ClinVar Miner

Variants from Stanford Center for Inherited Cardiovascular Disease,Stanford University with conflicting interpretations

Location: United States — Primary collection method: provider interpretation
Minimum review status of the submission from Stanford Center for Inherited Cardiovascular Disease,Stanford University: Collection method of the submission from Stanford Center for Inherited Cardiovascular Disease,Stanford University:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
309 398 0 132 138 4 88 341

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
Stanford Center for Inherited Cardiovascular Disease,Stanford University pathogenic likely pathogenic uncertain significance likely benign benign drug response risk factor other
pathogenic 0 11 6 0 0 1 0 0
likely pathogenic 106 0 16 1 0 0 0 0
uncertain significance 19 49 0 119 38 1 1 0
likely benign 1 1 9 0 6 0 0 0
benign 0 0 5 9 0 0 0 1

Submitter to submitter summary #

Total submitters: 36
Download table as spreadsheet
Submitter Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
GeneDx 0 329 0 100 75 0 55 230
Ambry Genetics 0 213 0 42 71 0 15 128
Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine 0 167 0 5 48 0 12 65
Integrated Genetics/Laboratory Corporation of America 0 44 0 8 42 0 3 53
Biesecker Lab/Clinical Genomics Section,National Institutes of Health 0 22 0 1 28 0 0 29
EGL Genetic Diagnostics, Eurofins Clinical Diagnostics 0 62 0 7 19 1 1 28
CeGaT Praxis fuer Humangenetik Tuebingen 0 53 0 7 16 0 4 27
Athena Diagnostics Inc 0 15 0 8 14 0 2 24
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute 0 22 0 7 15 0 1 23
ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories 0 39 0 6 16 0 0 22
Blueprint Genetics 0 26 0 14 4 0 4 22
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 0 7 0 2 7 0 0 9
PreventionGenetics, PreventionGenetics 0 7 0 2 6 0 0 8
Invitae 0 13 0 5 2 0 1 8
Illumina Clinical Services Laboratory,Illumina 0 6 0 2 3 0 2 7
Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen 0 10 0 5 0 0 1 6
Forensic Genetics Laboratory,Harris County Institute of Forensic Sciences 0 0 0 0 0 0 4 4
OMIM 0 6 0 0 0 1 3 3
Center for Advanced Laboratory Medicine, UC San Diego Health,University of California San Diego 0 0 0 0 3 0 0 3
Genetic Services Laboratory, University of Chicago 0 7 0 1 1 0 0 2
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics,Children's Hospital of Philadelphia 0 0 0 1 1 0 0 2
Quest Diagnostics Nichols Institute San Juan Capistrano 0 6 0 2 0 0 0 2
Human Genome Sequencing Center Clinical Lab, Baylor College of Medicine 0 0 0 1 0 0 0 1
PharmGKB 0 0 0 0 0 1 0 1
Genomic Research Center, Shahid Beheshti University of Medical Sciences 0 1 0 0 0 0 1 1
CSER _CC_NCGL, University of Washington 0 3 0 0 0 0 1 1
