ClinVar Miner

Variants from Quest Diagnostics Nichols Institute San Juan Capistrano with conflicting interpretations

Location: United States — Primary collection method: clinical testing
Minimum review status of the submission from Quest Diagnostics Nichols Institute San Juan Capistrano: Collection method of the submission from Quest Diagnostics Nichols Institute San Juan Capistrano:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
9303 3509 42 988 874 114 168 1915

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
Quest Diagnostics Nichols Institute San Juan Capistrano pathogenic likely pathogenic uncertain significance likely benign benign drug response risk factor other
pathogenic 0 89 56 2 0 14 14 16
likely pathogenic 69 0 35 1 1 4 2 4
uncertain significance 32 40 25 446 74 2 2 44
likely benign 4 1 272 0 356 0 0 10
benign 3 1 144 583 17 0 3 0

Submitter to submitter summary #

Total submitters: 78
Download table as spreadsheet
Submitter Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
GeneDx 0 2773 0 538 306 1 24 867
Integrated Genetics/Laboratory Corporation of America 0 1492 0 274 239 0 15 527
PreventionGenetics, PreventionGenetics 0 410 0 196 81 0 3 279
ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories 0 578 0 129 82 0 19 230
CeGaT Praxis fuer Humangenetik Tuebingen 0 316 0 113 96 0 16 225
Invitae 0 618 0 133 87 0 2 221
Department of Pathology and Laboratory Medicine,Sinai Health System 0 239 0 59 45 0 36 140
EGL Genetic Diagnostics, Eurofins Clinical Diagnostics 0 285 0 62 59 1 11 133
Quest Diagnostics Nichols Institute San Juan Capistrano 14414 194 0 109 10 0 0 119
OMIM 0 59 0 4 3 93 8 108
Biesecker Lab/Clinical Genomics Section,National Institutes of Health 0 0 41 4 43 0 1 86
Mayo Clinic Laboratories, Mayo Clinic 0 139 0 49 28 0 6 83
Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine 0 141 0 25 50 1 4 80
Genetic Services Laboratory, University of Chicago 0 61 0 48 22 1 0 71
Illumina Clinical Services Laboratory,Illumina 0 75 0 23 37 0 4 64
Counsyl 0 113 0 32 7 0 0 39
Mendelics 0 26 0 21 9 0 1 31
CHEO Genetics Diagnostic Laboratory,Children's Hospital of Eastern Ontario 0 84 0 15 8 0 2 25
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 0 37 0 16 4 0 4 24
PharmGKB 0 0 0 0 0 19 0 19
CSER _CC_NCGL, University of Washington 0 9 0 2 16 0 1 19
Clinical Genetics Karolinska University Hospital,Karolinska University Hospital 0 124 0 11 0 0 8 19
ISCA site 1 0 21 1 3 9 0 4 17
Foulkes Cancer Genetics LDI, Lady Davis Institute for Medical Research 0 78 0 5 9 0 1 15
CFTR-France 0 1 0 4 0 0 11 15
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) 0 159 0 8 2 0 2 12
Leiden Open Variation Database 0 43 0 8 3 0 1 12
King Laboratory,University of Washington 0 2 0 2 9 0 0 11
ARUP Laboratories, Cytogenetics and Genomic Microarray,ARUP Laboratories 0 48 0 0 9 0 2 11
Sharing Clinical Reports Project (SCRP) 0 109 0 4 7 0 0 11
Research Molecular Genetics Laboratory,Women's College Hospital, University of Toronto 0 13 0 2 2 0 7 11
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute 0 9 0 5 5 0 0 10
University of Washington Department of Laboratory Medicine, University of Washington 0 13 0 2 3 1 3 9
NIHR Bioresource Rare Diseases, University of Cambridge 0 4 0 2 2 0 3 7
Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen 0 81 0 3 0 0 4 7
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics,Children's Hospital of Philadelphia 0 1 0 4 2 0 0 6
Ambry Genetics 0 1 0 4 1 0 0 5
Fulgent Genetics,Fulgent Genetics 0 119 0 2 3 0 0 5
Breast Cancer Information Core (BIC) (BRCA1) 0 70 0 0 0 0 5 5
Department of Pathology and Molecular Medicine,Queen's University 0 13 0 0 5 0 0 5
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen 0 14 0 2 3 0 0 5
Lineagen, Inc 0 23 0 0 3 0 1 4
GeneKor MSA 0 44 0 4 0 0 0 4
Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA), c/o University of Cambridge 0 150 0 4 0 0 0 4
Cancer Genetics and Genomics Laboratory,British Columbia Cancer Agency 0 15 0 4 0 0 0 4
Centre for Mendelian Genomics,University Medical Centre Ljubljana 0 4 0 1 2 0 0 3
Greenwood Genetic Center Diagnostic Laboratories,Greenwood Genetic Center 0 2 0 1 0 0 1 2
Breast Cancer Information Core (BIC) (BRCA2) 0 69 0 0 0 0 2 2
Stanford Center for Inherited Cardiovascular Disease, Stanford University 0 6 0 2 0 0 0 2
Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde,Academisch Medisch Centrum 0 1 0 0 0 0 2 2
Molecular Oncology Laboratory,Hospital Clínico San Carlos 0 1 0 0 2 0 0 2
3DMed Clinical Laboratory Inc 0 10 0 0 2 0 0 2
Broad Institute Rare Disease Group, Broad Institute 0 2 0 0 2 0 0 2
Lab. Molecular Oncology,VUB, Free University of Brussels 0 1 0 1 1 0 0 2
Institute for Genomic Medicine (IGM) Clinical Laboratory,Nationwide Children's Hospital 0 0 0 2 0 0 0 2
CZECANCA consortium 0 58 0 0 0 0 2 2
Constitutional Genetics Lab,Leon Berard Cancer Center 0 25 0 0 0 0 2 2
Baylor Genetics 0 8 0 0 1 0 0 1
Molecular Diagnostics Lab,Nemours Alfred I. duPont Hospital for Children 0 1 0 0 0 0 1 1
Molecular Genetics Laboratory,BC Children's and BC Women's Hospitals 0 0 0 0 0 0 1 1
Michigan Medical Genetics Laboratories,University of Michigan 0 11 0 1 0 0 0 1
Natera, Inc. 0 10 0 0 1 0 0 1
Department of Medical Genetics, Oslo University Hospital 0 16 0 1 0 0 0 1
HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology 0 3 0 1 0 0 0 1
Knight Diagnostic Laboratories, Oregon Health and Sciences University 0 4 0 0 1 0 0 1
Centro de Genética y Biología Molecular, Universidad de San Martín de Porres 0 0 0 1 0 0 0 1
Department of Medical Genetics, University Hospital of North Norway 0 0 0 1 0 0 0 1
Center of Medical Genetics and Primary Health Care 0 1 0 0 1 0 0 1
Equipe Genetique des Anomalies du Developpement, Université de Bourgogne 0 1 0 0 0 0 1 1
Oxford Haemato-Oncology Service,Oxford University Hospitals NHS Foundation Trust 0 0 0 0 0 1 0 1
Institute of Human Genetics, University of Leipzig Medical Center 0 3 0 1 0 0 0 1
Endocrine oncology group, Uppsala University 0 0 0 1 0 0 0 1
DNA and Cytogenetics Diagnostics Unit,Erasmus Medical Center 0 14 0 0 1 0 0 1
Cancer Molecular Diagnostics Core,Tianjin Medical University Cancer Institute and Hospital 0 0 0 1 0 0 0 1
St. Jude Clinical Genomics Lab, St. Jude Children's Research Hospital 0 4 0 0 1 0 0 1
Gharavi Laboratory,Columbia University 0 13 0 1 0 0 0 1
Center for Reproductive Medicine,Shandong Provincial Hospital Affiliated to Shandong University 0 0 0 0 0 0 1 1
MAGI's Lab - Research,MAGI Group 0 3 0 0 1 0 0 1

All variants with conflicting interpretations #

Total variants: 1915
Download table as spreadsheet
HGVS dbSNP
GRCh37/hg19 10q24.2(chr10:100690060-100911811)x1
GRCh37/hg19 10q25.3(chr10:116322646-116572153)x3
GRCh37/hg19 11p15.1(chr11:16914628-17199531)x4
GRCh37/hg19 13q12.12(chr13:23519916-24936848)x1
GRCh37/hg19 13q21.2-21.31(chr13:61660181-63785757)x3
GRCh37/hg19 15q13.2-13.3(chr15:31108661-32446830)x1
GRCh37/hg19 15q26.3(chr15:100614375-100911698)x1
GRCh37/hg19 16p11.2(chr16:28819028-29051191)x3
GRCh37/hg19 16p11.2(chr16:29580020-30191848)x3
GRCh37/hg19 16p12.2(chr16:21801889-22431357)x3
GRCh37/hg19 16p12.3(chr16:19144340-19281768)x1
GRCh37/hg19 16p13.11-12.3(chr16:15316618-18185466)x3
GRCh37/hg19 16p13.3(chr16:6294808-6394422)x1
GRCh37/hg19 17q12(chr17:34822465-36283612)x3
GRCh37/hg19 17q12(chr17:34822465-36410559)x3
GRCh37/hg19 18p11.32(chr18:517102-1331930)x3
GRCh37/hg19 18q22.1(chr18:65687087-66530088)x4
GRCh37/hg19 1p33(chr1:49498351-50440974)x1
GRCh37/hg19 22q11.21(chr22:20716876-21465662)x1
GRCh37/hg19 22q11.21-11.22(chr22:21029655-22481498)x1
GRCh37/hg19 2p21(chr2:44506991-44581463)x1
GRCh37/hg19 2q21.1(chr2:130166042-130784390)x3
GRCh37/hg19 2q21.1(chr2:131477947-131956516)x1
GRCh37/hg19 2q34(chr2:213969855-214925262)x3
GRCh37/hg19 4q22.1(chr4:92491756-93233588)x3
GRCh37/hg19 4q32.3(chr4:164801123-165481802)x3
GRCh37/hg19 6q12(chr6:65564377-65671149)x1
GRCh37/hg19 6q14.2-14.3(chr6:84373742-85044270)x3
GRCh37/hg19 6q27(chr6:169244303-169803100)x3
GRCh37/hg19 7p21.1(chr7:16838232-17753807)x3
GRCh37/hg19 9p24.2(chr9:2689263-2787884)x1
GRCh37/hg19 Xp11.3(chrX:43396992-43626868)x2
NC_000011.10:g.5225460A>C rs560643693
NM_000016.5(ACADM):c.351A>C (p.Thr117=) rs74090726
NM_000016.5(ACADM):c.387+1del rs786204424
NM_000016.5(ACADM):c.443G>A (p.Arg148Lys) rs778906552
NM_000016.5(ACADM):c.600-18G>A rs370523609
NM_000016.5(ACADM):c.616C>T (p.Arg206Cys) rs373715782
NM_000016.5(ACADM):c.678A>G (p.Ala226=) rs2229249
NM_000016.5(ACADM):c.797A>G (p.Asp266Gly) rs201375579
NM_000038.6(APC):c.1005A>G (p.Leu335=) rs3797704
NM_000038.6(APC):c.1050T>G (p.Ser350=) rs760345157
NM_000038.6(APC):c.120G>A (p.Glu40=) rs142720069
NM_000038.6(APC):c.1240C>T (p.Arg414Cys) rs137854567
NM_000038.6(APC):c.1419G>A (p.Gln473=) rs141579422
NM_000038.6(APC):c.1488A>T (p.Thr496=) rs9282599
NM_000038.6(APC):c.1495C>G (p.Arg499Gly) rs137854580
NM_000038.6(APC):c.1554G>A (p.Thr518=) rs546568052
NM_000038.6(APC):c.1604C>T (p.Ser535Phe) rs75870842
NM_000038.6(APC):c.1606G>A (p.Glu536Lys) rs138098808
NM_000038.6(APC):c.1626+1G>A rs1554081934
NM_000038.6(APC):c.1626+4C>A rs1202435147
NM_000038.6(APC):c.1631T>C (p.Ile544Thr) rs144056494
NM_000038.6(APC):c.1690C>T (p.Arg564Ter) rs137854574
NM_000038.6(APC):c.1713A>G (p.Ala571=) rs529306174
NM_000038.6(APC):c.220+2T>A rs587781809
NM_000038.6(APC):c.2205G>A (p.Ala735=) rs141001261
NM_000038.6(APC):c.2262T>G (p.Val754=) rs148987776
NM_000038.6(APC):c.2438A>G (p.Asn813Ser) rs201522866
NM_000038.6(APC):c.2593C>T (p.Pro865Ser) rs192620988
NM_000038.6(APC):c.259C>T (p.Leu87=) rs569640184
NM_000038.6(APC):c.2640C>T (p.Ile880=) rs200184105
NM_000038.6(APC):c.2778T>C (p.Ser926=) rs371526966
NM_000038.6(APC):c.2805C>A (p.Tyr935Ter) rs137854575
NM_000038.6(APC):c.2805C>T (p.Tyr935=) rs137854575
NM_000038.6(APC):c.2838A>G (p.Thr946=) rs142835322
NM_000038.6(APC):c.295C>T (p.Arg99Trp) rs139196838
NM_000038.6(APC):c.3006C>T (p.Ala1002=) rs72541810
NM_000038.6(APC):c.3173A>G (p.Asp1058Gly) rs148725540
NM_000038.6(APC):c.317G>A (p.Arg106His) rs201764637
NM_000038.6(APC):c.3249T>G (p.Asp1083Glu) rs201629780
NM_000038.6(APC):c.3264G>A (p.Lys1088=) rs114774495
NM_000038.6(APC):c.3352A>G (p.Asn1118Asp) rs140493115
NM_000038.6(APC):c.3374T>C (p.Val1125Ala) rs377278397
NM_000038.6(APC):c.3462AGA[2] (p.Glu1157del) rs386833391
NM_000038.6(APC):c.3479C>A (p.Thr1160Lys) rs201004111
NM_000038.6(APC):c.3511C>T (p.Arg1171Cys) rs201830995
NM_000038.6(APC):c.3624C>T (p.Thr1208=) rs730882125
NM_000038.6(APC):c.3632T>G (p.Met1211Arg) rs575268622
NM_000038.6(APC):c.3711G>A (p.Gln1237=) rs756939805
NM_000038.6(APC):c.3739G>A (p.Ala1247Thr) rs148223181
NM_000038.6(APC):c.3786T>C (p.Tyr1262=) rs147411334
NM_000038.6(APC):c.385G>C (p.Glu129Gln) rs376628500
NM_000038.6(APC):c.3875C>T (p.Thr1292Met) rs371113837
NM_000038.6(APC):c.388A>G (p.Ser130Gly) rs150973053
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000038.6(APC):c.3949G>C (p.Glu1317Gln) rs1801166
NM_000038.6(APC):c.4074G>A (p.Ala1358=) rs149782464
NM_000038.6(APC):c.4212C>A (p.Ser1404=) rs144655979
NM_000038.6(APC):c.4237A>G (p.Met1413Val) rs141519952
NM_000038.6(APC):c.4333A>G (p.Thr1445Ala) rs587780597
NM_000038.6(APC):c.4336G>A (p.Ala1446Thr) rs146572883
NM_000038.6(APC):c.4413A>G (p.Ala1471=) rs964029262
NM_000038.6(APC):c.4420G>A (p.Ala1474Thr) rs139387758
NM_000038.6(APC):c.450A>G (p.Lys150=) rs116020626
NM_000038.6(APC):c.4833G>A (p.Gln1611=) rs762030106
NM_000038.6(APC):c.4893T>C (p.Ser1631=) rs35634377
NM_000038.6(APC):c.4905G>A (p.Gly1635=) rs137988845
NM_000038.6(APC):c.5009C>T (p.Ala1670Val) rs202228932
NM_000038.6(APC):c.5025T>G (p.Val1675=) rs876658169
NM_000038.6(APC):c.5027G>C (p.Arg1676Thr) rs143674116
NM_000038.6(APC):c.5140G>A (p.Asp1714Asn) rs148275069
NM_000038.6(APC):c.5250C>T (p.Val1750=) rs2229997
NM_000038.6(APC):c.5274T>A (p.Ser1758=) rs199600387
NM_000038.6(APC):c.5363G>A (p.Arg1788His) rs201472075
NM_000038.6(APC):c.5392A>G (p.Asn1798Asp) rs200794097
NM_000038.6(APC):c.5506G>A (p.Gly1836Arg) rs766739164
NM_000038.6(APC):c.5790A>G (p.Gln1930=) rs141152252
NM_000038.6(APC):c.5801C>T (p.Pro1934Leu) rs587780600
NM_000038.6(APC):c.5912C>G (p.Ser1971Cys) rs754691867
NM_000038.6(APC):c.607C>G (p.Gln203Glu) rs141576417
NM_000038.6(APC):c.6219T>G (p.Gly2073=) rs766559927
NM_000038.6(APC):c.6387G>A (p.Ser2129=) rs374310157
NM_000038.6(APC):c.647G>A (p.Arg216Gln) rs76685252
NM_000038.6(APC):c.6510A>C (p.Pro2170=) rs138571760
NM_000038.6(APC):c.6510del (p.Glu2172fs) rs1554087474
NM_000038.6(APC):c.6525A>G (p.Thr2175=) rs200151646
NM_000038.6(APC):c.6526T>C (p.Leu2176=) rs183468041
NM_000038.6(APC):c.6609T>C (p.Val2203=) rs149328018
NM_000038.6(APC):c.6669A>G (p.Ser2223=) rs372680843
NM_000038.6(APC):c.6679G>T (p.Gly2227Cys) rs367905430
NM_000038.6(APC):c.6724A>G (p.Ser2242Gly) rs201375478
NM_000038.6(APC):c.6821C>T (p.Ala2274Val) rs34919187
NM_000038.6(APC):c.6873A>T (p.Gln2291His) rs148878262
NM_000038.6(APC):c.7036C>T (p.Pro2346Ser) rs200756935
NM_000038.6(APC):c.7395T>C (p.Leu2465=) rs369906346
NM_000038.6(APC):c.7399C>A (p.Pro2467Thr) rs372305287
NM_000038.6(APC):c.7415C>T (p.Ala2472Val) rs200399245
NM_000038.6(APC):c.7490C>T (p.Ser2497Leu) rs141010008
