ClinVar Miner

Variants from Stanford Center for Inherited Cardiovascular Disease, Stanford University with conflicting interpretations

Location: United States  Primary collection method: provider interpretation
Minimum review status of the submission from Stanford Center for Inherited Cardiovascular Disease, Stanford University: Collection method of the submission from Stanford Center for Inherited Cardiovascular Disease, Stanford University:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
184 395 0 165 235 4 97 474

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
Stanford Center for Inherited Cardiovascular Disease, Stanford University pathogenic likely pathogenic uncertain significance likely benign benign drug response risk factor other
pathogenic 0 22 6 0 0 1 1 0
likely pathogenic 119 0 18 1 0 0 0 0
uncertain significance 21 58 0 212 66 1 1 0
likely benign 1 1 10 0 13 0 0 0
benign 1 0 5 11 0 0 0 1

Submitter to submitter summary #

Total submitters: 55
Download table as spreadsheet
Submitter Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
Ambry Genetics 0 388 0 89 169 0 37 295
GeneDx 0 403 0 115 113 0 47 275
Women's Health and Genetics/Laboratory Corporation of America, LabCorp 0 74 0 11 73 0 6 90
CeGaT Center for Human Genetics Tuebingen 0 74 0 14 56 0 7 77
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine 0 155 0 5 51 0 11 67
PreventionGenetics, part of Exact Sciences 0 43 0 17 47 0 2 66
Joint Genome Diagnostic Labs from Nijmegen and Maastricht, Radboudumc and MUMC+ 0 63 0 15 41 0 5 61
Clinical Genetics, Academic Medical Center 0 67 0 17 40 0 3 60
Genome Diagnostics Laboratory, University Medical Center Utrecht 0 21 0 7 39 0 3 49
Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center 0 43 0 8 33 0 3 44
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories 0 54 0 12 24 0 1 37
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen 0 32 0 7 26 0 2 35
Biesecker Lab/Clinical Genomics Section, National Institutes of Health 0 22 0 1 30 0 0 31
Eurofins Ntd Llc (ga) 0 62 0 7 19 1 1 28
Revvity Omics, Revvity 0 61 0 18 5 0 4 27
Athena Diagnostics Inc 0 19 0 9 14 0 2 25
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease, Montreal Heart Institute 0 22 0 7 15 0 1 23
Blueprint Genetics 0 23 0 13 5 0 4 22
Color Diagnostics, LLC DBA Color Health 0 40 0 9 10 0 3 22
Invitae 0 24 0 6 8 0 2 16
Mayo Clinic Laboratories, Mayo Clinic 0 54 0 10 0 0 5 15
Laboratory of Diagnostic Genome Analysis, Leiden University Medical Center (LUMC) 0 7 0 1 12 0 0 13
AiLife Diagnostics, AiLife Diagnostics 0 36 0 8 0 0 5 13
Center for Pediatric Genomic Medicine, Children's Mercy Hospital and Clinics 0 7 0 2 7 0 0 9
Illumina Laboratory Services, Illumina 0 9 0 2 5 0 1 8
Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen 0 13 0 7 0 0 1 8
OMIM 0 5 0 0 1 2 3 5
Quest Diagnostics Nichols Institute San Juan Capistrano 0 10 0 3 2 0 0 5
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego 0 6 0 5 0 0 0 5
Forensic Genetics Laboratory, Harris County Institute of Forensic Sciences 0 0 0 0 0 0 4 4
Genetic Services Laboratory, University of Chicago 0 6 0 1 2 0 0 3
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics, Children's Hospital of Philadelphia 0 0 0 1 1 0 0 2
Klaassen Lab, Charite University Medicine Berlin 0 1 0 2 0 0 0 2
Center for Advanced Laboratory Medicine, UC San Diego Health, University of California San Diego 0 0 0 0 2 0 0 2
Robert's Program, Boston Children's Hospital 0 1 0 2 0 0 0 2
Institute of Human Genetics, University Hospital Muenster 0 2 0 2 0 0 0 2
Greenwood Genetic Center Diagnostic Laboratories, Greenwood Genetic Center 0 4 0 1 0 0 0 1
Institute for Genomic Medicine (IGM) Clinical Laboratory, Nationwide Children's Hospital 0 0 0 0 1 0 0 1
PharmGKB 0 0 0 0 0 1 0 1
Genomic Research Center, Shahid Beheshti University of Medical Sciences 0 1 0 0 0 0 1 1
CSER _CC_NCGL, University of Washington 0 3 0 0 0 0 1 1
Clinical Genetics and Genomics, Karolinska University Hospital 0 1 0 1 0 0 0 1
Agnes Ginges Centre for Molecular Cardiology, Centenary Institute 0 2 0 1 0 0 0 1
Albrecht-Kossel-Institute, Medical University Rostock 0 0 0 0 0 1 0 1
Soonchunhyang University Bucheon Hospital, Soonchunhyang University Medical Center 0 0 0 0 1 0 0 1
Petrovsky National Research Centre of Surgery, The Federal Agency for Scientific Organizations 0 1 0 0 0 0 1 1
Centre for Mendelian Genomics, University Medical Centre Ljubljana 0 0 0 0 0 0 1 1
NIHR Bioresource Rare Diseases, University of Cambridge 0 2 0 0 0 0 1 1
Department of Pathology and Laboratory Medicine, Sinai Health System 0 2 0 0 1 0 0 1
Genome Diagnostics Laboratory, Amsterdam University Medical Center 0 4 0 1 0 0 0 1
Broad Center for Mendelian Genomics, Broad Institute of MIT and Harvard 0 0 0 0 1 0 0 1
Gharavi Laboratory, Columbia University 0 5 0 1 0 0 0 1
Practice for Gait Abnormalities, David Pomarino, Competency Network Toe Walking c/o Practice Pomarino 0 0 0 0 0 0 1 1
Human Genetics Bochum, Ruhr University Bochum 0 0 0 0 0 0 1 1
Biology Molecular and Stem Cell Facilities Laboratory, National Cardiovascular Center, Harapan Kita Hospital 0 0 0 0 0 0 1 1

