ClinVar Miner

Variants from Genomic Research Center, Shahid Beheshti University of Medical Sciences with conflicting interpretations

Location: Iran, Islamic Republic of  Primary collection method: clinical testing
Minimum review status of the submission from Genomic Research Center, Shahid Beheshti University of Medical Sciences: Collection method of the submission from Genomic Research Center, Shahid Beheshti University of Medical Sciences:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
1363 427 4 194 134 7 156 445

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
Genomic Research Center, Shahid Beheshti University of Medical Sciences pathogenic likely pathogenic uncertain significance likely benign benign drug response pathogenic, low penetrance risk factor
pathogenic 1 87 34 5 3 3 1 0
likely pathogenic 78 2 30 5 2 0 0 0
uncertain significance 56 38 0 72 40 0 1 3
likely benign 3 2 22 0 15 0 0 0
benign 2 2 11 15 1 0 0 0

Submitter to submitter summary #

Total submitters: 148
Download table as spreadsheet
Submitter Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
Invitae 0 232 0 45 68 2 51 166
OMIM 0 82 0 33 3 2 33 70
Illumina Laboratory Services, Illumina 0 84 0 14 25 0 5 44
GeneDx 0 54 1 10 17 0 13 41
Baylor Genetics 0 87 0 25 2 0 12 39
Revvity Omics, Revvity 0 63 0 17 2 0 14 33
Women's Health and Genetics/Laboratory Corporation of America, LabCorp 0 56 0 16 5 0 9 30
Counsyl 0 39 0 22 1 0 4 27
PreventionGenetics, part of Exact Sciences 0 19 1 7 15 0 3 26
Natera, Inc. 0 60 0 10 7 0 5 22
Mendelics 0 29 0 8 3 0 11 22
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine 0 30 0 11 6 0 4 21
CeGaT Center for Human Genetics Tuebingen 0 37 0 6 10 0 5 21
Center for Genomic Medicine, King Faisal Specialist Hospital and Research Center 0 23 0 11 2 0 8 21
Fulgent Genetics, Fulgent Genetics 0 65 0 14 0 0 4 18
Genome-Nilou Lab 0 75 0 10 4 0 1 15
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories 0 18 0 7 4 0 3 14
Victorian Clinical Genetics Services, Murdoch Childrens Research Institute 0 15 0 6 0 0 6 12
MGZ Medical Genetics Center 0 27 0 4 1 0 5 10
Eurofins Ntd Llc (ga) 0 32 0 3 6 0 1 10
Institute of Human Genetics, University of Leipzig Medical Center 0 31 0 5 2 0 3 10
Genetic Services Laboratory, University of Chicago 0 20 0 2 2 0 5 9
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen 0 16 1 3 3 0 2 9
Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center 0 15 0 3 4 0 2 9
Broad Center for Mendelian Genomics, Broad Institute of MIT and Harvard 0 10 0 4 0 0 5 9
Genome Diagnostics Laboratory, University Medical Center Utrecht 0 10 0 4 3 0 1 8
3billion 0 27 0 5 0 0 3 8
Neuberg Centre For Genomic Medicine, NCGM 0 23 0 6 0 0 2 8
Ambry Genetics 0 20 0 2 3 0 2 7
Centre for Mendelian Genomics, University Medical Centre Ljubljana 0 12 0 5 0 0 2 7
Centogene AG - the Rare Disease Company 0 9 0 5 0 0 1 6
Juha Muilu Group; Institute for Molecular Medicine Finland (FIMM) 0 0 1 3 0 0 2 6
Biochemical Molecular Genetic Laboratory, King Abdulaziz Medical City 0 5 0 3 0 0 3 6
Mayo Clinic Laboratories, Mayo Clinic 0 15 0 2 3 0 0 5
Breast Cancer Information Core (BIC) (BRCA1) 0 5 0 0 5 0 0 5
Myelin Disorders Clinic-Children's Medical Center/Medical Genetics Lab-Tarbiat Modares University, Children's Medical Center, Pediatrics Center of Excellence, 0 2 0 0 0 0 5 5
Myriad Genetics, Inc. 0 27 0 3 1 0 1 5
All of Us Research Program, National Institutes of Health 0 23 0 3 0 0 2 5
Athena Diagnostics Inc 0 6 0 0 3 0 1 4
Sharing Clinical Reports Project (SCRP) 0 15 0 3 1 0 0 4
Institute of Human Genetics Munich, Klinikum Rechts Der Isar, TU München 0 20 0 3 0 0 1 4
Division of Human Genetics, Children's Hospital of Philadelphia 0 4 0 3 0 0 1 4
Foundation for Research in Genetics and Endocrinology, FRIGE's Institute of Human Genetics 0 6 0 2 0 0 2 4
Equipe Genetique des Anomalies du Developpement, Université de Bourgogne 0 8 0 4 0 0 0 4
Genetics and Molecular Pathology, SA Pathology 0 10 0 3 0 0 1 4
Department of Pathology and Laboratory Medicine, Sinai Health System 0 9 0 2 1 0 1 4
Department Of Genetics, Sultan Qaboos University Hospital, Sultan Qaboos University 0 4 0 2 0 0 2 4
Lifecell International Pvt. Ltd 0 6 0 2 0 0 2 4
Laboratorio de Genetica e Diagnostico Molecular, Hospital Israelita Albert Einstein 0 11 0 4 0 0 0 4
Centre for Population Genomics, CPG 0 3 0 3 1 0 0 4
Michigan Medical Genetics Laboratories, University of Michigan 0 5 0 3 0 0 0 3
GeneReviews 0 54 1 1 0 0 1 3
PharmGKB 0 0 0 0 0 3 0 3
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) 0 21 0 3 0 0 0 3
Knight Diagnostic Laboratories, Oregon Health and Sciences University 0 8 1 1 0 0 1 3
Kasturba Medical College, Manipal, Kasturba Medical College, Manipal, Manipal Academy of Higher Education, Manipal, India 0 4 0 2 0 0 1 3
