT1A6):c.862-6558C>T rs191471887
NM_001077365.2(POMT1):c.1149C>T (p.His383=) rs202121299
NM_001077365.2(POMT1):c.1365+15C>T rs58896330
NM_001077525.3(MTMR14):c.480C>T (p.Asn160=) rs375826804
NM_001079802.2(FKTN):c.681G>A (p.Leu227=) rs142604625
NM_001083961.2(WDR62):c.2976G>A (p.Ser992=) rs757294519
NM_001083961.2(WDR62):c.4159C>A (p.Leu1387Ile) rs147652186
NM_001083961.2(WDR62):c.477G>A (p.Ala159=) rs146485488
NM_001083962.2(TCF4):c.504A>G (p.Val168=) rs370160994
NM_001083962.2(TCF4):c.790-9T>C rs373434281
NM_001089.3(ABCA3):c.2340C>T (p.His780=) rs45620539
NM_001098.3(ACO2):c.220C>G (p.Leu74Val) rs141772938
NM_001105206.3(LAMA4):c.4678C>A (p.Arg1560=) rs150069819
NM_001110219.3(GJB6):c.15G>A (p.Thr5=) rs150075979
NM_001110219.3(GJB6):c.489G>A (p.Leu163=) rs35002004
NM_001110556.2(FLNA):c.1191C>T (p.Ile397=) rs200048692
NM_001110556.2(FLNA):c.1450C>T (p.Arg484Trp) rs61730768
NM_001110556.2(FLNA):c.1691+7C>A rs199565118
NM_001110556.2(FLNA):c.1812C>T (p.Asp604=) rs370735674
NM_001110556.2(FLNA):c.1875C>T (p.Asp625=) rs200660642
NM_001110556.2(FLNA):c.2178C>T (p.Asn726=) rs371501734
NM_001110556.2(FLNA):c.237G>C (p.Ala79=) rs200626788
NM_001110556.2(FLNA):c.3045G>A (p.Ala1015=) rs370868704
NM_001110556.2(FLNA):c.3379G>A (p.Val1127Met) rs398123617
NM_001110556.2(FLNA):c.7092C>A (p.Ile2364=) rs782591917
NM_001110792.2(MECP2):c.1440G>A (p.Arg480=) rs267608633
NM_001110792.2(MECP2):c.564C>G (p.Pro188=) rs61754420
NM_001111125.3(IQSEC2):c.1926G>A (p.Pro642=) rs782748026
NM_001123385.2(BCOR):c.3446C>T (p.Ala1149Val) rs368780561
NM_001123385.2(BCOR):c.4320T>C (p.Pro1440=) rs753786462
NM_001123385.2(BCOR):c.837C>T (p.Leu279=) rs753531268
NM_001127222.2(CACNA1A):c.1395G>A (p.Ser465=) rs374307014
NM_001127222.2(CACNA1A):c.1782-6C>T rs201350764
NM_001127222.2(CACNA1A):c.2687C>G (p.Pro896Arg) rs121908242
NM_001127222.2(CACNA1A):c.2867G>T (p.Arg956Leu) rs551380805
NM_001127222.2(CACNA1A):c.2968GAGGGC[4] (p.990EG[4]) rs764399373
NM_001127222.2(CACNA1A):c.3040G>A (p.Glu1014Lys) rs16024
NM_001127222.2(CACNA1A):c.3309C>T (p.Pro1103=) rs374749004
NM_001127222.2(CACNA1A):c.3531C>A (p.Pro1177=) rs184723350
NM_001127222.2(CACNA1A):c.3531C>G (p.Pro1177=) rs184723350
NM_001127222.2(CACNA1A):c.4221C>T (p.Asp1407=) rs201200430
NM_001127222.2(CACNA1A):c.6630CCA[10] (p.His2219dup) rs759331923
NM_001127453.2(GSDME):c.1122C>T (p.Pro374=) rs138980048
NM_001127644.2(GABRA1):c.1155C>A (p.Gly385=) rs41308303
NM_001127644.2(GABRA1):c.441G>T (p.Arg147=) rs190024862
NM_001127644.2(GABRA1):c.501G>A (p.Pro167=) rs200750234
NM_001127644.2(GABRA1):c.704-10T>C rs188133840
NM_001128840.3(CACNA1D):c.1998G>A (p.Leu666=) rs146747080
NM_001130438.3(SPTAN1):c.2011+10G>A rs377437879
NM_001130438.3(SPTAN1):c.2610A>G (p.Gln870=) rs138101005
NM_001130438.3(SPTAN1):c.6498C>T (p.Arg2166=) rs72758823
NM_001130438.3(SPTAN1):c.7161-8G>A rs202180736
NM_001130438.3(SPTAN1):c.7161-9C>T rs187613754
NM_001130823.3(DNMT1):c.150C>T (p.His50=) rs146112081
NM_001130987.2(DYSF):c.225G>A (p.Thr75=) rs200957354
NM_001130987.2(DYSF):c.3403-10G>A rs116733194
NM_001134363.3(RBM20):c.530C>T (p.Thr177Ile) rs183130427
NM_001134407.3(GRIN2A):c.1354G>A (p.Val452Met) rs145956175
NM_001134407.3(GRIN2A):c.1410T>G (p.Thr470=) rs372058698
NM_001134407.3(GRIN2A):c.2883C>T (p.Asn961=) rs77705198
NM_001134407.3(GRIN2A):c.3827C>G (p.Ala1276Gly) rs145063086
NM_001134407.3(GRIN2A):c.4307A>G (p.Asn1436Ser) rs77029288
NM_001142771.2(PCDH15):c.4717C>T (p.Leu1573=) rs200155519
NM_001142800.2(EYS):c.5335G>A (p.Gly1779Ser) rs186499459
NM_001142800.2(EYS):c.7737T>C (p.Thr2579=) rs191846522
NM_001145809.2(MYH14):c.1115-4C>T rs142696359
NM_001145809.2(MYH14):c.615G>A (p.Thr205=) rs199921330
NM_001148.6(ANK2):c.11538C>T (p.Leu3846=) rs45602336
NM_001148.6(ANK2):c.1773T>C (p.Ser591=) rs374775005
NM_001165963.4(SCN1A):c.3481G>A (p.Ala1161Thr) rs201079458
NM_001165963.4(SCN1A):c.4724G>A (p.Arg1575His) rs368834365
NM_001165963.4(SCN1A):c.4872G>A (p.Leu1624=) rs142910512
NM_001165963.4(SCN1A):c.579C>T (p.Leu193=) rs116478064
NM_001165963.4(SCN1A):c.5951C>A (p.Pro1984His) rs146733308
NM_001165967.2(HES7):c.420G>A (p.Pro140=) rs200833034
NM_001165967.2(HES7):c.591C>T (p.Pro197=) rs558811781
NM_001168409.2(RIMS1):c.-58A>G rs192179523
NM_001170629.2(CHD8):c.456A>G (p.Pro152=) rs61752839
NM_001170629.2(CHD8):c.5390+10A>T rs181227407
NM_001170629.2(CHD8):c.7620C>T (p.Asp2540=) rs367905297
NM_001171.5(ABCC6):c.1263C>T (p.Thr421=) rs114179357
NM_001177316.2(SLC34A3):c.1149C>T (p.Ala383=) rs199536442
NM_001177316.2(SLC34A3):c.1473C>T (p.Tyr491=) rs148095831
NM_001177316.2(SLC34A3):c.375C>T (p.Gly125=) rs142873841
NM_001182.5(ALDH7A1):c.1263G>A (p.Ala421=) rs587780850
NM_001184880.2(PCDH19):c.1209C>T (p.Ser403=) rs372006606
NM_001191061.2(SLC25A22):c.132C>T (p.Arg44=) rs146402942
NM_001191061.2(SLC25A22):c.327G>A (p.Ala109=) rs141975755
NM_001191061.2(SLC25A22):c.413-8G>C rs376015598
NM_001191061.2(SLC25A22):c.414C>T (p.Ala138=) rs199887745
NM_001191061.2(SLC25A22):c.495C>T (p.Ala165=) rs374780430
NM_001191061.2(SLC25A22):c.579G>A (p.Thr193=) rs141430143
NM_001191061.2(SLC25A22):c.585C>T (p.Leu195=) rs147840220
NM_001191061.2(SLC25A22):c.876G>A (p.Ala292=) rs146300431
NM_001193466.2(KANSL1):c.2725-7A>G rs186818985
NM_001194998.2(CEP152):c.344G>A (p.Arg115Gln) rs188101277
NM_001195263.2(PDZD7):c.1348_1350del (p.Glu450del) rs555444131
NM_001195263.2(PDZD7):c.2719-9C>A rs184247824
NM_001199107.2(TBC1D24):c.1327G>A (p.Glu443Lys) rs141399869
NM_001199107.2(TBC1D24):c.1473C>G (p.Pro491=) rs370427146
NM_001199107.2(TBC1D24):c.169C>T (p.Arg57Cys) rs202162520
NM_001199799.2(ILDR1):c.792G>A (p.Pro264=) rs186672543
NM_001201543.2(FAM161A):c.1133T>G (p.Leu378Arg) rs187695569
NM_001201543.2(FAM161A):c.1153C>G (p.Gln385Glu) rs139266382
NM_001201543.2(FAM161A):c.2064T>C (p.Ile688=) rs138464813
NM_001252024.2(TRPM1):c.536C>T (p.Ser179Phe) rs138886378
NM_001256317.3(TMPRSS3):c.1125C>T (p.Tyr375=) rs111033292
NM_001256715.2(DNAAF3):c.323-4del rs201986299
NM_001256789.3(CACNA1F):c.1870G>A (p.Val624Ile) rs141010716
NM_001256789.3(CACNA1F):c.2387-19del rs375791434
NM_001256789.3(CACNA1F):c.3930C>A (p.Ile1310=) rs144131971
NM_001256850.1(TTN):c.32389+5A>C rs373367032
NM_001257180.2(SLC20A2):c.846C>T (p.Asp282=) rs116122164
NM_001267550.2(TTN):c.102271C>T (p.Arg34091Trp) rs140319117
NM_001267550.2(TTN):c.102696C>T (p.Val34232=) rs202180775
NM_001267550.2(TTN):c.102963C>T (p.Asn34321=) rs528502993
NM_001267550.2(TTN):c.104414G>A (p.Arg34805Gln) rs115150240
NM_001267550.2(TTN):c.104457C>T (p.Tyr34819=) rs548677252
NM_001267550.2(TTN):c.106580A>T (p.Glu35527Val) rs55725279
NM_001267550.2(TTN):c.11311+3703A>G rs144226338
NM_001267550.2(TTN):c.12307T>C (p.Leu4103=) rs587780988
NM_001267550.2(TTN):c.14424G>C (p.Val4808=) rs374479775
NM_001267550.2(TTN):c.14535C>T (p.Asp4845=) rs184307461
NM_001267550.2(TTN):c.15563A>C (p.Gln5188Pro) rs72648930