Clinical Genetics Karolinska University Hospital,Karolinska University Hospital 0 1 0 1 0 0 0 1
Agnes Ginges Centre for Molecular Cardiology,Centenary Institute 0 2 0 1 0 0 0 1
Albrecht-Kossel-Institute,Medical University Rostock 0 0 0 0 0 1 0 1
Petrovsky National Research Centre of Surgery, The Federal Agency for Scientific Organizations 0 1 0 0 0 0 1 1
Centre for Mendelian Genomics,University Medical Centre Ljubljana 0 0 0 0 0 0 1 1
NIHR Bioresource Rare Diseases, University of Cambridge 0 2 0 0 0 0 1 1
Department of Pathology and Laboratory Medicine,Sinai Health System 0 2 0 0 1 0 0 1
Broad Institute Rare Disease Group, Broad Institute 0 0 0 0 1 0 0 1
Gharavi Laboratory,Columbia University 0 5 0 1 0 0 0 1
Institute for Genomic Medicine (IGM) Clinical Laboratory,Nationwide Children's Hospital 0 0 0 0 1 0 0 1

All variants with conflicting interpretations #

Total variants: 341
Download table as spreadsheet
HGVS dbSNP
NC_012920.1:m.14484T>C rs199476104
NM_000090.3(COL3A1):c.1744G>A (p.Gly582Ser) rs121912923
NM_000109.4(DMD):c.1700T>C (p.Leu567Pro) rs370644567
NM_000117.3(EMD):c.272A>G (p.Asn91Ser) rs137977232
NM_000152.5(GAA):c.1552-13G>A rs111261964
NM_000152.5(GAA):c.271G>A (p.Asp91Asn) rs1800299
NM_000169.2(GLA):c.1196G>C (p.Trp399Ser) rs782449839
NM_000214.3(JAG1):c.1339T>C (p.Cys447Arg) rs863223651
NM_000218.3(KCNQ1):c.1781G>A (p.Arg594Gln) rs199472815
NM_000218.3(KCNQ1):c.573_577del (p.Arg192fs) rs397508118
NM_000238.4(KCNH2):c.1039C>T (p.Pro347Ser) rs138776684
NM_000238.4(KCNH2):c.2254C>T (p.Arg752Trp) rs199472990
NM_000238.4(KCNH2):c.2467C>T (p.Arg823Trp) rs199473538
NM_000238.4(KCNH2):c.422C>T (p.Pro141Leu) rs199472864
NM_000238.4(KCNH2):c.442C>T (p.Arg148Trp) rs139544114
NM_000256.3(MYBPC3):c.1015C>T (p.Gln339Ter) rs730880631
NM_000256.3(MYBPC3):c.1084dup (p.Ser362fs) rs730880723
NM_000256.3(MYBPC3):c.1224-2A>G rs397515891
NM_000256.3(MYBPC3):c.1227-2A>G rs730880531
NM_000256.3(MYBPC3):c.1238A>G (p.Glu413Gly) rs730880532
NM_000256.3(MYBPC3):c.1321G>A (p.Glu441Lys) rs193922377
NM_000256.3(MYBPC3):c.13G>C (p.Gly5Arg) rs201278114
NM_000256.3(MYBPC3):c.1484G>A (p.Arg495Gln) rs200411226
NM_000256.3(MYBPC3):c.148A>G (p.Ser50Gly) rs373164247
NM_000256.3(MYBPC3):c.1504C>T (p.Arg502Trp) rs375882485
NM_000256.3(MYBPC3):c.1522C>T (p.Gln508Ter) rs730880544
NM_000256.3(MYBPC3):c.1577_1580dup (p.Cys528fs) rs730880712
NM_000256.3(MYBPC3):c.1624+4A>T rs397515916
NM_000256.3(MYBPC3):c.1624G>C (p.Glu542Gln) rs121909374
NM_000256.3(MYBPC3):c.1838dup (p.Asp613fs) rs730880649
NM_000256.3(MYBPC3):c.1898-1G>A rs730880558
NM_000256.3(MYBPC3):c.2429G>A (p.Arg810His) rs375675796
NM_000256.3(MYBPC3):c.2490dup (p.His831fs) rs397515966
NM_000256.3(MYBPC3):c.2670G>A (p.Trp890Ter) rs397515982