NM_000038.6(APC):c.7514G>A (p.Arg2505Gln) rs147549623
NM_000038.6(APC):c.7533C>T (p.Leu2511=) rs1057522957
NM_000038.6(APC):c.7574G>A (p.Arg2525His) rs762034315
NM_000038.6(APC):c.7625A>G (p.Asn2542Ser) rs151163793
NM_000038.6(APC):c.7717A>G (p.Ile2573Val) rs145444830
NM_000038.6(APC):c.7766A>G (p.Glu2589Gly) rs200406572
NM_000038.6(APC):c.777G>T (p.Arg259=) rs147704593
NM_000038.6(APC):c.7786T>G (p.Ser2596Ala) rs138137162
NM_000038.6(APC):c.7878T>G (p.Thr2626=) rs757020188
NM_000038.6(APC):c.8042C>T (p.Pro2681Leu) rs182456139
NM_000038.6(APC):c.8043G>C (p.Pro2681=) rs149347068
NM_000038.6(APC):c.8061A>G (p.Ser2687=) rs746180965
NM_000038.6(APC):c.8266A>G (p.Ile2756Val) rs146115809
NM_000038.6(APC):c.8325G>A (p.Gly2775=) rs770719841
NM_000038.6(APC):c.904C>T (p.Arg302Ter) rs137854568
NM_000038.6(APC):c.933+5C>T rs573528468
NM_000051.3(ATM):c.1272T>C (p.Pro424=) rs35578748
NM_000051.3(ATM):c.1773T>C (p.Asn591=) rs61734356
NM_000051.3(ATM):c.4949A>G (p.Asn1650Ser) rs55870064
NM_000051.4(ATM):c.2289T>A (p.Phe763Leu) rs34231402
NM_000051.4(ATM):c.4060C>A (p.Pro1354Thr) rs145119475
NM_000051.4(ATM):c.4424A>G (p.Tyr1475Cys) rs34640941
NM_000051.4(ATM):c.5821G>C (p.Val1941Leu) rs147187700
NM_000051.4(ATM):c.6067G>A (p.Gly2023Arg) rs11212587
NM_000051.4(ATM):c.7740A>C (p.Arg2580Ser) rs199915459
NM_000059.3(BRCA2):c.-51C>T rs1057521841
NM_000059.3(BRCA2):c.10024G>T (p.Glu3342Ter) rs28897761
NM_000059.3(BRCA2):c.10087A>G (p.Ile3363Val) rs55881945
NM_000059.3(BRCA2):c.10089A>G (p.Ile3363Met) rs80358390
NM_000059.3(BRCA2):c.10111A>G (p.Thr3371Ala) rs80358393
NM_000059.3(BRCA2):c.10187G>A (p.Ser3396Asn) rs889208749
NM_000059.3(BRCA2):c.1021T>C (p.Cys341Arg) rs55833327
NM_000059.3(BRCA2):c.10222A>T (p.Lys3408Ter) rs80358402
NM_000059.3(BRCA2):c.10240A>G (p.Thr3414Ala) rs80358405
NM_000059.3(BRCA2):c.10249T>C (p.Tyr3417His) rs535952730
NM_000059.3(BRCA2):c.1040A>G (p.Gln347Arg) rs55800493
NM_000059.3(BRCA2):c.1059A>G (p.Ser353=) rs730881585
NM_000059.3(BRCA2):c.1096T>G (p.Leu366Val) rs587779357
NM_000059.3(BRCA2):c.1166C>A (p.Pro389Gln) rs397507263
NM_000059.3(BRCA2):c.1166C>T (p.Pro389Leu) rs397507263
NM_000059.3(BRCA2):c.1167G>A (p.Pro389=) rs148607710
NM_000059.3(BRCA2):c.1247T>G (p.Ile416Ser) rs80358418
NM_000059.3(BRCA2):c.1254A>C (p.Ser418=) rs1052409595
NM_000059.3(BRCA2):c.1272A>G (p.Ser424=) rs587780531
NM_000059.3(BRCA2):c.1311A>G (p.Lys437=) rs1566223261
NM_000059.3(BRCA2):c.1447G>C (p.Ala483Pro) rs80358432
NM_000059.3(BRCA2):c.1568A>G (p.His523Arg) rs80358443
NM_000059.3(BRCA2):c.1584C>T (p.Asn528=) rs730881587
NM_000059.3(BRCA2):c.1662T>C (p.Cys554=) rs80358451
NM_000059.3(BRCA2):c.1788T>C (p.Asp596=) rs11571642
NM_000059.3(BRCA2):c.1810A>G (p.Lys604Glu) rs80358467
NM_000059.3(BRCA2):c.1838T>G (p.Leu613Arg) rs587780646
NM_000059.3(BRCA2):c.1865C>T (p.Ala622Val) rs80358477
NM_000059.3(BRCA2):c.1909+1G>A rs587781629
NM_000059.3(BRCA2):c.1911T>C (p.Gly637=) rs11571652
NM_000059.3(BRCA2):c.2025A>G (p.Thr675=) rs147381487
NM_000059.3(BRCA2):c.2094A>G (p.Leu698=) rs28897714
NM_000059.3(BRCA2):c.2095C>T (p.Gln699Ter) rs878853559
NM_000059.3(BRCA2):c.2109C>T (p.Thr703=) rs762499878
NM_000059.3(BRCA2):c.2133C>T (p.Cys711=) rs535547513
NM_000059.3(BRCA2):c.2138A>T (p.Gln713Leu) rs55816687
NM_000059.3(BRCA2):c.2145A>G (p.Gly715=) rs112566179
NM_000059.3(BRCA2):c.2208A>G (p.Ala736=) rs144984153
NM_000059.3(BRCA2):c.2270A>G (p.Lys757Arg) rs763035556
NM_000059.3(BRCA2):c.2412A>G (p.Glu804=) rs587780866
NM_000059.3(BRCA2):c.2484T>C (p.Tyr828=) rs45619134
NM_000059.3(BRCA2):c.2490C>T (p.Asn830=) rs56331088
NM_000059.3(BRCA2):c.267G>A (p.Pro89=) rs587780648
NM_000059.3(BRCA2):c.2739C>T (p.Asp913=) rs276174829
NM_000059.3(BRCA2):c.2779A>G (p.Met927Val) rs786201837
NM_000059.3(BRCA2):c.2803G>C (p.Asp935His) rs28897716
NM_000059.3(BRCA2):c.2817C>T (p.Thr939=) rs367921107
NM_000059.3(BRCA2):c.2944A>C (p.Ile982Leu) rs28897717
NM_000059.3(BRCA2):c.2946A>G (p.Ile982Met) rs80358541
NM_000059.3(BRCA2):c.3054G>A (p.Lys1018=) rs368404583
NM_000059.3(BRCA2):c.3173A>G (p.Lys1058Arg) rs431825302
NM_000059.3(BRCA2):c.3201del (p.Val1068fs) rs864622672
NM_000059.3(BRCA2):c.3218A>G (p.Gln1073Arg) rs80358566
NM_000059.3(BRCA2):c.3262C>T (p.Pro1088Ser) rs80358572
NM_000059.3(BRCA2):c.3304A>T (p.Asn1102Tyr) rs28897719
NM_000059.3(BRCA2):c.3326C>T (p.Ala1109Val) rs41293479
NM_000059.3(BRCA2):c.3336del (p.Glu1113fs) rs398122763
NM_000059.3(BRCA2):c.3395_3396delinsGG (p.Lys1132Arg) rs1060502496
NM_000059.3(BRCA2):c.3445A>G (p.Met1149Val) rs80358589
NM_000059.3(BRCA2):c.3462C>T (p.Thr1154=) rs4986856
NM_000059.3(BRCA2):c.3495T>C (p.His1165=) rs776655838
NM_000059.3(BRCA2):c.3539A>G (p.Lys1180Arg) rs28897720
NM_000059.3(BRCA2):c.3568C>T (p.Arg1190Trp) rs80358604
NM_000059.3(BRCA2):c.3575T>G (p.Phe1192Cys) rs80358606
NM_000059.3(BRCA2):c.3672C>T (p.Gly1224=) rs587780650
NM_000059.3(BRCA2):c.3785C>G (p.Ser1262Ter) rs80358620
NM_000059.3(BRCA2):c.3873del (p.Gln1291fs) rs398122772
NM_000059.3(BRCA2):c.3874C>T (p.Leu1292=) rs587780867
NM_000059.3(BRCA2):c.3880T>C (p.Leu1294=) rs786201236
NM_000059.3(BRCA2):c.3916G>A (p.Val1306Ile) rs80358636
NM_000059.3(BRCA2):c.4314C>T (p.Val1438=) rs730881590
NM_000059.3(BRCA2):c.4320A>G (p.Lys1440=) rs769535925
NM_000059.3(BRCA2):c.442T>C (p.Cys148Arg) rs80358677
NM_000059.3(BRCA2):c.4698C>T (p.Thr1566=) rs750813972
NM_000059.3(BRCA2):c.4718G>A (p.Cys1573Tyr) rs56249050
NM_000059.3(BRCA2):c.4977C>T (p.Ser1659=) rs45484897
NM_000059.3(BRCA2):c.506A>G (p.Lys169Arg) rs80358730
NM_000059.3(BRCA2):c.5095G>A (p.Asp1699Asn) rs80358731
NM_000059.3(BRCA2):c.517-4C>G rs81002804
NM_000059.3(BRCA2):c.5171T>C (p.Ile1724Thr) rs80358743
NM_000059.3(BRCA2):c.521G>A (p.Arg174His) rs80358747
NM_000059.3(BRCA2):c.5268A>G (p.Val1756=) rs199879914
NM_000059.3(BRCA2):c.5278T>G (p.Ser1760Ala) rs28897735
NM_000059.3(BRCA2):c.5344C>A (p.Gln1782Lys) rs80358757
NM_000059.3(BRCA2):c.534A>G (p.Lys178=) rs28897703
NM_000059.3(BRCA2):c.5414A>G (p.Asn1805Ser) rs80358765
NM_000059.3(BRCA2):c.5423T>C (p.Ile1808Thr) rs397507350
NM_000059.3(BRCA2):c.5427C>T (p.Cys1809=) rs80359791
NM_000059.3(BRCA2):c.5498A>G (p.Asn1833Ser) rs587782601
NM_000059.3(BRCA2):c.5529A>C (p.Ala1843=) rs372951842
NM_000059.3(BRCA2):c.5552T>G (p.Ile1851Ser) rs80358776
NM_000059.3(BRCA2):c.5667T>C (p.Ile1889=) rs1053022395
NM_000059.3(BRCA2):c.5700A>G (p.Ser1900=) rs730881591
NM_000059.3(BRCA2):c.5710C>G (p.Leu1904Val) rs55875643
NM_000059.3(BRCA2):c.5715dup (p.Asn1906Ter) rs587782901
NM_000059.3(BRCA2):c.5737T>C (p.Cys1913Arg) rs80358799
NM_000059.3(BRCA2):c.575T>C (p.Met192Thr) rs80358805
NM_000059.3(BRCA2):c.5763T>G (p.Phe1921Leu) rs730881540
NM_000059.3(BRCA2):c.5879G>A (p.Cys1960Tyr) rs56157628
NM_000059.3(BRCA2):c.5969A>C (p.Asp1990Ala) rs148618542
NM_000059.3(BRCA2):c.5976A>G (p.Ser1992=) rs748854546
NM_000059.3(BRCA2):c.606C>T (p.Pro202=) rs747726394
NM_000059.3(BRCA2):c.6078A>G (p.Thr2026=) rs375649375
NM_000059.3(BRCA2):c.6131G>T (p.Gly2044Val) rs56191579
NM_000059.3(BRCA2):c.6143A>T (p.Asn2048Ile) rs80358853
NM_000059.3(BRCA2):c.6271A>C (p.Ser2091Arg) rs398122550
NM_000059.3(BRCA2):c.6273T>A (p.Ser2091Arg) rs966360777
NM_000059.3(BRCA2):c.63A>G (p.Lys21=) rs1280004443
NM_000059.3(BRCA2):c.6423T>G (p.Gly2141=) rs780721021
NM_000059.3(BRCA2):c.6443C>A (p.Ser2148Tyr) rs80358880
NM_000059.3(BRCA2):c.6455C>A (p.Ser2152Tyr) rs80358881
NM_000059.3(BRCA2):c.6531T>A (p.Ile2177=) rs587780658
NM_000059.3(BRCA2):c.6541G>C (p.Gly2181Arg) rs371067421
NM_000059.3(BRCA2):c.6675A>G (p.Thr2225=) rs28897741
NM_000059.3(BRCA2):c.6739A>G (p.Ser2247Gly) rs80358896
NM_000059.3(BRCA2):c.6785T>G (p.Met2262Arg) rs80358904
NM_000059.3(BRCA2):c.6803G>A (p.Arg2268Lys) rs80358906
NM_000059.3(BRCA2):c.6871A>G (p.Asn2291Asp) rs80358911
NM_000059.3(BRCA2):c.6877T>C (p.Phe2293Leu) rs80358912
NM_000059.3(BRCA2):c.6892G>A (p.Glu2298Lys) rs80358914
NM_000059.3(BRCA2):c.6915G>A (p.Lys2305=) rs1555285156
NM_000059.3(BRCA2):c.6921A>G (p.Ser2307=) rs181183366
NM_000059.3(BRCA2):c.6935A>T (p.Asp2312Val) rs80358916
NM_000059.3(BRCA2):c.6943A>C (p.Ile2315Leu) rs80358918
NM_000059.3(BRCA2):c.6960G>A (p.Leu2320=) rs373134168
NM_000059.3(BRCA2):c.6980del (p.Ser2326_Leu2327insTer) rs879255306
NM_000059.3(BRCA2):c.6986C>T (p.Pro2329Leu) rs80358925
NM_000059.3(BRCA2):c.7007+7_7007+8del rs1555285373
NM_000059.3(BRCA2):c.7052C>G (p.Ala2351Gly) rs80358932
NM_000059.3(BRCA2):c.7137A>G (p.Gly2379=) rs730881593
NM_000059.3(BRCA2):c.7185C>T (p.His2395=) rs730881580
NM_000059.3(BRCA2):c.7188G>A (p.Leu2396=) rs587780871
NM_000059.3(BRCA2):c.7188G>T (p.Leu2396Phe) rs587780871
NM_000059.3(BRCA2):c.7239A>G (p.Lys2413=) rs763727386
NM_000059.3(BRCA2):c.7307A>T (p.Asn2436Ile) rs80358955
NM_000059.3(BRCA2):c.7313A>G (p.Asp2438Gly) rs80358957
NM_000059.3(BRCA2):c.7317A>G (p.Gly2439=) rs587780660
NM_000059.3(BRCA2):c.7413A>G (p.Thr2471=) rs138067005
NM_000059.3(BRCA2):c.7422A>G (p.Glu2474=) rs1566241334
NM_000059.3(BRCA2):c.750G>A (p.Val250=) rs143214959
NM_000059.3(BRCA2):c.7522G>A (p.Gly2508Ser) rs80358978
NM_000059.3(BRCA2):c.7534C>T (p.Leu2512Phe) rs80358980
NM_000059.3(BRCA2):c.7559G>A (p.Arg2520Gln) rs80358982
NM_000059.3(BRCA2):c.7559G>C (p.Arg2520Pro) rs80358982
NM_000059.3(BRCA2):c.7565C>T (p.Ser2522Phe) rs80358985
NM_000059.3(BRCA2):c.7601C>T (p.Ala2534Val) rs74047012
NM_000059.3(BRCA2):c.7651A>C (p.Lys2551Gln) rs398122587
NM_000059.3(BRCA2):c.7805+8A>G rs81002847
NM_000059.3(BRCA2):c.7958T>C (p.Leu2653Pro) rs80359022
NM_000059.3(BRCA2):c.796T>C (p.Phe266Leu) rs587782433
NM_000059.3(BRCA2):c.8036A>G (p.Asp2679Gly) rs80359041
NM_000059.3(BRCA2):c.8154T>C (p.Ile2718=) rs148880015
NM_000059.3(BRCA2):c.8165C>G (p.Thr2722Arg) rs80359062
NM_000059.3(BRCA2):c.8188G>C (p.Ala2730Pro) rs80359066
NM_000059.3(BRCA2):c.81_83delinsTAAGACT (p.Ser28fs) rs879255300
NM_000059.3(BRCA2):c.8215G>A (p.Val2739Ile) rs80359069
NM_000059.3(BRCA2):c.8298A>G (p.Thr2766=) rs730881594
NM_000059.3(BRCA2):c.8332-6G>T rs587780872
NM_000059.3(BRCA2):c.8350C>T (p.Arg2784Trp) rs80359075
NM_000059.3(BRCA2):c.8352G>T (p.Arg2784=) rs747664806
NM_000059.3(BRCA2):c.8356G>A (p.Ala2786Thr) rs80359077
NM_000059.3(BRCA2):c.8359C>T (p.Arg2787Cys) rs41293517
NM_000059.3(BRCA2):c.8386C>T (p.Pro2796Ser) rs146120136
NM_000059.3(BRCA2):c.8417C>T (p.Ser2806Leu) rs587782785
NM_000059.3(BRCA2):c.8487+8G>A rs81002838
NM_000059.3(BRCA2):c.8545A>G (p.Lys2849Glu) rs80359109
NM_000059.3(BRCA2):c.8573A>G (p.Gln2858Arg) rs80359114
NM_000059.3(BRCA2):c.8632+6A>G rs81002894
NM_000059.3(BRCA2):c.8633-1G>A rs398122711
NM_000059.3(BRCA2):c.865A>G (p.Asn289Asp) rs766173
NM_000059.3(BRCA2):c.8687G>A (p.Arg2896His) rs80359128
NM_000059.3(BRCA2):c.8702G>A (p.Gly2901Asp) rs80359129
NM_000059.3(BRCA2):c.8754+1G>T rs397508006
NM_000059.3(BRCA2):c.8754+4A>G rs81002893
NM_000059.3(BRCA2):c.8755-9T>C rs397507413
NM_000059.3(BRCA2):c.8764A>G (p.Ser2922Gly) rs80359132
NM_000059.3(BRCA2):c.8850G>A (p.Lys2950=) rs28897754
NM_000059.3(BRCA2):c.889G>T (p.Glu297Ter) rs879255298
NM_000059.3(BRCA2):c.8918G>A (p.Arg2973His) rs80359143
NM_000059.3(BRCA2):c.9085G>A (p.Ala3029Thr) rs56179254
NM_000059.3(BRCA2):c.9087G>A (p.Ala3029=) rs368576266
NM_000059.3(BRCA2):c.9234C>T (p.Val3078=) rs587782428
NM_000059.3(BRCA2):c.9235del (p.Val3079fs) rs397507422
NM_000059.3(BRCA2):c.9253A>C (p.Thr3085Pro) rs397507423
NM_000059.3(BRCA2):c.9253dupA (p.Thr3085Asnfs) rs80359752
NM_000059.3(BRCA2):c.927A>G (p.Ser309=) rs80359806
NM_000059.3(BRCA2):c.9285C>T (p.Asp3095=) rs80359198
NM_000059.3(BRCA2):c.9344A>G (p.Lys3115Arg) rs276174923
NM_000059.3(BRCA2):c.9364G>A (p.Ala3122Thr) rs587782313
NM_000059.3(BRCA2):c.939T>C (p.Ser313=) rs1593891536
NM_000059.3(BRCA2):c.943T>A (p.Cys315Ser) rs79483201
NM_000059.3(BRCA2):c.9454G>A (p.Glu3152Lys) rs80359218
NM_000059.3(BRCA2):c.9501+4A>G rs81002848
NM_000059.3(BRCA2):c.9509A>G (p.Asp3170Gly) rs80359224
NM_000059.3(BRCA2):c.956A>C (p.Asn319Thr) rs55939572
NM_000059.3(BRCA2):c.9581C>A (p.Pro3194Gln) rs28897760
NM_000059.3(BRCA2):c.9583A>G (p.Thr3195Ala) rs80359227
NM_000059.3(BRCA2):c.9592T>C (p.Cys3198Arg) rs80359229
NM_000059.3(BRCA2):c.9593_9594del (p.Cys3198fs) rs1566260198
NM_000059.3(BRCA2):c.9613_9614delinsCT (p.Ala3205Leu) rs276174926
NM_000059.3(BRCA2):c.9720T>C (p.Val3240=) rs80359810
NM_000059.3(BRCA2):c.9728C>T (p.Pro3243Leu) rs80359241
NM_000059.3(BRCA2):c.9837A>G (p.Leu3279=) rs730881598
NM_000059.3(BRCA2):c.987G>A (p.Arg329=) rs561002197
NM_000059.3(BRCA2):c.9952A>C (p.Asn3318His) rs80359256
NM_000059.3(BRCA2):c.9997C>G (p.Leu3333Val) rs567476314
NM_000059.4(BRCA2):c.10045A>G (p.Thr3349Ala) rs80358387
NM_000059.4(BRCA2):c.10095delinsGAATTATATCT (p.Ser3366fs) rs276174803
NM_000059.4(BRCA2):c.1011C>T (p.Asn337=) rs41293473
NM_000059.4(BRCA2):c.10154G>A (p.Arg3385His) rs80358398
NM_000059.4(BRCA2):c.10202C>T (p.Thr3401Met) rs55853199
NM_000059.4(BRCA2):c.10203G>A (p.Thr3401=) rs147854265
NM_000059.4(BRCA2):c.10234A>G (p.Ile3412Val) rs1801426
NM_000059.4(BRCA2):c.1181A>C (p.Glu394Ala) rs56016241
NM_000059.4(BRCA2):c.1296_1297del (p.Asn433fs) rs80359276
NM_000059.4(BRCA2):c.145G>T (p.Glu49Ter) rs80358435
NM_000059.4(BRCA2):c.1538A>G (p.Lys513Arg) rs28897709
NM_000059.4(BRCA2):c.1744A>C (p.Thr582Pro) rs80358457
NM_000059.4(BRCA2):c.175C>G (p.Pro59Ala) rs56091799