NM_001267550.2(TTN):c.156C>T (p.Pro52=) rs72647842
NM_001267550.2(TTN):c.16056T>C (p.Asp5352=) rs376820575
NM_001267550.2(TTN):c.16716A>G (p.Pro5572=) rs367821526
NM_001267550.2(TTN):c.17928G>A (p.Leu5976=) rs373963067
NM_001267550.2(TTN):c.18379T>G (p.Cys6127Gly) rs370812788
NM_001267550.2(TTN):c.19063G>T (p.Asp6355Tyr) rs188878341
NM_001267550.2(TTN):c.20341G>A (p.Glu6781Lys) rs72648958
NM_001267550.2(TTN):c.20798G>C (p.Gly6933Ala) rs200118743
NM_001267550.2(TTN):c.21002A>G (p.Lys7001Arg) rs200594798
NM_001267550.2(TTN):c.21148C>T (p.Leu7050=) rs202089818
NM_001267550.2(TTN):c.21197A>G (p.Lys7066Arg) rs553548392
NM_001267550.2(TTN):c.21276C>T (p.Thr7092=) rs372264428
NM_001267550.2(TTN):c.21656C>T (p.Ser7219Phe) rs201029552
NM_001267550.2(TTN):c.21668G>A (p.Arg7223His) rs138853909
NM_001267550.2(TTN):c.23029G>A (p.Gly7677Arg) rs367826445
NM_001267550.2(TTN):c.23121G>A (p.Lys7707=) rs72648971
NM_001267550.2(TTN):c.23378-10C>A rs72648975
NM_001267550.2(TTN):c.24964G>T (p.Val8322Leu) rs201571580
NM_001267550.2(TTN):c.25569C>T (p.Ala8523=) rs375022009
NM_001267550.2(TTN):c.26019C>T (p.His8673=) rs370266918
NM_001267550.2(TTN):c.26762-39TTTGT[11] rs71393436
NM_001267550.2(TTN):c.27498G>A (p.Ser9166=) rs372528823
NM_001267550.2(TTN):c.28131C>T (p.Asn9377=) rs72648997
NM_001267550.2(TTN):c.28170C>T (p.Leu9390=) rs149910892
NM_001267550.2(TTN):c.30309T>C (p.Phe10103=) rs762141482
NM_001267550.2(TTN):c.30511+3G>A rs563582627
NM_001267550.2(TTN):c.30718G>T (p.Val10240Phe) rs111671438
NM_001267550.2(TTN):c.31757C>A (p.Pro10586Gln) rs200459347
NM_001267550.2(TTN):c.31762+5_31762+7del rs397517538
NM_001267550.2(TTN):c.33053G>A (p.Arg11018Gln) rs72650034
NM_001267550.2(TTN):c.33732G>A (p.Pro11244=) rs190604150
NM_001267550.2(TTN):c.33827-8C>T rs371318311
NM_001267550.2(TTN):c.33G>A (p.Pro11=) rs138331646
NM_001267550.2(TTN):c.3864T>G (p.Ala1288=) rs368702156
NM_001267550.2(TTN):c.39211+6C>T rs187365142
NM_001267550.2(TTN):c.39689C>T (p.Ala13230Val) rs148140756
NM_001267550.2(TTN):c.41330-7T>A rs373636988
NM_001267550.2(TTN):c.42329T>C (p.Val14110Ala) rs34706299
NM_001267550.2(TTN):c.42687C>T (p.Ala14229=) rs775889693
NM_001267550.2(TTN):c.43161G>A (p.Glu14387=) rs765214404
NM_001267550.2(TTN):c.43260C>T (p.Phe14420=) rs372382546
NM_001267550.2(TTN):c.44281C>T (p.Pro14761Ser) rs192766485
NM_001267550.2(TTN):c.44589G>A (p.Thr14863=) rs369800903
NM_001267550.2(TTN):c.45273C>T (p.Asn15091=) rs72677223
NM_001267550.2(TTN):c.46065G>C (p.Lys15355Asn) rs397517583
NM_001267550.2(TTN):c.47248G>A (p.Val15750Ile) rs72677232
NM_001267550.2(TTN):c.48353A>G (p.Asp16118Gly) rs376273101
NM_001267550.2(TTN):c.48624T>C (p.Pro16208=) rs72677240
NM_001267550.2(TTN):c.48953T>C (p.Ile16318Thr) rs72677243
NM_001267550.2(TTN):c.49032G>A (p.Val16344=) rs587780980
NM_001267550.2(TTN):c.49172G>A (p.Arg16391Gln) rs200944827
NM_001267550.2(TTN):c.49278T>C (p.Ala16426=) rs372633280
NM_001267550.2(TTN):c.49406T>A (p.Leu16469His) rs72677245
NM_001267550.2(TTN):c.50385T>C (p.Gly16795=) rs374672630
NM_001267550.2(TTN):c.50714G>A (p.Arg16905His) rs191539637
NM_001267550.2(TTN):c.51678C>T (p.Asn17226=) rs372635204
NM_001267550.2(TTN):c.51809G>T (p.Ser17270Ile) rs200650668
NM_001267550.2(TTN):c.52656T>C (p.Pro17552=) rs371031259
NM_001267550.2(TTN):c.52890C>T (p.Thr17630=) rs374228930
NM_001267550.2(TTN):c.53226T>C (p.Tyr17742=) rs202200861
NM_001267550.2(TTN):c.5373C>A (p.Thr1791=) rs727503693
NM_001267550.2(TTN):c.54207A>G (p.Pro18069=) rs372686070
NM_001267550.2(TTN):c.54321A>G (p.Ala18107=) rs368021072
NM_001267550.2(TTN):c.5479G>T (p.Ala1827Ser) rs141213991
NM_001267550.2(TTN):c.55659G>A (p.Val18553=) rs368450420
NM_001267550.2(TTN):c.55809G>A (p.Pro18603=) rs750472100
NM_001267550.2(TTN):c.56850G>A (p.Val18950=) rs368068200
NM_001267550.2(TTN):c.57273C>T (p.Asp19091=) rs587780489
NM_001267550.2(TTN):c.59318A>G (p.Glu19773Gly) rs371719028
NM_001267550.2(TTN):c.59344+3G>A rs142095604
NM_001267550.2(TTN):c.62943T>C (p.Thr20981=) rs184863287
NM_001267550.2(TTN):c.63439G>A (p.Ala21147Thr) rs72646853
NM_001267550.2(TTN):c.65276-8T>C rs377484398
NM_001267550.2(TTN):c.65459C>T (p.Thr21820Ile) rs56130023
NM_001267550.2(TTN):c.65534C>T (p.Pro21845Leu) rs201662134
NM_001267550.2(TTN):c.65729T>C (p.Ile21910Thr) rs146941600
NM_001267550.2(TTN):c.66051G>A (p.Val22017=) rs587780981
NM_001267550.2(TTN):c.66123A>G (p.Pro22041=) rs727504190
NM_001267550.2(TTN):c.687T>C (p.Phe229=) rs376527094
NM_001267550.2(TTN):c.69821G>A (p.Gly23274Asp) rs201043950
NM_001267550.2(TTN):c.69903C>A (p.Phe23301Leu) rs372799151
NM_001267550.2(TTN):c.70131A>G (p.Thr23377=) rs369503828
NM_001267550.2(TTN):c.7020C>T (p.Ile2340=) rs587780986
NM_001267550.2(TTN):c.70491C>T (p.Thr23497=) rs372382315
NM_001267550.2(TTN):c.70651C>T (p.Leu23551=) rs72646889
NM_001267550.2(TTN):c.72379G>A (p.Glu24127Lys) rs149763294
NM_001267550.2(TTN):c.72587G>A (p.Arg24196His) rs200317412
NM_001267550.2(TTN):c.74549A>G (p.Asp24850Gly) rs573415766
NM_001267550.2(TTN):c.74596A>G (p.Thr24866Ala) rs199784966
NM_001267550.2(TTN):c.7523A>G (p.His2508Arg) rs146970027
NM_001267550.2(TTN):c.76019T>A (p.Val25340Asp) rs200287703
NM_001267550.2(TTN):c.77043T>C (p.Tyr25681=) rs370810609
NM_001267550.2(TTN):c.77052C>T (p.Gly25684=) rs372543652
NM_001267550.2(TTN):c.77073T>C (p.Asp25691=) rs375398118
NM_001267550.2(TTN):c.78892G>A (p.Gly26298Arg) rs72648205
NM_001267550.2(TTN):c.80553C>T (p.Phe26851=) rs189790119
NM_001267550.2(TTN):c.80554C>T (p.Arg26852Cys) rs185887755
NM_001267550.2(TTN):c.80586C>T (p.Ser26862=) rs748292845
NM_001267550.2(TTN):c.80859G>A (p.Thr26953=) rs771257647
NM_001267550.2(TTN):c.81105C>A (p.Thr27035=) rs72648212
NM_001267550.2(TTN):c.81123G>A (p.Thr27041=) rs181299250
NM_001267550.2(TTN):c.83133G>A (p.Lys27711=) rs369223412
NM_001267550.2(TTN):c.84263G>A (p.Ser28088Asn) rs200450022
NM_001267550.2(TTN):c.84871C>T (p.Arg28291Cys) rs192152102
NM_001267550.2(TTN):c.85248A>T (p.Thr28416=) rs187180708
NM_001267550.2(TTN):c.87771C>A (p.Gly29257=) rs72648230
NM_001267550.2(TTN):c.88028G>A (p.Arg29343His) rs73036368
NM_001267550.2(TTN):c.88721G>A (p.Arg29574His) rs111727915
NM_001267550.2(TTN):c.88972A>G (p.Ile29658Val) rs200193877
NM_001267550.2(TTN):c.8902+14T>A rs13388274
NM_001267550.2(TTN):c.92241T>C (p.Gly30747=) rs373311745
NM_001267550.2(TTN):c.93803A>C (p.Lys31268Thr) rs200766837
NM_001267550.2(TTN):c.9402C>T (p.Asn3134=) rs587780987
NM_001267550.2(TTN):c.94348C>T (p.Arg31450Cys) rs541040798
NM_001267550.2(TTN):c.94623C>T (p.Tyr31541=) rs376539252
NM_001267550.2(TTN):c.95094C>T (p.Ala31698=) rs373509153
NM_001267550.2(TTN):c.95242C>T (p.Arg31748Cys) rs142525903
NM_001267550.2(TTN):c.96684C>T (p.Tyr32228=) rs368423941
NM_001267550.2(TTN):c.96904+4T>C rs373514079
NM_001267550.2(TTN):c.97257T>C (p.Ile32419=) rs373206096
NM_001267550.2(TTN):c.97386C>T (p.Thr32462=) rs376810671
NM_001267550.2(TTN):c.97418G>A (p.Arg32473His) rs397517770