NM_000256.3(MYBPC3):c.2792dup (p.Lys932fs) rs730880716
NM_000256.3(MYBPC3):c.2833_2834del (p.Arg945fs) rs397515987
NM_000256.3(MYBPC3):c.2870C>G (p.Thr957Ser) rs193922380
NM_000256.3(MYBPC3):c.2873C>T (p.Thr958Ile) rs376504548
NM_000256.3(MYBPC3):c.2905+1G>A rs397515991
NM_000256.3(MYBPC3):c.2942A>C (p.Gln981Pro) rs730880582
NM_000256.3(MYBPC3):c.2992C>G (p.Gln998Glu) rs11570112
NM_000256.3(MYBPC3):c.3019T>C (p.Trp1007Arg) rs730880585
NM_000256.3(MYBPC3):c.3190+5G>A rs587782958
NM_000256.3(MYBPC3):c.3297dup (p.Tyr1100fs) rs397516014
NM_000256.3(MYBPC3):c.3330+2T>G rs387906397
NM_000256.3(MYBPC3):c.3330+5G>C rs373746463
NM_000256.3(MYBPC3):c.3362G>A (p.Arg1121His) rs397516018
NM_000256.3(MYBPC3):c.3535G>A (p.Glu1179Lys) rs199669878
NM_000256.3(MYBPC3):c.3581C>T (p.Ala1194Val) rs730880594
NM_000256.3(MYBPC3):c.3584G>T (p.Gly1195Val) rs730880595
NM_000256.3(MYBPC3):c.3682C>T (p.Arg1228Cys) rs201312636
NM_000256.3(MYBPC3):c.3742_3759dup (p.Gly1248_Cys1253dup) rs193922384
NM_000256.3(MYBPC3):c.3771C>A (p.Asn1257Lys) rs730880603
NM_000256.3(MYBPC3):c.459del (p.Ile154fs) rs397516052
NM_000256.3(MYBPC3):c.551dup (p.Lys185fs) rs397516059
NM_000256.3(MYBPC3):c.649A>G (p.Ser217Gly) rs138753870
NM_000256.3(MYBPC3):c.655G>C (p.Val219Leu) rs397516068
NM_000256.3(MYBPC3):c.710A>C (p.Tyr237Ser) rs397516070
NM_000256.3(MYBPC3):c.821+1G>A rs397516073
NM_000256.3(MYBPC3):c.833del (p.Gly278fs) rs727503212
NM_000256.3(MYBPC3):c.927-9G>A rs397516083
NM_000256.3(MYBPC3):c.94G>A (p.Glu32Lys) rs730880575
NM_000257.4(MYH7):c.1003G>C (p.Ala335Pro) rs727503272
NM_000257.4(MYH7):c.1208G>T (p.Arg403Leu) rs121913624
NM_000257.4(MYH7):c.1324C>T (p.Arg442Cys) rs148808089
NM_000257.4(MYH7):c.1358G>A (p.Arg453His) rs397516101
NM_000257.4(MYH7):c.1750G>C (p.Gly584Arg) rs121913626
NM_000257.4(MYH7):c.1954A>G (p.Arg652Gly) rs727504239
NM_000257.4(MYH7):c.2153T>G (p.Phe718Cys) rs1060501432
NM_000257.4(MYH7):c.2156G>A (p.Arg719Gln) rs121913641
NM_000257.4(MYH7):c.2206A>G (p.Ile736Val) rs397516138
NM_000257.4(MYH7):c.2207T>C (p.Ile736Thr) rs727503261
NM_000257.4(MYH7):c.2213G>C (p.Ser738Thr) rs730880894
NM_000257.4(MYH7):c.2221G>T (p.Gly741Trp) rs121913632
NM_000257.4(MYH7):c.2302G>A (p.Gly768Arg) rs727503260
NM_000257.4(MYH7):c.2360G>A (p.Arg787His) rs376754645
NM_000257.4(MYH7):c.2593A>G (p.Lys865Glu) rs730880749
NM_000257.4(MYH7):c.2602G>C (p.Ala868Pro) rs727504356
NM_000257.4(MYH7):c.2681A>G (p.Glu894Gly) rs397516161
NM_000257.4(MYH7):c.2770G>A (p.Glu924Lys) rs121913628
NM_000257.4(MYH7):c.2858A>T (p.Asp953Val) rs730880901
NM_000257.4(MYH7):c.2890G>C (p.Val964Leu) rs45496496
NM_000257.4(MYH7):c.2945T>C (p.Met982Thr) rs145532615
NM_000257.4(MYH7):c.3981C>A (p.Asn1327Lys) rs141764279
NM_000257.4(MYH7):c.4031G>A (p.Arg1344Gln) rs797045097