SIB Swiss Institute of Bioinformatics 0 2 0 3 0 0 0 3
Kariminejad - Najmabadi Pathology & Genetics Center 0 1 0 1 0 0 2 3
Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen 0 5 0 1 0 0 2 3
Laboratory of Diagnosis and Therapy of Lysosomal Disorders, University of Padova 0 1 0 2 0 0 1 3
Genome Diagnostics Laboratory, Amsterdam University Medical Center 0 2 0 1 2 0 0 3
Johns Hopkins Genomics, Johns Hopkins University 0 5 0 2 0 0 1 3
New York Genome Center 0 9 0 1 0 0 2 3
AiLife Diagnostics, AiLife Diagnostics 0 1 0 2 0 0 1 3
Genomics England Pilot Project, Genomics England 0 2 0 2 0 0 1 3
Molecular Genetics, Royal Melbourne Hospital 0 0 0 2 1 0 0 3
KCCC/NGS Laboratory, Kuwait Cancer Control Center 0 5 0 3 0 0 0 3
Greenwood Genetic Center Diagnostic Laboratories, Greenwood Genetic Center 0 6 0 1 0 0 1 2
Clinical Molecular Genetics Laboratory, Johns Hopkins All Children's Hospital 0 2 0 0 0 0 2 2
Institute of Medical Genetics and Genomics, Sir Ganga Ram Hospital 0 1 0 1 0 0 1 2
Elsea Laboratory, Baylor College of Medicine 0 5 0 2 0 0 0 2
Blueprint Genetics 0 3 0 1 1 0 0 2
RettBASE 0 2 0 1 0 0 1 2
GeneKor MSA 0 1 0 1 1 0 0 2
Institute for Clinical Genetics, University Hospital TU Dresden, University Hospital TU Dresden 0 5 0 1 0 0 1 2
Center for Pediatric Genomic Medicine, Children's Mercy Hospital and Clinics 0 7 0 1 0 0 1 2
Soonchunhyang University Bucheon Hospital, Soonchunhyang University Medical Center 0 0 0 1 0 0 1 2
Joint Genome Diagnostic Labs from Nijmegen and Maastricht, Radboudumc and MUMC+ 0 7 1 0 1 0 0 2
Undiagnosed Diseases Network, NIH 0 2 0 2 0 0 0 2
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego 0 3 0 0 0 0 2 2
Laboratory of Diagnostic Genome Analysis, Leiden University Medical Center (LUMC) 0 2 0 1 0 0 1 2
UNC Molecular Genetics Laboratory, University of North Carolina at Chapel Hill 0 3 0 2 0 0 0 2
Biochemistry Laboratory of CDMU, Chengde Medical University 0 0 0 2 0 0 0 2
Reproductive Health Research and Development, BGI Genomics 0 4 0 0 0 1 1 2
Zotz-Klimas Genetics Lab, MVZ Zotz Klimas 0 4 0 2 0 0 0 2
ClinGen Rett and Angelman-like Disorders Variant Curation Expert Panel 0 2 0 1 1 0 0 2
DASA 0 9 0 2 0 0 0 2
Biomedical Genomics and Oncogenetics Laboratory, Institut Pasteur de Tunis, University Tunis El Manar 0 0 0 0 0 0 2 2
H3Africa Consortium 0 2 0 0 1 0 1 2
BRCAlab, Lund University 0 8 0 1 1 0 0 2
Center for Human Genetics, Inc, Center for Human Genetics, Inc 0 4 0 1 0 0 0 1
Genome Diagnostics Laboratory, The Hospital for Sick Children 0 6 0 0 0 0 1 1
Biesecker Lab/Clinical Genomics Section, National Institutes of Health 0 0 0 0 1 0 0 1
Molecular Diagnostics Lab, Nemours Children's Health, Delaware 0 1 0 1 0 0 0 1
Clinical Biochemistry Laboratory, Health Services Laboratory 0 0 0 0 0 0 1 1
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics, Children's Hospital of Philadelphia 0 5 0 1 0 0 0 1
Molecular Genetics Laboratory, BC Children's and BC Women's Hospitals 0 1 0 0 0 0 1 1
Clinical Genetics, Academic Medical Center 0 6 0 0 1 0 0 1
Centre for Inherited Metabolic Diseases, Karolinska University Hospital 0 2 0 1 0 0 0 1
Courtagen Diagnostics Laboratory, Courtagen Life Sciences 0 2 0 0 0 0 1 1
Breast Cancer Information Core (BIC) (BRCA2) 0 9 0 0 1 0 0 1
Institute of Otorhinolaryngology, The First affiliated hospital, Sun Yat-sen University 0 0 0 0 0 0 1 1
Genomic Research Center, Shahid Beheshti University of Medical Sciences 2228 6 0 1 0 0 0 1
Pathway Genomics 0 1 0 1 0 0 0 1
CSER _CC_NCGL, University of Washington 0 0 0 1 0 0 0 1
Clinical Genetics and Genomics, Karolinska University Hospital 0 4 0 0 0 0 1 1
University Children's Hospital, University of Zurich 0 1 0 1 0 0 0 1
Stanford Center for Inherited Cardiovascular Disease, Stanford University 0 1 0 0 0 0 1 1
Laboratory of Applied Genomics, Kongju National University 0 0 0 1 0 0 0 1
Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital 0 4 0 1 0 0 0 1
Baylor-Hopkins Center for Mendelian Genomics, Johns Hopkins University School of Medicine 0 1 0 0 0 0 1 1
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease, Montreal Heart Institute 0 0 0 0 1 0 0 1
Bioscientia Institut fuer Medizinische Diagnostik GmbH, Sonic Healthcare 0 0 0 1 0 0 0 1
Color Diagnostics, LLC DBA Color Health 0 4 0 0 0 0 1 1
Institute of Human Genetics, University Hospital of Duesseldorf 0 2 0 1 0 0 0 1
Daryl Scott Lab, Baylor College of Medicine 0 3 0 0 0 0 1 1
Leiden Open Variation Database 0 0 0 0 0 0 1 1
Pele Pequeno Principe Research Institute, Faculdades Pequeno Principe 0 0 0 1 0 0 0 1
Wong Mito Lab, Molecular and Human Genetics, Baylor College of Medicine 0 1 0 1 0 0 0 1
Tartaglia Lab, Genetics and Rare Diseases Research Division, Bambino Gesu' Children's Hospital 0 0 0 1 0 0 0 1
ClinGen PAH Variant Curation Expert Panel 0 4 0 1 0 0 0 1