NM_001267550.2(TTN):c.99162G>A (p.Lys33054=) rs368686031
NM_001271208.2(NEB):c.12C>T (p.Asp4=) rs117178114
NM_001271208.2(NEB):c.4272G>C (p.Thr1424=) rs35654397
NM_001277269.1(OTOG):c.6929G>A (p.Arg2310His) rs142799217
NM_001278074.1(COL5A1):c.1383C>T (p.Ile461=) rs61736827
NM_001278074.1(COL5A1):c.1896C>T (p.Phe632=) rs376478864
NM_001278074.1(COL5A1):c.3906+10C>T rs183881247
NM_001278074.1(COL5A1):c.804C>T (p.Gly268=) rs147729713
NM_001278116.2(L1CAM):c.1379+3G>A rs782455321
NM_001278116.2(L1CAM):c.1993C>G (p.Leu665Val) rs199592861
NM_001278116.2(L1CAM):c.2302G>A (p.Val768Ile) rs36021462
NM_001278116.2(L1CAM):c.3192G>T (p.Ser1064=) rs142563956
NM_001278116.2(L1CAM):c.386G>A (p.Arg129Gln) rs200809259
NM_001291867.2(NHS):c.513C>T (p.Leu171=) rs398124610
NM_001291867.2(NHS):c.618G>A (p.Pro206=) rs200952266
NM_001297.5(CNGB1):c.1631C>T (p.Pro544Leu) rs145234666
NM_001305581.2(LRMDA):c.132-253012del rs146123023
NM_001305581.2(LRMDA):c.193C>T (p.Leu65=) rs147768808
NM_001308211.1(EARS2):c.263_264delinsAA (p.Ala88Glu) rs1555504721
NM_001318510.2(ACSL4):c.806+3A>G rs183171123
NM_001323289.2(CDKL5):c.1002T>C (p.Ala334=) rs756986206
NM_001323289.2(CDKL5):c.2388C>T (p.Ser796=) rs727503847
NM_001330078.2(NRXN1):c.105C>A (p.Gly35=) rs55640811
NM_001330078.2(NRXN1):c.1365T>C (p.Leu455=) rs201727684
NM_001330078.2(NRXN1):c.2037G>A (p.Pro679=) rs199714221
NM_001330078.2(NRXN1):c.2730G>A (p.Lys910=) rs192909520
NM_001330078.2(NRXN1):c.2772C>T (p.Tyr924=) rs200182626
NM_001330078.2(NRXN1):c.3045C>T (p.Ala1015=) rs56402642
NM_001330078.2(NRXN1):c.3129A>G (p.Val1043=) rs200698497
NM_001330078.2(NRXN1):c.4254A>G (p.Pro1418=) rs55923848
NM_001330078.2(NRXN1):c.498G>A (p.Ala166=) rs201212909
NM_001330078.2(NRXN1):c.882C>T (p.Tyr294=) rs200464704
NM_001330260.2(SCN8A):c.1819G>A (p.Ala607Thr) rs367949317
NM_001330260.2(SCN8A):c.4155A>C (p.Thr1385=) rs144424662
NM_001354663.2(OPA1):c.-260_-243del rs863224140
NM_001354689.3(RAF1):c.122G>A (p.Arg41Gln) rs145611571
NM_001354689.3(RAF1):c.124_125delinsAT (p.Ala42Ile) rs876657965
NM_001354689.3(RAF1):c.1728+4A>G rs771344560
NM_001354689.3(RAF1):c.639T>C (p.Thr213=) rs397516823
NM_001354712.2(THRB):c.532+8G>C rs146617205
NM_001360016.2(G6PD):c.1458-13C>G rs371772243
NM_001365068.1(ASTN2):c.2806+27659G>A rs572052810
NM_001365536.1(SCN9A):c.4314C>T (p.Val1438=) rs188336294
NM_001366722.1(GRIP1):c.3207C>T (p.Pro1069=) rs187691546
NM_001367624.1(ZNF469):c.2841G>A (p.Arg947=) rs150435442
NM_001367721.1(CASK):c.1315-10A>G rs375004542
NM_001367721.1(CASK):c.1669-8C>G rs201327474
NM_001367721.1(CASK):c.1718C>T (p.Thr573Ile) rs141840001
NM_001367721.1(CASK):c.1922G>A (p.Arg641Lys) rs76106850
NM_001367721.1(CASK):c.2297G>A (p.Arg766Gln) rs137964936
NM_001367721.1(CASK):c.2317+9T>C rs5964007
NM_001367721.1(CASK):c.42G>C (p.Leu14=) rs377590077
NM_001367721.1(CASK):c.891A>G (p.Lys297=) rs544979992
NM_001368397.1(FRMPD4):c.2829C>T (p.Tyr943=) rs140515130
NM_001368397.1(FRMPD4):c.3738C>T (p.His1246=) rs151079505
NM_001368397.1(FRMPD4):c.3937C>A (p.Arg1313=) rs41303149
NM_001374353.1(GLI2):c.1080G>A (p.Ser360=) rs149110951
NM_001376.5(DYNC1H1):c.10887C>T (p.Phe3629=) rs141133453
NM_001453.3(FOXC1):c.279C>T (p.Asn93=) rs141798688
NM_001457.4(FLNB):c.1946G>A (p.Arg649Gln) rs145910735
NM_001457.4(FLNB):c.6000T>C (p.Gly2000=) rs140926445
NM_001457.4(FLNB):c.6843C>T (p.Ile2281=) rs140332932
NM_001457.4(FLNB):c.7254C>T (p.Ser2418=) rs563382903
NM_001458.4(FLNC):c.5644A>G (p.Ile1882Val) rs184018403
NM_001482.3(GATM):c.669T>C (p.Tyr223=) rs151231277
NM_001492.6(GDF1):c.55C>G (p.Leu19Val) rs370986101
NM_001493.3(GDI1):c.1167C>T (p.Pro389=) rs140855833
NM_001499.2(GLE1):c.1641T>C (p.Tyr547=) rs77053118
NM_001558.4(IL10RA):c.72A>C (p.Thr24=) rs560128585
NM_001605.2(AARS1):c.2521-3C>T rs200586605
NM_001614.5(ACTG1):c.1095G>A (p.Ser365=) rs201121917
NM_001692.4(ATP6V1B1):c.815C>T (p.Ala272Val) rs145735762
NM_001793.6(CDH3):c.1704G>A (p.Thr568=) rs561193756
NM_001844.5(COL2A1):c.1176C>T (p.Arg392=) rs201575114
NM_001844.5(COL2A1):c.1300C>T (p.Pro434Ser) rs140985224
NM_001844.5(COL2A1):c.195C>T (p.Asp65=) rs202210896
NM_001844.5(COL2A1):c.3786C>G (p.Leu1262=) rs139114389
NM_001844.5(COL2A1):c.4116C>T (p.Asn1372=) rs150237416
NM_001845.6(COL4A1):c.1466-6C>T rs183563055
NM_001851.5(COL9A1):c.2562T>C (p.Pro854=) rs1135057
NM_001852.4(COL9A2):c.2019G>A (p.Ser673=) rs148008235
NM_001852.4(COL9A2):c.2058C>T (p.Ile686=) rs115675008
NM_001853.4(COL9A3):c.1242C>T (p.Pro414=) rs150153886
NM_001854.4(COL11A1):c.1792-39ATG[11] rs71752747
NM_001854.4(COL11A1):c.2322G>A (p.Lys774=) rs140608161
NM_001854.4(COL11A1):c.3231G>A (p.Pro1077=) rs147247206
NM_001854.4(COL11A1):c.5198G>A (p.Arg1733His) rs140250347
NM_001909.5(CTSD):c.912G>A (p.Pro304=) rs140238987
NM_001927.4(DES):c.1353C>T (p.Ile451=) rs121913002
NM_001953.5(TYMP):c.1290G>A (p.Arg430=) rs570574111
NM_001966.4(EHHADH):c.1608G>A (p.Gly536=) rs141355337
NM_001999.4(FBN2):c.2427T>A (p.Ile809=) rs139686090
NM_001999.4(FBN2):c.3013T>C (p.Leu1005=) rs147633551
NM_001999.4(FBN2):c.3045C>T (p.Pro1015=) rs371640952
NM_001999.4(FBN2):c.3351C>T (p.Asp1117=) rs78484531
NM_001999.4(FBN2):c.4100-9G>T rs377002313
NM_001999.4(FBN2):c.7380C>T (p.Cys2460=) rs147102633
NM_002047.4(GARS1):c.1716G>A (p.Pro572=) rs370608239
NM_002181.4(IHH):c.1051G>A (p.Val351Met) rs143959492
NM_002222.6(ITPR1):c.3849C>T (p.His1283=) rs61757108
NM_002222.6(ITPR1):c.5076C>T (p.Asn1692=) rs61757111
NM_002222.6(ITPR1):c.7770C>T (p.Ile2590=) rs371988852
NM_002241.5(KCNJ10):c.219G>A (p.Ala73=) rs144495959
NM_002241.5(KCNJ10):c.615A>G (p.Lys205=) rs142228240
NM_002335.4(LRP5):c.2124G>A (p.Ser708=) rs140977837
NM_002335.4(LRP5):c.3990G>A (p.Ala1330=) rs147637431
NM_002381.5(MATN3):c.330C>T (p.Ile110=) rs201755444
NM_002397.5(MEF2C):c.1332C>T (p.His444=) rs376439815
NM_002435.3(MPI):c.10C>T (p.Pro4Ser) rs143982014
NM_002471.3(MYH6):c.5652C>T (p.Ala1884=) rs200662317
NM_002471.4(MYH6):c.5400C>T (p.Asp1800=) rs144329079
NM_002472.3(MYH8):c.1209C>A (p.Cys403Ter) rs144321381
NM_002472.3(MYH8):c.5293-1G>A rs144785726
NM_002473.5(MYH9):c.2871C>T (p.Ser957=) rs374840260
NM_002473.6(MYH9):c.3192C>T (p.Ile1064=) rs144807538
NM_002473.6(MYH9):c.4396C>T (p.Arg1466Trp) rs139134727
NM_002473.6(MYH9):c.4878C>T (p.Ile1626=) rs143947828
NM_002473.6(MYH9):c.591G>A (p.Ser197=) rs140241271
NM_002474.3(MYH11):c.3897C>T (p.Ala1299=) rs190546350
NM_002485.4(NBN):c.1089C>T (p.Tyr363=) rs121908974
NM_002485.5(NBN):c.38-10T>A rs556807466
NM_002485.5(NBN):c.511A>G (p.Ile171Val) rs61754966
NM_002485.5(NBN):c.643C>T (p.Arg215Trp) rs34767364
NM_002547.3(OPHN1):c.2029C>A (p.Leu677Met) rs143713841
NM_002691.4(POLD1):c.13C>T (p.Arg5Trp) rs9282830
NM_002691.4(POLD1):c.3054G>A (p.Val1018=) rs369613619
NM_002693.2(POLG):c.1066C>T (p.Leu356=) rs371431444
NM_002693.2(POLG):c.1275C>T (p.Ala425=) rs147404477
NM_002693.2(POLG):c.1386G>A (p.Ser462=) rs62640034
NM_002693.2(POLG):c.2028G>A (p.Ala676=) rs373550219