NM_000257.4(MYH7):c.4066G>A (p.Glu1356Lys) rs727503246
NM_000257.4(MYH7):c.427C>T (p.Arg143Trp) rs727503278
NM_000257.4(MYH7):c.4377G>T (p.Lys1459Asn) rs201307101
NM_000257.4(MYH7):c.4402G>A (p.Glu1468Lys) rs876657884
NM_000257.4(MYH7):c.452C>T (p.Pro151Leu) rs730880837
NM_000257.4(MYH7):c.4588C>T (p.Arg1530Ter) rs397516225
NM_000257.4(MYH7):c.5135G>A (p.Arg1712Gln) rs193922390
NM_000257.4(MYH7):c.5378T>C (p.Leu1793Pro) rs121913654
NM_000257.4(MYH7):c.5399C>T (p.Ala1800Val) rs730880817
NM_000257.4(MYH7):c.5452C>T (p.Arg1818Trp) rs763073072
NM_000257.4(MYH7):c.5562G>A (p.Thr1854=) rs368706722
NM_000257.4(MYH7):c.611G>A (p.Arg204His) rs397516260
NM_000257.4(MYH7):c.709C>T (p.Arg237Trp) rs45516091
NM_000257.4(MYH7):c.77C>T (p.Ala26Val) rs186964570
NM_000257.4(MYH7):c.788T>C (p.Ile263Thr) rs397516269
NM_000257.4(MYH7):c.958G>A (p.Val320Met) rs376897125
NM_000258.3(MYL3):c.170C>A (p.Ala57Asp) rs139794067
NM_000258.3(MYL3):c.427G>A (p.Glu143Lys) rs104893750
NM_000335.4(SCN5A):c.5461_5464del (p.Glu1822fs) rs794728924
NM_000335.5(SCN5A):c.2440C>T (p.Arg814Trp) rs199473161
NM_000335.5(SCN5A):c.3305C>A (p.Ser1102Tyr) rs7626962
NM_000335.5(SCN5A):c.3748G>A (p.Val1250Met) rs199473600
NM_000335.5(SCN5A):c.3875T>C (p.Phe1292Ser) rs41311127
NM_000335.5(SCN5A):c.52C>T (p.Arg18Trp) rs199473044
NM_000335.5(SCN5A):c.5848G>T (p.Val1950Leu) rs41315493
NM_000335.5(SCN5A):c.659C>T (p.Thr220Ile) rs45620037
NM_000363.5(TNNI3):c.204del (p.Arg69fs) rs727504872
NM_000363.5(TNNI3):c.235C>T (p.Arg79Cys) rs3729712
NM_000363.5(TNNI3):c.25-8T>A rs3729836
NM_000363.5(TNNI3):c.302A>G (p.His101Arg) rs730881087
NM_000363.5(TNNI3):c.433C>T (p.Arg145Trp) rs104894724
NM_000363.5(TNNI3):c.485G>A (p.Arg162Gln) rs397516354
NM_000363.5(TNNI3):c.497C>T (p.Ser166Phe) rs727504242
NM_000363.5(TNNI3):c.509G>A (p.Arg170Gln) rs727503503
NM_000363.5(TNNI3):c.523C>T (p.Gln175Ter) rs876661394
NM_000363.5(TNNI3):c.610C>T (p.Arg204Cys) rs727504243
NM_000371.3(TTR):c.130C>T (p.Pro44Ser) rs11541790
NM_000371.4(TTR):c.238A>G (p.Thr80Ala) rs121918070
NM_000371.4(TTR):c.349G>T (p.Ala117Ser) rs267607161
NM_000371.4(TTR):c.417G>A (p.Thr139=) rs2276382
NM_000432.3(MYL2):c.488A>G (p.Glu163Gly) rs397516407
NM_000432.4(MYL2):c.141C>A (p.Asn47Lys) rs199474808
NM_000432.4(MYL2):c.173G>A (p.Arg58Gln) rs104894369
NM_000432.4(MYL2):c.484G>A (p.Gly162Arg) rs199474814
NM_000527.4(LDLR):c.313+1G>A
NM_000527.5(LDLR):c.1055G>A (p.Cys352Tyr) rs193922566
NM_000527.5(LDLR):c.1586+5G>A rs781362878
NM_000527.5(LDLR):c.190+4A>T rs769446356
NM_000527.5(LDLR):c.519C>G (p.Cys173Trp) rs769318035
NM_000527.5(LDLR):c.631C>T (p.His211Tyr) rs771917370
NM_000527.5(LDLR):c.682G>A (p.Glu228Lys)
NM_000527.5(LDLR):c.798T>A (p.Asp266Glu) rs139043155
NM_000540.3(RYR1):c.7300G>A (p.Gly2434Arg) rs121918593