Molecular Diagnostics Laboratory, M Health Fairview: University of Minnesota 0 1 0 0 0 0 1 1
Laboratory of Medical Genetics, National & Kapodistrian University of Athens 0 5 0 1 0 0 0 1
St. Jude Molecular Pathology, St. Jude Children's Research Hospital 0 0 0 0 0 0 1 1
Uitto Lab, Thomas Jefferson University 0 0 0 1 0 0 0 1
Breda Genetics srl 0 0 0 1 0 0 0 1
Department of Pediatrics, Gifu University 0 0 0 1 0 0 0 1
Genetic Testing Center for Deafness, Department of Otolaryngology Head & Neck Surgery, Institute of Otolaryngology, Chinese PLA General Hospital 0 2 0 1 0 0 0 1
Biochemical Genetics Department, Cyprus Institute of Neurology and Genetics 0 0 0 1 0 0 0 1
Molecular Medicine for Neurodegenerative and Neuromuscular Diseases Unit, IRCCS Fondazione Stella Maris 0 3 0 0 0 0 1 1
Al Jalila Children's Genomics Center, Al Jalila Childrens Speciality Hospital 0 6 0 1 0 0 0 1
Unidad de Genómica Garrahan, Hospital de Pediatría Garrahan 0 0 0 1 0 0 0 1
Clinical Genomics Program, Stanford Medicine 0 3 0 1 0 0 0 1
Istanbul Faculty of Medicine, Istanbul University 0 0 0 0 0 0 1 1
Laboratory of Genetics in Ophthalmology, Institut Imagine 0 1 0 0 0 0 1 1
Department of Laboratory Medicine, Yonsei University College of Medicine 0 0 0 1 0 0 0 1
GenomeConnect - Simons Searchlight 0 0 0 1 0 0 0 1
Pediatrics, MediClubGeorgia 0 0 0 1 0 0 0 1
Department of Medical Laboratory Science, Faculty of Allied Health Sciences, University of Peradeniya 0 0 0 0 0 0 1 1
ATS em Genética Clínica, Universidade Federal do Rio Grande do Sul 0 0 0 1 0 0 0 1
Suma Genomics 0 1 0 0 0 0 1 1
Human Genetics Bochum, Ruhr University Bochum 0 0 0 1 0 0 0 1
Center for Research in Genodermatoses and Epidermolysis Bullosa, University of Buenos Aires 0 0 0 1 0 0 0 1
Center for Precision Medicine, Meizhou People's Hospital 0 1 0 0 1 0 0 1
Arcensus 0 1 0 1 0 0 0 1
Inherited Neuropathy Consortium Ii, University Of Miami 0 0 0 0 0 0 1 1
Department Of Human Genetics, Institute Of Clinical And Translational Research, Biomedical Research Center, Slovak Academy Of Sciences 0 1 0 0 0 0 1 1
Neonatal Disease Screening Center, Medical Genetics Center, Huaihua City Maternal and Child Health Care Hospital 0 1 0 1 0 0 0 1

All variants with conflicting interpretations #

Total variants: 445
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_022336.4(EDAR):c.750C>T (p.Ser250=) rs260632 0.90287
NM_022336.4(EDAR):c.1056C>T (p.Cys352=) rs12623957 0.72397
NM_022893.4(BCL11A):c.386-24278G>A rs11886868 0.65121
NM_005013.2(NUCB2):c.-406C>G rs214088 0.62041
NM_005105.5(RBM8A):c.67+93A>T rs872786 0.29287
NM_007294.4(BRCA1):c.3113A>G (p.Glu1038Gly) rs16941 0.29115
NM_000059.4(BRCA2):c.1114A>C (p.Asn372His) rs144848 0.23116
NM_000017.4(ACADS):c.625G>A (p.Gly209Ser) rs1799958 0.20617
NM_007294.4(BRCA1):c.1067A>G (p.Gln356Arg) rs1799950 0.04695
NM_000243.3(MEFV):c.442G>C (p.Glu148Gln) rs3743930 0.02112
NM_005105.5(RBM8A):c.-21G>A rs139428292 0.01871
NM_000237.3(LPL):c.953A>G (p.Asn318Ser) rs268 0.01327
NM_000506.5(F2):c.*97G>A rs1799963 0.00979
NM_144672.4(OTOA):c.2359G>T (p.Glu787Ter) rs200988634 0.00927
NM_000211.5(ITGB2):c.329-6C>T rs9983887 0.00876
NM_032119.4(ADGRV1):c.9650C>T (p.Ala3217Val) rs114137750 0.00844
NM_001243133.2(NLRP3):c.592G>A (p.Val198Met) rs121908147 0.00835
NM_006346.4(PIBF1):c.1214G>A (p.Arg405Gln) rs17089782 0.00771
NM_001902.6(CTH):c.200C>T (p.Thr67Ile) rs28941785 0.00693
NM_006214.4(PHYH):c.734G>A (p.Arg245Gln) rs62619919 0.00690
NM_000443.4(ABCB4):c.1769G>A (p.Arg590Gln) rs45575636 0.00625
NM_000043.6(FAS):c.183G>A (p.Lys61=) rs3218613 0.00606
NM_152618.3(BBS12):c.116T>C (p.Ile39Thr) rs138036823 0.00577
NM_000359.3(TGM1):c.1559A>G (p.Glu520Gly) rs142404759 0.00555
NM_001308330.2(STXBP5L):c.1135G>A (p.Val379Met) rs61996323 0.00545
NM_005105.5(RBM8A):c.67+32G>C rs201779890 0.00518
NM_001082.5(CYP4F2):c.648-7C>A rs3093221 0.00504
NM_001365536.1(SCN9A):c.3767A>G (p.Asn1256Ser) rs141268327 0.00496
NM_000540.3(RYR1):c.5634G>C (p.Glu1878Asp) rs114203198 0.00479
NM_016335.6(PRODH):c.865T>A (p.Leu289Met) rs137852934 0.00464
NM_002863.5(PYGL):c.1145C>T (p.Pro382Leu) rs143759519 0.00440
NM_000372.5(TYR):c.1217C>T (p.Pro406Leu) rs104894313 0.00375
NM_000016.6(ACADM):c.985A>G (p.Lys329Glu) rs77931234 0.00363
NM_001067.4(TOP2A):c.1737+5G>A rs140672916 0.00360
NM_021870.3(FGG):c.571G>A (p.Gly191Arg) rs6063 0.00339
NM_000900.5(MGP):c.157A>G (p.Lys53Glu) rs1801716 0.00329
NM_001386125.1(OBSCN):c.35T>A (p.Phe12Tyr) rs191837710 0.00322
NM_000209.4(PDX1):c.226G>A (p.Asp76Asn) rs137852783 0.00320
NM_033337.3(CAV3):c.233C>T (p.Thr78Met) rs72546668 0.00317
NM_001399.5(EDA):c.206G>T (p.Arg69Leu) rs132630309 0.00312
NM_001145809.2(MYH14):c.1150G>T (p.Gly384Cys) rs119103280 0.00303
NM_001079866.2(BCS1L):c.613G>A (p.Val205Ile) rs148278887 0.00295
NM_000666.3(ACY1):c.1057C>T (p.Arg353Cys) rs121912698 0.00260