NM_000059.4(BRCA2):c.1786G>C (p.Asp596His) rs56328701
NM_000059.4(BRCA2):c.1792A>G (p.Thr598Ala) rs28897710
NM_000059.4(BRCA2):c.179A>G (p.Asn60Ser) rs80358463
NM_000059.4(BRCA2):c.1804G>A (p.Gly602Arg) rs80358466
NM_000059.4(BRCA2):c.2233A>G (p.Lys745Glu) rs374691587
NM_000059.4(BRCA2):c.2416G>C (p.Asp806His) rs56404215
NM_000059.4(BRCA2):c.2550A>G (p.Gln850=) rs80359785
NM_000059.4(BRCA2):c.2926_2927delinsAT (p.Ser976Ile) rs276174831
NM_000059.4(BRCA2):c.2957A>G (p.Asn986Ser) rs28897718
NM_000059.4(BRCA2):c.2987T>G (p.Leu996Arg) rs80358545
NM_000059.4(BRCA2):c.2999T>C (p.Ile1000Thr) rs374769365
NM_000059.4(BRCA2):c.316+5G>A rs81002840
NM_000059.4(BRCA2):c.3225T>C (p.Ser1075=) rs779228375
NM_000059.4(BRCA2):c.322A>C (p.Asn108His) rs80358567
NM_000059.4(BRCA2):c.3256A>G (p.Ile1086Val) rs80358571
NM_000059.4(BRCA2):c.3509C>T (p.Ala1170Val) rs80358599
NM_000059.4(BRCA2):c.3516G>A (p.Ser1172=) rs1799952
NM_000059.4(BRCA2):c.353G>A (p.Arg118His) rs80358603
NM_000059.4(BRCA2):c.3869G>A (p.Cys1290Tyr) rs41293485
NM_000059.4(BRCA2):c.3883C>T (p.Gln1295Ter) rs879255309
NM_000059.4(BRCA2):c.4143AGA[1] (p.Glu1382del) rs80359432
NM_000059.4(BRCA2):c.430GTT[1] (p.Val145del) rs80359442
NM_000059.4(BRCA2):c.440A>G (p.Gln147Arg) rs80358674
NM_000059.4(BRCA2):c.4436G>C (p.Ser1479Thr) rs80358678
NM_000059.4(BRCA2):c.4464_4465del (p.His1488fs) rs397507720
NM_000059.4(BRCA2):c.4588A>T (p.Lys1530Ter) rs80358692
NM_000059.4(BRCA2):c.4614T>C (p.Ser1538=) rs45520945
NM_000059.4(BRCA2):c.4656T>C (p.Gly1552=) rs41293491
NM_000059.4(BRCA2):c.4670C>G (p.Thr1557Ser) rs80358698
NM_000059.4(BRCA2):c.467A>G (p.Asp156Gly) rs68071147
NM_000059.4(BRCA2):c.4928T>C (p.Val1643Ala) rs28897731
NM_000059.4(BRCA2):c.5328GAA[1] (p.Lys1777del) rs398122529
NM_000059.4(BRCA2):c.5612G>A (p.Ser1871Asn) rs80358782
NM_000059.4(BRCA2):c.5616_5620del (p.Lys1872fs) rs80359525
NM_000059.4(BRCA2):c.5634C>G (p.Asn1878Lys) rs80358784
NM_000059.4(BRCA2):c.5635G>A (p.Glu1879Lys) rs55996097
NM_000059.4(BRCA2):c.5645C>A (p.Ser1882Ter) rs80358785
NM_000059.4(BRCA2):c.5645C>G (p.Ser1882Ter) rs80358785
NM_000059.4(BRCA2):c.5744C>T (p.Thr1915Met) rs4987117
NM_000059.4(BRCA2):c.5752C>T (p.His1918Tyr) rs80358803
NM_000059.4(BRCA2):c.5869A>G (p.Ile1957Val) rs80358817
NM_000059.4(BRCA2):c.5897A>G (p.His1966Arg) rs80358823
NM_000059.4(BRCA2):c.5946del (p.Ser1982fs) rs80359550
NM_000059.4(BRCA2):c.5986G>A (p.Ala1996Thr) rs80358833
NM_000059.4(BRCA2):c.6017G>C (p.Ser2006Thr) rs144784912
NM_000059.4(BRCA2):c.6131G>C (p.Gly2044Ala) rs56191579
NM_000059.4(BRCA2):c.6275_6276del rs11571658
NM_000059.4(BRCA2):c.627C>A (p.Leu209=) rs28897704
NM_000059.4(BRCA2):c.6290C>T (p.Thr2097Met) rs80358866
NM_000059.4(BRCA2):c.6513G>T (p.Val2171=) rs206076
NM_000059.4(BRCA2):c.658_659del rs80359604
NM_000059.4(BRCA2):c.6953G>A (p.Arg2318Gln) rs80358921
NM_000059.4(BRCA2):c.7024C>T (p.Gln2342Ter) rs80358928
NM_000059.4(BRCA2):c.708T>C (p.His236=) rs185506536
NM_000059.4(BRCA2):c.7435+6G>A rs81002852
NM_000059.4(BRCA2):c.7436-4A>G rs81002904
NM_000059.4(BRCA2):c.7448G>A (p.Ser2483Asn) rs80358967
NM_000059.4(BRCA2):c.7463G>A (p.Arg2488Lys) rs80358968
NM_000059.4(BRCA2):c.7504C>T (p.Arg2502Cys) rs55716624
NM_000059.4(BRCA2):c.7506C>T (p.Arg2502=) rs140693106
NM_000059.4(BRCA2):c.7521A>G (p.Pro2507=) rs759383358
NM_000059.4(BRCA2):c.7868A>G (p.His2623Arg) rs80359012
NM_000059.4(BRCA2):c.7878G>C (p.Trp2626Cys) rs80359013
NM_000059.4(BRCA2):c.7879A>T (p.Ile2627Phe) rs80359014
NM_000059.4(BRCA2):c.8009C>T (p.Ser2670Leu) rs80359035
NM_000059.4(BRCA2):c.8010G>A (p.Ser2670=) rs146430937
NM_000059.4(BRCA2):c.8092G>A (p.Ala2698Thr) rs80359052
NM_000059.4(BRCA2):c.8229_8243del (p.Arg2744_Gly2748del) rs80359698
NM_000059.4(BRCA2):c.8243G>A (p.Gly2748Asp) rs80359071
NM_000059.4(BRCA2):c.825A>T (p.Lys275Asn) rs397507399
NM_000059.4(BRCA2):c.831T>G (p.Asn277Lys) rs28897705
NM_000059.4(BRCA2):c.8351G>A (p.Arg2784Gln) rs80359076
NM_000059.4(BRCA2):c.8377G>A (p.Gly2793Arg) rs80359082
NM_000059.4(BRCA2):c.8486A>G (p.Gln2829Arg) rs80359100
NM_000059.4(BRCA2):c.8488-1G>A rs397507404
NM_000059.4(BRCA2):c.8917C>T (p.Arg2973Cys) rs45469092
NM_000059.4(BRCA2):c.8941G>A (p.Glu2981Lys) rs139052578
NM_000059.4(BRCA2):c.8954-5A>G rs886040949
NM_000059.4(BRCA2):c.8972G>A (p.Arg2991His) rs80359150
NM_000059.4(BRCA2):c.9155G>A (p.Arg3052Gln) rs80359171
NM_000059.4(BRCA2):c.9242T>C (p.Val3081Ala) rs80359189
NM_000059.4(BRCA2):c.9271G>A (p.Val3091Ile) rs80359194
NM_000059.4(BRCA2):c.9285C>G (p.Asp3095Glu) rs80359198
NM_000059.4(BRCA2):c.9458G>C (p.Gly3153Ala) rs80359220
NM_000059.4(BRCA2):c.9501+3A>T rs61757642
NM_000059.4(BRCA2):c.956A>G (p.Asn319Ser) rs55939572
NM_000059.4(BRCA2):c.9586A>G (p.Lys3196Glu) rs80359228
NM_000059.4(BRCA2):c.9699_9702del rs80359775
NM_000059.4(BRCA2):c.9875C>T (p.Pro3292Leu) rs56121817
NM_000059.4(BRCA2):c.9976A>T (p.Lys3326Ter) rs11571833
NM_000059.4(BRCA2):c.9986A>G (p.Asn3329Ser) rs76635144
NM_000075.4(CDK4):c.122A>G (p.Asn41Ser) rs144890720
NM_000075.4(CDK4):c.306A>G (p.Thr102=) rs201202764
NM_000075.4(CDK4):c.549C>T (p.Pro183=) rs778696237
NM_000075.4(CDK4):c.625C>T (p.Arg209Cys) rs140644696
NM_000075.4(CDK4):c.660C>T (p.Ala220=) rs773490152
NM_000075.4(CDK4):c.661G>A (p.Asp221Asn) rs587778187
NM_000075.4(CDK4):c.764G>A (p.Arg255His) rs144657355
NM_000075.4(CDK4):c.771G>A (p.Val257=) rs377612647
NM_000075.4(CDK4):c.776C>T (p.Ser259Leu) rs201617914
NM_000075.4(CDK4):c.813G>A (p.Leu271=) rs1487727732
NM_000075.4(CDK4):c.834T>C (p.Phe278=) rs115576923
NM_000077.4(CDKN2A):c.*6C>G rs375628411
NM_000077.4(CDKN2A):c.-19413C>G rs528789830
NM_000077.4(CDKN2A):c.-25C>T rs144481587
NM_000077.4(CDKN2A):c.-2G>A rs191394143
NM_000077.4(CDKN2A):c.-34G>C rs1800586
NM_000077.4(CDKN2A):c.146T>C (p.Ile49Thr) rs199907548
NM_000077.4(CDKN2A):c.167G>T (p.Ser56Ile) rs104894109
NM_000077.4(CDKN2A):c.170C>T (p.Ala57Val) rs372266620
NM_000077.4(CDKN2A):c.174A>C (p.Arg58=) rs201208890
NM_000077.4(CDKN2A):c.197A>G (p.His66Arg) rs756750256
NM_000077.4(CDKN2A):c.272T>A (p.Leu91Gln) rs1563889362
NM_000077.4(CDKN2A):c.273G>A (p.Leu91=) rs4987127
NM_000077.4(CDKN2A):c.298G>T (p.Ala100Ser) rs200863613
NM_000077.4(CDKN2A):c.318G>A (p.Val106=) rs199888003
NM_000077.4(CDKN2A):c.369T>A (p.His123Gln) rs6413463
NM_000077.4(CDKN2A):c.373G>C (p.Asp125His) rs146179135
NM_000077.4(CDKN2A):c.379G>T (p.Ala127Ser) rs6413464
NM_000077.4(CDKN2A):c.384G>A (p.Arg128=) rs199901898
NM_000077.4(CDKN2A):c.405G>A (p.Gly135=) rs751586391
NM_000077.4(CDKN2A):c.430C>T (p.Arg144Cys) rs116150891
NM_000077.4(CDKN2A):c.442G>A (p.Ala148Thr) rs3731249
NM_000077.4(CDKN2A):c.45G>T (p.Trp15Cys) rs138677674
NM_000077.4(CDKN2A):c.51C>A (p.Ala17=) rs764362225
NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[1] (p.Ala4_Pro11del) rs587780668
NM_000077.5(CDKN2A):c.151-7C>T
NM_000179.2(MSH6):c.*17G>A rs876661000
NM_000179.2(MSH6):c.*4_*6dup rs1451012329
NM_000179.2(MSH6):c.-2G>T rs374748889
NM_000179.2(MSH6):c.-8C>T rs565211544
NM_000179.2(MSH6):c.1049C>T (p.Ala350Val) rs587782331
NM_000179.2(MSH6):c.1050C>T (p.Ala350=) rs730881802
NM_000179.2(MSH6):c.1063G>A (p.Gly355Ser) rs587778531
NM_000179.2(MSH6):c.1295T>C (p.Phe432Ser) rs750528093
NM_000179.2(MSH6):c.1449G>T (p.Val483=) rs35590297
NM_000179.2(MSH6):c.1509C>T (p.Ser503=) rs545020313
NM_000179.2(MSH6):c.1665A>G (p.Ala555=) rs146785465
NM_000179.2(MSH6):c.1696G>A (p.Gly566Arg) rs63749973
NM_000179.2(MSH6):c.1776A>T (p.Val592=) rs56132616
NM_000179.2(MSH6):c.178T>C (p.Leu60=) rs35819209
NM_000179.2(MSH6):c.1867C>G (p.Pro623Ala) rs3136334
NM_000179.2(MSH6):c.1869C>T (p.Pro623=) rs141242295
NM_000179.2(MSH6):c.1917G>A (p.Glu639=) rs368059229
NM_000179.2(MSH6):c.2057G>A (p.Gly686Asp) rs587779227
NM_000179.2(MSH6):c.2314C>T (p.Arg772Trp) rs63750138
NM_000179.2(MSH6):c.2319C>T (p.Leu773=) rs63749895
NM_000179.2(MSH6):c.2384T>C (p.Ile795Thr) rs202127474
NM_000179.2(MSH6):c.2561_2562delinsTT (p.Lys854Ile) rs587780673
NM_000179.2(MSH6):c.260+7G>A rs774479750
NM_000179.2(MSH6):c.2904C>G (p.Val968=) rs150683226
NM_000179.2(MSH6):c.2940A>G (p.Glu980=) rs730881818
NM_000179.2(MSH6):c.3024C>T (p.Thr1008=) rs587780675
NM_000179.2(MSH6):c.3162C>T (p.Ile1054=) rs149605979
NM_000179.2(MSH6):c.3203G>A (p.Arg1068Gln) rs398123230
NM_000179.2(MSH6):c.3284G>A (p.Arg1095His) rs63750253
NM_000179.2(MSH6):c.3300G>A (p.Thr1100=) rs540252208
NM_000179.2(MSH6):c.3384T>C (p.Tyr1128=) rs544518097
NM_000179.2(MSH6):c.3438+11_3438+14del rs377746844
NM_000179.2(MSH6):c.3439-1G>T rs587779263
NM_000179.2(MSH6):c.3513T>C (p.Asp1171=) rs63749834
NM_000179.2(MSH6):c.3647-6T>A rs182871847
NM_000179.2(MSH6):c.3675G>A (p.Thr1225=) rs730881820
NM_000179.2(MSH6):c.3727A>T (p.Thr1243Ser) rs147453999
NM_000179.2(MSH6):c.3832C>A (p.Pro1278Thr) rs587782109
NM_000179.2(MSH6):c.3850dup (p.Thr1284fs) rs1553333421
NM_000179.2(MSH6):c.393A>C (p.Val131=) rs752488540
NM_000179.2(MSH6):c.3960A>G (p.Ala1320=) rs373425206
NM_000179.2(MSH6):c.491A>C (p.His164Pro) rs146469162
NM_000179.2(MSH6):c.628-7C>A rs373129248
NM_000179.2(MSH6):c.926C>G (p.Ser309Cys) rs544222338
NM_000179.2(MSH6):c.984C>T (p.Ser328=) rs138143769
NM_000179.3(MSH6):c.1054G>A (p.Val352Ile) rs730881787
NM_000179.3(MSH6):c.107C>T (p.Ala36Val) rs61756469
NM_000179.3(MSH6):c.10C>T (p.Gln4Ter) rs786201042
NM_000179.3(MSH6):c.1135_1139del (p.Arg378_Arg379insTer) rs267608077
NM_000179.3(MSH6):c.1483C>T rs587779212
NM_000179.3(MSH6):c.1526T>C (p.Val509Ala) rs63751005
NM_000179.3(MSH6):c.2555AGA[2] (p.Lys854del) rs587782858
NM_000179.3(MSH6):c.2667G>T (p.Gln889His) rs149945495
NM_000179.3(MSH6):c.3245C>T (p.Pro1082Leu) rs191109849
NM_000179.3(MSH6):c.3246G>T (p.Pro1082=) rs3136351
NM_000179.3(MSH6):c.3259C>T (p.Pro1087Ser) rs63750998
NM_000179.3(MSH6):c.3260C>G (p.Pro1087Arg) rs63750753
NM_000179.3(MSH6):c.3478G>A (p.Val1160Ile) rs376799914
NM_000179.3(MSH6):c.3488A>T (p.Glu1163Val) rs63750252
NM_000179.3(MSH6):c.3716_3717del (p.Ile1239fs) rs1064794384
NM_000179.3(MSH6):c.3724C>A (p.Arg1242Ser) rs587779285
NM_000179.3(MSH6):c.3799_3800del (p.Met1267fs) rs267608114
NM_000179.3(MSH6):c.3851C>T (p.Thr1284Met) rs63750836
NM_000179.3(MSH6):c.3961A>G (p.Arg1321Gly) rs41295278
NM_000179.3(MSH6):c.3986C>T (p.Ser1329Leu) rs199594809
NM_000179.3(MSH6):c.3991C>T (p.Arg1331Ter) rs267608094
NM_000179.3(MSH6):c.4001+2TAAC[2] rs267608132
NM_000179.3(MSH6):c.4001+4_4001+8dup rs587782853
NM_000179.3(MSH6):c.4002-10T>A rs545466048
NM_000179.3(MSH6):c.4068_4071dup (p.Lys1358delinsAspTer) rs55740729
NM_000179.3(MSH6):c.431G>T (p.Ser144Ile) rs3211299
NM_000179.3(MSH6):c.663A>C (p.Glu221Asp) rs41557217
NM_000179.3(MSH6):c.73G>T (p.Ala25Ser) rs267608026
NM_000179.3(MSH6):c.866_867delinsAA (p.Gly289Glu) rs267608079
NM_000179.3(MSH6):c.884A>G (p.Lys295Arg) rs267608051
NM_000243.2(MEFV):c.1437C>G (p.Phe479Leu) rs104895083
NM_000243.3(MEFV):c.1105C>T rs11466023
NM_000243.3(MEFV):c.2076_2078del (p.Ile692del) rs104895093
NM_000243.3(MEFV):c.2282G>A (p.Arg761His) rs104895097
NM_000243.3(MEFV):c.442G>C rs3743930
NM_000249.3(MLH1):c.1020C>G (p.Ser340=) rs374770981
NM_000249.3(MLH1):c.1050A>G (p.Pro350=) rs137937003
NM_000249.3(MLH1):c.1104G>A (p.Ser368=) rs769364808
NM_000249.3(MLH1):c.1128T>C (p.Asp376=) rs267607824
NM_000249.3(MLH1):c.1269G>A (p.Arg423=) rs373076967
NM_000249.3(MLH1):c.1517T>C (p.Val506Ala) rs63749909
NM_000249.3(MLH1):c.1558+4C>T rs531873434
NM_000249.3(MLH1):c.1731G>A (p.Ser577=) rs63751657
NM_000249.3(MLH1):c.1744C>T (p.Leu582Phe) rs63751713
NM_000249.3(MLH1):c.1808C>G (p.Pro603Arg) rs63750876
NM_000249.3(MLH1):c.1896G>A (p.Glu632=) rs63751632
NM_000249.3(MLH1):c.1963A>G (p.Ile655Val) rs55907433
NM_000249.3(MLH1):c.1964T>C (p.Ile655Thr) rs63751225
NM_000249.3(MLH1):c.1975C>T (p.Arg659Ter) rs63751310
NM_000249.3(MLH1):c.198C>T (p.Thr66=) rs61751642
NM_000249.3(MLH1):c.1990-6G>A rs117221851
NM_000249.3(MLH1):c.207+2T>C rs267607722
NM_000249.3(MLH1):c.2070C>T (p.Tyr690=) rs550890395
NM_000249.3(MLH1):c.2101C>A (p.Gln701Lys) rs63750114
NM_000249.3(MLH1):c.2174G>A (p.Arg725His) rs566928243
NM_000249.3(MLH1):c.2252A>G (p.Lys751Arg) rs140195825
NM_000249.3(MLH1):c.24T>A (p.Ile8=) rs748406142
NM_000249.3(MLH1):c.303T>G (p.Gly101=) rs4647220
NM_000249.3(MLH1):c.304G>A (p.Glu102Lys) rs63750453
NM_000249.3(MLH1):c.375A>G (p.Ala125=) rs1800144
NM_000249.3(MLH1):c.381-1G>A rs267607744
NM_000249.3(MLH1):c.454-10T>G rs1260098414
NM_000249.3(MLH1):c.579A>G (p.Ser193=) rs587781038
NM_000249.3(MLH1):c.676C>T (p.Arg226Ter) rs63751615
NM_000249.3(MLH1):c.69A>G (p.Glu23=) rs63750555
NM_000249.3(MLH1):c.843A>C (p.Ala281=) rs146796765
NM_000249.3(MLH1):c.885-2A>G rs267607805
NM_000249.3(MLH1):c.974G>A (p.Arg325Gln) rs63750268
NM_000249.4(MLH1):c.1013A>G (p.Asn338Ser) rs63751467
NM_000249.4(MLH1):c.1040C>A (p.Thr347Asn) rs201541505
NM_000249.4(MLH1):c.1166G>A (p.Arg389Gln) rs63750361
NM_000249.4(MLH1):c.1321G>A (p.Ala441Thr) rs63750365
NM_000249.4(MLH1):c.1360G>C (p.Gly454Arg) rs63750527
NM_000249.4(MLH1):c.1379A>C (p.Glu460Ala) rs202038499
NM_000249.4(MLH1):c.1565G>A (p.Arg522Gln) rs63751630
NM_000249.4(MLH1):c.1742C>T (p.Pro581Leu) rs63751684
NM_000249.4(MLH1):c.1820T>A (p.Leu607His) rs41295284
NM_000249.4(MLH1):c.1853A>C (p.Lys618Thr) rs63750449
NM_000249.4(MLH1):c.191A>G (p.Asn64Ser) rs63750952