NM_000719.7(CACNA1C):c.1552C>T (p.Arg518Cys) rs786205748
NM_000719.7(CACNA1C):c.5918G>A (p.Arg1973Gln) rs112414325
NM_000719.7(CACNA1C):c.911T>C (p.Ile304Thr) rs201756421
NM_001005242.3(PKP2):c.505A>G (p.Ser169Gly) rs139139859
NM_001005242.3(PKP2):c.76G>A (p.Asp26Asn) rs143004808
NM_001018005.2(TPM1):c.115-238G>C rs730881126
NM_001018005.2(TPM1):c.574G>A (p.Glu192Lys) rs199476315
NM_001018005.2(TPM1):c.644C>T (p.Ser215Leu) rs199476316
NM_001018005.2(TPM1):c.64G>A (p.Ala22Thr) rs397516382
NM_001018005.2(TPM1):c.845C>G (p.Thr282Ser) rs397516395
NM_001018008.2(TPM1):c.695G>A (p.Arg232His) rs730881128
NM_001035.3(RYR2):c.10231-4T>C rs117180147
NM_001035.3(RYR2):c.1259G>A (p.Arg420Gln) rs794728721
NM_001035.3(RYR2):c.14173T>A (p.Tyr4725Asn) rs876661387
NM_001035.3(RYR2):c.2267G>A (p.Ser756Asn) rs193922623
NM_001035.3(RYR2):c.3251G>A (p.Arg1084Lys) rs193922624
NM_001035.3(RYR2):c.3320C>T (p.Thr1107Met) rs200236750
NM_001035.3(RYR2):c.3380A>G (p.Glu1127Gly) rs200525962
NM_001035.3(RYR2):c.649A>G (p.Ile217Val) rs200642525
NM_001035.3(RYR2):c.8145G>T (p.Glu2715Asp) rs200420897
NM_001035.3(RYR2):c.9619A>G (p.Asn3207Asp) rs372601642
NM_001035.3(RYR2):c.9655G>A (p.Val3219Met) rs371147744
NM_001037.5(SCN1B):c.363C>G (p.Cys121Trp) rs104894718
NM_001037.5(SCN1B):c.448+193G>A rs66876876
NM_001103.3(ACTN2):c.1748A>G (p.Glu583Gly) rs200631005
NM_001103.3(ACTN2):c.2147C>T (p.Thr716Met) rs193922635
NM_001103.3(ACTN2):c.2578C>T (p.Gln860Ter) rs763078071
NM_001103.3(ACTN2):c.893G>A (p.Arg298His) rs142482143
NM_001103.3(ACTN2):c.947T>C (p.Met316Thr) rs370757762
NM_001105206.3(LAMA4):c.1277T>C (p.Met426Thr) rs200112094
NM_001105206.3(LAMA4):c.1475T>A (p.Leu492His) rs3752579
NM_001134363.3(RBM20):c.1222dup (p.Leu408fs) rs1564844428
NM_001134363.3(RBM20):c.1286T>C (p.Leu429Pro) rs61735272
NM_001134363.3(RBM20):c.2662G>A (p.Asp888Asn) rs201370621
NM_001134363.3(RBM20):c.2737G>A (p.Glu913Lys) rs397516607
NM_001134363.3(RBM20):c.448G>A (p.Ala150Thr) rs199868951
NM_001134363.3(RBM20):c.680G>T (p.Gly227Val) rs202238753
NM_001148.6(ANK2):c.11231C>A (p.Thr3744Asn) rs121912705
NM_001148.6(ANK2):c.4310C>T (p.Thr1437Met) rs142534126
NM_001148.6(ANK2):c.4315G>T (p.Gly1439Cys) rs34591340
NM_001148.6(ANK2):c.7183A>C (p.Thr2395Pro) rs201693280
NM_001148.6(ANK2):c.9526G>T (p.Asp3176Tyr) rs138928206
NM_001199973.2(RPL36A-HNRNPH2):c.300+2502_300+2517del rs876661347
NM_001232.3(CASQ2):c.97C>T (p.Arg33Ter) rs397507556
NM_001232.4(CASQ2):c.1188TGA[2] (p.Asp398del) rs72554070
NM_001232.4(CASQ2):c.731A>G (p.His244Arg) rs28730716
NM_001234.5(CAV3):c.442C>T (p.Arg148Trp) rs730880422
NM_001256850.1(TTN):c.30895+1G>A rs794727043
NM_001267550.2(TTN):c.11312-5194_11312-5162dup rs397517815
NM_001267550.2(TTN):c.52307_52310dup (p.Glu17437delinsAspTer) rs794729323