NM_002693.2(POLG):c.2220C>T (p.Asn740=) rs141538857
NM_002693.2(POLG):c.2481-7C>T rs2307448
NM_002693.2(POLG):c.2487C>T (p.Pro829=) rs147563527
NM_002693.2(POLG):c.2541C>T (p.Ala847=) rs143810171
NM_002693.2(POLG):c.2601T>C (p.Pro867=) rs201749977
NM_002693.2(POLG):c.2724C>T (p.Ala908=) rs377390914
NM_002693.2(POLG):c.3104+8C>A rs754615624
NM_002693.2(POLG):c.3216C>G (p.Thr1072=) rs146936870
NM_002693.2(POLG):c.3424C>T (p.Arg1142Trp) rs2307442
NM_002693.2(POLG):c.3450C>T (p.Ala1150=) rs774880085
NM_002693.2(POLG):c.3482+6C>T rs55779802
NM_002693.2(POLG):c.3482+7G>A rs200309191
NM_002693.2(POLG):c.3652C>T (p.Leu1218=) rs146301349
NM_002693.2(POLG):c.578G>A (p.Arg193Gln) rs3176162
NM_002693.2(POLG):c.798G>T (p.Val266=) rs143631183
NM_002693.2(POLG):c.970C>T (p.Pro324Ser) rs2307437
NM_002693.2(POLG):c.975C>A (p.Pro325=) rs551973680
NM_002739.5(PRKCG):c.1524C>A (p.Pro508=) rs115736276
NM_002743.3(PRKCSH):c.416G>A (p.Arg139His) rs139991238
NM_002834.5(PTPN11):c.48A>G (p.Ala16=) rs372736227
NM_002878.3(RAD51D):c.568G>A (p.Ala190Thr) rs80116829
NM_002878.3(RAD51D):c.919G>A (p.Glu307Lys) rs115031549
NM_002900.3(RBP3):c.1514A>T (p.His505Leu) rs201808774
NM_002900.3(RBP3):c.63C>T (p.His21=) rs146038948
NM_002979.5(SCP2):c.1469-10T>C rs761545816
NM_002979.5(SCP2):c.900C>T (p.Asp300=) rs148423275
NM_003036.4(SKI):c.216C>T (p.Pro72=) rs756778048
NM_003036.4(SKI):c.798C>T (p.Ala266=) rs149642284
NM_003073.5(SMARCB1):c.444C>T (p.Ser148=) rs138184483
NM_003119.4(SPG7):c.1083G>A (p.Ala361=) rs114135540
NM_003159.2(CDKL5):c.2797+1193C>T rs183092299
NM_003165.4(STXBP1):c.1320C>T (p.Ile440=) rs370249358
NM_003165.4(STXBP1):c.1404C>A (p.Ile468=) rs777499631
NM_003179.2(SYP):c.612G>A (p.Ser204=) rs145093168
NM_003179.2(SYP):c.687C>T (p.Ala229=) rs201427270
NM_003193.5(TBCE):c.394G>A (p.Val132Ile) rs144448831
NM_003193.5(TBCE):c.585C>T (p.Ser195=) rs139440109
NM_003361.3(UMOD):c.1406C>T (p.Thr469Met) rs143583842
NM_003392.4(WNT5A):c.417C>T (p.Tyr139=) rs371576999
NM_003482.3(KMT2D):c.2551C>T (p.Leu851=) rs186151848
NM_003482.3(KMT2D):c.2847G>A (p.Pro949=) rs369436545
NM_003482.3(KMT2D):c.4986C>T (p.Cys1662=) rs143063879
NM_003482.3(KMT2D):c.7109G>C (p.Arg2370Pro) rs373234419
NM_003482.3(KMT2D):c.840-6C>T rs182926808
NM_003482.4(KMT2D):c.11738AGC[8] (p.Gln3919dup) rs576788910
NM_003490.4(SYN3):c.711+5658G>A rs149161075
NM_003611.3(OFD1):c.276T>C (p.Ser92=) rs201675886
NM_003611.3(OFD1):c.54A>G (p.Glu18=) rs147114577
NM_003640.5(ELP1):c.3280A>G (p.Arg1094Gly) rs146440397
NM_003673.3(TCAP):c.270G>A (p.Pro90=) rs372538567
NM_003673.4(TCAP):c.132C>T (p.Asp44=) rs397516861
NM_003673.4(TCAP):c.60C>G (p.Ala20=) rs146502276
NM_003722.5(TP63):c.504C>T (p.Asn168=) rs141278696
NM_003722.5(TP63):c.678C>T (p.Arg226=) rs61732782
NM_003742.4(ABCB11):c.1248C>A (p.Ile416=) rs183390670
NM_003742.4(ABCB11):c.1404T>A (p.Ile468=) rs34200464
NM_003742.4(ABCB11):c.156G>A (p.Arg52=) rs140587295
NM_003742.4(ABCB11):c.174C>T (p.Asp58=) rs11568362
NM_003742.4(ABCB11):c.2036C>T (p.Ala679Val) rs200912109
NM_003742.4(ABCB11):c.2811A>T (p.Gly937=) rs192375476
NM_003742.4(ABCB11):c.2927A>G (p.Gln976Arg) rs199940188
NM_003742.4(ABCB11):c.3214-6C>G rs750991541
NM_003742.4(ABCB11):c.3548T>C (p.Ile1183Thr) rs143484849
NM_003742.4(ABCB11):c.408C>T (p.Ser136=) rs183214630
NM_003839.4(TNFRSF11A):c.1254T>G (p.Ser418=) rs34966542
NM_003839.4(TNFRSF11A):c.1340C>T (p.Thr447Ile) rs776173779
NM_003846.3(PEX11B):c.374+9T>C rs200094067
NM_003846.3(PEX11B):c.483A>G (p.Gly161=) rs148000769
NM_003865.3(HESX1):c.525G>A (p.Ala175=) rs141063672
NM_003919.3(SGCE):c.606A>G (p.Thr202=) rs148979783
NM_004004.6(GJB2):c.*1C>T rs111033327
NM_004006.2(DMD):c.10262+1G>A rs145603325
NM_004006.2(DMD):c.1731A>T (p.Glu577Asp) rs150199251
NM_004006.2(DMD):c.2457A>C (p.Leu819=) rs72468680
NM_004006.2(DMD):c.31+36949C>T rs182597890
NM_004006.2(DMD):c.3419A>G (p.His1140Arg) rs201297190
NM_004006.2(DMD):c.4072-3T>C rs751657094
NM_004006.2(DMD):c.5181A>T (p.Ile1727=) rs200887855
NM_004006.2(DMD):c.821A>G (p.Tyr274Cys) rs745868830
NM_004006.2(DMD):c.8226A>G (p.Gln2742=) rs746514008
NM_004006.2(DMD):c.9165G>A (p.Thr3055=) rs137905486
NM_004006.2(DMD):c.9479G>A (p.Arg3160His) rs771392678
NM_004100.5(EYA4):c.866C>T (p.Thr289Met) rs41286200
NM_004183.4(BEST1):c.624G>A (p.Gln208=) rs150247275
NM_004187.5(KDM5C):c.1794C>T (p.Pro598=) rs35353912
NM_004187.5(KDM5C):c.465C>T (p.Ser155=) rs138520224
NM_004287.4(GOSR2):c.29+8C>T rs573306680
NM_004320.5(ATP2A1):c.663C>G (p.Gly221=) rs113803159
NM_004321.7(KIF1A):c.3027G>A (p.Ala1009=) rs200149062
NM_004321.7(KIF1A):c.3042C>G (p.Ala1014=) rs370286749
NM_004333.6(BRAF):c.138+17C>G rs756400234
NM_004369.3(COL6A3):c.7702C>T (p.Leu2568=) rs201479636
NM_004369.3(COL6A3):c.9508G>A (p.Gly3170Arg) rs568632361
NM_004380.3(CREBBP):c.2950A>T (p.Asn984Tyr) rs140406003
NM_004380.3(CREBBP):c.5829G>A (p.Pro1943=) rs546554430
NM_004385.5(VCAN):c.5859G>T (p.Thr1953=) rs80028865
NM_004385.5(VCAN):c.6902T>G (p.Phe2301Cys) rs160278
NM_004385.5(VCAN):c.927T>C (p.Thr309=) rs536465380
NM_004403.3(GSDME):c.823A>G (p.Ile275Val) rs149956122
NM_004407.4(DMP1):c.1107C>T (p.Asp369=) rs147451774
NM_004407.4(DMP1):c.815G>A (p.Arg272His) rs145237146
NM_004415.4(DSP):c.88G>A (p.Val30Met) rs121912998
NM_004447.6(EPS8):c.1638C>T (p.Asn546=) rs149455769
NM_004452.3(ESRRB):c.351G>A (p.Val117=) rs141586518
NM_004463.3(FGD1):c.1563C>T (p.Pro521=) rs201996522
NM_004463.3(FGD1):c.2289G>A (p.Lys763=) rs150865566
NM_004463.3(FGD1):c.2816A>C (p.Glu939Ala) rs147012050
NM_004463.3(FGD1):c.440G>A (p.Arg147His) rs200707592
NM_004519.4(KCNQ3):c.1935A>G (p.Gln645=) rs587781011
NM_004519.4(KCNQ3):c.2462A>G (p.Asn821Ser) rs118192254
NM_004519.4(KCNQ3):c.954C>A (p.Gly318=) rs143224896
NM_004527.4(MEOX1):c.126G>A (p.Pro42=) rs141693578
NM_004530.6(MMP2):c.759C>T (p.Ser253=) rs148801200
NM_004595.5(SMS):c.661-5C>T rs371972467
NM_004595.5(SMS):c.978G>A (p.Ser326=) rs150564614
NM_004608.3(TBX6):c.353+9C>A rs369603655
NM_004608.3(TBX6):c.408C>T (p.Arg136=) rs149724027
NM_004608.3(TBX6):c.585C>T (p.Val195=) rs148435229
NM_004612.4(TGFBR1):c.528G>A (p.Thr176=) rs190878719
NM_004625.4(WNT7A):c.213C>T (p.Asp71=) rs75651130
NM_004625.4(WNT7A):c.555C>T (p.Asn185=) rs149363953
NM_004625.4(WNT7A):c.861G>A (p.Val287=) rs149962459
NM_004698.4(PRPF3):c.1032A>G (p.Thr344=) rs143350315
NM_004727.3(SLC24A1):c.1131C>T (p.Thr377=) rs199504782
NM_004727.3(SLC24A1):c.2778C>T (p.Pro926=) rs117685425
NM_004817.4(TJP2):c.185C>T (p.Thr62Met) rs138241615
NM_004817.4(TJP2):c.2751C>T (p.Arg917=) rs184519036
NM_004820.5(CYP7B1):c.1464G>A (p.Leu488=) rs114797034
NM_004820.5(CYP7B1):c.94G>T (p.Ala32Ser) rs181854355
NM_004836.7(EIF2AK3):c.3153C>T (p.Tyr1051=) rs56120877
NM_004977.2(KCNC3):c.23C>G (p.Ser8Trp) rs761806977
NM_004984.4(KIF5A):c.1419G>A (p.Leu473=) rs139091551
NM_004994.3(MMP9):c.1896C>T (p.Leu632=) rs202160464