NM_000249.4(MLH1):c.2066A>G (p.Gln689Arg) rs63750702
NM_000249.4(MLH1):c.394G>C (p.Asp132His) rs28930073
NM_000249.4(MLH1):c.649C>T (p.Arg217Cys) rs4986984
NM_000249.4(MLH1):c.977T>C (p.Val326Ala) rs63751049
NM_000251.2(MSH2):c.-185C>A rs188036046
NM_000251.2(MSH2):c.-9G>C rs547444746
NM_000251.2(MSH2):c.1217G>A (p.Arg406Gln) rs146567853
NM_000251.2(MSH2):c.1229del (p.Gly410fs) rs1553356700
NM_000251.2(MSH2):c.1255C>A (p.Gln419Lys) rs63750006
NM_000251.2(MSH2):c.1275A>G (p.Glu425=) rs63751650
NM_000251.2(MSH2):c.1276+2T>C rs267607953
NM_000251.2(MSH2):c.1277-8T>C rs145400590
NM_000251.2(MSH2):c.1294T>C (p.Leu432=) rs937218360
NM_000251.2(MSH2):c.1387-4G>C rs376796243
NM_000251.2(MSH2):c.1418C>T (p.Ser473Leu) rs63751403
NM_000251.2(MSH2):c.1488A>G (p.Leu496=) rs267607960
NM_000251.2(MSH2):c.1560A>G (p.Gly520=) rs63750820
NM_000251.2(MSH2):c.1638G>A (p.Lys546=) rs372350768
NM_000251.2(MSH2):c.1680T>C (p.Asn560=) rs200056411
NM_000251.2(MSH2):c.1705_1706del (p.Glu569fs) rs63750393
NM_000251.2(MSH2):c.1748A>G (p.Asn583Ser) rs201118107
NM_000251.2(MSH2):c.1760-1G>A rs587779110
NM_000251.2(MSH2):c.1760-3C>T rs786202843
NM_000251.2(MSH2):c.1865C>G (p.Pro622Arg) rs28929483
NM_000251.2(MSH2):c.1886A>G (p.Gln629Arg) rs61756468
NM_000251.2(MSH2):c.198C>T (p.Tyr66=) rs730881784
NM_000251.2(MSH2):c.2005+10C>T rs1558518671
NM_000251.2(MSH2):c.2043A>G (p.Gln681=) rs730881763
NM_000251.2(MSH2):c.211+8C>T rs267607916
NM_000251.2(MSH2):c.2120G>A (p.Cys707Tyr) rs373226409
NM_000251.2(MSH2):c.2205C>T (p.Ile735=) rs533553381
NM_000251.2(MSH2):c.2211-6C>A rs267608003
NM_000251.2(MSH2):c.2271C>T (p.Tyr757=) rs56076152
NM_000251.2(MSH2):c.2458+1G>A rs267608010
NM_000251.2(MSH2):c.317G>A (p.Arg106Lys) rs41295286
NM_000251.2(MSH2):c.336C>A (p.Ser112=) rs34312619
NM_000251.2(MSH2):c.499G>C (p.Asp167His) rs63750255
NM_000251.2(MSH2):c.4G>A (p.Ala2Thr) rs63750466
NM_000251.2(MSH2):c.505A>G (p.Ile169Val) rs63750716
NM_000251.2(MSH2):c.508C>T (p.Gln170Ter) rs63750843
NM_000251.2(MSH2):c.557A>G (p.Asn186Ser) rs151129360
NM_000251.2(MSH2):c.642A>G (p.Arg214=) rs768931909
NM_000251.2(MSH2):c.67T>C (p.Phe23Leu) rs372619120
NM_000251.2(MSH2):c.819A>G (p.Val273=) rs146577635
NM_000251.2(MSH2):c.944G>T (p.Gly315Val) rs202026056
NM_000251.2(MSH2):c.972G>A (p.Gln324=) rs63750505
NM_000251.3(MSH2):c.1147C>T (p.Arg383Ter) rs63749849
NM_000251.3(MSH2):c.1690A>G (p.Thr564Ala) rs55778204
NM_000251.3(MSH2):c.1730T>C (p.Ile577Thr) rs63749910
NM_000251.3(MSH2):c.2038C>T (p.Arg680Ter) rs63749932
NM_000251.3(MSH2):c.2228C>T rs63751155
NM_000251.3(MSH2):c.2579C>T (p.Ser860Leu) rs63750849
NM_000251.3(MSH2):c.273TCT[2] (p.Leu94del) rs267607919
NM_000251.3(MSH2):c.2785C>T (p.Arg929Ter) rs551060742
NM_000251.3(MSH2):c.435T>G (p.Ile145Met) rs63750124
NM_000251.3(MSH2):c.55T>C (p.Phe19Leu) rs141711342
NM_000251.3(MSH2):c.815C>T (p.Ala272Val) rs34136999
NM_000251.3(MSH2):c.913G>A (p.Ala305Thr) rs63751454
NM_000277.3(PAH):c.1139C>T (p.Thr380Met) rs62642937
NM_000277.3(PAH):c.1242C>T (p.Tyr414=) rs1801152
NM_000277.3(PAH):c.1243G>A (p.Asp415Asn) rs62644499
NM_000277.3(PAH):c.1278T>C (p.Asn426=) rs59326968
NM_000277.3(PAH):c.707-7A>T rs62508624
NM_000277.3(PAH):c.734T>C (p.Val245Ala) rs76212747
NM_000314.7(PTEN):c.-837C>T rs786201900
NM_000314.7(PTEN):c.-909T>C rs550385924
NM_000314.7(PTEN):c.1197A>G (p.Gln399=) rs374684043
NM_000314.7(PTEN):c.132C>T (p.Gly44=) rs150651961
NM_000314.7(PTEN):c.210-39A>G rs370918174
NM_000314.7(PTEN):c.321T>C (p.Asp107=) rs372876243
NM_000314.7(PTEN):c.367C>T (p.His123Tyr) rs786204931
NM_000314.7(PTEN):c.521A>G (p.Tyr174Cys) rs864622341
NM_000314.7(PTEN):c.720C>T (p.Tyr240=) rs190070312
NM_000314.8(PTEN):c.210-7_210-3del rs587780544
NM_000314.8(PTEN):c.234C>T (p.Thr78=) rs35917308
NM_000314.8(PTEN):c.235G>A (p.Ala79Thr) rs202004587
NM_000314.8(PTEN):c.882T>G (p.Ser294Arg) rs143335584
NM_000384.3(APOB):c.10131G>A (p.Leu3377=) rs1799812
NM_000384.3(APOB):c.10294C>G (p.Gln3432Glu)
NM_000384.3(APOB):c.11401T>A (p.Ser3801Thr)
NM_000384.3(APOB):c.11833A>G (p.Thr3945Ala) rs1801698
NM_000384.3(APOB):c.1223T>C (p.Ile408Thr)
NM_000384.3(APOB):c.12382G>A (p.Val4128Met)
NM_000384.3(APOB):c.12794T>C (p.Val4265Ala) rs61743502
NM_000384.3(APOB):c.12940A>G (p.Ile4314Val)
NM_000384.3(APOB):c.13369G>A (p.Asp4457Asn) rs183812948
NM_000384.3(APOB):c.13441G>A (p.Ala4481Thr)
NM_000384.3(APOB):c.13680T>C (p.Thr4560=) rs72654427
NM_000384.3(APOB):c.1594C>T (p.Arg532Trp)
NM_000384.3(APOB):c.1785C>G (p.Ser595=) rs139864087
NM_000384.3(APOB):c.2188G>A (p.Val730Ile)
NM_000384.3(APOB):c.26TGGCGCTGC[1] (p.9LAL[1])
NM_000384.3(APOB):c.3337G>C (p.Asp1113His)
NM_000384.3(APOB):c.3383G>A (p.Arg1128His) rs12713843
NM_000384.3(APOB):c.3427C>T (p.Pro1143Ser)
NM_000384.3(APOB):c.4163G>A (p.Arg1388His) rs13306187
NM_000384.3(APOB):c.4825T>C (p.Leu1609=) rs72653083
NM_000384.3(APOB):c.49CTG[8] (p.Leu21_Leu22dup) rs745520533
NM_000384.3(APOB):c.5066G>A (p.Arg1689His)
NM_000384.3(APOB):c.5741A>G (p.Asn1914Ser)
NM_000384.3(APOB):c.606A>T (p.Glu202Asp) rs61746672
NM_000384.3(APOB):c.6261C>A (p.Thr2087=) rs61744855
NM_000384.3(APOB):c.6636TGA[1] (p.Asp2213del) rs541497967
NM_000384.3(APOB):c.7285T>A (p.Ser2429Thr)
NM_000384.3(APOB):c.7331G>A (p.Arg2444His) rs200143030
NM_000384.3(APOB):c.7612C>T (p.Leu2538=) rs72653093
NM_000384.3(APOB):c.7615G>A (p.Val2539Ile) rs148170480
NM_000384.3(APOB):c.7696G>A (p.Glu2566Lys) rs1801696
NM_000384.3(APOB):c.8148C>T (p.Ile2716=) rs6413458
NM_000384.3(APOB):c.8295A>G (p.Gln2765=) rs767506952
NM_000384.3(APOB):c.8353A>C (p.Asn2785His) rs2163204
NM_000384.3(APOB):c.8462C>T (p.Pro2821Leu) rs72653095
NM_000384.3(APOB):c.9835A>G (p.Ser3279Gly)
NM_000384.3(APOB):c.9883T>C (p.Tyr3295His) rs186299244
NM_000455.4(STK11):c.-1C>T rs759284466
NM_000455.4(STK11):c.-2G>T rs774072752
NM_000455.4(STK11):c.1039G>A (p.Ala347Thr) rs369744528
NM_000455.4(STK11):c.1041G>A (p.Ala347=) rs537906142
NM_000455.4(STK11):c.1108+3G>A rs755746417
NM_000455.4(STK11):c.1109-3C>T rs864622219
NM_000455.4(STK11):c.1109-4C>T rs1407794756
NM_000455.4(STK11):c.1185A>G (p.Thr395=) rs370207155
NM_000455.4(STK11):c.1190C>T (p.Ala397Val) rs558040549
NM_000455.4(STK11):c.1194G>A (p.Ala398=) rs184271025
NM_000455.4(STK11):c.1284G>A (p.Ser428=) rs369097329
NM_000455.4(STK11):c.1296G>A (p.Gln432=) rs587781179
NM_000455.4(STK11):c.200T>C (p.Leu67Pro) rs137853077
NM_000455.4(STK11):c.237C>T (p.Ile79=) rs751859508
NM_000455.4(STK11):c.357C>T (p.Asn119=) rs372511774
NM_000455.4(STK11):c.375-7G>A rs587781176
NM_000455.4(STK11):c.426C>T (p.Ser142=) rs758448869
NM_000455.4(STK11):c.432G>A (p.Pro144=) rs376788924
NM_000455.4(STK11):c.464+10C>T rs587782445
NM_000455.4(STK11):c.464+9G>A rs376313955
NM_000455.4(STK11):c.537G>A (p.Pro179=) rs528535500
NM_000455.4(STK11):c.580G>A (p.Asp194Asn) rs121913315
NM_000455.4(STK11):c.594C>T (p.Ala198=) rs772940660
NM_000455.4(STK11):c.597+8C>T rs565387911
NM_000455.4(STK11):c.598-8C>T rs373610101
NM_000455.4(STK11):c.612C>T (p.Phe204=) rs774100153
NM_000455.4(STK11):c.615G>A (p.Ala205=) rs532889728
NM_000455.4(STK11):c.618G>A (p.Ala206=) rs370976710
NM_000455.4(STK11):c.666C>T (p.Pro222=) rs542189325
NM_000455.4(STK11):c.735-10C>T rs553975112
NM_000455.4(STK11):c.735-9G>A rs201899557
NM_000455.4(STK11):c.735C>G (p.Leu245=) rs773147894
NM_000455.4(STK11):c.787T>C (p.Leu263=) rs372378119
NM_000455.4(STK11):c.795G>A (p.Glu265=) rs730881963
NM_000455.4(STK11):c.825G>A (p.Pro275=) rs202011521
NM_000455.4(STK11):c.840C>T (p.Pro280=) rs1471868090
NM_000455.4(STK11):c.920+7G>A rs2075607
NM_000455.4(STK11):c.921-10G>A rs183406870
NM_000455.4(STK11):c.921-9C>T rs761688641
NM_000455.4(STK11):c.945G>A (p.Pro315=) rs376329042
NM_000455.4(STK11):c.970C>G (p.Pro324Ala) rs549474196
NM_000455.5(STK11):c.1038C>T (p.Gly346=) rs767565606
NM_000455.5(STK11):c.1211C>T (p.Ser404Phe) rs200078204
NM_000455.5(STK11):c.1225C>T (p.Arg409Trp) rs368466538
NM_000455.5(STK11):c.559G>A (p.Gly187Ser) rs587782032
NM_000455.5(STK11):c.842C>T (p.Pro281Leu) rs121913322
NM_000455.5(STK11):c.894C>A (p.Phe298Leu) rs199681533
NM_000465.4(BARD1):c.1059C>G (p.Pro353=) rs368649242
NM_000465.4(BARD1):c.1152C>T (p.Ser384=) rs368291318
NM_000465.4(BARD1):c.1194A>G (p.Thr398=) rs781482219
NM_000465.4(BARD1):c.144G>A (p.Leu48=) rs151168457
NM_000465.4(BARD1):c.1473G>A (p.Gly491=) rs151080730
NM_000465.4(BARD1):c.1652C>G (p.Ser551Ter) rs587781707
NM_000465.4(BARD1):c.1670G>C (p.Cys557Ser) rs28997576
NM_000465.4(BARD1):c.1694G>A (p.Arg565His) rs146946984
NM_000465.4(BARD1):c.1738G>A (p.Glu580Lys) rs35306212
NM_000465.4(BARD1):c.1972C>T (p.Arg658Cys) rs3738888
NM_000465.4(BARD1):c.1973G>A (p.Arg658His) rs377227840
NM_000465.4(BARD1):c.1977A>G (p.Arg659=) rs147215925
NM_000465.4(BARD1):c.2191C>G (p.Arg731Gly) rs76744638
NM_000465.4(BARD1):c.2280G>A (p.Ser760=) rs749959440
NM_000465.4(BARD1):c.2282G>A (p.Ser761Asn) rs142155101
NM_000465.4(BARD1):c.253G>T (p.Val85Leu) rs370359540
NM_000465.4(BARD1):c.33G>T (p.Gln11His) rs143914387
NM_000465.4(BARD1):c.348T>C (p.His116=) rs139934362
NM_000465.4(BARD1):c.364+7A>C rs1475396127
NM_000465.4(BARD1):c.568G>A (p.Asp190Asn) rs369561166
NM_000465.4(BARD1):c.609A>C (p.Gly203=) rs28997574
NM_000465.4(BARD1):c.620A>G (p.Lys207Arg) rs34969857
NM_000465.4(BARD1):c.668A>G (p.Glu223Gly) rs145009419
NM_000465.4(BARD1):c.722C>G (p.Ser241Cys) rs3738885
NM_000465.4(BARD1):c.738A>G (p.Pro246=) rs587780859
NM_000465.4(BARD1):c.773T>C (p.Ile258Thr) rs146223579
NM_000465.4(BARD1):c.90T>A (p.Gly30=) rs150354152
NM_000492.3(CFTR):c.-461A>G rs185028612
NM_000492.3(CFTR):c.-812T>G rs181008242
NM_000492.3(CFTR):c.1001G>A (p.Arg334Gln) rs397508137
NM_000492.3(CFTR):c.1046C>T (p.Ala349Val) rs121909021
NM_000492.3(CFTR):c.1054C>T (p.Arg352Trp) rs193922497
NM_000492.3(CFTR):c.1135G>T (p.Glu379Ter) rs397508165
NM_000492.3(CFTR):c.1516A>G (p.Ile506Val) rs1800091
NM_000492.3(CFTR):c.1521_1523delCTT (p.Phe508delPhe) rs113993960
NM_000492.3(CFTR):c.1584+12T>C rs193922502
NM_000492.3(CFTR):c.1584+53_1584+63dup rs397508232
NM_000492.3(CFTR):c.1666A>G (p.Ile556Val) rs75789129
NM_000492.3(CFTR):c.2559T>C (p.Ile853=) rs1800104
NM_000492.3(CFTR):c.2620-15C>G rs139379077
NM_000492.3(CFTR):c.2620-26A>G rs201716473
NM_000492.3(CFTR):c.2735C>T (p.Ser912Leu) rs121909034
NM_000492.3(CFTR):c.2856G>C (p.Met952Ile) rs151048781
NM_000492.3(CFTR):c.2909-15T>G rs397508455
NM_000492.3(CFTR):c.3080T>C (p.Ile1027Thr) rs1800112
NM_000492.3(CFTR):c.3205G>A (p.Gly1069Arg) rs200321110
NM_000492.3(CFTR):c.3429G>A (p.Leu1143=) rs375845215
NM_000492.3(CFTR):c.3469-17T>C rs199630678
NM_000492.3(CFTR):c.349C>G (p.Arg117Gly) rs77834169
NM_000492.3(CFTR):c.3558A>G (p.Gln1186=) rs1800121
NM_000492.3(CFTR):c.360G>A (p.Ala120=) rs1800077
NM_000492.3(CFTR):c.3718-24G>A rs374013084
NM_000492.3(CFTR):c.4056G>T (p.Gln1352His) rs113857788
NM_000492.3(CFTR):c.4243-20A>G rs138025486
NM_000492.3(CFTR):c.4243-5C>T rs114402068
NM_000492.3(CFTR):c.4243-7del rs878854021
NM_000492.3(CFTR):c.4272C>T (p.Tyr1424=) rs1800135
NM_000492.3(CFTR):c.4296C>T (p.Asn1432=) rs761669740
NM_000492.3(CFTR):c.4357C>T (p.Arg1453Trp) rs4148725
NM_000492.3(CFTR):c.598T>A (p.Phe200Ile) rs397508766
NM_000492.3(CFTR):c.650A>G (p.Glu217Gly) rs121909046
NM_000492.3(CFTR):c.744-33GATT[8] rs1805171
NM_000492.3(CFTR):c.870-7_870-5del rs759762840
NM_000492.3(CFTR):c.91C>T (p.Arg31Cys) rs1800073
NM_000492.3(CFTR):c.935_937delTCT (p.Phe312del) rs121908768
NM_000492.4(CFTR):c.1052C>G (p.Thr351Ser) rs1800086
NM_000492.4(CFTR):c.1055G>A (p.Arg352Gln) rs121908753
NM_000492.4(CFTR):c.1327G>T (p.Asp443Tyr) rs147422190
NM_000492.4(CFTR):c.1367T>C rs193922500
NM_000492.4(CFTR):c.14C>T (p.Pro5Leu) rs193922501
NM_000492.4(CFTR):c.1518C>A (p.Ile506=) rs1800092
NM_000492.4(CFTR):c.1523T>G (p.Phe508Cys) rs74571530
NM_000492.4(CFTR):c.1581A>G (p.Glu527=) rs1800094
NM_000492.4(CFTR):c.1584G>A (p.Glu528=) rs1800095
NM_000492.4(CFTR):c.1624G>T (p.Gly542Ter) rs113993959
NM_000492.4(CFTR):c.1646G>A (p.Ser549Asn) rs121908755
NM_000492.4(CFTR):c.1647T>G (p.Ser549Arg) rs121909005
NM_000492.4(CFTR):c.1652G>A (p.Gly551Asp) rs75527207
NM_000492.4(CFTR):c.1727G>C (p.Gly576Ala) rs1800098
NM_000492.4(CFTR):c.2002C>T (p.Arg668Cys) rs1800100
NM_000492.4(CFTR):c.200C>T (p.Pro67Leu) rs368505753
NM_000492.4(CFTR):c.220C>T (p.Arg74Trp) rs115545701
NM_000492.4(CFTR):c.2249C>T (p.Pro750Leu) rs140455771
NM_000492.4(CFTR):c.224G>A (p.Arg75Gln) rs1800076
NM_000492.4(CFTR):c.2260G>A (p.Val754Met) rs150157202
NM_000492.4(CFTR):c.274-6T>C rs371315549
NM_000492.4(CFTR):c.2820T>G (p.Thr940=) rs60887846
NM_000492.4(CFTR):c.2834C>T (p.Ser945Leu) rs397508442
NM_000492.4(CFTR):c.2898G>A (p.Thr966=) rs1800109
NM_000492.4(CFTR):c.2900T>C (p.Leu967Ser) rs1800110
NM_000492.4(CFTR):c.2991G>C (p.Leu997Phe) rs1800111
NM_000492.4(CFTR):c.3154T>G (p.Phe1052Val) rs150212784
NM_000492.4(CFTR):c.3199G>A (p.Ala1067Thr) rs121909020
NM_000492.4(CFTR):c.3208C>T (p.Arg1070Trp) rs202179988
NM_000492.4(CFTR):c.3285A>T (p.Thr1095=) rs1800118
NM_000492.4(CFTR):c.3297C>A rs747754623
NM_000492.4(CFTR):c.3454G>C (p.Asp1152His) rs75541969
NM_000492.4(CFTR):c.350G>A (p.Arg117His) rs78655421
NM_000492.4(CFTR):c.3705T>G (p.Ser1235Arg) rs34911792
NM_000492.4(CFTR):c.3752G>A (p.Ser1251Asn) rs74503330
NM_000492.4(CFTR):c.3808G>A (p.Asp1270Asn) rs11971167