NM_001267550.2(TTN):c.54166C>T (p.Arg18056Ter) rs768431507
NM_001267550.2(TTN):c.57331C>T (p.Arg19111Ter) rs72646831
NM_001267550.2(TTN):c.57769C>T (p.Arg19257Ter) rs794729275
NM_001267550.2(TTN):c.59729C>T (p.Thr19910Ile) rs369476725
NM_001267550.2(TTN):c.62217T>A (p.Tyr20739Ter) rs727503586
NM_001267550.2(TTN):c.64688del (p.Pro21563fs) rs774395395
NM_001267550.2(TTN):c.67706G>A (p.Arg22569Gln) rs185620750
NM_001267550.2(TTN):c.75328C>T (p.Arg25110Ter) rs794729382
NM_001267550.2(TTN):c.75663del (p.Lys25221fs) rs1131691542
NM_001267550.2(TTN):c.76397_76398del (p.Ile25466fs) rs794729342
NM_001267550.2(TTN):c.90246A>G (p.Ile30082Met) rs886038812
NM_001267550.2(TTN):c.91621G>A (p.Gly30541Arg) rs200854704
NM_001267550.2(TTN):c.9487C>T (p.Arg3163Cys) rs140664731
NM_001267550.2(TTN):c.98294C>G (p.Ala32765Gly) rs72648273
NM_001276345.2(TNNT2):c.310C>T (p.Arg104Cys) rs727503513
NM_001276345.2(TNNT2):c.311G>T (p.Arg104Leu) rs397516457
NM_001276345.2(TNNT2):c.321G>T (p.Lys107Asn) rs397516459
NM_001276345.2(TNNT2):c.418C>T (p.Arg140Cys) rs397516463
NM_001276345.2(TNNT2):c.506G>A (p.Arg169Gln) rs45501500
NM_001276345.2(TNNT2):c.547C>T (p.Arg183Trp) rs727503512
NM_001276345.2(TNNT2):c.548G>A (p.Arg183Gln) rs397516471
NM_001276345.2(TNNT2):c.601-1G>A rs483352835
NM_001276345.2(TNNT2):c.644G>A (p.Arg215Gln) rs121964860
NM_001276345.2(TNNT2):c.862C>T (p.Arg288Cys) rs121964857
NM_001276345.2(TNNT2):c.866G>A (p.Gly289Glu) rs727505233
NM_001289808.2(CRYAB):c.460G>A (p.Gly154Ser) rs150516929
NM_001613.4(ACTA2):c.773G>A (p.Arg258His) rs121434527
NM_001927.4(DES):c.1371+1G>A rs748323823
NM_001943.5(DSG2):c.1303G>A (p.Asp435Asn) rs370509593
NM_001943.5(DSG2):c.137G>A (p.Arg46Gln) rs121913008
NM_001943.5(DSG2):c.2759T>G (p.Val920Gly) rs142841727
NM_001943.5(DSG2):c.437G>T (p.Arg146Leu) rs113451409
NM_001943.5(DSG2):c.44T>A (p.Leu15Gln) rs372174546
NM_001943.5(DSG2):c.545A>G (p.Asn182Ser) rs368512832
NM_001943.5(DSG2):c.716T>C (p.Val239Ala) rs200997703
NM_002230.4(JUP):c.266T>C (p.Met89Thr) rs542745694
NM_002294.3(LAMP2):c.1093+2514G>A rs144140265
NM_002471.4(MYH6):c.1410C>T (p.Asp470=) rs139886074
NM_002471.4(MYH6):c.292G>A (p.Glu98Lys) rs140596256
NM_003276.2(TMPO):c.1277C>T (p.Pro426Leu) rs141443652
NM_003280.3(TNNC1):c.161C>A (p.Pro54His) rs876661393
NM_003280.3(TNNC1):c.23C>T (p.Ala8Val) rs267607125
NM_003673.4(TCAP):c.313G>C (p.Glu105Gln) rs146906267
NM_003803.4(MYOM1):c.2384+4A>T rs73373171
NM_004006.2(DMD):c.10889G>A (p.Arg3630Gln) rs1057522606
NM_004006.3(DMD):c.6571C>T (p.Arg2191Trp) rs149322279
NM_004281.3(BAG3):c.1436C>T (p.Ala479Val) rs34656239
NM_004281.3(BAG3):c.699C>A (p.Tyr233Ter) rs876661342
NM_004281.4(BAG3):c.280A>T (p.Ile94Phe) rs145393807
NM_004281.4(BAG3):c.367C>T (p.Arg123Ter) rs387906875