NM_001374385.1(ATP8B1):c.208G>A (p.Asp70Asn) rs34719006 0.00245
NM_213599.3(ANO5):c.155A>G (p.Asn52Ser) rs143777403 0.00238
NM_000262.3(NAGA):c.973G>A (p.Glu325Lys) rs121434529 0.00225
NM_005732.4(RAD50):c.980G>A (p.Arg327His) rs28903091 0.00207
NM_000157.4(GBA1):c.1226A>G (p.Asn409Ser) rs76763715 0.00191
NM_018706.7(DHTKD1):c.2185G>A (p.Gly729Arg) rs117225135 0.00190
NM_000027.4(AGA):c.436T>G (p.Leu146Val) rs146381591 0.00188
NM_001017922.2(ERMAP):c.169G>A (p.Gly57Arg) rs56025238 0.00181
NM_001365536.1(SCN9A):c.1997A>G (p.Lys666Arg) rs121908919 0.00180
NM_000293.3(PHKB):c.400G>A (p.Asp134Asn) rs144486825 0.00176
NM_000138.5(FBN1):c.3509G>A (p.Arg1170His) rs137854475 0.00168
NM_001003841.3(SLC6A19):c.517G>A (p.Asp173Asn) rs121434346 0.00168
NM_000293.3(PHKB):c.574A>G (p.Ile192Val) rs117218785 0.00165
NM_002693.3(POLG):c.1760C>T (p.Pro587Leu) rs113994096 0.00160
NM_002693.3(POLG):c.752C>T (p.Thr251Ile) rs113994094 0.00159
NM_007055.4(POLR3A):c.1909+22G>A rs191875469 0.00156
NM_018136.5(ASPM):c.9254T>C (p.Ile3085Thr) rs138138436 0.00155
NM_001041.4(SI):c.3218G>A (p.Gly1073Asp) rs121912616 0.00150
NM_001110792.2(MECP2):c.638C>T (p.Ala213Val) rs61748381 0.00150
NM_000053.4(ATP7B):c.1995G>A (p.Met665Ile) rs72552259 0.00149
NM_005055.5(RAPSN):c.264C>A (p.Asn88Lys) rs104894299 0.00149
NM_138694.4(PKHD1):c.1342G>C (p.Gly448Arg) rs149781976 0.00146
NM_014467.3(SRPX2):c.1030C>A (p.Leu344Ile) rs149051060 0.00145
NM_001174150.2(ARL13B):c.1151G>A (p.Gly384Glu) rs146264035 0.00143
NM_002354.3(EPCAM):c.831A>G (p.Ile277Met) rs115283528 0.00135
NM_000032.5(ALAS2):c.1559C>T (p.Pro520Leu) rs201062903 0.00124
NM_213607.3(CCDC103):c.461A>C (p.His154Pro) rs145457535 0.00123
NM_000500.9(CYP21A2):c.518T>A (p.Ile173Asn) rs6475 0.00117
NM_001044385.3(TMEM237):c.1065C>G (p.Leu355=) rs149240122 0.00111
NM_020070.4(IGLL1):c.425C>T (p.Pro142Leu) rs1064422 0.00104
NM_018480.7(TMEM126B):c.635G>T (p.Gly212Val) rs141542003 0.00103
NM_031448.6(C19orf12):c.391A>G (p.Lys131Glu) rs146170087 0.00094
NM_000435.3(NOTCH3):c.3691C>T (p.Arg1231Cys) rs201680145 0.00089
NM_000276.4(OCRL):c.40-5C>T rs201211377 0.00088
NM_032578.4(MYPN):c.3583G>A (p.Val1195Met) rs71534280 0.00083
NM_001358530.2(MOCS1):c.853G>A (p.Glu285Lys) rs140243105 0.00081
NM_005609.4(PYGM):c.848A>G (p.Asn283Ser) rs114468011 0.00081
NM_001384474.1(LOXHD1):c.4480C>T (p.Arg1494Ter) rs201587138 0.00069
NM_015375.3(DSTYK):c.86G>A (p.Arg29Gln) rs200780796 0.00065
NM_000642.3(AGL):c.334A>G (p.Ile112Val) rs147024351 0.00064
NM_001110792.2(MECP2):c.626C>T (p.Thr209Met) rs61749714 0.00064
NM_000352.6(ABCC8):c.1063G>A (p.Ala355Thr) rs145136257 0.00057
NM_022132.5(MCCC2):c.1015G>A (p.Val339Met) rs150591260 0.00057
NM_025114.4(CEP290):c.1092T>G (p.Ile364Met) rs201988582 0.00054
NM_001177316.2(SLC34A3):c.1453C>T (p.Arg485Cys) rs145029982 0.00052
NM_004329.3(BMPR1A):c.1243G>A (p.Glu415Lys) rs140592056 0.00051
NM_000257.4(MYH7):c.2890G>C (p.Val964Leu) rs45496496 0.00050
NM_000548.5(TSC2):c.1070C>T (p.Ala357Val) rs150195368 0.00050
NM_001194998.2(CEP152):c.2034T>G (p.Tyr678Ter) rs182018947 0.00048
NM_000085.5(CLCNKB):c.656-31del rs751608665 0.00046
NM_001388464.1(H2BW2):c.257T>C (p.Ile86Thr) rs782616912 0.00046
NM_019109.5(ALG1):c.827G>A (p.Arg276Gln) rs201975029 0.00045
NM_001378183.1(PIEZO2):c.5080G>A (p.Asp1694Asn) rs114649884 0.00044
NM_001382567.1(STIM1):c.2021G>A (p.Arg674His) rs140080199 0.00044
NM_023110.3(FGFR1):c.899T>C (p.Ile300Thr) rs121909633 0.00042
NM_182914.3(SYNE2):c.14528T>A (p.Phe4843Tyr) rs141488398 0.00042
NM_153700.2(STRC):c.3460C>T (p.Arg1154Ter) rs576724182 0.00041
NM_000492.4(CFTR):c.3154T>G (p.Phe1052Val) rs150212784 0.00039
NM_000277.3(PAH):c.1139C>T (p.Thr380Met) rs62642937 0.00036
NM_000151.4(G6PC1):c.247C>T (p.Arg83Cys) rs1801175 0.00034
NM_007294.4(BRCA1):c.1456T>C (p.Phe486Leu) rs55906931 0.00034
NM_015506.3(MMACHC):c.440G>C (p.Gly147Ala) rs140522266 0.00034
NM_001267550.2(TTN):c.26528C>T (p.Thr8843Met) rs72648990 0.00032
NM_005573.4(LMNB1):c.676C>T (p.Arg226Cys) rs142016804 0.00032
NM_033629.6(TREX1):c.341G>A (p.Arg114His) rs72556554 0.00030
NM_000277.3(PAH):c.688G>A (p.Val230Ile) rs62516152 0.00029
NM_007294.4(BRCA1):c.1648A>C (p.Asn550His) rs56012641 0.00029
NM_007294.4(BRCA1):c.536A>G (p.Tyr179Cys) rs56187033 0.00029
NM_014845.6(FIG4):c.834A>T (p.Lys278Asn) rs138048706 0.00029
NM_000359.3(TGM1):c.281G>A (p.Gly94Asp) rs121918729 0.00025
NM_000466.3(PEX1):c.2528G>A (p.Gly843Asp) rs61750420 0.00025
NM_012213.3(MLYCD):c.1328G>C (p.Gly443Ala) rs200278015 0.00025
NM_000199.5(SGSH):c.220C>T (p.Arg74Cys) rs104894636 0.00021
NM_002296.4(LBR):c.1114C>T (p.Arg372Cys) rs200180113 0.00021
NM_004004.6(GJB2):c.427C>T (p.Arg143Trp) rs80338948 0.00021
NM_004525.3(LRP2):c.3128A>G (p.Tyr1043Cys) rs201299366 0.00021
NM_007294.4(BRCA1):c.2477C>A (p.Thr826Lys) rs28897683 0.00021