NM_004999.4(MYO6):c.3530G>A (p.Arg1177His) rs139664153
NM_005006.7(NDUFS1):c.1291C>G (p.Leu431Val) rs78042826
NM_005045.4(RELN):c.474-7T>C rs55693709
NM_005045.4(RELN):c.6141C>T (p.Phe2047=) rs79161241
NM_005045.4(RELN):c.7114G>A (p.Val2372Met) rs114344654
NM_005068.2(SIM1):c.279C>T (p.Phe93=) rs145361258
NM_005097.4(LGI1):c.600C>T (p.Cys200=) rs148862146
NM_005097.4(LGI1):c.717A>C (p.Ile239=) rs146425212
NM_005120.3(MED12):c.3797G>A (p.Arg1266His) rs587780391
NM_005120.3(MED12):c.5400+6C>T rs192656109
NM_005249.5(FOXG1):c.1086G>A (p.Leu362=) rs570981209
NM_005249.5(FOXG1):c.1323C>T (p.Ser441=) rs144434028
NM_005249.5(FOXG1):c.256C>A (p.Gln86Lys) rs398124202
NM_005249.5(FOXG1):c.326C>T (p.Pro109Leu) rs398124203
NM_005249.5(FOXG1):c.594C>G (p.Pro198=) rs141088742
NM_005333.5(HCCS):c.521C>T (p.Ala174Val) rs367601527
NM_005359.6(SMAD4):c.565C>T (p.Arg189Cys) rs140743238
NM_005379.4(MYO1A):c.2724+7G>A rs55985817
NM_005477.3(HCN4):c.1356C>T (p.Ser452=) rs148453034
NM_005506.4(SCARB2):c.445G>A (p.Val149Met) rs147159813
NM_005506.4(SCARB2):c.486C>T (p.Ala162=) rs143518519
NM_005522.4(HOXA1):c.684A>G (p.Gln228=) rs34462126
NM_005529.7(HSPG2):c.10512C>T (p.His3504=) rs55875654
NM_005529.7(HSPG2):c.11475C>T (p.Ile3825=) rs111866498
NM_005529.7(HSPG2):c.12874G>A (p.Glu4292Lys) rs141280063
NM_005529.7(HSPG2):c.13018G>A (p.Val4340Met) rs145687082
NM_005529.7(HSPG2):c.3707C>A (p.Ala1236Glu) rs113652076
NM_005559.4(LAMA1):c.5867A>G (p.Asn1956Ser) rs117433399
NM_005559.4(LAMA1):c.6354C>T (p.Val2118=) rs150849018
NM_005559.4(LAMA1):c.8447G>A (p.Arg2816Gln) rs200996196
NM_005562.3(LAMC2):c.1318A>G (p.Ile440Val) rs147889360
NM_005562.3(LAMC2):c.1899G>C (p.Leu633=) rs141812464
NM_005591.3(MRE11):c.1798G>C (p.Glu600Gln) rs145415033
NM_005603.6(ATP8B1):c.1014C>T (p.Asn338=) rs145750280
NM_005603.6(ATP8B1):c.150A>G (p.Glu50=) rs137973298
NM_005603.6(ATP8B1):c.2928G>A (p.Ala976=) rs201803908
NM_005609.4(PYGM):c.1092+6dup rs368602234
NM_005633.3(SOS1):c.*4C>T rs188849286
NM_005633.3(SOS1):c.2511-9dup rs727503436
NM_005633.3(SOS1):c.3391+7A>G rs201982464
NM_005670.4(EPM2A):c.129C>G (p.Ala43=) rs547147183
NM_005670.4(EPM2A):c.24G>A (p.Val8=) rs587780938
NM_005676.5(RBM10):c.1104A>G (p.Pro368=) rs149109733
NM_005751.4(AKAP9):c.10767G>A (p.Leu3589=) rs56198613
NM_005751.4(AKAP9):c.8286A>C (p.Lys2762Asn) rs144875383
NM_005802.5(TOPORS):c.2525C>A (p.Thr842Asn) rs139859703
NM_005802.5(TOPORS):c.2547A>G (p.Ser849=) rs150650712
NM_005876.5(SPEG):c.116T>C (p.Val39Ala) rs565137573
NM_005881.4(BCKDK):c.1066A>T (p.Ser356Cys) rs142542453
NM_005902.4(SMAD3):c.207-10G>A rs201912204
NM_005902.4(SMAD3):c.885G>A (p.Arg295=) rs139616052
NM_005982.4(SIX1):c.330G>A (p.Arg110=) rs73309461
NM_006005.3(WFS1):c.1597C>T (p.Pro533Ser) rs146132083
NM_006005.3(WFS1):c.1760G>A (p.Arg587Gln) rs71539657
NM_006005.3(WFS1):c.2424C>T (p.Ser808=) rs56035336
NM_006009.4(TUBA1A):c.4-7C>T rs560491477
NM_006017.3(PROM1):c.103G>C (p.Glu35Gln) rs200290535
NM_006017.3(PROM1):c.134A>G (p.Asp45Gly) rs201559220
NM_006017.3(PROM1):c.879C>T (p.Ser293=) rs148242593
NM_006019.4(TCIRG1):c.197-5C>T rs183885218
NM_006031.6(PCNT):c.8889G>A (p.Ser2963=) rs151325202
NM_006037.3(HDAC4):c.681C>T (p.His227=) rs148880349
NM_006059.4(LAMC3):c.2517G>A (p.Thr839=) rs140540789
NM_006059.4(LAMC3):c.4092C>T (p.Ser1364=) rs141724499
NM_006059.4(LAMC3):c.4146G>C (p.Arg1382Ser) rs147092908
NM_006086.4(TUBB3):c.357G>A (p.Val119=) rs34174718
NM_006204.4(PDE6C):c.2037-7T>C rs181296577
NM_006204.4(PDE6C):c.2082G>A (p.Met694Ile) rs150112560
NM_006208.3(ENPP1):c.1791T>C (p.Asn597=) rs548504035
NM_006208.3(ENPP1):c.2757A>T (p.Pro919=) rs73541508
NM_006261.4(PROP1):c.52G>A (p.Gly18Ser) rs775353413
NM_006269.2(RP1):c.228C>T (p.Leu76=) rs142600056
NM_006269.2(RP1):c.4299A>G (p.Ala1433=) rs148918111
NM_006269.2(RP1):c.6024A>G (p.Lys2008=) rs147680018
NM_006329.3(FBLN5):c.621T>C (p.Asp207=) rs200178859
NM_006343.3(MERTK):c.1261C>T (p.Arg421Trp) rs142985827
NM_006343.3(MERTK):c.2593C>T (p.Arg865Trp) rs2230516
NM_006343.3(MERTK):c.773C>A (p.Ala258Glu) rs35252762
NM_006343.3(MERTK):c.960+9C>A rs373198570
NM_006348.5(COG5):c.15C>G (p.Gly5=) rs202123650
NM_006359.3(SLC9A6):c.141C>T (p.Gly47=) rs139299794
NM_006363.6(SEC23B):c.773A>G (p.Gln258Arg) rs534770840
NM_006383.4(CIB2):c.231G>A (p.Ala77=) rs144346527
NM_006393.3(NEBL):c.604G>A (p.Gly202Arg) rs137973321
NM_006416.5(SLC35A1):c.7G>T (p.Ala3Ser) rs149903512
NM_006420.3(ARFGEF2):c.3892G>A (p.Gly1298Ser) rs139037316
NM_006420.3(ARFGEF2):c.4462A>T (p.Thr1488Ser) rs151221957
NM_006420.3(ARFGEF2):c.807C>T (p.Asp269=) rs149172723
NM_006445.4(PRPF8):c.306C>T (p.Leu102=) rs113874709
NM_006445.4(PRPF8):c.4524C>T (p.Gly1508=) rs144851263
NM_006445.4(PRPF8):c.5352C>T (p.Asn1784=) rs141456140
NM_006445.4(PRPF8):c.6792G>A (p.Ser2264=) rs369391284
NM_006516.3(SLC2A1):c.258C>T (p.Phe86=) rs147319894
NM_006516.3(SLC2A1):c.276-7T>C rs369273744
NM_006516.3(SLC2A1):c.498C>T (p.Val166=) rs150971143
NM_006516.3(SLC2A1):c.679+4C>T rs139492241
NM_006516.3(SLC2A1):c.777C>T (p.Ile259=) rs78388808
NM_006516.3(SLC2A1):c.894C>T (p.Phe298=) rs140825318
NM_006516.3(SLC2A1):c.906G>T (p.Gly302=) rs55693364
NM_006516.3(SLC2A1):c.972+7del rs531385270
NM_006516.3(SLC2A1):c.987G>A (p.Glu329=) rs201989024
NM_006517.5(SLC16A2):c.1596C>T (p.Ser532=) rs199904356
NM_006517.5(SLC16A2):c.412C>G (p.Gln138Glu) rs145061343
NM_006662.3(SRCAP):c.7248C>T (p.Ser2416=) rs138152469
NM_006790.2(MYOT):c.1275A>G (p.Ala425=) rs140678912
NM_006790.2(MYOT):c.342C>T (p.Ser114=) rs34593399
NM_006920.6(SCN1A):c.2011-13dup rs549232924
NM_006920.6(SCN1A):c.694+10A>G rs373417440
NM_006922.4(SCN3A):c.1381-4A>G rs199597878
NM_006922.4(SCN3A):c.2003G>A (p.Gly668Glu) rs199975643
NM_006922.4(SCN3A):c.363T>C (p.Ala121=) rs145171998
NM_006922.4(SCN3A):c.4899T>A (p.Arg1633=) rs748935500
NM_006922.4(SCN3A):c.642G>A (p.Ala214=) rs575814709
NM_006941.3(SOX10):c.574G>A (p.Gly192Ser) rs200475773
NM_006941.4(SOX10):c.72C>T (p.Ser24=) rs763019569
NM_006941.4(SOX10):c.753G>A (p.Ser251=) rs376907937
NM_006946.3(SPTBN2):c.1456G>A (p.Ala486Thr) rs143155918
NM_006946.3(SPTBN2):c.157+5G>A rs150159444
NM_006946.3(SPTBN2):c.1719C>T (p.His573=) rs148207416
NM_006950.3(SYN1):c.1107C>T (p.Ile369=) rs150248483
NM_006950.3(SYN1):c.1569G>A (p.Ala523=) rs587781185
NM_007055.4(POLR3A):c.1771-5del rs544204280
NM_007078.3(LDB3):c.896+6722G>A rs144445130
NM_007254.4(PNKP):c.1491C>T (p.Ala497=) rs116192442
NM_007254.4(PNKP):c.501G>A (p.Val167=) rs142143566
NM_007254.4(PNKP):c.519C>T (p.Asp173=) rs144284975
NM_007254.4(PNKP):c.672C>T (p.Arg224=) rs151180981
NM_007294.3(BRCA1):c.4097-10G>A rs80358057
NM_007294.3(BRCA1):c.81-13C>G rs56328013
NM_007294.4(BRCA1):c.1866G>A (p.Ala622=) rs1800064
NM_007294.4(BRCA1):c.2002C>T (p.Leu668Phe) rs80357250
NM_007294.4(BRCA1):c.2315T>C (p.Val772Ala) rs80357467
NM_007294.4(BRCA1):c.2368A>G (p.Thr790Ala) rs41286298
NM_007294.4(BRCA1):c.3657G>C (p.Glu1219Asp) rs80356876