NM_004281.4(BAG3):c.653G>A (p.Arg218Gln) rs201638005
NM_004387.4(NKX2-5):c.334+1G>T rs876661380
NM_004387.4(NKX2-5):c.443del (p.Ala148fs) rs876661381
NM_004387.4(NKX2-5):c.627GCC[6] (p.Pro214dup) rs746833511
NM_004415.4(DSP):c.1140+6T>C rs534740669
NM_004415.4(DSP):c.269A>G (p.Gln90Arg) rs188516326
NM_004415.4(DSP):c.3701A>G (p.Asn1234Ser) rs185367490
NM_004415.4(DSP):c.4372C>G (p.Arg1458Gly) rs28763965
NM_004415.4(DSP):c.4741A>G (p.Lys1581Glu) rs186842903
NM_004415.4(DSP):c.5498A>T (p.Glu1833Val) rs78652302
NM_004415.4(DSP):c.6208G>A (p.Asp2070Asn) rs41302885
NM_004415.4(DSP):c.6881C>G (p.Ala2294Gly) rs147000526
NM_004415.4(DSP):c.7916G>A (p.Arg2639Gln) rs116888866
NM_004415.4(DSP):c.88G>A (p.Val30Met) rs121912998
NM_004415.4(DSP):c.939+1G>A rs727504443
NM_004517.4(ILK):c.65A>G (p.Asn22Ser) rs114115159
NM_004572.3(PKP2):c.2524G>A (p.Val842Ile) rs368633311
NM_004612.4(TGFBR1):c.343+3A>G rs374717754
NM_004980.4(KCND3):c.1456A>G (p.Thr486Ala) rs149008060
NM_005159.5(ACTC1):c.275_277del (p.Phe92del) rs730880388
NM_005159.5(ACTC1):c.500T>C (p.Ile167Thr) rs730880409
NM_005472.5(KCNE3):c.248G>A (p.Arg83His) rs17215437
NM_005477.3(HCN4):c.2804C>T (p.Ser935Phe) rs775803239
NM_005691.3(ABCC9):c.2199-13G>A rs201226082
NM_005751.4(AKAP9):c.3580G>A (p.Ala1194Thr) rs139965373
NM_005751.4(AKAP9):c.4814C>T (p.Thr1605Met) rs777627168
NM_005751.4(AKAP9):c.7488T>G (p.Asn2496Lys) rs201977551
NM_005751.4(AKAP9):c.8189A>G (p.Gln2730Arg) rs80191629
NM_006073.4(TRDN):c.367G>A (p.Asp123Asn) rs201021891
NM_006393.3(NEBL):c.180G>C (p.Lys60Asn) rs41277374
NM_006393.3(NEBL):c.82-4A>G rs368268112
NM_006514.3(SCN10A):c.3803G>A (p.Arg1268Gln) rs138832868
NM_007078.3(LDB3):c.1051A>G (p.Thr351Ala) rs138251566
NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[1] (p.434APAYTPSP[1]) rs397517209
NM_007078.3(LDB3):c.466G>A (p.Ala156Thr) rs200596619
NM_007078.3(LDB3):c.566C>T (p.Ser189Leu) rs45487699
NM_007373.3(SHOC2):c.610A>G (p.Ile204Val) rs200015085
NM_014000.3(VCL):c.2521G>C (p.Asp841His) rs150385900
NM_014476.5(PDLIM3):c.715G>A (p.Asp239Asn) rs142143310
NM_014476.5(PDLIM3):c.896G>A (p.Ser299Asn) rs143812960
NM_015120.4(ALMS1):c.1456A>G (p.Ile486Val) rs73945001
NM_015120.4(ALMS1):c.2039A>G (p.Tyr680Cys) rs199573929
NM_016203.4(PRKAG2):c.712G>A (p.Ala238Thr) rs200736454
NM_020433.5(JPH2):c.572C>G (p.Pro191Arg) rs554853074
NM_024334.2(TMEM43):c.1061G>C (p.Cys354Ser) rs187262922
NM_024422.6(DSC2):c.2194T>G (p.Leu732Val) rs151024019
NM_024422.6(DSC2):c.304G>A (p.Glu102Lys) rs144799937
NM_032578.4(MYPN):c.3122T>A (p.Ile1041Asn) rs754227127
NM_032578.4(MYPN):c.3481C>A (p.Leu1161Ile) rs138313730
NM_033118.4(MYLK2):c.173C>A (p.Ala58Asp) rs138130914
NM_033337.3(CAV3):c.233C>T (p.Thr78Met) rs72546668