NM_199242.3(UNC13D):c.118-308C>T rs959968589 0.00021
NM_000017.4(ACADS):c.1058C>T (p.Ser353Leu) rs28941773 0.00020
NM_014043.4(CHMP2B):c.85A>G (p.Ile29Val) rs63750818 0.00020
NM_000153.4(GALC):c.956A>G (p.Tyr319Cys) rs183105855 0.00019
NM_000159.4(GCDH):c.1204C>T (p.Arg402Trp) rs121434369 0.00019
NM_000322.5(PRPH2):c.367C>T (p.Arg123Trp) rs563581127 0.00019
NM_000414.4(HSD17B4):c.46G>A (p.Gly16Ser) rs137853096 0.00019
NM_001193313.2(SUGCT):c.301C>T (p.Arg101Ter) rs137852862 0.00019
NM_001620.3(AHNAK):c.10589A>G (p.Lys3530Arg) rs143895650 0.00018
NM_182961.4(SYNE1):c.16831C>T (p.Arg5611Trp) rs369292604 0.00017
NM_006005.3(WFS1):c.2020G>A (p.Gly674Arg) rs200672755 0.00016
NM_000348.4(SRD5A2):c.586G>A (p.Gly196Ser) rs121434250 0.00015
NM_001127222.2(CACNA1A):c.5987C>T (p.Thr1996Met) rs778274864 0.00015
NM_003119.4(SPG7):c.233T>A (p.Leu78Ter) rs121918358 0.00014
NM_000016.6(ACADM):c.799G>A (p.Gly267Arg) rs121434274 0.00013
NM_000540.3(RYR1):c.2654G>A (p.Arg885His) rs370634440 0.00013
NM_000243.3(MEFV):c.2080A>G (p.Met694Val) rs61752717 0.00012
NM_004006.3(DMD):c.9479G>A (p.Arg3160His) rs771392678 0.00012
NM_032119.4(ADGRV1):c.2596C>T (p.Arg866Trp) rs200389929 0.00011
NM_000035.4(ALDOB):c.1013C>T (p.Ala338Val) rs77718928 0.00010
NM_000071.3(CBS):c.770C>T (p.Thr257Met) rs758236584 0.00010
NM_000080.4(CHRNE):c.506A>T (p.Gln169Leu) rs148370803 0.00010
NM_000243.3(MEFV):c.2282G>A (p.Arg761His) rs104895097 0.00010
NM_000310.4(PPT1):c.329A>G (p.Asn110Ser) rs142894102 0.00010
NM_001282225.2(ADA2):c.139G>A (p.Gly47Arg) rs202134424 0.00010
NM_016111.4(TELO2):c.2296G>A (p.Val766Met) rs371675497 0.00010
NM_016327.3(UPB1):c.105-2A>G rs138081800 0.00010
NM_000518.5(HBB):c.93-21G>A rs35004220 0.00009
NM_000709.4(BCKDHA):c.943C>T (p.Arg315Trp) rs373336888 0.00009
NM_001038603.3(MARVELD2):c.1498C>T (p.Arg500Ter) rs118203957 0.00009
NM_001164508.2(NEB):c.24114+1G>A rs755239192 0.00009
NM_001243279.3(ACSF3):c.1081G>A (p.Gly361Ser) rs145285434 0.00009
NM_001360.3(DHCR7):c.278C>T (p.Thr93Met) rs80338853 0.00009
NM_145262.4(GLYCTK):c.1478T>G (p.Phe493Cys) rs121909448 0.00009
NM_000104.4(CYP1B1):c.1169G>A (p.Arg390His) rs56010818 0.00008
NM_000211.5(ITGB2):c.381C>T (p.Ile127=) rs483352812 0.00007
NM_000489.6(ATRX):c.4130A>G (p.Glu1377Gly) rs782553301 0.00007
NM_000170.3(GLDC):c.1940C>T (p.Pro647Leu) rs201135624 0.00006
NM_000789.4(ACE):c.2858G>A (p.Arg953Gln) rs143507892 0.00006
NM_001378969.1(KCND3):c.1348C>T (p.Leu450Phe) rs150401343 0.00006
NM_001848.3(COL6A1):c.2911G>A (p.Val971Met) rs769795690 0.00006
NM_002103.5(GYS1):c.162_163del (p.Asp56fs) rs587777375 0.00006
NM_002206.3(ITGA7):c.427C>T (p.Arg143Ter) rs17854600 0.00006
NM_003560.4(PLA2G6):c.2370T>G (p.Tyr790Ter) rs121908680 0.00006
NM_004369.4(COL6A3):c.6898G>A (p.Gly2300Arg) rs763348222 0.00006
NM_033409.4(SLC52A3):c.62A>G (p.Asn21Ser) rs199588390 0.00006
NM_153676.4(USH1C):c.308G>A (p.Arg103His) rs397514500 0.00006
NM_001844.5(COL2A1):c.4148C>T (p.Thr1383Met) rs138498898 0.00005
NM_001844.5(COL2A1):c.4316C>T (p.Thr1439Met) rs121912886 0.00005
NM_016239.4(MYO15A):c.5925G>A (p.Trp1975Ter) rs375290498 0.00005
NM_020964.3(EPG5):c.2373C>T (p.Asp791=) rs552419530 0.00005
NM_000071.3(CBS):c.341C>T (p.Ala114Val) rs121964964 0.00004
NM_000094.4(COL7A1):c.6473G>A (p.Arg2158His) rs138626345 0.00004
NM_000211.5(ITGB2):c.897+1G>A rs201752283 0.00004
NM_000214.3(JAG1):c.1439C>T (p.Ala480Val) rs149366993 0.00004
NM_000292.3(PHKA2):c.2971G>A (p.Gly991Arg) rs750628677 0.00004
NM_000310.4(PPT1):c.535C>T (p.Arg179Cys) rs560471003 0.00004
NM_000492.4(CFTR):c.2834C>T (p.Ser945Leu) rs397508442 0.00004
NM_000528.4(MAN2B1):c.2249G>A (p.Arg750Gln) rs373240866 0.00004
NM_000535.7(PMS2):c.2356C>A (p.Leu786Met) rs576055272 0.00004
NM_001040716.2(PC):c.1607C>T (p.Pro536Leu) rs751657066 0.00004
NM_001146079.2(CLDN14):c.301G>A (p.Gly101Arg) rs74315438 0.00004
NM_001160372.4(TRAPPC9):c.3056A>C (p.Asp1019Ala) rs755371528 0.00004
NM_001360.3(DHCR7):c.1A>G (p.Met1Val) rs104886033 0.00004
NM_001673.5(ASNS):c.146G>A (p.Arg49Gln) rs769236847 0.00004
NM_001848.3(COL6A1):c.1945G>A (p.Glu649Lys) rs764129993 0.00004
NM_001849.4(COL6A2):c.1817-8C>A rs750444649 0.00004
NM_001918.5(DBT):c.75_76del (p.Cys26fs) rs768832921 0.00004
NM_002693.3(POLG):c.911T>G (p.Leu304Arg) rs121918044 0.00004
NM_004369.4(COL6A3):c.4121A>T (p.Asp1374Val) rs766488017 0.00004
NM_005076.5(CNTN2):c.1075C>A (p.Arg359Ser) rs371816961 0.00004
NM_005518.4(HMGCS2):c.181_182insCCAATATGGCCCTGGAGGCCAA (p.Val61fs) rs1553241079 0.00004
NM_020166.5(MCCC1):c.1701G>A (p.Thr567=) rs377320336 0.00004
NM_052845.4(MMAB):c.571C>T (p.Arg191Trp) rs376128990 0.00004
NM_177924.5(ASAH1):c.125C>T (p.Thr42Met) rs145873635 0.00004
NM_182961.4(SYNE1):c.13331G>A (p.Arg4444Gln) rs139075013 0.00004
NM_000053.4(ATP7B):c.2668G>A (p.Val890Met) rs786204718 0.00003