NM_000492.4(CFTR):c.3846G>A (p.Trp1282Ter) rs77010898
NM_000492.4(CFTR):c.3897A>G (p.Thr1299=) rs1800131
NM_000492.4(CFTR):c.4243-35del rs193922527
NM_000492.4(CFTR):c.4333G>A (p.Asp1445Asn) rs148783445
NM_000492.4(CFTR):c.443T>C (p.Ile148Thr) rs35516286
NM_000492.4(CFTR):c.489+3A>G rs377729736
NM_000492.4(CFTR):c.509G>A (p.Arg170His) rs1800079
NM_000492.4(CFTR):c.532G>A (p.Gly178Arg) rs80282562
NM_000492.4(CFTR):c.617T>G (p.Leu206Trp) rs121908752
NM_000492.4(CFTR):c.695T>A (p.Val232Asp) rs397508783
NM_000492.4(CFTR):c.772A>G (p.Arg258Gly) rs191456345
NM_000500.9(CYP21A2):c.1439G>T (p.Arg480Leu) rs184649564
NM_000500.9(CYP21A2):c.844G>T (p.Val282Leu) rs6471
NM_000517.4(HBA2):c.-41C>G rs1188584832
NM_000517.4(HBA2):c.427T>A (p.Ter143Lys) rs41464951
NM_000517.4(HBA2):c.427T>C (p.Ter143Gln) rs41464951
NM_000517.4(HBA2):c.427T>G (p.Ter143Glu) rs41464951
NM_000517.4(HBA2):c.49A>G (p.Lys17Glu) rs281865555
NM_000517.6(HBA2):c.*103G>A rs1363099908
NM_000517.6(HBA2):c.*98T>C rs1455865276
NM_000517.6(HBA2):c.146T>G (p.Leu49Arg) rs41392146
NM_000517.6(HBA2):c.237C>A (p.Asn79Lys) rs281860607
NM_000517.6(HBA2):c.257A>T (p.Asp86Val) rs41331747
NM_000517.6(HBA2):c.300+64A>G rs111264741
NM_000517.6(HBA2):c.301-24delinsCTCGGCCC rs1596570272
NM_000517.6(HBA2):c.344C>T (p.Pro115Leu) rs267607269
NM_000517.6(HBA2):c.377T>G (p.Leu126Arg) rs41397847
NM_000517.6(HBA2):c.379G>A (p.Asp127Asn) rs33933481
NM_000517.6(HBA2):c.38C>A (p.Ala13Asp)
NM_000517.6(HBA2):c.391G>C (p.Ala131Pro) rs41529844
NM_000517.6(HBA2):c.40G>C (p.Ala14Pro) rs281860609
NM_000517.6(HBA2):c.420del (p.Lys140fs) rs63750520
NM_000517.6(HBA2):c.428A>C (p.Ter143Ser) rs41321345
NM_000517.6(HBA2):c.64G>C (p.Ala22Pro) rs281864817
NM_000517.6(HBA2):c.69C>T (p.Gly23=) rs63751457
NM_000517.6(HBA2):c.89T>C (p.Leu30Pro) rs41341344
NM_000517.6(HBA2):c.95+27C>T rs558457816
NM_000517.6(HBA2):c.95+39C>G rs1025977498
NM_000517.6(HBA2):c.98T>G (p.Met33Arg) rs1468615416
NM_000518.4(HBB):c.-82C>T rs34500389
NM_000518.4(HBB):c.142G>A (p.Asp48Asn) rs33932070
NM_000518.4(HBB):c.157G>A (p.Asp53Asn) rs33961886
NM_000518.4(HBB):c.157G>C (p.Asp53His) rs33961886
NM_000518.4(HBB):c.191A>G (p.His64Arg) rs33985544
NM_000518.4(HBB):c.208G>A (p.Gly70Ser) rs33947415
NM_000518.4(HBB):c.220G>A (p.Asp74Asn) rs33945705
NM_000518.4(HBB):c.232C>G (p.His78Asp) rs33991294
NM_000518.4(HBB):c.23A>G (p.Glu8Gly) rs34387455
NM_000518.4(HBB):c.263C>A (p.Thr88Lys) rs33993568
NM_000518.4(HBB):c.275T>G (p.Leu92Arg) rs33917785
NM_000518.4(HBB):c.283G>A (p.Asp95Asn) rs33959340
NM_000518.4(HBB):c.29C>G (p.Ser10Cys) rs33918131
NM_000518.4(HBB):c.34G>A (p.Val12Ile) rs33974228
NM_000518.4(HBB):c.34G>T (p.Val12Phe) rs33974228
NM_000518.4(HBB):c.364G>A (p.Glu122Lys) rs33946267
NM_000518.4(HBB):c.364G>C (p.Glu122Gln) rs33946267
NM_000518.4(HBB):c.374C>A (p.Pro125Gln) rs33983276
NM_000518.4(HBB):c.374C>T (p.Pro125Leu) rs33983276
NM_000518.4(HBB):c.404T>C (p.Val135Ala) rs33966761
NM_000518.4(HBB):c.410G>A (p.Gly137Asp) rs33949486
NM_000518.4(HBB):c.44T>C (p.Leu15Pro) rs33935445
NM_000518.4(HBB):c.44T>G (p.Leu15Arg) rs33935445
NM_000518.4(HBB):c.64G>T (p.Asp22Tyr) rs33950093
NM_000518.4(HBB):c.67G>C (p.Glu23Gln) rs33959855
NM_000518.4(HBB):c.68A>C (p.Glu23Ala) rs33936254
NM_000518.4(HBB):c.68A>G (p.Glu23Gly) rs33936254
NM_000518.4(HBB):c.68A>T (p.Glu23Val) rs33936254
NM_000518.4(HBB):c.71T>A (p.Val24Asp) rs33945546
NM_000518.5(HBB):c.*96T>C rs34029390
NM_000518.5(HBB):c.-138C>A rs33944208
NM_000518.5(HBB):c.-31C>T rs63750628
NM_000518.5(HBB):c.-50A>C rs34305195
NM_000518.5(HBB):c.-75G>C rs63750400
NM_000518.5(HBB):c.-80T>A rs33980857
NM_000518.5(HBB):c.-92C>G rs397515291
NM_000518.5(HBB):c.103G>T (p.Val35Phe) rs1141387
NM_000518.5(HBB):c.122G>A (p.Arg41Lys) rs34831026
NM_000518.5(HBB):c.16C>T (p.Pro6Ser) rs33912272
NM_000518.5(HBB):c.179A>C (p.Lys60Thr) rs35537181
NM_000518.5(HBB):c.221_224dup (p.Leu76fs) rs1564875128
NM_000518.5(HBB):c.246C>A (p.Leu82=) rs145669504
NM_000518.5(HBB):c.250G>C (p.Gly84Arg) rs33930385
NM_000518.5(HBB):c.250G>T (p.Gly84Cys) rs33930385
NM_000518.5(HBB):c.253A>G (p.Thr85Ala) rs35960772
NM_000518.5(HBB):c.274C>T (p.Leu92=) rs769583496
NM_000518.5(HBB):c.286A>G (p.Lys96Glu) rs33914359
NM_000518.5(HBB):c.294C>T (p.His98=) rs34515413
NM_000518.5(HBB):c.315G>C (p.Arg105Ser) rs33914944
NM_000518.5(HBB):c.316-114C>A rs1003790835
NM_000518.5(HBB):c.316-124A>T rs1184042209
NM_000518.5(HBB):c.316-125A>G rs63751175
NM_000518.5(HBB):c.316-138G>A rs1444028845
NM_000518.5(HBB):c.316-179A>C rs185607297
NM_000518.5(HBB):c.316-189A>G rs1034207896
NM_000518.5(HBB):c.316-19T>A rs191535077
NM_000518.5(HBB):c.316-292del rs1170203019
NM_000518.5(HBB):c.316-3C>G rs33913413
NM_000518.5(HBB):c.316-7C>A rs34483965
NM_000518.5(HBB):c.316-96G>C rs193922561
NM_000518.5(HBB):c.316C>T (p.Leu106Phe) rs34022507
NM_000518.5(HBB):c.323dup (p.Asn109fs) rs35225141
NM_000518.5(HBB):c.324C>T (p.Gly108=) rs193922562
NM_000518.5(HBB):c.328G>C (p.Val110Leu) rs33969677
NM_000518.5(HBB):c.33C>A (p.Ala11=) rs35799536
NM_000518.5(HBB):c.341T>A (p.Val114Glu) rs34484056
NM_000518.5(HBB):c.344T>C (p.Leu115Pro) rs36015961
NM_000518.5(HBB):c.359G>A (p.Gly120Asp) rs33947020
NM_000518.5(HBB):c.363A>C (p.Lys121Asn) rs34726542
NM_000518.5(HBB):c.380T>A (p.Val127Glu) rs33925391
NM_000518.5(HBB):c.380T>C (p.Val127Ala) rs33925391
NM_000518.5(HBB):c.380T>G (p.Val127Gly) rs33925391
NM_000518.5(HBB):c.389C>T (p.Ala130Val) rs111645889
NM_000518.5(HBB):c.394C>A (p.Gln132Lys) rs33910209
NM_000518.5(HBB):c.394C>G (p.Gln132Glu) rs33910209
NM_000518.5(HBB):c.397A>C (p.Lys133Gln) rs33953406
NM_000518.5(HBB):c.402G>C (p.Val134=) rs113082294
NM_000518.5(HBB):c.431A>G (p.His144Arg) rs33918338
NM_000518.5(HBB):c.437A>G (p.Tyr146Cys) rs35117167
NM_000518.5(HBB):c.440_441dup (p.Ter148ThrextTer?) rs33999427
NM_000518.5(HBB):c.45G>A (p.Leu15=) rs762782573
NM_000518.5(HBB):c.4G>A (p.Val2Met) rs33958358
NM_000518.5(HBB):c.50G>A (p.Gly17Asp) rs33962676
NM_000518.5(HBB):c.57G>A (p.Val19=) rs1554918177
NM_000518.5(HBB):c.59A>G (p.Asn20Ser) rs33972047
NM_000518.5(HBB):c.61G>A (p.Val21Met) rs35890959
NM_000518.5(HBB):c.75T>A (p.Gly25=) rs33951465
NM_000518.5(HBB):c.93-23T>C rs111851677
NM_000518.5(HBB):c.93G>T (p.Arg31Ser) rs1135071
NM_000520.6(HEXA):c.1306A>G (p.Ile436Val) rs1800431
NM_000520.6(HEXA):c.1518A>G (p.Glu506=) rs4777502
NM_000527.4(LDLR):c.1056C>T (p.Cys352=) rs13306515
NM_000527.4(LDLR):c.1402G>A (p.Val468Ile) rs5932
NM_000527.4(LDLR):c.313+1G>A
NM_000527.4(LDLR):c.993C>T (p.Asp331=) rs147905921
NM_000527.5(LDLR):c.1027G>A (p.Gly343Ser)
NM_000527.5(LDLR):c.1061-8T>C
NM_000527.5(LDLR):c.1414G>T (p.Asp472Tyr) rs730882102
NM_000527.5(LDLR):c.1576C>T (p.Pro526Ser) rs730882106
NM_000527.5(LDLR):c.1706-10G>A
NM_000527.5(LDLR):c.2177C>T (p.Thr726Ile)
NM_000527.5(LDLR):c.2231G>A (p.Arg744Gln)
NM_000527.5(LDLR):c.2479G>A (p.Val827Ile) rs137853964
NM_000527.5(LDLR):c.519C>G (p.Cys173Trp) rs769318035
NM_000527.5(LDLR):c.589T>G (p.Cys197Gly) rs730882085
NM_000527.5(LDLR):c.829G>A (p.Glu277Lys)
NM_000527.5(LDLR):c.910G>A (p.Asp304Asn) rs121908030
NM_000527.5(LDLR):c.941-4G>A
NM_000535.7(PMS2):c.1004A>G (p.Asn335Ser) rs200513014
NM_000535.7(PMS2):c.1145-10G>A rs533551639
NM_000535.7(PMS2):c.116del (p.Val39fs) rs1064794152
NM_000535.7(PMS2):c.1199A>C (p.Gln400Pro) rs148069478
NM_000535.7(PMS2):c.1242C>T (p.Asp414=) rs142839559
NM_000535.7(PMS2):c.1248C>A (p.Ser416=) rs780709321
NM_000535.7(PMS2):c.1320A>G (p.Pro440=) rs138697590
NM_000535.7(PMS2):c.137G>A (p.Ser46Asn) rs121434629
NM_000535.7(PMS2):c.137G>T (p.Ser46Ile) rs121434629
NM_000535.7(PMS2):c.1463C>T (p.Ala488Val) rs587779328
NM_000535.7(PMS2):c.1467G>A (p.Glu489=) rs542522853
NM_000535.7(PMS2):c.1490G>A (p.Gly497Asp) rs199739859
NM_000535.7(PMS2):c.1533G>A (p.Thr511=) rs542520309
NM_000535.7(PMS2):c.1560G>A (p.Ala520=) rs201167814
NM_000535.7(PMS2):c.1569C>G (p.Ser523=) rs141458772
NM_000535.7(PMS2):c.1656T>C (p.His552=) rs113726095
NM_000535.7(PMS2):c.166C>G (p.Leu56Val) rs371011390
NM_000535.7(PMS2):c.1806C>G (p.Ala602=) rs376046767
NM_000535.7(PMS2):c.1980C>T (p.Ala660=) rs368928783
NM_000535.7(PMS2):c.2049C>T (p.Asn683=) rs752950007
NM_000535.7(PMS2):c.2095G>C (p.Asp699His) rs587781317
NM_000535.7(PMS2):c.2149G>A (p.Val717Met) rs201671325
NM_000535.7(PMS2):c.2160G>A (p.Gly720=) rs546441038
NM_000535.7(PMS2):c.2187C>G (p.Leu729=) rs373630535
NM_000535.7(PMS2):c.23+7G>C rs878854047
NM_000535.7(PMS2):c.2350G>A (p.Asp784Asn) rs143340522
NM_000535.7(PMS2):c.2356C>A (p.Leu786Met) rs576055272
NM_000535.7(PMS2):c.2395C>T (p.Arg799Trp) rs149202766
NM_000535.7(PMS2):c.240C>T (p.Phe80=) rs143162541
NM_000535.7(PMS2):c.2445G>A (p.Ser815=) rs753199796
NM_000535.7(PMS2):c.255G>A (p.Leu85=) rs200491279
NM_000535.7(PMS2):c.353+6A>G rs376449640
NM_000535.7(PMS2):c.354-2A>G rs786202098
NM_000535.7(PMS2):c.379G>A (p.Ala127Thr) rs114090343
NM_000535.7(PMS2):c.477G>A (p.Val159=) rs147701251
NM_000535.7(PMS2):c.497T>C (p.Leu166Pro) rs116349687
NM_000535.7(PMS2):c.53T>C (p.Ile18Thr) rs201343342
NM_000535.7(PMS2):c.572A>G (p.Tyr191Cys) rs375289386
NM_000535.7(PMS2):c.595C>T (p.Arg199Cys) rs372297364
NM_000535.7(PMS2):c.620G>A (p.Gly207Glu) rs374704824
NM_000535.7(PMS2):c.756_757del (p.Cys252_Glu253delinsTer) rs1064794905
NM_000535.7(PMS2):c.795T>C (p.Asn265=) rs766667186
NM_000535.7(PMS2):c.831G>A (p.Thr277=) rs116481522
NM_000535.7(PMS2):c.903+1G>A
NM_000535.7(PMS2):c.903+4T>A rs753803330
NM_000535.7(PMS2):c.936G>A (p.Met312Ile) rs139194813
NM_000535.7(PMS2):c.953A>G (p.Tyr318Cys) rs139438201
NM_000546.5(TP53):c.1014C>T (p.Phe338=) rs150293825
NM_000546.5(TP53):c.1015G>A (p.Glu339Lys) rs17882252
NM_000546.5(TP53):c.102C>G (p.Pro34=) rs11575998
NM_000546.5(TP53):c.1079G>C (p.Gly360Ala) rs35993958
NM_000546.5(TP53):c.1079G>T (p.Gly360Val) rs35993958
NM_000546.5(TP53):c.123T>C (p.Asp41=) rs369129220
NM_000546.5(TP53):c.18A>C (p.Ser6=) rs573130482
NM_000546.5(TP53):c.217G>A (p.Val73Met) rs587782423
NM_000546.5(TP53):c.248C>T (p.Ala83Val) rs201717599
NM_000546.5(TP53):c.255T>C (p.Pro85=) rs775515332
NM_000546.5(TP53):c.319T>C (p.Tyr107His) rs368771578
NM_000546.5(TP53):c.354A>T (p.Thr118=) rs751978853
NM_000546.5(TP53):c.374C>T (p.Thr125Met) rs786201057
NM_000546.5(TP53):c.464C>G (p.Thr155Ser) rs786202752
NM_000546.5(TP53):c.472C>T (p.Arg158Cys) rs587780068
NM_000546.5(TP53):c.510G>A (p.Thr170=) rs757544615
NM_000546.5(TP53):c.559+8G>A rs775915220
NM_000546.5(TP53):c.63C>T (p.Asp21=) rs1800369
NM_000546.5(TP53):c.666G>T (p.Pro222=) rs72661118
NM_000546.5(TP53):c.6G>A (p.Glu2=) rs143458271
NM_000546.5(TP53):c.704A>G (p.Asn235Ser) rs144340710
NM_000546.5(TP53):c.772G>A (p.Glu258Lys) rs121912652
NM_000546.5(TP53):c.848G>A (p.Arg283His) rs371409680
NM_000546.5(TP53):c.920-5C>T rs34361146
NM_000546.5(TP53):c.97-9C>T rs202217267
NM_000546.6(TP53):c.1040C>A (p.Ala347Asp) rs397516434
NM_000546.6(TP53):c.31G>C (p.Glu11Gln) rs201382018
NM_000546.6(TP53):c.638G>A (p.Arg213Gln) rs587778720
NM_000546.6(TP53):c.642T>G (p.His214Gln) rs587781386
NM_000546.6(TP53):c.743G>A (p.Arg248Gln) rs11540652
NM_000546.6(TP53):c.885T>C (p.Pro295=) rs200073907
NM_000546.6(TP53):c.903A>G (p.Pro301=) rs72661120
NM_000546.6(TP53):c.935C>G (p.Thr312Ser) rs145151284
NM_000552.4(VWF):c.1614C>T (p.Pro538=) rs138268387
NM_000552.4(VWF):c.2451T>A (p.His817Gln) rs57950734
NM_000552.4(VWF):c.2561G>A (p.Arg854Gln) rs41276738
NM_000552.4(VWF):c.2771G>A (p.Arg924Gln) rs33978901
NM_000552.4(VWF):c.3426T>C (p.Cys1142=) rs535693463
NM_000552.4(VWF):c.3686T>G (p.Val1229Gly) rs61749367
NM_000552.4(VWF):c.3692A>C (p.Asn1231Thr) rs61749368
NM_000552.4(VWF):c.3719C>T (p.Pro1240Leu) rs150576611
NM_000552.4(VWF):c.3789G>A (p.Ser1263=) rs199831474
NM_000552.4(VWF):c.3797C>T (p.Pro1266Leu) rs61749370
NM_000552.4(VWF):c.3916C>T (p.Arg1306Trp) rs61749384
NM_000552.4(VWF):c.3922C>T (p.Arg1308Cys) rs61749387
NM_000552.4(VWF):c.4195C>T (p.Arg1399Cys) rs61750077
NM_000552.4(VWF):c.4443G>T (p.Gly1481=) rs144796763
NM_000552.4(VWF):c.4641T>C (p.Thr1547=) rs216310
NM_000552.4(VWF):c.4751A>G (p.Tyr1584Cys) rs1800386
NM_000552.4(VWF):c.4824C>T (p.Thr1608=) rs142635883
NM_000552.4(VWF):c.5170+10C>T rs61750601
NM_000552.4(VWF):c.5191T>A (p.Ser1731Thr) rs61750603
NM_000552.4(VWF):c.5277C>T (p.Asp1759=) rs41276736
NM_000552.4(VWF):c.5313G>T (p.Gly1771=) rs2229448
NM_000552.4(VWF):c.546G>A (p.Ser182=) rs143054357
NM_000552.4(VWF):c.6187C>T (p.Pro2063Ser) rs61750615
NM_000552.4(VWF):c.658-3C>A rs377196768
NM_000552.4(VWF):c.7988G>C (p.Arg2663Pro) rs149834874
NM_000552.4(VWF):c.7997C>T (p.Thr2666Met) rs78353028
NM_000552.5(VWF):c.4196G>A rs1800382
NM_000558.3(HBA1):c.154G>C (p.Gly52Arg) rs33960522
NM_000558.3(HBA1):c.179G>A (p.Gly60Asp) rs28928878
NM_000558.3(HBA1):c.193G>C (p.Asp65His) rs33984024
NM_000558.3(HBA1):c.283G>C (p.Asp95His) rs34102339
NM_000558.3(HBA1):c.344C>G (p.Pro115Arg) rs33910377
NM_000558.3(HBA1):c.49A>G (p.Lys17Glu) rs41407250
NM_000558.5(HBA1):c.*46C>A rs141514155
NM_000558.5(HBA1):c.-42C>T rs370305736
NM_000558.5(HBA1):c.-52C>T rs1276035978
NM_000558.5(HBA1):c.104T>G (p.Leu35Arg) rs35203445
NM_000558.5(HBA1):c.17C>A (p.Ala6Asp) rs34090856
NM_000558.5(HBA1):c.223G>C (p.Asp75His) rs28928875
NM_000558.5(HBA1):c.301-31_301-24delinsG