NM_007294.4(BRCA1):c.425C>A (p.Pro142His) rs55971303
NM_007294.4(BRCA1):c.548-9del rs273902774
NM_007294.4(BRCA1):c.824G>A (p.Gly275Asp) rs397509327
NM_007317.3(KIF22):c.1619A>T (p.Gln540Leu) rs148628152
NM_007373.3(SHOC2):c.38A>C (p.Glu13Ala) rs730881018
NM_012144.4(DNAI1):c.81+5del rs200411544
NM_012193.4(FZD4):c.1194T>C (p.Tyr398=) rs147766472
NM_012208.4(HARS2):c.7C>G (p.Leu3Val) rs186043734
NM_012224.3(NEK1):c.1081-15dup rs398124255
NM_012232.6(CAVIN1):c.168C>A (p.Ser56Arg) rs139531639
NM_012301.4(MAGI2):c.2142G>A (p.Pro714=) rs144574076
NM_012418.4(FSCN2):c.492C>T (p.Asp164=) rs370382419
NM_012463.4(ATP6V0A2):c.2229T>C (p.Cys743=) rs150508296
NM_012469.4(PRPF6):c.1368G>A (p.Ala456=) rs139828718
NM_012469.4(PRPF6):c.1797G>A (p.Arg599=) rs145483312
NM_013296.5(GPSM2):c.2043G>A (p.Ser681=) rs140949805
NM_013382.5(POMT2):c.1404A>G (p.Lys468=) rs150491326
NM_013382.5(POMT2):c.1701C>G (p.Pro567=) rs151051452
NM_014000.3(VCL):c.1555A>C (p.Ile519Leu) rs141033098
NM_014014.5(SNRNP200):c.3897C>G (p.Thr1299=) rs144934076
NM_014014.5(SNRNP200):c.4935G>A (p.Val1645=) rs375650263
NM_014014.5(SNRNP200):c.5520C>G (p.Thr1840=) rs368225080
NM_014014.5(SNRNP200):c.6093-7C>A rs201143866
NM_014014.5(SNRNP200):c.6369C>T (p.Ser2123=) rs61753580
NM_014112.5(TRPS1):c.2976G>A (p.Pro992=) rs201030937
NM_014141.6(CNTNAP2):c.1140T>A (p.Ala380=) rs141439475
NM_014141.6(CNTNAP2):c.1455T>C (p.Asn485=) rs370095062
NM_014141.6(CNTNAP2):c.1777+7G>A rs770951811
NM_014141.6(CNTNAP2):c.2292C>T (p.His764=) rs143286960
NM_014141.6(CNTNAP2):c.237C>T (p.Ser79=) rs145162968
NM_014141.6(CNTNAP2):c.2508T>C (p.Phe836=) rs149185385
NM_014141.6(CNTNAP2):c.2609T>C (p.Val870Ala) rs138481453
NM_014141.6(CNTNAP2):c.273T>C (p.Asn91=) rs773595457
NM_014141.6(CNTNAP2):c.3522A>T (p.Gly1174=) rs141078449
NM_014141.6(CNTNAP2):c.3600G>A (p.Ser1200=) rs117876038
NM_014141.6(CNTNAP2):c.3678C>T (p.Ser1226=) rs201219937
NM_014141.6(CNTNAP2):c.3741A>C (p.Pro1247=) rs141772824
NM_014141.6(CNTNAP2):c.3927C>T (p.Ala1309=) rs143856702
NM_014141.6(CNTNAP2):c.755-5C>T rs369675346
NM_014251.3(SLC25A13):c.1354G>A (p.Val452Ile) rs143877538
NM_014254.3(RXYLT1):c.252C>T (p.Ser84=) rs141095352
NM_014319.5(LEMD3):c.862C>G (p.Arg288Gly) rs144086377
NM_014363.6(SACS):c.10668G>A (p.Leu3556=) rs139517699
NM_014363.6(SACS):c.1373C>T (p.Thr458Ile) rs61729954
NM_014363.6(SACS):c.1917A>G (p.Ala639=) rs138457742
NM_014363.6(SACS):c.4076T>C (p.Met1359Thr) rs146451611
NM_014363.6(SACS):c.8022T>C (p.Phe2674=) rs34928783
NM_014363.6(SACS):c.8339T>G (p.Phe2780Cys) rs111540787
NM_014363.6(SACS):c.9852A>G (p.Thr3284=) rs147506904
NM_014467.3(SRPX2):c.840G>A (p.Ala280=) rs139377205
NM_014780.4(CUL7):c.2229C>G (p.Ala743=) rs188565648
NM_014780.4(CUL7):c.3432G>A (p.Thr1144=) rs144556973
NM_014780.4(CUL7):c.4659G>A (p.Glu1553=) rs139243761
NM_014795.4(ZEB2):c.1542G>T (p.Pro514=) rs141674976
NM_014795.4(ZEB2):c.2766A>T (p.Pro922=) rs185223937
NM_014845.5(FIG4):c.2097-10C>G rs142482745
NM_014874.3(MFN2):c.1403G>A (p.Arg468His) rs138382758
NM_014874.3(MFN2):c.1641C>T (p.Leu547=) rs140924661
NM_014874.3(MFN2):c.756C>T (p.Asn252=) rs137960129
NM_014927.5(CNKSR2):c.1458A>G (p.Arg486=) rs760890681
NM_014927.5(CNKSR2):c.2199G>A (p.Thr733=) rs113091231
NM_014989.5(RIMS1):c.1533G>A (p.Pro511=) rs201473375
NM_014989.5(RIMS1):c.2699-8T>C rs149883454
NM_014989.5(RIMS1):c.3399-4A>G rs368216570
NM_014989.5(RIMS1):c.4506-5G>A rs201556693
NM_015102.5(NPHP4):c.2807C>T (p.Thr936Met) rs201074950
NM_015120.4(ALMS1):c.1456A>G (p.Ile486Val) rs73945001
NM_015120.4(ALMS1):c.8448A>G (p.Ser2816=) rs137932254
NM_015175.2(NBEAL2):c.1948G>A (p.Gly650Arg) rs201373710
NM_015175.2(NBEAL2):c.7658G>A (p.Gly2553Glu) rs144664865
NM_015295.2(SMCHD1):c.2151G>A (p.Ala717=) rs372945746
NM_015295.2(SMCHD1):c.2838T>C (p.Ala946=) rs375251871
NM_015295.2(SMCHD1):c.306G>A (p.Ser102=) rs7229488
NM_015295.2(SMCHD1):c.424+10C>T rs201631086
NM_015311.3(OBSL1):c.1599G>A (p.Thr533=) rs149009269
NM_015311.3(OBSL1):c.2466C>T (p.Ser822=) rs146306059
NM_015311.3(OBSL1):c.4588C>T (p.Leu1530=) rs201893489
NM_015404.4(WHRN):c.1365T>C (p.Ser455=) rs111033459
NM_015404.4(WHRN):c.1627-5T>A rs187221008
NM_015506.3(MMACHC):c.848G>T (p.Ter283Leu) rs201025783
NM_015560.2(OPA1):c.1923G>A (p.Ala641=) rs138114609
NM_015560.2(OPA1):c.2256G>T (p.Leu752=) rs148047706
NM_015560.2(OPA1):c.756C>T (p.Asp252=) rs147242797
NM_015629.4(PRPF31):c.527+9G>T rs376994481
NM_015850.4(FGFR1):c.1092G>A (p.Pro364=) rs56174879
NM_016008.4(DYNC2LI1):c.508-4G>A rs201151187
NM_016203.4(PRKAG2):c.1098A>G (p.Pro366=) rs116541276
NM_016219.5(MAN1B1):c.1800C>T (p.Thr600=) rs146417316
NM_016239.4(MYO15A):c.4033A>T (p.Ile1345Leu) rs201234482
NM_016239.4(MYO15A):c.4623G>A (p.Thr1541=) rs926074
NM_016239.4(MYO15A):c.54G>A (p.Lys18=) rs144909486
NM_016239.4(MYO15A):c.6186C>A (p.Ala2062=) rs141475629
NM_016247.4(IMPG2):c.534-13dup rs567795716
NM_016418.5(NF2):c.1123-6C>T rs147898623
NM_016729.3(FOLR1):c.157T>C (p.Leu53=) rs143413500
NM_016729.3(FOLR1):c.508G>A (p.Ala170Thr) rs139633601
NM_017547.4(FOXRED1):c.9G>A (p.Arg3=) rs28372779
NM_017617.5(NOTCH1):c.2734C>T (p.Arg912Trp) rs201620358
NM_017653.5(DYM):c.288-10G>A rs557407004
NM_017653.5(DYM):c.946+7G>A rs150849326
NM_017739.3(POMGNT1):c.1596T>C (p.Asn532=) rs200730202
NM_017739.3(POMGNT1):c.421-7C>A rs189274856
NM_017739.3(POMGNT1):c.486A>G (p.Leu162=) rs138330966
NM_017780.4(CHD7):c.2751G>A (p.Thr917=) rs369429961
NM_017780.4(CHD7):c.4437G>A (p.Gly1479=) rs41265246
NM_017780.4(CHD7):c.5439C>T (p.Pro1813=) rs373869399
NM_017780.4(CHD7):c.6771C>T (p.Pro2257=) rs367615733
NM_017780.4(CHD7):c.6822T>C (p.Ala2274=) rs61743849
NM_017882.3(CLN6):c.270C>T (p.Asn90=) rs145247814
NM_017890.4(VPS13B):c.10819A>G (p.Ile3607Val) rs145547375
NM_018006.5(TRMU):c.351T>C (p.Asn117=) rs117710834
NM_018006.5(TRMU):c.772+8G>A rs201372242
NM_018129.4(PNPO):c.723C>G (p.Ser241=) rs144362146
NM_018136.5(ASPM):c.9276T>C (p.Gly3092=) rs151142538
NM_018136.5(ASPM):c.933C>G (p.Ser311Arg) rs563858170
NM_018136.5(ASPM):c.9657T>G (p.Ser3219=) rs756879923
NM_018139.2(DNAAF2):c.1953A>G (p.Pro651=) rs34352773
NM_018328.4(MBD5):c.276A>G (p.Ala92=) rs141855494
NM_018699.3(PRDM5):c.1283-5C>T rs185134294
NM_018941.3(CLN8):c.522C>T (p.Cys174=) rs148417620
NM_018965.3(TREM2):c.259G>A (p.Asp87Asn) rs142232675
NM_018965.3(TREM2):c.677-6T>C rs199910080
NM_019066.5(MAGEL2):c.1175C>T (p.Thr392Met) rs781777662
NM_019066.5(MAGEL2):c.1286C>T (p.Pro429Leu) rs2233061
NM_019066.5(MAGEL2):c.1344ACCCGTGATCCGCCAGGCCCC[1] (p.442PVIRQAP[2]) rs794726941
NM_019066.5(MAGEL2):c.1404CCCACCTGTGATCCGCCAGGC[1] (p.464VIRQAPP[3]) rs1386125417
NM_019066.5(MAGEL2):c.1470G>A (p.Pro490=) rs771501846
NM_019066.5(MAGEL2):c.406G>A (p.Gly136Arg) rs570335069
NM_019066.5(MAGEL2):c.939CCCACCTGCACAGCCGATGGC[1] (p.314PPAQPMA[1]) rs528108868
NM_019098.4(CNGB3):c.1510A>G (p.Thr504Ala) rs140286824
NM_019098.4(CNGB3):c.2007A>G (p.Lys669=) rs147991883