NM_144573.3(NEXN):c.1935C>G (p.Phe645Leu) rs794729086
NM_144573.4(NEXN):c.1416AAG[1] (p.Arg475del) rs794729091
NM_144573.4(NEXN):c.1671GGA[2] (p.Glu561_Glu562del) rs397517848
NM_144573.4(NEXN):c.995A>C (p.Glu332Ala) rs201763096
NM_170707.4(LMNA):c.1129C>T (p.Arg377Cys) rs397517889
NM_170707.4(LMNA):c.1294C>T (p.Gln432Ter) rs267607618
NM_170707.4(LMNA):c.1622G>A (p.Arg541His) rs61444459
NM_170707.4(LMNA):c.1930C>T (p.Arg644Cys) rs142000963
NM_170707.4(LMNA):c.344A>T (p.Glu115Val) rs794728588
NM_170707.4(LMNA):c.356G>C (p.Arg119Pro) rs397517902
NM_170707.4(LMNA):c.398G>A (p.Arg133Gln) rs60864230
NM_170707.4(LMNA):c.513+2T>G rs1553264668
NM_170707.4(LMNA):c.640-10A>G rs80356807
NM_170707.4(LMNA):c.646C>T (p.Arg216Cys) rs794728591
NM_170707.4(LMNA):c.736C>T (p.Gln246Ter) rs267607587
NM_172056.2(KCNH2):c.1496T>G (p.Leu499Arg) rs794728370
NM_172056.2(KCNH2):c.1838C>T (p.Thr613Met) rs199473524
NM_172056.2(KCNH2):c.1882G>A (p.Gly628Ser) rs121912507
NM_172056.2(KCNH2):c.215C>A (p.Pro72Gln) rs199473421
NM_172056.2(KCNH2):c.2390C>A (p.Ala797Asp) rs794728389
NM_172056.2(KCNH2):c.982C>T (p.Arg328Cys) rs199473505
NM_172244.3(SGCD):c.717C>G (p.Asp239Glu) rs180898690
NM_174934.3(SCN4B):c.22G>A (p.Gly8Ser) rs149868494
NM_174936.4(PCSK9):c.45GCT[8] (p.Leu23dup) rs35574083
NM_181798.1(KCNQ1):c.1013-1G>T rs775537394
NM_181798.1(KCNQ1):c.1184A>C (p.Tyr395Ser) rs199472789
NM_181798.1(KCNQ1):c.1305-2A>G rs878854350
NM_181798.1(KCNQ1):c.1387G>A (p.Ala463Thr) rs199472813
NM_181798.1(KCNQ1):c.199G>C (p.Ala67Pro) rs199472699
NM_181798.1(KCNQ1):c.343G>A (p.Asp115Asn) rs199472712
NM_181798.1(KCNQ1):c.394C>T (p.Arg132Cys) rs199472719
NM_181798.1(KCNQ1):c.416T>C (p.Leu139Pro) rs199473460
NM_181798.1(KCNQ1):c.449C>T (p.Ser150Leu) rs199472730
NM_181798.1(KCNQ1):c.577C>T (p.Pro193Ser) rs199472753
NM_181798.1(KCNQ1):c.592G>A (p.Gly198Arg) rs199472756
NM_181798.1(KCNQ1):c.650C>A (p.Ala217Glu) rs199472763
NM_181798.1(KCNQ1):c.694C>T (p.Gln232Ter) rs397508075
NM_181798.1(KCNQ1):c.740T>A (p.Leu247His) rs199472767
NM_182961.4(SYNE1):c.23315G>A (p.Arg7772Gln) rs138787771
NM_198056.2(SCN5A):c.1993G>T (p.Ala665Ser) rs756474485
NM_198056.2(SCN5A):c.2014G>A (p.Ala672Thr) rs199473140
NM_198056.2(SCN5A):c.268C>A (p.Gln90Lys) rs794728839
NM_198056.2(SCN5A):c.2893C>T (p.Arg965Cys) rs199473180
NM_198056.2(SCN5A):c.4877G>A (p.Arg1626His) rs199473283
NM_198056.2(SCN5A):c.4931G>A (p.Arg1644His) rs28937316
NM_198056.2(SCN5A):c.5129C>T (p.Ser1710Leu) rs137854604
NM_198056.2(SCN5A):c.5378T>A (p.Met1793Lys) rs794728897
NM_198056.2(SCN5A):c.680T>C (p.Leu227Pro) rs760011764
NM_198056.2(SCN5A):c.80G>A (p.Arg27His) rs199473045
NM_201596.3(CACNB2):c.641G>C (p.Ser214Thr) rs149253719
m.7468C>T rs111033173
m.8342G>A rs118192103

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.