NM_000558.5(HBA1):c.337C>G (p.His113Asp) rs34830032
NM_000558.5(HBA1):c.362C>A (p.Ala121Glu) rs63749927
NM_000558.5(HBA1):c.364G>A (p.Val122Met) rs63751008
NM_000558.5(HBA1):c.396T>C (p.Ser132=) rs149264789
NM_000558.5(HBA1):c.47G>A (p.Gly16Asp) rs281865560
NM_000558.5(HBA1):c.84G>T (p.Glu28Asp) rs41530750
NM_000558.5(HBA1):c.91G>A (p.Glu31Lys) rs33993166
NM_000558.5(HBA1):c.96-1G>A rs34883113
NM_001024688.2(NBN):c.896del (p.Pro299fs) rs587781969
NM_001048171.1(MUTYH):c.1076C>T (p.Ala359Val) rs35352891
NM_001048171.1(MUTYH):c.1378C>T (p.Arg460Cys) rs200229669
NM_001048171.1(MUTYH):c.1506G>A (p.Pro502=) rs143796254
NM_001048171.1(MUTYH):c.654C>T (p.Thr218=) rs780747266
NM_001048171.1(MUTYH):c.956-9C>T rs3219488
NM_001048174.2(MUTYH):c.1103G>A (p.Gly368Asp) rs36053993
NM_001048174.2(MUTYH):c.1174C>A (p.Leu392Met) rs144079536
NM_001048174.2(MUTYH):c.1192C>T (p.Arg398Cys) rs150792276
NM_001048174.2(MUTYH):c.11C>T (p.Pro4Leu) rs79777494
NM_001048174.2(MUTYH):c.1347G>C (p.Thr449=) rs74318065
NM_001048174.2(MUTYH):c.228C>T (p.Tyr76=) rs121908380
NM_001048174.2(MUTYH):c.241C>T (p.Arg81Trp) rs765123255
NM_001048174.2(MUTYH):c.32G>A (p.Gly11Asp) rs75321043
NM_001048174.2(MUTYH):c.637C>T (p.Arg213Trp) rs34126013
NM_001048174.2(MUTYH):c.737G>A (p.Arg246Gln) rs149866955
NM_001048174.2(MUTYH):c.774G>A (p.Gly258=) rs771290019
NM_001048174.2(MUTYH):c.841C>T (p.Arg281Cys) rs138089183
NM_001048174.2(MUTYH):c.850-2A>G rs77542170
NM_001048174.2(MUTYH):c.954G>A (p.Ser318=) rs372673338
NM_001110792.2(MECP2):c.1162C>T (p.Pro388Ser) rs61752387
NM_001110792.2(MECP2):c.491C>G (p.Pro164Arg) rs61748404
NM_001126049.2(KLLN):c.-671A>G rs70937047
NM_001126049.2(KLLN):c.-794_-783del rs587781340
NM_001126049.2(KLLN):c.-840G>A rs563841270
NM_001128425.1(MUTYH):c.389-6C>T rs376600220
NM_001128425.1(MUTYH):c.548G>A (p.Gly183Asp) rs587781864
NM_001142571.2(RAD51D):c.726A>G (p.Glu242=) rs114012742
NM_001142571.2(RAD51D):c.758A>G (p.Glu253Gly) rs28363284
NM_001167617.2(MLH1):c.*32_*34CTT[1] rs193922366
NM_001167617.2(MLH1):c.-426_-425delinsTG rs63749994
NM_001167617.2(MLH1):c.-7del rs1064795441
NM_001281492.1(MSH6):c.1511_1512del (p.Thr503_Leu504insTer) rs267608082
NM_001281492.1(MSH6):c.2647_2651del (p.Lys883fs) rs587782712
NM_001281492.1(MSH6):c.3488_3491dup (p.Pro1165fs) rs1553333500
NM_001281492.1(MSH6):c.3693_*3GACT[3] (p.Ter1231=) rs765313977
NM_001281492.1(MSH6):c.778_780delinsAA (p.Asp260fs) rs863225398
NM_001354630.1(MLH1):c.1732-878_1732-877delinsGC rs35502531
NM_001354712.2(THRB):c.994G>A (p.Gly332Arg) rs28999969
NM_001370658.1(BTD):c.1041C>T (p.Gly347=) rs142421934
NM_001370658.1(BTD):c.1147T>G (p.Phe383Val) rs104893686
NM_002485.4(NBN):c.-2C>A rs202104448
NM_002485.4(NBN):c.1035C>T (p.Gly345=) rs146605798
NM_002485.4(NBN):c.1036G>A (p.Val346Met) rs200297914
NM_002485.4(NBN):c.1124+6G>T rs375862750
NM_002485.4(NBN):c.1222A>G (p.Lys408Glu) rs34120922
NM_002485.4(NBN):c.1317A>G (p.Ile439Met) rs28538230
NM_002485.4(NBN):c.1398-10dup rs587780555
NM_002485.4(NBN):c.1454C>T (p.Thr485Met) rs200891292
NM_002485.4(NBN):c.1489A>G (p.Thr497Ala) rs3026268
NM_002485.4(NBN):c.1690G>A (p.Glu564Lys) rs72550742
NM_002485.4(NBN):c.1720T>A (p.Leu574Ile) rs142334798
NM_002485.4(NBN):c.1777C>G (p.Pro593Ala) rs146989944
NM_002485.4(NBN):c.1809C>A (p.Phe603Leu) rs192236678
NM_002485.4(NBN):c.1882G>A (p.Glu628Lys) rs115321485
NM_002485.4(NBN):c.1914+10G>A rs577706448
NM_002485.4(NBN):c.207A>G (p.Lys69=) rs754352569
NM_002485.4(NBN):c.2196A>G (p.Gln732=) rs587780780
NM_002485.4(NBN):c.37+10G>C rs369408590
NM_002485.4(NBN):c.426T>C (p.Asn142=) rs143070291
NM_002485.4(NBN):c.441C>T (p.Cys147=) rs137857529
NM_002485.4(NBN):c.584+6T>C rs1554566602
NM_002485.4(NBN):c.584+9T>C rs746913991
NM_002485.4(NBN):c.702+9G>A rs748373099
NM_002485.4(NBN):c.758C>T (p.Thr253Ile) rs61754967
NM_002485.5(NBN):c.1354A>C (p.Thr452Pro) rs141137543
NM_002485.5(NBN):c.1845+10A>G rs570914185
NM_002485.5(NBN):c.283G>A (p.Asp95Asn) rs61753720
NM_002485.5(NBN):c.38-10T>A rs556807466
NM_002485.5(NBN):c.381T>C (p.Ala127=) rs61754795
NM_002485.5(NBN):c.425A>G (p.Asn142Ser) rs769414
NM_002485.5(NBN):c.511A>G (p.Ile171Val) rs61754966
NM_002485.5(NBN):c.628G>T (p.Val210Phe) rs61754796
NM_002485.5(NBN):c.643C>T (p.Arg215Trp) rs34767364
NM_002485.5(NBN):c.657_661del (p.Lys219fs) rs587776650
NM_002485.5(NBN):c.788T>C (p.Phe263Ser) rs147626427
NM_002691.4(POLD1):c.1017G>T (p.Ser339=) rs373404887
NM_002691.4(POLD1):c.1061C>T (p.Ala354Val) rs140990974
NM_002691.4(POLD1):c.1092G>C (p.Leu364=) rs139883454
NM_002691.4(POLD1):c.1138-8A>G rs41544624
NM_002691.4(POLD1):c.1182C>T (p.Thr394=) rs377462923
NM_002691.4(POLD1):c.1243-6C>T rs761914051
NM_002691.4(POLD1):c.1275C>T (p.Ala425=) rs3219392
NM_002691.4(POLD1):c.1383+8C>T rs374719944
NM_002691.4(POLD1):c.13C>T (p.Arg5Trp) rs9282830
NM_002691.4(POLD1):c.1494+5C>T rs565428379
NM_002691.4(POLD1):c.1503C>T (p.Asn501=) rs371647100
NM_002691.4(POLD1):c.1608G>A (p.Ala536=) rs568549476
NM_002691.4(POLD1):c.1620C>T (p.Gly540=) rs140216790
NM_002691.4(POLD1):c.1626C>T (p.Pro542=) rs201208120
NM_002691.4(POLD1):c.1665C>T (p.Val555=) rs150238541
NM_002691.4(POLD1):c.1731C>T (p.Gly577=) rs376473853
NM_002691.4(POLD1):c.1785C>T (p.Asp595=) rs769563176
NM_002691.4(POLD1):c.1795G>A (p.Ala599Thr) rs149569984
NM_002691.4(POLD1):c.17G>A (p.Arg6Gln) rs778275831
NM_002691.4(POLD1):c.1932C>G (p.Asp644Glu) rs80214209
NM_002691.4(POLD1):c.1977C>T (p.Ile659=) rs45605236
NM_002691.4(POLD1):c.2007-4G>A rs202035484
NM_002691.4(POLD1):c.2017G>A (p.Glu673Lys) rs61751955
NM_002691.4(POLD1):c.202+3A>G rs375365167
NM_002691.4(POLD1):c.2052G>C (p.Gln684His) rs144143245
NM_002691.4(POLD1):c.208G>A (p.Val70Ile) rs147911699
NM_002691.4(POLD1):c.208G>T (p.Val70Phe) rs147911699
NM_002691.4(POLD1):c.2100A>G (p.Val700=) rs772468675
NM_002691.4(POLD1):c.2103C>T (p.Tyr701=) rs201483538
NM_002691.4(POLD1):c.2155-6C>T rs112481714
NM_002691.4(POLD1):c.2163G>A (p.Thr721=) rs763876339
NM_002691.4(POLD1):c.2178G>C (p.Gln726His) rs747483140
NM_002691.4(POLD1):c.2185G>A (p.Glu729Lys) rs200931999
NM_002691.4(POLD1):c.2250+4G>A rs370478977
NM_002691.4(POLD1):c.2250+7G>A rs775363857
NM_002691.4(POLD1):c.2275G>A (p.Val759Ile) rs145473716
NM_002691.4(POLD1):c.2317G>A (p.Ala773Thr) rs753865441
NM_002691.4(POLD1):c.2337G>A (p.Ala779=) rs147108748
NM_002691.4(POLD1):c.2388+4C>T rs371542643
NM_002691.4(POLD1):c.2577C>T (p.Gly859=) rs149366027
NM_002691.4(POLD1):c.258G>A (p.Ala86=) rs200687128
NM_002691.4(POLD1):c.2599G>A (p.Val867Ile) rs367680864
NM_002691.4(POLD1):c.2700C>T (p.His900=) rs769965495
NM_002691.4(POLD1):c.2832C>T (p.Phe944=) rs143974331
NM_002691.4(POLD1):c.2955G>T (p.Arg985=) rs770495723
NM_002691.4(POLD1):c.2967G>A (p.Thr989=) rs3218752
NM_002691.4(POLD1):c.2979G>A (p.Thr993=) rs3218774
NM_002691.4(POLD1):c.2988G>A (p.Thr996=) rs542996664
NM_002691.4(POLD1):c.3015C>T (p.Phe1005=) rs752830545
NM_002691.4(POLD1):c.3054G>A (p.Val1018=) rs369613619
NM_002691.4(POLD1):c.3072C>T (p.Ala1024=) rs111698572
NM_002691.4(POLD1):c.3156G>A (p.Ser1052=) rs373910727
NM_002691.4(POLD1):c.3198C>T (p.His1066=) rs569987101
NM_002691.4(POLD1):c.3204C>T (p.Asp1068=) rs759019419
NM_002691.4(POLD1):c.3218+5G>A rs569395274
NM_002691.4(POLD1):c.3231C>T (p.Pro1077=) rs770660636
NM_002691.4(POLD1):c.324G>T (p.Ala108=) rs20582
NM_002691.4(POLD1):c.3258G>C (p.Arg1086=) rs776167760
NM_002691.4(POLD1):c.371T>C (p.Val124Ala) rs199993010
NM_002691.4(POLD1):c.378C>T (p.Arg126=) rs145324823
NM_002691.4(POLD1):c.433G>A (p.Ala145Thr) rs137953986
NM_002691.4(POLD1):c.455C>T (p.Ala152Val) rs41563714
NM_002691.4(POLD1):c.531C>T (p.Arg177=) rs150702648
NM_002691.4(POLD1):c.534G>C (p.Gly178=) rs376129517
NM_002691.4(POLD1):c.606C>T (p.His202=) rs200405635
NM_002691.4(POLD1):c.612C>T (p.His204=) rs147881471
NM_002691.4(POLD1):c.624G>A (p.Pro208=) rs78996304
NM_002691.4(POLD1):c.639C>T (p.Thr213=) rs139949679
NM_002691.4(POLD1):c.651G>A (p.Pro217=) rs199622672
NM_002691.4(POLD1):c.666G>A (p.Pro222=) rs746678748
NM_002691.4(POLD1):c.714G>A (p.Thr238=) rs149096523
NM_002691.4(POLD1):c.773C>T (p.Thr258Met) rs76131127
NM_002691.4(POLD1):c.778A>G (p.Ile260Val) rs8105725
NM_002691.4(POLD1):c.783C>T (p.Val261=) rs34269084
NM_002691.4(POLD1):c.80A>T (p.Asp27Val) rs150066950
NM_002691.4(POLD1):c.840+10T>C rs1555790184
NM_002691.4(POLD1):c.841-10A>G rs140160345
NM_002691.4(POLD1):c.849G>T (p.Gln283His) rs113282414
NM_002691.4(POLD1):c.883G>A (p.Val295Met) rs199545019
NM_002691.4(POLD1):c.885G>C (p.Val295=) rs201946114
NM_002691.4(POLD1):c.88C>T (p.Arg30Trp) rs3218772
NM_002691.4(POLD1):c.900G>A (p.Pro300=) rs142407935
NM_002691.4(POLD1):c.945C>T (p.Phe315=) rs150116169
NM_002691.4(POLD1):c.957C>T (p.Cys319=) rs377300843
NM_002691.4(POLD1):c.961G>A (p.Gly321Ser) rs41554817
NM_002691.4(POLD1):c.971-4G>A rs200144991
NM_002878.3(RAD51D):c.146C>T (p.Ala49Val) rs140317560
NM_002878.3(RAD51D):c.196G>A (p.Val66Met) rs56026142
NM_002878.3(RAD51D):c.216C>T (p.Tyr72=) rs148690585
NM_002878.3(RAD51D):c.26G>C (p.Cys9Ser) rs140825795
NM_002878.3(RAD51D):c.345+5A>G rs878854562
NM_002878.3(RAD51D):c.481-7G>A rs145832514
NM_002878.3(RAD51D):c.568G>A (p.Ala190Thr) rs80116829
NM_002878.3(RAD51D):c.796C>T (p.Arg266Cys) rs587781813
NM_002878.3(RAD51D):c.864C>T (p.Gly288=) rs138557828
NM_002878.3(RAD51D):c.873C>T (p.Arg291=) rs140848654
NM_002878.3(RAD51D):c.904-3C>T rs45478491
NM_002878.3(RAD51D):c.919G>A (p.Glu307Lys) rs115031549
NM_002878.3(RAD51D):c.932T>A (p.Ile311Asn) rs145309168
NM_002878.3(RAD51D):c.983C>T (p.Thr328Ile) rs138969595
NM_003001.5(SDHC):c.*84G>C rs201210474
NM_003001.5(SDHC):c.120G>A (p.Arg40=) rs36097930
NM_003001.5(SDHC):c.342C>T (p.His114=) rs143730978
NM_003001.5(SDHC):c.354T>C (p.Phe118=) rs61733156
NM_003001.5(SDHC):c.405+23C>T rs373731336
NM_003002.4(SDHD):c.149A>G (p.His50Arg) rs11214077
NM_003002.4(SDHD):c.320T>G (p.Leu107Arg) rs876658477
NM_003002.4(SDHD):c.34G>A (p.Gly12Ser) rs34677591
NM_003002.4(SDHD):c.438T>C (p.Asp146=) rs201328474
NM_004329.2(BMPR1A):c.-6T>C rs1047677696
NM_004329.2(BMPR1A):c.1191C>G (p.Pro397=) rs751078831
NM_004329.2(BMPR1A):c.1327C>T (p.Arg443Cys) rs35619497
NM_004329.2(BMPR1A):c.1348G>A (p.Val450Met) rs55932635
NM_004329.2(BMPR1A):c.1395G>A (p.Pro465=) rs55845713
NM_004329.2(BMPR1A):c.1395G>C (p.Pro465=) rs55845713
NM_004329.2(BMPR1A):c.1419T>G (p.Val473=) rs145756629
NM_004329.2(BMPR1A):c.1474-10T>C rs369633360
NM_004329.2(BMPR1A):c.1560G>A (p.Thr520=) rs142775086
NM_004329.2(BMPR1A):c.231-9C>T rs763313220
NM_004329.2(BMPR1A):c.618A>G (p.Leu206=) rs55992440
NM_004329.2(BMPR1A):c.676-6A>C rs186999445
NM_004329.2(BMPR1A):c.729C>T (p.Gly243=) rs770821763
NM_004329.2(BMPR1A):c.961C>T (p.Leu321=) rs377412651
NM_004329.3(BMPR1A):c.1330T>C rs774061725
NM_004329.3(BMPR1A):c.1433G>A (p.Arg478His) rs113849804
NM_004360.5(CDH1):c.*8G>A rs201223411
NM_004360.5(CDH1):c.-8G>C rs879449703
NM_004360.5(CDH1):c.1018A>G (p.Thr340Ala) rs116093741
NM_004360.5(CDH1):c.1137+1G>A rs876660771
NM_004360.5(CDH1):c.1138-3C>T rs36103202
NM_004360.5(CDH1):c.1145del (p.Gly382fs) rs1555515863
NM_004360.5(CDH1):c.1162G>A (p.Glu388Lys) rs372838203
NM_004360.5(CDH1):c.1223C>T (p.Ala408Val) rs138135866
NM_004360.5(CDH1):c.1224G>A (p.Ala408=) rs200161607
NM_004360.5(CDH1):c.1272C>T (p.Val424=) rs61756284
NM_004360.5(CDH1):c.1273G>A (p.Val425Ile) rs570930882
NM_004360.5(CDH1):c.1298A>G (p.Asp433Gly) rs376097289
NM_004360.5(CDH1):c.1353T>C (p.Ile451=) rs114192597
NM_004360.5(CDH1):c.1359C>T (p.His453=) rs114861467
NM_004360.5(CDH1):c.1409C>T (p.Thr470Ile) rs370864592
NM_004360.5(CDH1):c.1417G>A (p.Val473Ile) rs36087757
NM_004360.5(CDH1):c.1530C>T (p.Ala510=) rs1597898262
NM_004360.5(CDH1):c.1565+1G>T rs587780113
NM_004360.5(CDH1):c.1587dup (p.Ala530fs) rs1555516532
NM_004360.5(CDH1):c.1684A>G (p.Thr562Ala) rs587782061
NM_004360.5(CDH1):c.1689C>T (p.Ala563=) rs587780786
NM_004360.5(CDH1):c.1711+9G>A rs368770384
NM_004360.5(CDH1):c.1711+9G>C rs368770384
NM_004360.5(CDH1):c.1744C>T (p.Leu582=) rs1801025
NM_004360.5(CDH1):c.1773C>T (p.Asn591=) rs373719554
NM_004360.5(CDH1):c.2077G>A (p.Gly693Ser) rs386833398
NM_004360.5(CDH1):c.2103C>T (p.Val701=) rs730881656
NM_004360.5(CDH1):c.2104G>A (p.Glu702Lys) rs149127230
NM_004360.5(CDH1):c.2121T>C (p.Ile707=) rs764657974
NM_004360.5(CDH1):c.214G>A (p.Asp72Asn) rs35606263
NM_004360.5(CDH1):c.2322G>A (p.Arg774=) rs150734856
NM_004360.5(CDH1):c.2329G>A (p.Asp777Asn) rs372989292
NM_004360.5(CDH1):c.2331C>T (p.Asp777=) rs114265540
NM_004360.5(CDH1):c.2412C>T (p.Pro804=) rs202075199
NM_004360.5(CDH1):c.2494G>A (p.Val832Met) rs35572355
NM_004360.5(CDH1):c.2520C>T (p.Ser840=) rs140328601
NM_004360.5(CDH1):c.286A>G (p.Ile96Val) rs749306433
NM_004360.5(CDH1):c.33G>C (p.Leu11=) rs730881654
NM_004360.5(CDH1):c.394G>A (p.Val132Ile) rs142498771
NM_004360.5(CDH1):c.49-8C>T rs774761552
NM_004360.5(CDH1):c.570C>T (p.Tyr190=) rs761753486
NM_004360.5(CDH1):c.604G>A (p.Val202Ile) rs546716073
NM_004360.5(CDH1):c.656del (p.Pro219fs) rs1555515284
NM_004360.5(CDH1):c.670C>T (p.Arg224Cys) rs200310662
NM_004360.5(CDH1):c.671G>A (p.Arg224His) rs201511530
NM_004360.5(CDH1):c.731A>G (p.Asp244Gly) rs1064794231
NM_004360.5(CDH1):c.832+9A>T rs1057521268
NM_004360.5(CDH1):c.88C>A (p.Pro30Thr) rs139866691
NM_004360.5(CDH1):c.892G>A (p.Ala298Thr) rs142822590