NM_000071.3(CBS):c.1135C>T (p.Arg379Trp) rs769080151 0.00003
NM_000094.4(COL7A1):c.682+1G>A rs775288140 0.00003
NM_000368.5(TSC1):c.568C>T (p.Arg190Cys) rs118203400 0.00003
NM_000426.4(LAMA2):c.4471G>A (p.Asp1491Asn) rs375640462 0.00003
NM_000487.6(ARSA):c.931G>A (p.Gly311Ser) rs74315459 0.00003
NM_001099404.2(SCN5A):c.615T>G (p.Tyr205Ter) rs765669597 0.00003
NM_001110556.2(FLNA):c.20G>C (p.Arg7Pro) rs781814342 0.00003
NM_001382391.1(CSPP1):c.3296A>G (p.Glu1099Gly) rs201629827 0.00003
NM_001609.4(ACADSB):c.1128+3A>T rs760423996 0.00003
NM_001999.4(FBN2):c.8596G>A (p.Gly2866Ser) rs752201545 0.00003
NM_004369.4(COL6A3):c.175C>T (p.Arg59Ter) rs398124119 0.00003
NM_004380.3(CREBBP):c.5740G>A (p.Val1914Met) rs760771706 0.00003
NM_013275.6(ANKRD11):c.541G>A (p.Ala181Thr) rs777123332 0.00003
NM_017654.4(SAMD9):c.3381C>A (p.Tyr1127Ter) rs572380130 0.00003
NM_017882.3(CLN6):c.662A>C (p.Tyr221Ser) rs764571295 0.00003
NM_020041.3(SLC2A9):c.1138C>T (p.Arg380Trp) rs121908321 0.00003
NM_020549.5(CHAT):c.620G>A (p.Arg207His) rs764497513 0.00003
NM_033629.6(TREX1):c.-26-1G>A rs749323787 0.00003
NM_153717.3(EVC):c.2731C>T (p.Arg911Ter) rs767400887 0.00003
NM_198586.3(NHLRC1):c.436G>A (p.Asp146Asn) rs769301934 0.00003
NM_000520.6(HEXA):c.1511G>A (p.Arg504His) rs121907955 0.00002
NM_000532.5(PCCB):c.889C>T (p.Arg297Cys) rs549397464 0.00002
NM_000540.3(RYR1):c.5920C>T (p.Arg1974Trp) rs779733902 0.00002
NM_001012339.3(DNAJC21):c.983+1G>A rs368148362 0.00002
NM_001032386.2(SUOX):c.1376G>A (p.Arg459Gln) rs776356158 0.00002
NM_001199753.2(CPT1C):c.899G>A (p.Arg300His) rs753309074 0.00002
NM_001378615.1(CC2D2A):c.100C>T (p.Arg34Ter) rs896947430 0.00002
NM_001999.4(FBN2):c.2036C>T (p.Ser679Phe) rs760483684 0.00002
NM_004646.4(NPHS1):c.319G>A (p.Ala107Thr) rs386833933 0.00002
NM_005660.3(SLC35A2):c.485G>A (p.Arg162His) rs782305321 0.00002
NM_012431.3(SEMA3E):c.2143C>A (p.Gln715Lys) rs538244011 0.00002
NM_012470.4(TNPO3):c.2542del (p.Tyr848fs) rs773574448 0.00002
NM_014874.4(MFN2):c.334G>A (p.Val112Met) rs757937208 0.00002
NM_015047.3(EMC1):c.245C>T (p.Thr82Met) rs869320625 0.00002
NM_015443.4(KANSL1):c.112G>A (p.Gly38Ser) rs770738115 0.00002
NM_018896.5(CACNA1G):c.3200G>A (p.Arg1067His) rs369751310 0.00002
NM_025243.4(SLC19A3):c.68G>T (p.Gly23Val) rs121917882 0.00002
NM_182894.3(VSX2):c.679C>T (p.Arg227Trp) rs121912545 0.00002
NM_207122.2(EXT2):c.1393C>T (p.Arg465Ter) rs772690312 0.00002
NM_000017.4(ACADS):c.1031A>G (p.Glu344Gly) rs387906950 0.00001
NM_000019.4(ACAT1):c.997G>C (p.Ala333Pro) rs120074147 0.00001
NM_000033.4(ABCD1):c.1452C>G (p.Pro484=) rs782546330 0.00001
NM_000059.4(BRCA2):c.8117A>G (p.Asn2706Ser) rs80359055 0.00001
NM_000159.4(GCDH):c.826G>T (p.Val276Leu) rs763300541 0.00001
NM_000170.3(GLDC):c.2368C>T (p.Arg790Trp) rs386833556 0.00001
NM_000193.4(SHH):c.1147G>A (p.Ala383Thr) rs137853341 0.00001
NM_000199.5(SGSH):c.544C>T (p.Arg182Cys) rs529855742 0.00001
NM_000199.5(SGSH):c.812C>T (p.Thr271Met) rs746776254 0.00001
NM_000214.3(JAG1):c.2429C>T (p.Pro810Leu) rs769531968 0.00001
NM_000257.4(MYH7):c.2804A>T (p.Glu935Val) rs730880761 0.00001
NM_000257.4(MYH7):c.4130C>T (p.Thr1377Met) rs397516201 0.00001
NM_000257.4(MYH7):c.4588C>T (p.Arg1530Ter) rs397516225 0.00001
NM_000263.4(NAGLU):c.1444C>T (p.Arg482Trp) rs104894596 0.00001
NM_000263.4(NAGLU):c.934G>A (p.Asp312Asn) rs1052471595 0.00001
NM_000264.5(PTCH1):c.1322G>A (p.Arg441His) rs767273237 0.00001
NM_000310.4(PPT1):c.490C>T (p.Arg164Ter) rs386833649 0.00001
NM_000391.4(TPP1):c.1340G>A (p.Arg447His) rs119455956 0.00001
NM_000400.4(ERCC2):c.1195C>T (p.Leu399Phe) rs551211003 0.00001
NM_000492.4(CFTR):c.376G>A (p.Gly126Ser) rs397508606 0.00001
NM_000512.5(GALNS):c.1219A>C (p.Asn407His) rs749578474 0.00001
NM_000520.6(HEXA):c.2T>C (p.Met1Thr) rs786204721 0.00001
NM_000520.6(HEXA):c.754C>T (p.Arg252Cys) rs566580738 0.00001
NM_000540.3(RYR1):c.326G>A (p.Arg109Gln) rs762278203 0.00001
NM_000642.3(AGL):c.664+3A>G rs370792293 0.00001
NM_001032382.2(PQBP1):c.778C>T (p.Arg260Ter) rs781987043 0.00001
NM_001130987.2(DYSF):c.2864+1G>A rs199954546 0.00001
NM_001163435.3(TBCK):c.2159C>T (p.Ser720Phe) rs370050799 0.00001
NM_001164508.2(NEB):c.24220G>T (p.Glu8074Ter) rs1218073575 0.00001
NM_001267550.2(TTN):c.107635C>T (p.Gln35879Ter) rs757082154 0.00001
NM_001365536.1(SCN9A):c.1285C>T (p.Arg429Cys) rs763256222 0.00001
NM_001370658.1(BTD):c.40G>A (p.Gly14Ser) rs119103232 0.00001
NM_001556.3(IKBKB):c.1933C>T (p.Arg645Trp) rs753922163 0.00001
NM_001918.5(DBT):c.902G>A (p.Arg301His) rs770981889 0.00001
NM_002335.4(LRP5):c.199G>A (p.Ala67Thr) rs544861971 0.00001
NM_002693.3(POLG):c.1721G>A (p.Arg574Gln) rs764287987 0.00001
NM_002693.3(POLG):c.3527C>T (p.Ser1176Leu) rs776031396 0.00001
NM_003482.4(KMT2D):c.9002A>G (p.Lys3001Arg) rs371231725 0.00001
NM_003560.4(PLA2G6):c.1427+1G>A rs750939090 0.00001