NM_020066.5(FMN2):c.883T>C (p.Ser295Pro) rs201538863
NM_020433.4(JPH2):c.1380G>A (p.Ala460=) rs531877510
NM_020436.5(SALL4):c.2376T>C (p.Asn792=) rs143601538
NM_020451.3(SELENON):c.427GAG[5] (p.Glu146dup) rs141295085
NM_020451.3(SELENON):c.729G>A (p.Pro243=) rs139020143
NM_020661.4(AICDA):c.48A>G (p.Lys16=) rs186739900
NM_020822.3(KCNT1):c.2142G>A (p.Leu714=) rs370580872
NM_020822.3(KCNT1):c.2214G>A (p.Pro738=) rs142424896
NM_020822.3(KCNT1):c.3256G>A (p.Gly1086Arg) rs201156458
NM_020822.3(KCNT1):c.474G>A (p.Ser158=) rs139076605
NM_020822.3(KCNT1):c.942C>T (p.Thr314=) rs144766991
NM_020822.3(KCNT1):c.99A>G (p.Gln33=) rs146152956
NM_020956.2(PRX):c.*1779T>C rs149715830
NM_021098.3(CACNA1H):c.4039-4G>A rs57315342
NM_021101.5(CLDN1):c.195A>G (p.Lys65=) rs145197251
NM_021625.4(TRPV4):c.1491+10C>T rs201815805
NM_021625.4(TRPV4):c.2304G>C (p.Ser768=) rs138986228
NM_021830.5(TWNK):c.384C>T (p.Ser128=) rs148234280
NM_021939.3(FKBP10):c.174A>G (p.Glu58=) rs150052125
NM_022067.4(VIPAS39):c.1254T>C (p.Asn418=) rs188105111
NM_022067.4(VIPAS39):c.1455C>A (p.Ser485Arg) rs145453157
NM_022067.4(VIPAS39):c.972C>T (p.Arg324=) rs147303718
NM_022095.4(ZNF335):c.2280G>A (p.Gln760=) rs148186790
NM_022124.6(CDH23):c.2830A>G (p.Ser944Gly) rs188098974
NM_022124.6(CDH23):c.2940G>A (p.Thr980=) rs373631099
NM_022124.6(CDH23):c.330C>T (p.His110=) rs201232514
NM_022124.6(CDH23):c.3361A>T (p.Ile1121Phe) rs200542052
NM_022124.6(CDH23):c.3801C>T (p.Thr1267=) rs56107171
NM_022124.6(CDH23):c.4488+7C>T rs374215303
NM_022124.6(CDH23):c.5130C>A (p.Ile1710=) rs111033487
NM_022124.6(CDH23):c.5722G>A (p.Val1908Ile) rs368828743
NM_022124.6(CDH23):c.6169A>G (p.Ile2057Val) rs573057228
NM_022124.6(CDH23):c.6648C>T (p.Ala2216=) rs186394654
NM_022124.6(CDH23):c.8167G>C (p.Val2723Leu) rs142857685
NM_022124.6(CDH23):c.9670C>T (p.Arg3224Trp) rs111033457
NM_022367.4(SEMA4A):c.84G>A (p.Thr28=) rs149711133
NM_022436.3(ABCG5):c.80G>C (p.Gly27Ala) rs56204478
NM_022437.3(ABCG8):c.1093A>G (p.Thr365Ala) rs114404835
NM_022437.3(ABCG8):c.1201A>T (p.Thr401Ser) rs144200355
NM_022437.3(ABCG8):c.1411+8T>A rs201991639
NM_022437.3(ABCG8):c.1924G>A (p.Ala642Thr) rs113005049
NM_022437.3(ABCG8):c.870C>T (p.Thr290=) rs117221284
NM_022455.4(NSD1):c.3088T>C (p.Leu1030=) rs61756006
NM_022455.4(NSD1):c.3150C>T (p.Thr1050=) rs144257298
NM_022455.4(NSD1):c.5520A>G (p.Glu1840=) rs140815139
NM_022455.4(NSD1):c.7597C>G (p.Leu2533Val) rs398124386
NM_022464.5(SIL1):c.1167C>T (p.Pro389=) rs199890503
NM_022464.5(SIL1):c.573G>A (p.Lys191=) rs148927511
NM_022464.5(SIL1):c.984C>T (p.Leu328=) rs368666457
NM_022567.2(NYX):c.1203G>A (p.Pro401=) rs139558261
NM_023036.6(DNAI2):c.754G>A (p.Val252Met) rs140326154
NM_023073.3(CPLANE1):c.3828T>C (p.Leu1276=) rs145520487
NM_024009.3(GJB3):c.547G>A (p.Glu183Lys) rs74315318
NM_024105.4(ALG12):c.1155C>T (p.Pro385=) rs113652023
NM_024120.5(NDUFAF5):c.585T>C (p.Tyr195=) rs150955045
NM_024301.5(FKRP):c.567C>T (p.Pro189=) rs201454433
NM_024408.4(NOTCH2):c.4312G>A (p.Val1438Ile) rs745861610
NM_024408.4(NOTCH2):c.5074A>G (p.Ile1692Val) rs143134864
NM_024408.4(NOTCH2):c.5103A>G (p.Lys1701=) rs201233415
NM_024422.6(DSC2):c.1914G>C (p.Gln638His) rs147742157
NM_024426.6(WT1):c.1131T>C (p.Pro377=) rs151034312
NM_024577.3(SH3TC2):c.3686A>T (p.Asp1229Val) rs146920285
NM_024577.3(SH3TC2):c.3795G>C (p.Leu1265=) rs144873879
NM_024596.5(MCPH1):c.1349A>C (p.Lys450Thr) rs77959215
NM_024596.5(MCPH1):c.1458A>G (p.Lys486=) rs192003514
NM_024596.5(MCPH1):c.1480G>A (p.Ala494Thr) rs183880522
NM_024596.5(MCPH1):c.90A>G (p.Thr30=) rs139678787
NM_024747.6(HPS6):c.2250G>A (p.Ser750=) rs139161525
NM_024757.5(EHMT1):c.1135A>G (p.Lys379Glu) rs146711478
NM_024757.5(EHMT1):c.3555C>T (p.Tyr1185=) rs398124407
NM_024809.5(TCTN2):c.-2G>A rs141768405
NM_025009.5(CEP135):c.1740A>G (p.Arg580=) rs59759676
NM_025074.7(FRAS1):c.108+10T>G rs76831011
NM_025074.7(FRAS1):c.39G>A (p.Ala13=) rs773457837
NM_025074.7(FRAS1):c.7029+7G>A rs183687186
NM_025074.7(FRAS1):c.9627C>T (p.Tyr3209=) rs377369857
NM_025193.4(HSD3B7):c.234C>T (p.Ala78=) rs143699328
NM_025219.3(DNAJC5):c.153G>T (p.Pro51=) rs151265913
NM_025243.4(SLC19A3):c.*8G>A rs188532608
NM_025265.4(TSEN2):c.560G>C (p.Arg187Pro) rs146117200
NM_030665.4(RAI1):c.4043C>T (p.Ala1348Val) rs143396390
NM_030665.4(RAI1):c.834GCA[17] (p.Gln288_Gln291dup) rs371983878
NM_030777.4(SLC2A10):c.515C>T (p.Thr172Ile) rs143301610
NM_030973.3(MED25):c.135-6T>G rs199743509
NM_030973.3(MED25):c.396C>T (p.Arg132=) rs142353864
NM_031220.4(PITPNM3):c.987G>A (p.Leu329=) rs148451236
NM_031407.7(HUWE1):c.3082A>G (p.Thr1028Ala) rs145758265
NM_031407.7(HUWE1):c.3663G>A (p.Ser1221=) rs142126065
NM_031427.4(DNAL1):c.517C>T (p.Leu173=) rs35284335
NM_032119.4(ADGRV1):c.10149C>T (p.Ser3383=) rs376298949
NM_032119.4(ADGRV1):c.10563T>C (p.Leu3521=) rs200946170
NM_032119.4(ADGRV1):c.15608A>G (p.Glu5203Gly) rs202106463
NM_032119.4(ADGRV1):c.15786C>T (p.Phe5262=) rs369083434
NM_032119.4(ADGRV1):c.1776C>A (p.Val592=) rs184127858
NM_032119.4(ADGRV1):c.1849G>A (p.Val617Met) rs199988872
NM_032119.4(ADGRV1):c.2112G>A (p.Pro704=) rs182990046
NM_032119.4(ADGRV1):c.4214C>T (p.Ser1405Phe) rs41305898
NM_032119.4(ADGRV1):c.6994A>T (p.Ile2332Phe) rs193030567
NM_032119.4(ADGRV1):c.8730+9_8730+10del rs780180737
NM_032119.4(ADGRV1):c.9213C>T (p.Asp3071=) rs56329646
NM_032273.4(TMEM126A):c.96T>G (p.Leu32=) rs36100288
NM_032382.4(COG8):c.597C>T (p.Asn199=) rs113642086
NM_032409.3(PINK1):c.858G>A (p.Pro286=) rs148144773
NM_033056.4(PCDH15):c.1900G>A (p.Val634Ile) rs146199636
NM_033056.4(PCDH15):c.4719G>A (p.Leu1573=) rs529962978
NM_033056.4(PCDH15):c.5435C>T (p.Pro1812Leu) rs139668636
NM_033056.4(PCDH15):c.5565C>T (p.Ala1855=) rs111033445
NM_033100.4(CDHR1):c.2229G>A (p.Arg743=) rs150969538
NM_033100.4(CDHR1):c.526-7C>G rs190906755
NM_033100.4(CDHR1):c.783G>A (p.Pro261=) rs147346345
NM_033337.3(CAV3):c.201C>A (p.Val67=) rs201593267
NM_033337.3(CAV3):c.234G>A (p.Thr78=) rs148846096
NM_033337.3(CAV3):c.276C>T (p.Phe92=) rs72546669
NM_033337.3(CAV3):c.40G>A (p.Val14Ile) rs121909281
NM_033337.3(CAV3):c.443G>A (p.Arg148Gln) rs140575619
NM_033380.3(COL4A5):c.3023A>G (p.Lys1008Arg) rs142929745
NM_033380.3(COL4A5):c.3296C>T (p.Ser1099Phe) rs767087695
NM_033380.3(COL4A5):c.858T>C (p.Gly286=) rs183837448
NM_033380.3(COL4A5):c.89A>G (p.Tyr30Cys) rs150305490
NM_052989.3(IFT122):c.1992+7A>G rs757823317
NM_058246.4(DNAJB6):c.831T>G (p.Ser277=) rs369098407
NM_080680.3(COL11A2):c.1615C>T (p.Arg539Trp) rs145499142
NM_080680.3(COL11A2):c.2017-5T>G rs200523422
NM_080680.3(COL11A2):c.4863+7G>A rs200947059
NM_080916.3(DGUOK):c.4G>T (p.Ala2Ser) rs147551003
NM_080916.3(DGUOK):c.708-3T>C rs370071744
NM_133259.4(LRPPRC):c.3275+7G>A rs111392631
NM_133259.4(LRPPRC):c.64C>G (p.Leu22Val) rs181626399
NM_133261.3(GIPC3):c.856G>A (p.Val286Ile) rs138339125
NM_133261.3(GIPC3):c.906C>T (p.Ala302=) rs140960269
NM_133378.4(TTN):c.80602+8T>C rs369690199