NM_005359.6(SMAD4):c.102A>G (p.Thr34=) rs146104321
NM_005359.6(SMAD4):c.1086T>C (p.Phe362=) rs1801250
NM_005359.6(SMAD4):c.1218G>A (p.Ala406=) rs145097078
NM_005359.6(SMAD4):c.1392C>T (p.Ala464=) rs140487104
NM_005359.6(SMAD4):c.1447+9G>A rs878854766
NM_005359.6(SMAD4):c.1573A>G (p.Ile525Val) rs149755320
NM_005359.6(SMAD4):c.1647A>G (p.Gln549=) rs113545983
NM_005359.6(SMAD4):c.228A>G (p.Arg76=) rs587780556
NM_005359.6(SMAD4):c.354G>A (p.Ala118=) rs145988618
NM_005359.6(SMAD4):c.424+5G>A rs200772603
NM_005359.6(SMAD4):c.455-6A>G rs181178864
NM_005359.6(SMAD4):c.565C>T (p.Arg189Cys) rs140743238
NM_005359.6(SMAD4):c.582A>G (p.Thr194=) rs145805120
NM_005359.6(SMAD4):c.667+9T>C rs776523203
NM_005359.6(SMAD4):c.880A>G (p.Met294Val) rs7238500
NM_005359.6(SMAD4):c.909T>G (p.Pro303=) rs141149381
NM_006231.3(POLE):c.-6G>A rs534524789
NM_006231.3(POLE):c.1007A>G (p.Asn336Ser) rs5744760
NM_006231.3(POLE):c.1021G>T (p.Ala341Ser) rs137860861
NM_006231.3(POLE):c.1106+7C>A rs369889926
NM_006231.3(POLE):c.1110A>G (p.Pro370=) rs772386963
NM_006231.3(POLE):c.1188G>A (p.Glu396=) rs371717068
NM_006231.3(POLE):c.123G>A (p.Thr41=) rs5744734
NM_006231.3(POLE):c.1242C>T (p.Asp414=) rs775213170
NM_006231.3(POLE):c.1347G>A (p.Thr449=) rs142373951
NM_006231.3(POLE):c.1359+9G>A rs75135381
NM_006231.3(POLE):c.1360-6C>T rs139836643
NM_006231.3(POLE):c.1405C>T (p.Leu469=) rs368303888
NM_006231.3(POLE):c.1470C>T (p.Asp490=) rs5744777
NM_006231.3(POLE):c.155G>A (p.Arg52Gln) rs372459649
NM_006231.3(POLE):c.1560A>G (p.Gln520=) rs201841065
NM_006231.3(POLE):c.1608T>C (p.Ser536=) rs763078534
NM_006231.3(POLE):c.16G>C (p.Gly6Arg) rs202220778
NM_006231.3(POLE):c.1740C>T (p.His580=) rs114972594
NM_006231.3(POLE):c.1781C>T (p.Thr594Ile) rs574033788
NM_006231.3(POLE):c.1794+5C>T rs200095915
NM_006231.3(POLE):c.1924-6T>C rs755311168
NM_006231.3(POLE):c.1924-6del rs758112633
NM_006231.3(POLE):c.2026+9C>T rs373790607
NM_006231.3(POLE):c.207C>T (p.Thr69=) rs146986360
NM_006231.3(POLE):c.2089C>T (p.Pro697Ser) rs5744800
NM_006231.3(POLE):c.2106G>T (p.Gly702=) rs5744801
NM_006231.3(POLE):c.2262C>T (p.Tyr754=) rs145337550
NM_006231.3(POLE):c.2271C>T (p.Thr757=) rs765532123
NM_006231.3(POLE):c.2292G>A (p.Arg764=) rs1555227097
NM_006231.3(POLE):c.2468+10C>T rs5744823
NM_006231.3(POLE):c.2510T>C (p.Phe837Ser) rs139182500
NM_006231.3(POLE):c.2561+6T>C rs116231808
NM_006231.3(POLE):c.2707-9G>A rs1057521516
NM_006231.3(POLE):c.2781C>T (p.Asn927=) rs775486303
NM_006231.3(POLE):c.2865-6_2865-4del rs369732588
NM_006231.3(POLE):c.2886C>T (p.Asp962=) rs757682919
NM_006231.3(POLE):c.2935C>T (p.Leu979=) rs56081968
NM_006231.3(POLE):c.2964G>A (p.Ser988=) rs200080353
NM_006231.3(POLE):c.296C>T (p.Pro99Leu) rs5744739
NM_006231.3(POLE):c.2974G>A (p.Ala992Thr) rs115193764
NM_006231.3(POLE):c.2982C>T (p.Leu994=) rs771463033
NM_006231.3(POLE):c.3090C>T (p.Phe1030=) rs766306895
NM_006231.3(POLE):c.3378+10A>G rs193075152
NM_006231.3(POLE):c.3378+7G>T rs755370377
NM_006231.3(POLE):c.3489C>T (p.His1163=) rs5744888
NM_006231.3(POLE):c.3582+6G>A rs113307290
NM_006231.3(POLE):c.3594C>T (p.Ala1198=) rs200803943
NM_006231.3(POLE):c.3615G>A (p.Pro1205=) rs560825851
NM_006231.3(POLE):c.3747G>A (p.Val1249=) rs80290414
NM_006231.3(POLE):c.3763T>C (p.Leu1255=) rs745838504
NM_006231.3(POLE):c.3881G>A (p.Arg1294His) rs115455318
NM_006231.3(POLE):c.391G>T (p.Val131Leu) rs745601745
NM_006231.3(POLE):c.3933T>C (p.Pro1311=) rs533545710
NM_006231.3(POLE):c.4047G>A (p.Ala1349=) rs201746181
NM_006231.3(POLE):c.4057A>G (p.Ser1353Gly) rs141619382
NM_006231.3(POLE):c.4184A>G (p.Tyr1395Cys) rs5744933
NM_006231.3(POLE):c.4236C>T (p.Asn1412=) rs377245595
NM_006231.3(POLE):c.4237G>A (p.Glu1413Lys) rs372901803
NM_006231.3(POLE):c.4245C>T (p.Asn1415=) rs778896278
NM_006231.3(POLE):c.4246G>A (p.Ala1416Thr) rs146711942
NM_006231.3(POLE):c.4259C>T (p.Ala1420Val) rs41561818
NM_006231.3(POLE):c.4450A>C (p.Ile1484Leu) rs772734618
NM_006231.3(POLE):c.4494G>A (p.Ala1498=) rs777611171
NM_006231.3(POLE):c.4534G>A (p.Val1512Ile) rs147354120
NM_006231.3(POLE):c.4587G>A (p.Leu1529=) rs1565938547
NM_006231.3(POLE):c.4645C>G (p.Pro1549Ala) rs147500308
NM_006231.3(POLE):c.4719C>T (p.Leu1573=) rs115219846
NM_006231.3(POLE):c.4730A>C (p.Glu1577Ala) rs5744948
NM_006231.3(POLE):c.4731G>A (p.Glu1577=) rs772361606
NM_006231.3(POLE):c.4941C>T (p.Phe1647=) rs145639967
NM_006231.3(POLE):c.5001C>T (p.Phe1667=) rs112358554
NM_006231.3(POLE):c.5124C>T (p.Phe1708=) rs114891564
NM_006231.3(POLE):c.5135C>T (p.Ala1712Val) rs5744950
NM_006231.3(POLE):c.519C>T (p.Ala173=) rs187690610
NM_006231.3(POLE):c.51C>G (p.Gly17=) rs780436496
NM_006231.3(POLE):c.546C>T (p.His182=) rs115257501
NM_006231.3(POLE):c.5478G>T (p.Arg1826=) rs537648186
NM_006231.3(POLE):c.5496T>C (p.Leu1832=) rs147543146
NM_006231.3(POLE):c.555C>T (p.Asp185=) rs763871536
NM_006231.3(POLE):c.5570A>G (p.Lys1857Arg) rs5744971
NM_006231.3(POLE):c.561C>T (p.Tyr187=) rs143938822
NM_006231.3(POLE):c.5659G>A (p.Val1887Met) rs114119067
NM_006231.3(POLE):c.5769C>T (p.Gly1923=) rs375198950
NM_006231.3(POLE):c.6111C>T (p.Ala2037=) rs541439106
NM_006231.3(POLE):c.6271C>T (p.Pro2091Ser) rs572252265
NM_006231.3(POLE):c.6405C>T (p.Val2135=) rs139607077
NM_006231.3(POLE):c.6418G>A (p.Glu2140Lys) rs5745066
NM_006231.3(POLE):c.6453C>T (p.Tyr2151=) rs116076060
NM_006231.3(POLE):c.6494G>A (p.Arg2165His) rs5745068
NM_006231.3(POLE):c.6495C>T (p.Arg2165=) rs114778730
NM_006231.3(POLE):c.6531+6G>T rs774747998
NM_006231.3(POLE):c.6597C>T (p.Ile2199=) rs147611144
NM_006231.3(POLE):c.6675C>T (p.Arg2225=) rs149973644
NM_006231.3(POLE):c.6714C>T (p.Cys2238=) rs200082120
NM_006231.3(POLE):c.6716C>T (p.Ala2239Val) rs190813054
NM_006231.3(POLE):c.672C>T (p.Tyr224=) rs376923206
NM_006231.3(POLE):c.6763A>T (p.Ile2255Phe) rs73155056
NM_006231.3(POLE):c.6766G>A (p.Gly2256Arg) rs116323660
NM_006231.3(POLE):c.6777G>C (p.Arg2259=) rs540203276
NM_006231.3(POLE):c.6777G>T (p.Arg2259=) rs540203276
NM_006231.3(POLE):c.6795C>T (p.Tyr2265=) rs142222159
NM_006231.3(POLE):c.6817A>T (p.Thr2273Ser) rs73481453
NM_006231.3(POLE):c.6820C>G (p.Leu2274Val) rs148788180
NM_006231.3(POLE):c.691C>T (p.Arg231Cys) rs146592584
NM_006231.3(POLE):c.718G>C (p.Val240Leu) rs371882716
NM_006231.3(POLE):c.720+6T>C rs751448342
NM_006231.3(POLE):c.761C>T (p.Pro254Leu) rs200211438
NM_006231.3(POLE):c.774C>G (p.Thr258=) rs149345392
NM_006231.3(POLE):c.776G>A (p.Arg259His) rs61732929
NM_006231.3(POLE):c.779G>A (p.Arg260Gln) rs5744752
NM_006231.3(POLE):c.846C>T (p.Pro282=) rs5744758
NM_006231.3(POLE):c.84A>T (p.Ser28=) rs774280853
NM_006231.3(POLE):c.912C>T (p.Gly304=) rs1064794932
NM_006231.3(POLE):c.942A>C (p.Ser314=) rs548933169
NM_006231.4(POLE):c.1288G>A (p.Ala430Thr) rs140566004
NM_006231.4(POLE):c.1337G>A (p.Arg446Gln) rs151273553
NM_006231.4(POLE):c.139C>T (p.Arg47Trp) rs143626223
NM_006231.4(POLE):c.2090C>G (p.Pro697Arg) rs36120395
NM_006231.4(POLE):c.2171C>T (p.Ala724Val) rs61734163
NM_006231.4(POLE):c.2174-8G>A rs117409343
NM_006231.4(POLE):c.2602C>T (p.Leu868=) rs115830215
NM_006231.4(POLE):c.2683G>A (p.Ala895Thr) rs201115064
NM_006231.4(POLE):c.3046G>A (p.Val1016Met) rs147692158
NM_006231.4(POLE):c.3718G>A (p.Glu1240Lys) rs113594027
NM_006231.4(POLE):c.3851G>A (p.Arg1284Gln) rs149462407
NM_006231.4(POLE):c.4523G>A (p.Arg1508His) rs142508245
NM_006231.4(POLE):c.5562T>C (p.Ala1854=) rs1174721130
NM_006231.4(POLE):c.6004+5G>T rs372169366
NM_006231.4(POLE):c.6331-8C>T rs769766403
NM_006231.4(POLE):c.6658-7C>A rs531482240
NM_006231.4(POLE):c.6748-6C>T rs750255126
NM_006231.4(POLE):c.844C>T (p.Pro282Ser) rs138207610
NM_006231.4(POLE):c.861T>A (p.Asp287Glu) rs139075637
NM_006231.4(POLE):c.940T>G (p.Ser314Ala) rs770403791
NM_006231.4(POLE):c.941C>G (p.Ser314Ter) rs869312803
NM_007194.4(CHEK2):c.-6G>A rs376995740
NM_007194.4(CHEK2):c.1100del (p.Thr367fs) rs555607708
NM_007194.4(CHEK2):c.1175C>T (p.Ala392Val) rs373073383
NM_007194.4(CHEK2):c.1176G>A (p.Ala392=) rs142692907
NM_007194.4(CHEK2):c.1263del (p.Ser422fs) rs587780174
NM_007194.4(CHEK2):c.126T>A (p.Ser42=) rs1601853112
NM_007194.4(CHEK2):c.1283C>T (p.Ser428Phe) rs137853011
NM_007194.4(CHEK2):c.1343T>G (p.Ile448Ser) rs17886163
NM_007194.4(CHEK2):c.1357G>C (p.Ala453Pro) rs763395924
NM_007194.4(CHEK2):c.1407G>A (p.Val469=) rs17881378
NM_007194.4(CHEK2):c.1421G>A (p.Arg474His) rs121908706
NM_007194.4(CHEK2):c.1427C>T (p.Thr476Met) rs142763740
NM_007194.4(CHEK2):c.1489G>A (p.Asp497Asn) rs143965148
NM_007194.4(CHEK2):c.1497G>C (p.Leu499=) rs587780890
NM_007194.4(CHEK2):c.1513T>A (p.Ser505Thr) rs587781960
NM_007194.4(CHEK2):c.1542+11T>A rs17881716
NM_007194.4(CHEK2):c.190G>A (p.Glu64Lys) rs141568342
NM_007194.4(CHEK2):c.231CCAAGAACCTGAGGA[1] (p.77DQEPE[1]) rs587780181
NM_007194.4(CHEK2):c.254C>T (p.Pro85Leu) rs17883862
NM_007194.4(CHEK2):c.320-5T>A rs121908700
NM_007194.4(CHEK2):c.349A>G (p.Arg117Gly) rs28909982
NM_007194.4(CHEK2):c.3G>A (p.Met1Ile) rs786203977
NM_007194.4(CHEK2):c.410G>A (p.Arg137Gln) rs368570187
NM_007194.4(CHEK2):c.444+1G>A rs121908698
NM_007194.4(CHEK2):c.470T>C (p.Ile157Thr) rs17879961
NM_007194.4(CHEK2):c.480AGA[1] (p.Glu161del) rs587782008
NM_007194.4(CHEK2):c.499G>A (p.Gly167Arg) rs72552322
NM_007194.4(CHEK2):c.538C>T (p.Arg180Cys) rs77130927
NM_007194.4(CHEK2):c.542G>A (p.Arg181His) rs121908701
NM_007194.4(CHEK2):c.556A>C (p.Asn186His) rs146198085
NM_007194.4(CHEK2):c.591del (p.Val198fs) rs587782245
NM_007194.4(CHEK2):c.592+3A>T rs587782849
NM_007194.4(CHEK2):c.683+1G>T rs786203650
NM_007194.4(CHEK2):c.707T>C (p.Leu236Pro) rs587782471
NM_007194.4(CHEK2):c.715G>A (p.Glu239Lys) rs121908702
NM_007194.4(CHEK2):c.7C>T (p.Arg3Trp) rs199708878
NM_007194.4(CHEK2):c.846+4_846+7del rs764884641
NM_007194.4(CHEK2):c.847-10C>G rs745745105
NM_007294.3(BRCA1):c.301+8T>C rs80358101
NM_007294.3(BRCA1):c.3668_3671dupTTCC (p.Cys1225Serfs) rs80357797
NM_007294.3(BRCA1):c.4096+1G>A rs80358178
NM_007294.3(BRCA1):c.4097-10G>A rs80358057
NM_007294.3(BRCA1):c.4097-7A>G rs80358007
NM_007294.3(BRCA1):c.4185+10G>A rs80358104
NM_007294.3(BRCA1):c.4185+5A>G rs766330646
NM_007294.3(BRCA1):c.4186-10G>A rs80358172
NM_007294.3(BRCA1):c.4676-8C>G rs80358021
NM_007294.3(BRCA1):c.5075-9A>T rs80358059
NM_007294.3(BRCA1):c.5153-1G>C rs80358137
NM_007294.3(BRCA1):c.5153-6C>A rs80358129
NM_007294.3(BRCA1):c.5266dupC (p.Gln1756Profs) rs80357906
NM_007294.3(BRCA1):c.5332+7G>T rs773655919
NM_007294.3(BRCA1):c.5406+4A>G rs397509279
NM_007294.3(BRCA1):c.5406+5G>T rs80358073
NM_007294.3(BRCA1):c.5467+1G>A rs80358145
NM_007294.3(BRCA1):c.5468-10_5468-9del rs273902770
NM_007294.3(BRCA1):c.547+8T>G rs762224894
NM_007294.3(BRCA1):c.593+9A>G rs80358133
NM_007294.3(BRCA1):c.66dupA (p.Glu23Argfs) rs80357783
NM_007294.4(BRCA1):c.*4C>T rs1057520246
NM_007294.4(BRCA1):c.1008A>G (p.Thr336=) rs1060504568
NM_007294.4(BRCA1):c.1011A>G (p.Glu337=) rs1555592670
NM_007294.4(BRCA1):c.1036C>T (p.Pro346Ser) rs80357015
NM_007294.4(BRCA1):c.1106_1108del (p.Asp369del) rs80358325
NM_007294.4(BRCA1):c.122A>G (p.His41Arg) rs80357276
NM_007294.4(BRCA1):c.1233T>G (p.Asp411Glu) rs80357024
NM_007294.4(BRCA1):c.1258G>T (p.Asp420Tyr) rs80357488
NM_007294.4(BRCA1):c.130T>A (p.Cys44Ser) rs80357327
NM_007294.4(BRCA1):c.131G>T (p.Cys44Phe) rs80357446
NM_007294.4(BRCA1):c.1392C>T (p.Thr464=) rs533802049
NM_007294.4(BRCA1):c.140G>T (p.Cys47Phe) rs80357150
NM_007294.4(BRCA1):c.1427A>G (p.His476Arg) rs55720177
NM_007294.4(BRCA1):c.1456T>C (p.Phe486Leu) rs55906931
NM_007294.4(BRCA1):c.1459G>T (p.Val487Phe) rs369588942
NM_007294.4(BRCA1):c.1470A>G (p.Pro490=) rs775032066
NM_007294.4(BRCA1):c.1534C>T (p.Leu512Phe) rs41286294
NM_007294.4(BRCA1):c.1561G>A (p.Ala521Thr) rs80357122
NM_007294.4(BRCA1):c.1573G>A (p.Val525Ile) rs80357273
NM_007294.4(BRCA1):c.1609A>G (p.Asn537Asp) rs398122639
NM_007294.4(BRCA1):c.1616C>T (p.Thr539Met) rs80357374
NM_007294.4(BRCA1):c.1617G>A (p.Thr539=) rs372002119
NM_007294.4(BRCA1):c.1703C>T (p.Pro568Leu) rs80356910
NM_007294.4(BRCA1):c.1724A>G (p.Glu575Gly) rs111539978
NM_007294.4(BRCA1):c.1789G>A (p.Glu597Lys) rs55650082
NM_007294.4(BRCA1):c.1843TCT[1] (p.Ser616del) rs80358329
NM_007294.4(BRCA1):c.1866G>A (p.Ala622=) rs1800064
NM_007294.4(BRCA1):c.1905T>C (p.Asn635=) rs369373293
NM_007294.4(BRCA1):c.190T>C (p.Cys64Arg) rs80357064
NM_007294.4(BRCA1):c.190T>G (p.Cys64Gly) rs80357064
NM_007294.4(BRCA1):c.1974G>C (p.Met658Ile) rs55678461
NM_007294.4(BRCA1):c.19C>T (p.Arg7Cys) rs80356994
NM_007294.4(BRCA1):c.2002C>T (p.Leu668Phe) rs80357250
NM_007294.4(BRCA1):c.211A>G (p.Arg71Gly) rs80357382
NM_007294.4(BRCA1):c.2155A>G (p.Lys719Glu) rs80357147
NM_007294.4(BRCA1):c.2207A>C (p.Glu736Ala) rs397507196
NM_007294.4(BRCA1):c.2232T>G (p.Ala744=) rs4986846
NM_007294.4(BRCA1):c.2268G>C (p.Arg756Ser) rs80356884
NM_007294.4(BRCA1):c.2286A>T (p.Arg762Ser) rs273898682
NM_007294.4(BRCA1):c.2329T>G (p.Tyr777Asp) rs397507199
NM_007294.4(BRCA1):c.2347A>G (p.Ile783Val) rs80356948
NM_007294.4(BRCA1):c.2351C>T (p.Ser784Leu) rs55914168
NM_007294.4(BRCA1):c.2368A>G (p.Thr790Ala) rs41286298
NM_007294.4(BRCA1):c.2412G>C (p.Gln804His) rs55746541
NM_007294.4(BRCA1):c.2426A>G (p.Glu809Gly) rs397507201
NM_007294.4(BRCA1):c.2473G>T (p.Asp825Tyr) rs80357328
NM_007294.4(BRCA1):c.2477C>A (p.Thr826Lys) rs28897683