NM_004168.4(SDHA):c.1660C>T (p.Arg554Trp) rs9809219 0.00001
NM_004369.4(COL6A3):c.3220G>A (p.Asp1074Asn) rs778403814 0.00001
NM_005198.5(CHKB):c.138G>T (p.Glu46Asp) rs752292240 0.00001
NM_005787.6(ALG3):c.1024C>A (p.Leu342Ile) rs568371168 0.00001
NM_005787.6(ALG3):c.165C>T (p.Gly55=) rs387906273 0.00001
NM_006019.4(TCIRG1):c.1297C>T (p.Gln433Ter) rs777785526 0.00001
NM_006245.4(PPP2R5D):c.758G>A (p.Arg253Gln) rs1131691266 0.00001
NM_006267.5(RANBP2):c.1754C>T (p.Thr585Met) rs121434502 0.00001
NM_006432.5(NPC2):c.190+5G>A rs80358268 0.00001
NM_006623.4(PHGDH):c.1030C>T (p.Arg344Ter) rs769256568 0.00001
NM_006946.4(SPTBN2):c.1973G>A (p.Arg658Gln) rs753491527 0.00001
NM_007194.4(CHEK2):c.592+3A>T rs587782849 0.00001
NM_012414.4(RAB3GAP2):c.1276C>T (p.Arg426Cys) rs587777167 0.00001
NM_014270.5(SLC7A9):c.605-3C>A rs749913021 0.00001
NM_015166.4(MLC1):c.177+1G>T rs1374593138 0.00001
NM_015978.3(TNNI3K):c.1051G>A (p.Gly351Ser) rs777466193 0.00001
NM_016035.5(COQ4):c.458C>T (p.Ala153Val) rs757173567 0.00001
NM_016138.5(COQ7):c.161G>A (p.Arg54Gln) rs770654508 0.00001
NM_017777.4(MKS1):c.515+1G>A rs201933838 0.00001
NM_017882.3(CLN6):c.679G>A (p.Glu227Lys) rs746753722 0.00001
NM_018972.4(GDAP1):c.373C>T (p.Arg125Ter) rs745663149 0.00001
NM_019616.4(F7):c.1043G>T (p.Cys348Phe) rs121964927 0.00001
NM_020461.4(TUBGCP6):c.1066G>A (p.Val356Met) rs773504995 0.00001
NM_020632.3(ATP6V0A4):c.1346G>A (p.Arg449His) rs1443883930 0.00001
NM_024301.5(FKRP):c.968G>A (p.Arg323His) rs1349031936 0.00001
NM_024306.5(FA2H):c.460C>T (p.Arg154Cys) rs387907040 0.00001
NM_025265.4(TSEN2):c.926A>G (p.Tyr309Cys) rs113994149 0.00001
NM_033629.6(TREX1):c.218C>T (p.Pro73Leu) rs755919767 0.00001
NM_054012.4(ASS1):c.40G>A (p.Gly14Ser) rs121908636 0.00001
NM_152419.3(HGSNAT):c.1345dup (p.Asp449fs) rs483352894 0.00001
NM_176787.5(PIGN):c.996T>G (p.Ile332Met) rs1060499763 0.00001
NM_182760.4(SUMF1):c.1045C>T (p.Arg349Trp) rs137852846 0.00001
NM_000033.4(ABCD1):c.1699C>T (p.Gln567Ter) rs201114595
NM_000044.6(AR):c.171GCA[24] (p.Gln80dup) rs3032358
NM_000048.4(ASL):c.1079T>C (p.Met360Thr) rs875989948
NM_000049.4(ASPA):c.244dup (p.Met82fs) rs756198538
NM_000049.4(ASPA):c.437_449del (p.Ser146fs) rs2073669074
NM_000059.4(BRCA2):c.5350_5351del (p.Asn1784fs) rs80359507
NM_000059.4(BRCA2):c.6841+80_6841+83del rs11571661
NM_000066.4(C8B):c.361C>T (p.Arg121Ter) rs150022116
NM_000071.3(CBS):c.434C>T (p.Pro145Leu) rs121964963
NM_000136.3(FANCC):c.346-1G>A rs1484503633
NM_000152.5(GAA):c.2237G>C (p.Trp746Ser) rs752921215
NM_000153.4(GALC):c.578T>C (p.Ile193Thr) rs1555383498
NM_000155.4(GALT):c.572C>T (p.Ala191Val) rs794727838
NM_000158.4(GBE1):c.998A>T (p.Glu333Val) rs1553684545
NM_000159.4(GCDH):c.1205G>A (p.Arg402Gln) rs786204626
NM_000180.4(GUCY2D):c.129_134del (p.Leu44_Leu45del) rs552184470
NM_000180.4(GUCY2D):c.2927G>T (p.Arg976Leu) rs61750184
NM_000190.4(HMBS):c.667G>A (p.Glu223Lys) rs118204110
NM_000199.5(SGSH):c.89-2A>G rs1369704445
NM_000211.5(ITGB2):c.715G>A (p.Ala239Thr) rs179363873
NM_000231.3(SGCG):c.690T>A (p.Ser230Arg) rs875989949
NM_000277.3(PAH):c.1180G>C (p.Asp394His) rs62516142
NM_000290.4(PGAM2):c.533del (p.Gly178fs) rs747947171
NM_000302.4(PLOD1):c.1651-2A>C rs565513365
NM_000314.8(PTEN):c.196A>T (p.Lys66Ter) rs1554897271
NM_000341.4(SLC3A1):c.1400T>A (p.Met467Lys) rs121912691
NM_000350.3(ABCA4):c.2713del (p.Glu905fs) rs869312184
NM_000352.6(ABCC8):c.4258C>T (p.Arg1420Cys) rs28938469
NM_000441.2(SLC26A4):c.2027T>A (p.Leu676Gln) rs111033318
NM_000487.6(ARSA):c.449C>T (p.Pro150Leu) rs199476375
NM_000489.6(ATRX):c.5968TCT[2] (p.Ser1992del) rs782391479
NM_000492.3(CFTR):c.1521_1523del (p.Phe508del) rs113993960
NM_000492.4(CFTR):c.2989-1G>A rs397508470
NM_000492.4(CFTR):c.350G>A (p.Arg117His) rs78655421
NM_000507.4(FBP1):c.966del (p.Asp323fs) rs747269745
NM_000512.5(GALNS):c.542A>G (p.Tyr181Cys) rs786205899
NM_000520.6(HEXA):c.1361G>A (p.Gly454Asp) rs1229811721
NM_000531.6(OTC):c.674C>T (p.Pro225Leu) rs67120076
NM_000540.3(RYR1):c.14416A>G (p.Asn4806Asp) rs886039586
NM_000540.3(RYR1):c.2485C>T (p.Arg829Ter) rs778320565
NM_000540.3(RYR1):c.7927-7C>T rs886054395
NM_000642.3(AGL):c.4221dup (p.Leu1408fs) rs786204655
NM_000784.4(CYP27A1):c.808C>T (p.Arg270Ter) rs72551318
NM_000965.5(RARB):c.1159C>T (p.Arg387Cys) rs397518483
NM_001040142.2(SCN2A):c.1820G>A (p.Arg607Gln) rs755003900
NM_001042492.3(NF1):c.1756_1759del (p.Thr586fs) rs786202782
NM_001048174.2(MUTYH):c.228C>A (p.Tyr76Ter) rs121908380
NM_001099922.3(ALG13):c.2754ACC[14] (p.Pro945del) rs750710267
NM_001099922.3(ALG13):c.2797CCT[11] (p.Pro944_Pro945del) rs56717389
NM_001101426.4(CRPPA):c.1105GTT[3] (p.Val372del) rs587777798
NM_001110792.2(MECP2):c.1199_1233del (p.Pro400fs) rs267608589
NM_001110792.2(MECP2):c.33AGG[6] (p.Gly16dup) rs587783744
NM_001110792.2(MECP2):c.509C>T (p.Thr170Met) rs28934906