NM_133433.4(NIPBL):c.615G>A (p.Ser205=) rs150678035
NM_133497.4(KCNV2):c.756G>A (p.Lys252=) rs138861317
NM_133497.4(KCNV2):c.80G>A (p.Arg27His) rs145731729
NM_138694.4(PKHD1):c.8174-18dup rs566540835
NM_139058.3(ARX):c.1300GCC[8] (p.Ala440dup) rs398124508
NM_139058.3(ARX):c.306GGC[11] (p.Ala115dup) rs387906492
NM_144596.4(TTC8):c.267C>A (p.Arg89=) rs200113889
NM_144612.6(LOXHD1):c.177G>A (p.Thr59=) rs116413527
NM_144612.6(LOXHD1):c.1944C>T (p.Ser648=) rs369039902
NM_144612.6(LOXHD1):c.5127C>T (p.Gly1709=) rs373924055
NM_144612.6(LOXHD1):c.5214-3C>T rs528236655
NM_144631.6(ZNF513):c.519C>T (p.Ser173=) rs199520071
NM_144966.5(FREM1):c.571G>A (p.Gly191Arg) rs370556388
NM_144991.3(TSPEAR):c.343G>A (p.Asp115Asn) rs144586270
NM_147127.5(EVC2):c.18C>T (p.Ser6=) rs556910528
NM_147196.3(TMIE):c.367AAG[6] (p.Lys129_Lys131del) rs10578999
NM_152778.3(MFSD8):c.1006G>C (p.Glu336Gln) rs150418024
NM_153026.3(PRICKLE1):c.1461C>T (p.Ser487=) rs116197349
NM_153026.3(PRICKLE1):c.2262C>G (p.Leu754=) rs727504104
NM_153033.4(KCTD7):c.273C>T (p.Ser91=) rs139585796
NM_153033.4(KCTD7):c.387C>T (p.Ala129=) rs140932942
NM_153033.4(KCTD7):c.687T>C (p.Asp229=) rs372150992
NM_153212.3(GJB4):c.495C>T (p.Ser165=) rs147912521
NM_153240.5(NPHP3):c.1083T>C (p.Ser361=) rs781244729
NM_153676.4(USH1C):c.1906C>T (p.Arg636Cys) rs149510892
NM_153676.4(USH1C):c.2014-1G>A rs150567427
NM_153676.4(USH1C):c.2124T>C (p.Ser708=) rs369021714
NM_153676.4(USH1C):c.2443C>T (p.Leu815=) rs148477093
NM_153676.4(USH1C):c.360C>T (p.Gly120=) rs140869579
NM_153676.4(USH1C):c.674+4G>A rs202095395
NM_153704.6(TMEM67):c.958A>T (p.Ser320Cys) rs111619594
NM_170707.4(LMNA):c.1051A>C (p.Arg351=) rs771623461
NM_170707.4(LMNA):c.1098G>A (p.Lys366=) rs57901307
NM_170707.4(LMNA):c.1149G>A (p.Glu383=) rs267607603
NM_170707.4(LMNA):c.1488+8G>A rs762836610
NM_170707.4(LMNA):c.1488G>A (p.Thr496=) rs375516745
NM_170707.4(LMNA):c.1551G>A (p.Gln517=) rs41314035
NM_170707.4(LMNA):c.1656C>T (p.Asp552=) rs370219874
NM_170707.4(LMNA):c.471G>A (p.Thr157=) rs150645079
NM_170707.4(LMNA):c.640-52C>T rs41314033
NM_170707.4(LMNA):c.789G>A (p.Leu263=) rs148557956
NM_170707.4(LMNA):c.895A>G (p.Ile299Val) rs150924946
NM_172056.2(KCNH2):c.2331C>T (p.Thr777=) rs41307292
NM_172056.2(KCNH2):c.51C>G (p.Thr17=) rs144338227
NM_172107.4(KCNQ2):c.1301+7C>T rs374877247
NM_172107.4(KCNQ2):c.1827C>T (p.Ala609=) rs369438374
NM_172364.5(CACNA2D4):c.1239G>A (p.Pro413=) rs201783863
NM_173495.3(PTCHD1):c.1311T>C (p.His437=) rs150186077
NM_173591.3(OTOGL):c.3042A>G (p.Gln1014=) rs144125797
NM_173591.3(OTOGL):c.3186+10C>T rs201373228
NM_173591.3(OTOGL):c.3228T>C (p.Thr1076=) rs138823379
NM_173591.3(OTOGL):c.3329T>C (p.Ile1110Thr) rs150426222
NM_173630.4(RTTN):c.1221A>G (p.Glu407=) rs112327299
NM_173630.4(RTTN):c.3048G>A (p.Pro1016=) rs149233888
NM_173660.5(DOK7):c.1029C>T (p.Gly343=) rs375877997
NM_174878.3(CLRN1):c.9C>A (p.Ser3Arg) rs187218889
NM_181303.2(NLGN3):c.282G>A (p.Ser94=) rs143817848
NM_182914.2(SYNE2):c.10392C>T (p.Cys3464=) rs373646325
NM_182914.2(SYNE2):c.15445C>T (p.Arg5149Cys) rs143088941
NM_182914.2(SYNE2):c.16743G>A (p.Thr5581=) rs138769395
NM_182961.4(SYNE1):c.10800G>A (p.Leu3600=) rs114858512
NM_182961.4(SYNE1):c.11127A>G (p.Glu3709=) rs149260051
NM_182961.4(SYNE1):c.11355G>A (p.Arg3785=) rs151081036
NM_182961.4(SYNE1):c.11430G>A (p.Thr3810=) rs137919524
NM_182961.4(SYNE1):c.12564C>T (p.Ser4188=) rs141202420
NM_182961.4(SYNE1):c.13101C>T (p.Ile4367=) rs140136749
NM_182961.4(SYNE1):c.13572C>T (p.Val4524=) rs111511993
NM_182961.4(SYNE1):c.14625G>A (p.Thr4875=) rs140118684
NM_182961.4(SYNE1):c.1730-7G>A rs367603152
NM_182961.4(SYNE1):c.18870C>T (p.Ser6290=) rs138173087
NM_182961.4(SYNE1):c.2065C>A (p.Arg689=) rs139480065
NM_182961.4(SYNE1):c.22554G>A (p.Gly7518=) rs148240825
NM_182961.4(SYNE1):c.22617C>T (p.Leu7539=) rs111367233
NM_182961.4(SYNE1):c.24150C>T (p.His8050=) rs140259310
NM_182961.4(SYNE1):c.25120-6A>G rs201898019
NM_182961.4(SYNE1):c.5070C>G (p.Val1690=) rs146789107
NM_182961.4(SYNE1):c.5488T>C (p.Leu1830=) rs118022241
NM_182961.4(SYNE1):c.582-9A>G rs200412221
NM_182961.4(SYNE1):c.6826-6A>G rs183683592
NM_182961.4(SYNE1):c.7458A>G (p.Gln2486=) rs139070088
NM_182961.4(SYNE1):c.7647C>T (p.His2549=) rs113163375
NM_182961.4(SYNE1):c.779-9dup rs567435072
NM_182961.4(SYNE1):c.8973G>A (p.Thr2991=) rs146424389
NM_182961.4(SYNE1):c.9807+5C>T rs185350092
NM_194248.3(OTOF):c.2215-80T>C rs143141993
NM_194248.3(OTOF):c.5742G>A (p.Leu1914=) rs141235641
NM_198056.2(SCN5A):c.435C>T (p.Cys145=) rs587781159
NM_198506.5(LRIT3):c.1752_1754del (p.Leu585del) rs145776307
NM_198506.5(LRIT3):c.379G>T (p.Asp127Tyr) rs148810231
NM_198525.3(KIF7):c.3665-5G>A rs79532879
NM_198586.3(NHLRC1):c.32C>A (p.Ala11Glu) rs139029314
NM_198859.4(PRICKLE2):c.1962G>A (p.Leu654=) rs367685080
NM_198903.2(GABRG2):c.918T>C (p.Phe306=) rs115126975
NM_201384.3(PLEC):c.10302C>A (p.Thr3434=) rs199879193
NM_201384.3(PLEC):c.11418C>T (p.Thr3806=) rs559510708
NM_201384.3(PLEC):c.12615C>T (p.Ile4205=) rs202116866
NM_201384.3(PLEC):c.13470C>T (p.Arg4490=) rs531535217
NM_201384.3(PLEC):c.174+10G>A rs181850748
NM_201384.3(PLEC):c.2064G>A (p.Pro688=) rs374590279
NM_201384.3(PLEC):c.2304+9dup rs35671527
NM_201384.3(PLEC):c.2478C>T (p.Asp826=) rs202135215
NM_201384.3(PLEC):c.2535C>T (p.Ser845=) rs199721954
NM_201384.3(PLEC):c.2551G>A (p.Val851Met) rs200647397
NM_201384.3(PLEC):c.2844C>T (p.Pro948=) rs200482255
NM_201384.3(PLEC):c.4326G>A (p.Ala1442=) rs369943756
NM_201384.3(PLEC):c.5761C>T (p.Arg1921Trp) rs201278290
NM_201384.3(PLEC):c.6594C>T (p.Thr2198=) rs144242254
NM_201384.3(PLEC):c.7830G>A (p.Ala2610=) rs376112916
NM_201384.3(PLEC):c.8613C>T (p.Cys2871=) rs35821434
NM_201384.3(PLEC):c.963C>T (p.Phe321=) rs368425406
NM_201525.4(ADGRG1):c.1810C>T (p.Leu604=) rs113358058
NM_201525.4(ADGRG1):c.1983T>C (p.Gly661=) rs111939130
NM_201548.5(CERKL):c.132G>C (p.Glu44Asp) rs727503857
NM_201548.5(CERKL):c.27G>A (p.Arg9=) rs368855330
NM_201599.3(ZMYM3):c.195C>G (p.Gly65=) rs139405380
NM_201599.3(ZMYM3):c.4065C>T (p.Arg1355=) rs142437272
NM_206933.3(USH2A):c.5802G>A (p.Ser1934=) rs149776188
NM_206933.4(USH2A):c.14517G>A (p.Thr4839=) rs397517991
NM_206933.4(USH2A):c.14664G>A (p.Thr4888=) rs111033525
NM_206933.4(USH2A):c.3123C>A (p.His1041Gln) rs149304901
NM_206933.4(USH2A):c.4560C>T (p.Ile1520=) rs148000219
NM_206933.4(USH2A):c.4578G>T (p.Gly1526=) rs147560504
NM_206933.4(USH2A):c.5048A>G (p.Asn1683Ser) rs140080678
NM_206933.4(USH2A):c.8315C>T (p.Thr2772Ile) rs150807452
NM_206933.4(USH2A):c.8559-7G>A rs199618999
NM_207352.4(CYP4V2):c.1479C>T (p.Asn493=) rs374270799
NM_207361.6(FREM2):c.177T>C (p.Gly59=) rs370018440
NM_207361.6(FREM2):c.2367G>A (p.Pro789=) rs140101984
NM_207361.6(FREM2):c.2740T>G (p.Cys914Gly) rs146685625
NM_207361.6(FREM2):c.2823C>T (p.Pro941=) rs150154438
NM_212472.2(PRKAR1A):c.798G>A (p.Thr266=) rs201774040
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.