NM_007294.4(BRCA1):c.2481A>G (p.Glu827=) rs397508970
NM_007294.4(BRCA1):c.2521C>T (p.Arg841Trp) rs1800709
NM_007294.4(BRCA1):c.2584A>G (p.Lys862Glu) rs80356927
NM_007294.4(BRCA1):c.2612C>G (p.Pro871Arg) rs799917
NM_007294.4(BRCA1):c.2613G>A (p.Pro871=) rs587782608
NM_007294.4(BRCA1):c.2634A>G (p.Ala878=) rs730881451
NM_007294.4(BRCA1):c.2668G>A (p.Gly890Arg) rs80357200
NM_007294.4(BRCA1):c.2706_2707dup (p.Cys903fs) rs80357717
NM_007294.4(BRCA1):c.2722G>T (p.Glu908Ter) rs80356978
NM_007294.4(BRCA1):c.2726A>T (p.Asn909Ile) rs80357127
NM_007294.4(BRCA1):c.2783G>A (p.Gly928Asp) rs202004680
NM_007294.4(BRCA1):c.2860C>T (p.Leu954=) rs730881452
NM_007294.4(BRCA1):c.288C>T (p.Asp96=) rs146085503
NM_007294.4(BRCA1):c.301+1G>A rs587782173
NM_007294.4(BRCA1):c.301+7G>A rs80358113
NM_007294.4(BRCA1):c.3012G>A (p.Glu1004=) rs786201784
NM_007294.4(BRCA1):c.3055A>G (p.Ile1019Val) rs80357311
NM_007294.4(BRCA1):c.3093T>A (p.Ile1031=) rs786204265
NM_007294.4(BRCA1):c.3119G>A (p.Ser1040Asn) rs4986852
NM_007294.4(BRCA1):c.3328_3330del (p.Lys1110del) rs80358335
NM_007294.4(BRCA1):c.3351dup (p.Gln1118fs) rs80357785
NM_007294.4(BRCA1):c.3362A>G (p.Asn1121Ser) rs80356919
NM_007294.4(BRCA1):c.3410T>C (p.Met1137Thr) rs80357297
NM_007294.4(BRCA1):c.3415AGT[1] (p.Ser1140del) rs80358337
NM_007294.4(BRCA1):c.3448C>T (p.Pro1150Ser) rs80357272
NM_007294.4(BRCA1):c.3454G>A (p.Asp1152Asn) rs80357175
NM_007294.4(BRCA1):c.346del (p.Glu116fs) rs762635795
NM_007294.4(BRCA1):c.3541G>A (p.Val1181Ile) rs56336919
NM_007294.4(BRCA1):c.3596C>T (p.Ala1199Val) rs587782458
NM_007294.4(BRCA1):c.3600G>T (p.Gln1200His) rs56214134
NM_007294.4(BRCA1):c.3657G>C (p.Glu1219Asp) rs80356876
NM_007294.4(BRCA1):c.366T>G (p.Val122=) rs190900046
NM_007294.4(BRCA1):c.3691T>C (p.Phe1231Leu) rs41293451
NM_007294.4(BRCA1):c.3699A>G (p.Lys1233=) rs368690455
NM_007294.4(BRCA1):c.3771G>A (p.Glu1257=) rs1597861430
NM_007294.4(BRCA1):c.378A>G (p.Gln126=) rs786201256
NM_007294.4(BRCA1):c.3835G>A (p.Ala1279Thr) rs80357036
NM_007294.4(BRCA1):c.3845A>T (p.Glu1282Val) rs80357217
NM_007294.4(BRCA1):c.3848A>G (p.His1283Arg) rs80357047
NM_007294.4(BRCA1):c.389A>T (p.Tyr130Phe) rs56055578
NM_007294.4(BRCA1):c.3929C>A (p.Thr1310Lys) rs80357257
NM_007294.4(BRCA1):c.3944C>G (p.Pro1315Arg) rs80357500
NM_007294.4(BRCA1):c.3963C>G (p.Ser1321=) rs1567789440
NM_007294.4(BRCA1):c.3967C>T (p.Gln1323Ter) rs80357262
NM_007294.4(BRCA1):c.396C>A (p.Asn132Lys) rs80357413
NM_007294.4(BRCA1):c.4036G>A (p.Glu1346Lys) rs80357407
NM_007294.4(BRCA1):c.4047G>A (p.Thr1349=) rs758515222
NM_007294.4(BRCA1):c.4115G>A (p.Cys1372Tyr) rs55848034
NM_007294.4(BRCA1):c.4166G>A (p.Ser1389Asn) rs78951648
NM_007294.4(BRCA1):c.4209C>T (p.Asn1403=) rs786201224
NM_007294.4(BRCA1):c.4261C>T (p.His1421Tyr) rs80357013
NM_007294.4(BRCA1):c.427G>T (p.Glu143Ter) rs80356991
NM_007294.4(BRCA1):c.4327C>G (p.Arg1443Gly) rs41293455
NM_007294.4(BRCA1):c.4347A>G (p.Thr1449=) rs80356840
NM_007294.4(BRCA1):c.4402A>C (p.Asn1468His) rs80357022
NM_007294.4(BRCA1):c.4410A>T (p.Glu1470Asp) rs80357075
NM_007294.4(BRCA1):c.4419T>A (p.Ser1473=) rs730881455
NM_007294.4(BRCA1):c.4484G>A (p.Arg1495Lys) rs80357389
NM_007294.4(BRCA1):c.4524G>A (p.Trp1508Ter) rs80356885
NM_007294.4(BRCA1):c.4535G>T (p.Ser1512Ile) rs1800744
NM_007294.4(BRCA1):c.457A>C (p.Ser153Arg) rs28897674
NM_007294.4(BRCA1):c.4585A>G (p.Ile1529Val) rs80357095
NM_007294.4(BRCA1):c.4635C>T (p.His1545=) rs373686790
NM_007294.4(BRCA1):c.463C>G (p.Gln155Glu) rs80357180
NM_007294.4(BRCA1):c.4654T>C (p.Tyr1552His) rs1265352633
NM_007294.4(BRCA1):c.4675+1G>A rs80358044
NM_007294.4(BRCA1):c.4675G>A (p.Glu1559Lys) rs80356988
NM_007294.4(BRCA1):c.4689C>G (p.Tyr1563Ter) rs80357433
NM_007294.4(BRCA1):c.4729T>C (p.Ser1577Pro) rs80356909
NM_007294.4(BRCA1):c.4813T>C (p.Leu1605=) rs80356833
NM_007294.4(BRCA1):c.4816A>G (p.Lys1606Glu) rs80356943
NM_007294.4(BRCA1):c.4837A>T (p.Ser1613Cys) rs1799966
NM_007294.4(BRCA1):c.4868C>G (p.Ala1623Gly) rs80356862
NM_007294.4(BRCA1):c.4882A>G (p.Met1628Val) rs80357465
NM_007294.4(BRCA1):c.4934G>C (p.Arg1645Thr) rs70953661
NM_007294.4(BRCA1):c.4956G>A (p.Met1652Ile) rs1799967
NM_007294.4(BRCA1):c.4976del (p.Pro1659fs) rs879255295
NM_007294.4(BRCA1):c.4988T>A (p.Met1663Lys) rs80357205
NM_007294.4(BRCA1):c.5014CAC[1] (p.His1673del) rs80358343
NM_007294.4(BRCA1):c.5022C>T (p.Ile1674=) rs786203868
NM_007294.4(BRCA1):c.5050_5051del (p.Thr1684fs) rs879255283
NM_007294.4(BRCA1):c.5074+6C>G rs80358032
NM_007294.4(BRCA1):c.5074G>C (p.Asp1692His) rs80187739
NM_007294.4(BRCA1):c.5096G>A (p.Arg1699Gln) rs41293459
NM_007294.4(BRCA1):c.5100A>G (p.Thr1700=) rs45519437
NM_007294.4(BRCA1):c.5117G>A (p.Gly1706Glu) rs80356860
NM_007294.4(BRCA1):c.5117G>C (p.Gly1706Ala) rs80356860
NM_007294.4(BRCA1):c.5124G>A (p.Ala1708=) rs1057520432
NM_007294.4(BRCA1):c.5143A>T (p.Ser1715Cys) rs80357222
NM_007294.4(BRCA1):c.5144G>A (p.Ser1715Asn) rs45444999
NM_007294.4(BRCA1):c.5157G>T (p.Val1719=) rs28897697
NM_007294.4(BRCA1):c.5175A>G (p.Glu1725=) rs191373374
NM_007294.4(BRCA1):c.5189A>G (p.Asn1730Ser) rs80357171
NM_007294.4(BRCA1):c.5207T>C (p.Val1736Ala) rs45553935
NM_007294.4(BRCA1):c.522A>G (p.Gln174=) rs765432756
NM_007294.4(BRCA1):c.5252G>A (p.Arg1751Gln) rs80357442
NM_007294.4(BRCA1):c.528G>A (p.Thr176=) rs34545365
NM_007294.4(BRCA1):c.5304C>T (p.Cys1768=) rs138493864
NM_007294.4(BRCA1):c.5408G>C (p.Gly1803Ala) rs80357149
NM_007294.4(BRCA1):c.5411T>A (p.Val1804Asp) rs80356920
NM_007294.4(BRCA1):c.5412C>T (p.Val1804=) rs730881456
NM_007294.4(BRCA1):c.5454C>T (p.Asp1818=) rs1555574705
NM_007294.4(BRCA1):c.5456A>G (p.Asn1819Ser) rs80357286
NM_007294.4(BRCA1):c.548-9del rs273902774
NM_007294.4(BRCA1):c.5497G>A (p.Val1833Met) rs80357268
NM_007294.4(BRCA1):c.5509T>C (p.Trp1837Arg) rs80356959
NM_007294.4(BRCA1):c.5524_5531del (p.Val1842fs) rs879255287
NM_007294.4(BRCA1):c.5572A>C (p.Ile1858Leu) rs765656957
NM_007294.4(BRCA1):c.5576C>G (p.Pro1859Arg) rs80357322
NM_007294.4(BRCA1):c.564A>G (p.Glu188=) rs768065826
NM_007294.4(BRCA1):c.612G>C (p.Leu204Phe) rs80357394
NM_007294.4(BRCA1):c.661G>T (p.Ala221Ser) rs80357088
NM_007294.4(BRCA1):c.68_69del (p.Glu23fs) rs80357914
NM_007294.4(BRCA1):c.692C>T (p.Thr231Met) rs80357001
NM_007294.4(BRCA1):c.693G>A (p.Thr231=) rs62625298
NM_007294.4(BRCA1):c.694G>A (p.Asp232Asn) rs55975699
NM_007294.4(BRCA1):c.715del (p.His239fs) rs879255294
NM_007294.4(BRCA1):c.795T>C (p.Ser265=) rs201441987
NM_007294.4(BRCA1):c.81-6T>C rs80358179
NM_007294.4(BRCA1):c.81T>C (p.Cys27=) rs587780805
NM_007294.4(BRCA1):c.823G>A (p.Gly275Ser) rs8176153
NM_007294.4(BRCA1):c.824G>A (p.Gly275Asp) rs397509327
NM_007294.4(BRCA1):c.828A>G (p.Thr276=) rs186274774
NM_007294.4(BRCA1):c.837T>C (p.His279=) rs775477245
NM_007294.4(BRCA1):c.839C>G (p.Ala280Gly) rs80357199
NM_007294.4(BRCA1):c.844_850dup (p.Gln284fs) rs80357989
NM_007294.4(BRCA1):c.946A>G (p.Ser316Gly) rs55874646
NM_007294.4(BRCA1):c.987T>C (p.Asn329=) rs774849810
NM_012222.2(MUTYH):c.1004_1005delinsGC (p.Gln335Arg) rs587780083
NM_012222.2(MUTYH):c.129C>T (p.Asn43=) rs141679570
NM_012222.2(MUTYH):c.1440C>T (p.Thr480=) rs150269172
NM_012222.2(MUTYH):c.1535C>T (p.Ser512Phe) rs140118273
NM_012222.2(MUTYH):c.1576C>A (p.Leu526Met) rs3219496
NM_012222.2(MUTYH):c.1592G>A (p.Arg531Gln) rs3219497
NM_012222.2(MUTYH):c.496-4A>G rs201678305
NM_020975.6(RET):c.3112A>G (p.Thr1038Ala) rs201740483
NM_024675.3(PALB2):c.1001A>G (p.Tyr334Cys) rs200620434
NM_024675.3(PALB2):c.1194G>A (p.Val398=) rs61755173
NM_024675.3(PALB2):c.1227T>C (p.Tyr409=) rs1555461386
NM_024675.3(PALB2):c.1273G>A (p.Val425Met) rs576081828
NM_024675.3(PALB2):c.1470C>T (p.Pro490=) rs45612837
NM_024675.3(PALB2):c.1492G>T (p.Asp498Tyr) rs75023630
NM_024675.3(PALB2):c.149A>C (p.Lys50Thr) rs763598472
NM_024675.3(PALB2):c.1572A>G (p.Ser524=) rs45472400
NM_024675.3(PALB2):c.1606C>T (p.Leu536=) rs151162255
NM_024675.3(PALB2):c.1641C>T (p.Thr547=) rs564514783
NM_024675.3(PALB2):c.1697G>A (p.Arg566His) rs144617793
NM_024675.3(PALB2):c.1794G>A (p.Leu598=) rs182494675
NM_024675.3(PALB2):c.1810C>T (p.Leu604=) rs144015319
NM_024675.3(PALB2):c.1881G>T (p.Val627=) rs139362268
NM_024675.3(PALB2):c.1941T>C (p.His647=) rs745467835
NM_024675.3(PALB2):c.195G>A (p.Pro65=) rs751176316
NM_024675.3(PALB2):c.2027T>C (p.Ile676Thr) rs200875161
NM_024675.3(PALB2):c.2067G>A (p.Ser689=) rs371149159
NM_024675.3(PALB2):c.2244A>G (p.Thr748=) rs750048627
NM_024675.3(PALB2):c.2256A>G (p.Gly752=) rs147120218
NM_024675.3(PALB2):c.2289G>C (p.Leu763Phe) rs373478248
NM_024675.3(PALB2):c.232G>A (p.Val78Ile) rs515726085
NM_024675.3(PALB2):c.2365C>T (p.Leu789=) rs145805054
NM_024675.3(PALB2):c.2368C>T (p.Gln790Ter) rs886039480
NM_024675.3(PALB2):c.2442G>A (p.Glu814=) rs140776736
NM_024675.3(PALB2):c.2586+10A>G rs373321719
NM_024675.3(PALB2):c.2590C>T (p.Pro864Ser) rs45568339
NM_024675.3(PALB2):c.2616G>T (p.Val872=) rs1567215519
NM_024675.3(PALB2):c.2674G>A (p.Glu892Lys) rs45476495
NM_024675.3(PALB2):c.2752C>T (p.Pro918Ser) rs515726094
NM_024675.3(PALB2):c.2851T>C (p.Ser951Pro) rs149522412
NM_024675.3(PALB2):c.2964A>G (p.Gln988=) rs777244673
NM_024675.3(PALB2):c.298C>T (p.Leu100Phe) rs61756147
NM_024675.3(PALB2):c.2996+9del rs769414858
NM_024675.3(PALB2):c.3054G>C (p.Glu1018Asp) rs183489969
NM_024675.3(PALB2):c.3113G>A (p.Trp1038Ter) rs180177132
NM_024675.3(PALB2):c.3116del (p.Asn1039fs) rs180177133
NM_024675.3(PALB2):c.3201+1G>C rs587776423
NM_024675.3(PALB2):c.3202-8G>T rs367979106
NM_024675.3(PALB2):c.3307G>A (p.Val1103Met) rs201657283
NM_024675.3(PALB2):c.3495G>A (p.Ser1165=) rs45439097
NM_024675.3(PALB2):c.3549C>G (p.Tyr1183Ter) rs118203998
NM_024675.3(PALB2):c.400G>A (p.Asp134Asn) rs139555085
NM_024675.3(PALB2):c.62T>G (p.Leu21Ter) rs769240800
NM_024675.3(PALB2):c.721A>G (p.Asn241Asp) rs113217267
NM_024675.3(PALB2):c.94C>G (p.Leu32Val) rs151316635
NM_024675.4(PALB2):c.172_175del (p.Gln60fs) rs180177143
NM_024675.4(PALB2):c.212-10del rs766487430
NM_024675.4(PALB2):c.23C>T (p.Pro8Leu) rs150390726
NM_024675.4(PALB2):c.2816T>G (p.Leu939Trp) rs45478192
NM_024675.4(PALB2):c.3257G>A (p.Arg1086Gln) rs146377793
NM_024675.4(PALB2):c.3426_3429del (p.Leu1142fs) rs587776424
NM_032043.2(BRIP1):c.-6A>C rs1442433909
NM_032043.2(BRIP1):c.1433A>G (p.His478Arg) rs45501097
NM_032043.2(BRIP1):c.1890A>G (p.Thr630=) rs145796331
NM_032043.2(BRIP1):c.1935+7T>C rs201024366
NM_032043.2(BRIP1):c.2061G>C (p.Val687=) rs112414873
NM_032043.2(BRIP1):c.2097+7G>A rs4988352
NM_032043.2(BRIP1):c.2232C>T (p.Asp744=) rs374362388
NM_032043.2(BRIP1):c.225C>T (p.Gly75=) rs186802750
NM_032043.2(BRIP1):c.2286T>C (p.Arg762=) rs61754141
NM_032043.2(BRIP1):c.2310T>C (p.Asp770=) rs148752066
NM_032043.2(BRIP1):c.2406C>T (p.Asp802=) rs748981650
NM_032043.2(BRIP1):c.2937A>G (p.Lys979=) rs75091137
NM_032043.2(BRIP1):c.297C>T (p.Asp99=) rs201617644
NM_032043.2(BRIP1):c.3099T>C (p.Pro1033=) rs202228407
NM_032043.2(BRIP1):c.317G>A (p.Arg106His) rs143615668
NM_032043.2(BRIP1):c.3275C>T (p.Pro1092Leu) rs587780830
NM_032043.2(BRIP1):c.3378A>C (p.Glu1126Asp) rs145855459
NM_032043.2(BRIP1):c.3459T>C (p.Asp1153=) rs4987050
NM_032043.2(BRIP1):c.36G>T (p.Gly12=) rs45566938
NM_032043.2(BRIP1):c.3717C>T (p.Ser1239=) rs758809865
NM_032043.2(BRIP1):c.387T>C (p.Pro129=) rs779324498
NM_032043.2(BRIP1):c.408A>C (p.Ala136=) rs876660891
NM_032043.2(BRIP1):c.430G>A (p.Ala144Thr) rs116952709
NM_032043.2(BRIP1):c.517C>T (p.Arg173Cys) rs4988345
NM_032043.2(BRIP1):c.584T>C (p.Leu195Pro) rs4988347
NM_032043.2(BRIP1):c.587A>G (p.Asn196Ser) rs550707862
NM_032043.2(BRIP1):c.618G>A (p.Ser206=) rs367614726
NM_032043.2(BRIP1):c.636C>A (p.Gly212=) rs1057520255
NM_032043.2(BRIP1):c.689C>T (p.Ser230Leu) rs759031349
NM_032043.2(BRIP1):c.702G>A (p.Lys234=) rs45512798
NM_032043.2(BRIP1):c.852C>T (p.Val284=) rs144940449
NM_032043.2(BRIP1):c.890A>G (p.Lys297Arg) rs28997570
NM_032043.2(BRIP1):c.918+1G>A rs587781655
NM_032043.2(BRIP1):c.924A>G (p.Lys308=) rs374974885
NM_032043.3(BRIP1):c.1255C>T (p.Arg419Trp) rs150624408
NM_032043.3(BRIP1):c.139C>G (p.Pro47Ala) rs28903098
NM_032043.3(BRIP1):c.1629-3T>C rs587780828
NM_032043.3(BRIP1):c.1735C>T (p.Arg579Cys) rs28997571
NM_032043.3(BRIP1):c.2220G>T (p.Gln740His) rs45589637
NM_032043.3(BRIP1):c.2958C>T (p.Ser986=) rs1603275662
NM_032043.3(BRIP1):c.854A>G (p.His285Arg) rs141055990
NM_054012.4(ASS1):c.571G>A (p.Glu191Lys) rs777828000
NM_058195.4(CDKN2A):c.69C>T (p.Phe23=) rs374360796
NM_058216.3(RAD51C):c.146-8A>G rs201079501
NM_058216.3(RAD51C):c.186A>G (p.Gln62=) rs28363303
NM_058216.3(RAD51C):c.195A>G (p.Arg65=) rs45511291
NM_058216.3(RAD51C):c.376G>A (p.Ala126Thr) rs61758784
NM_058216.3(RAD51C):c.404+2T>C rs730881931
NM_058216.3(RAD51C):c.428A>G (p.Gln143Arg) rs587780255
NM_058216.3(RAD51C):c.790G>A (p.Gly264Ser) rs147241704
NM_058216.3(RAD51C):c.859A>G (p.Thr287Ala) rs28363317
NM_058216.3(RAD51C):c.994C>T (p.Gln332Ter) rs1555605074
NM_174936.3(PCSK9):c.1326C>T (p.Ala442=) rs28362262
NM_174936.3(PCSK9):c.1327G>A (p.Ala443Thr)
NM_174936.3(PCSK9):c.137G>T (p.Arg46Leu)
NM_174936.3(PCSK9):c.609C>T (p.Thr203=) rs200856421
NM_174936.3(PCSK9):c.709C>T (p.Arg237Trp) rs148195424
NM_174936.3(PCSK9):c.753C>T (p.Arg251=) rs28385710
NM_174936.4(PCSK9):c.45GCT[9] (p.Leu22_Leu23dup) rs35574083

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.