NM_001110792.2(MECP2):c.6CGC[8] (p.Ala7_Ala8dup) rs398123566
NM_001110792.2(MECP2):c.961C>T (p.Arg321Trp) rs61751444
NM_001111125.3(IQSEC2):c.3054G>A (p.Thr1018=) rs782748833
NM_001127222.2(CACNA1A):c.3310_3315dup (p.Gly1104_Pro1105dup) rs776584949
NM_001127222.2(CACNA1A):c.4174G>A (p.Val1392Met) rs794727411
NM_001130144.3(LTBP3):c.76CTG[13] (p.Leu33_Leu35dup) rs71036212
NM_001139.3(ALOX12B):c.1566G>T (p.Pro522=) rs936466427
NM_001139.3(ALOX12B):c.527+2T>G rs1555643304
NM_001144967.3(NEDD4L):c.2677G>A (p.Glu893Lys)
NM_001164508.2(NEB):c.24302_24305dup (p.Leu8102fs) rs1344099907
NM_001164508.2(NEB):c.9631G>A (p.Glu3211Lys) rs757944456
NM_001174150.2(ARL13B):c.422C>G (p.Ala141Gly) rs529580146
NM_001205254.2(OCLN):c.173_194del (p.Trp58fs) rs797045841
NM_001243226.3(TCF4):c.74del (p.Asn25fs) rs752700752
NM_001267550.2(TTN):c.2283_2288del (p.Lys762_Ala763del) rs727503701
NM_001267550.2(TTN):c.34098GGAAGAGGAAGTTCTACCTGA[3] (p.11363VLPEEEE[5]) rs397517548
NM_001346754.2(PIGW):c.617_620del (p.Val206fs) rs753385776
NM_001356.5(DDX3X):c.1052G>A (p.Arg351Gln) rs1057518707
NM_001358530.2(MOCS1):c.1508_1509del (p.Glu503fs) rs397518419
NM_001374828.1(ARID1B):c.1281_1295del (p.Ala429_Ala433del) rs1457993750
NM_001378454.1(ALMS1):c.36GGA[16] (p.Glu26_Glu28dup) rs55889738
NM_001384140.1(PCDH15):c.2361TGT[2] (p.Val790del) rs483352837
NM_001384140.1(PCDH15):c.4990dup (p.Met1664fs) rs766484375
NM_001386393.1(PANK2):c.1112G>C (p.Arg371Pro) rs1241995212
NM_001492.6(GDF1):c.1047_1050del (p.Phe349fs) rs768027510
NM_001709.5(BDNF):c.5C>T (p.Thr2Ile) rs8192466
NM_001848.3(COL6A1):c.850G>A (p.Gly284Arg) rs121912938
NM_001849.4(COL6A2):c.2329T>C (p.Cys777Arg) rs267606747
NM_001875.5(CPS1):c.2161C>T (p.Arg721Ter) rs202107577
NM_002225.5(IVD):c.149G>C (p.Arg50Pro) rs2229311
NM_002225.5(IVD):c.599del (p.Pro200fs) rs1566936542
NM_002618.4(PEX13):c.383G>T (p.Gly128Val) rs554152771
NM_002693.3(POLG):c.126GCA[12] (p.Gln55dup) rs41550117
NM_002887.4(RARS1):c.2T>C (p.Met1Thr) rs769713780
NM_003850.3(SUCLA2):c.751G>A (p.Asp251Asn) rs397515462
NM_003850.3(SUCLA2):c.815A>T (p.Asp272Val) rs1555256440
NM_003982.4(SLC7A7):c.149T>A (p.Met50Lys) rs386833811
NM_004177.5(STX3):c.589C>T (p.Arg197Ter) rs746797808
NM_004369.4(COL6A3):c.2729C>T (p.Thr910Met) rs189356869
NM_004519.4(KCNQ3):c.1720C>T (p.Pro574Ser) rs74582884
NM_004586.3(RPS6KA3):c.2185C>T (p.Arg729Trp) rs1555924331
NM_004722.4(AP4M1):c.1225T>C (p.Phe409Leu) rs760907496
NM_005120.3(MED12):c.6241CAG[7] (p.Gln2086dup) rs786200971
NM_005609.4(PYGM):c.1A>G (p.Met1Val) rs267606993
NM_005619.5(RTN2):c.938dup (p.Thr314fs) rs748397131
NM_005687.5(FARSB):c.853G>A (p.Glu285Lys) rs767956337
NM_005957.5(MTHFR):c.379C>T (p.His127Tyr) rs769381688
NM_005989.4(AKR1D1):c.796C>T (p.Arg266Ter) rs770247815
NM_006245.4(PPP2R5D):c.752A>T (p.Asp251Val) rs1064794719
NM_006493.4(CLN5):c.377T>G (p.Leu126Ter) rs386833972
NM_006623.4(PHGDH):c.781G>A (p.Val261Met) rs267606947
NM_007254.4(PNKP):c.1360C>A (p.Leu454Met) rs200611702
NM_007255.3(B4GALT7):c.277dup (p.His93fs) rs879255634
NM_007294.4(BRCA1):c.3756_3759del (p.Ser1253fs) rs80357868
NM_007327.4(GRIN1):c.2530C>T (p.Arg844Cys) rs1554770667
NM_012233.3(RAB3GAP1):c.429dup (p.Lys144Ter) rs1553444644
NM_014141.6(CNTNAP2):c.97+1G>A rs972116002
NM_014233.4(UBTF):c.628G>A (p.Glu210Lys) rs1555582065
NM_014336.5(AIPL1):c.294del (p.Ile99fs) rs1597331616
NM_014625.4(NPHS2):c.467dup (p.Leu156fs) rs528833893
NM_015120.4(ALMS1):c.54_77del (p.Glu22_Glu29del) rs55889738
NM_016035.5(COQ4):c.437T>G (p.Phe146Cys) rs1163170578
NM_016239.3(MYO15A):c.419dup (p.Phe141Valfs) rs750130520
NM_016938.5(EFEMP2):c.481G>A (p.Glu161Lys) rs761656636
NM_018941.4(CLN8):c.46C>A (p.Leu16Met) rs386834129
NM_020376.4(PNPLA2):c.1430C>T (p.Pro477Leu) rs142588621
NM_020751.3(COG6):c.1746+2T>G rs1555280464
NM_020987.5(ANK3):c.2902G>C (p.Asp968His) rs730882195
NM_020988.3(GNAO1):c.448A>C (p.Asn150His) rs2037660713
NM_022124.6(CDH23):c.4104+15del rs1839422034
NM_022336.4(EDAR):c.1024+16del rs3833574
NM_022336.4(EDAR):c.1259G>A (p.Arg420Gln) rs121908453
NM_031448.6(C19orf12):c.371dup (p.Met124fs) rs1568326754
NM_032383.5(HPS3):c.2739_2742del (p.Glu913fs) rs1277509410
NM_033056.4(PCDH15):c.5029_5032dup (p.Ser1678fs) rs773160902
NM_144772.3(NAXE):c.326dup (p.Thr110fs) rs779820587
NM_144773.4(PROKR2):c.254G>A (p.Arg85His) rs74315418
NM_152564.5(VPS13B):c.6856C>T (p.Gln2286Ter) rs1833092121
NM_152743.4(BRAT1):c.393_422del (p.Gln132_Ala141del) rs1562582216
NM_172107.4(KCNQ2):c.1678C>T (p.Arg560Trp) rs773171451
NM_172107.4(KCNQ2):c.794C>T (p.Ala265Val) rs587777219
NM_172250.3(MMAA):c.664A>G (p.Arg222Gly) rs920825350
NM_198239.2(CCN6):c.740_741del (p.Cys247fs) rs727503755
NM_203290.4(POLR1C):c.364T>A (p.Phe122Ile) rs1554131502
NM_203446.3(SYNJ1):c.1918_1921del (p.Val640fs) rs1488690709

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.