All variants with conflicting interpretations #

Total variants: 474
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_000363.5(TNNI3):c.25-8T>A rs3729836 0.35138
NM_000335.5(SCN5A):c.1673A>G (p.His558Arg) rs1805124 0.24768
NM_001232.4(CASQ2):c.731A>G (p.His244Arg) rs28730716 0.02511
NM_000152.5(GAA):c.271G>A (p.Asp91Asn) rs1800299 0.02215
NM_000335.5(SCN5A):c.3305C>A (p.Ser1102Tyr) rs7626962 0.02208
NM_001035.3(RYR2):c.4198A>G (p.Ser1400Gly) rs56229512 0.01531
NM_004415.4(DSP):c.5498A>T (p.Glu1833Val) rs78652302 0.00908
NM_001005242.3(PKP2):c.76G>A (p.Asp26Asn) rs143004808 0.00716
NM_001032283.3(TMPO):c.565+2487C>T rs17028450 0.00576
NM_001943.5(DSG2):c.2759T>G (p.Val920Gly) rs142841727 0.00439
NM_182961.4(SYNE1):c.23315G>A (p.Arg7772Gln) rs138787771 0.00432
NM_002294.3(LAMP2):c.1093+2514G>A rs144140265 0.00404
NM_006393.3(NEBL):c.180G>C (p.Lys60Asn) rs41277374 0.00382
NM_001134363.3(RBM20):c.2662G>A (p.Asp888Asn) rs201370621 0.00344
NM_005472.5(KCNE3):c.248G>A (p.Arg83His) rs17215437 0.00338
NM_033337.3(CAV3):c.233C>T (p.Thr78Met) rs72546668 0.00317
NM_004415.4(DSP):c.6208G>A (p.Asp2070Asn) rs41302885 0.00290
NM_003803.4(MYOM1):c.2384+4A>T rs73373171 0.00286
NM_000152.5(GAA):c.1552-13G>A rs111261964 0.00276
NM_144573.4(NEXN):c.995A>C (p.Glu332Ala) rs201763096 0.00262
NM_006514.4(SCN10A):c.3803G>A (p.Arg1268Gln) rs138832868 0.00259
NM_001267550.2(TTN):c.98294C>G (p.Ala32765Gly) rs72648273 0.00253
NM_000256.3(MYBPC3):c.2992C>G (p.Gln998Glu) rs11570112 0.00247
NM_001037.5(SCN1B):c.448+193G>A rs66876876 0.00227
NM_001378454.1(ALMS1):c.1453A>G (p.Ile485Val) rs73945001 0.00195
NM_000256.3(MYBPC3):c.565G>A (p.Val189Ile) rs11570052 0.00187
NM_001378454.1(ALMS1):c.2036A>G (p.Tyr679Cys) rs199573929 0.00146
NM_001032283.3(TMPO):c.565+1696C>T rs141443652 0.00142
NM_000719.7(CACNA1C):c.5918G>A (p.Arg1973Gln) rs112414325 0.00140
NM_024422.6(DSC2):c.2194T>G (p.Leu732Val) rs151024019 0.00138
NM_004415.4(DSP):c.4372C>G (p.Arg1458Gly) rs28763965 0.00131
NM_001134363.3(RBM20):c.1286T>C (p.Leu429Pro) rs61735272 0.00126
NM_032578.4(MYPN):c.3481C>A (p.Leu1161Ile) rs138313730 0.00123
NM_170707.4(LMNA):c.1930C>T (p.Arg644Cys) rs142000963 0.00117
NM_000371.4(TTR):c.417G>A (p.Thr139=) rs2276382 0.00104
NM_004281.4(BAG3):c.1436C>T (p.Ala479Val) rs34656239 0.00097
NM_001005242.3(PKP2):c.505A>G (p.Ser169Gly) rs139139859 0.00096
NM_000257.4(MYH7):c.2945T>C (p.Met982Thr) rs145532615 0.00095
NM_004415.4(DSP):c.88G>A (p.Val30Met) rs121912998 0.00094
NM_001105206.3(LAMA4):c.1475T>A (p.Leu492His) rs3752579 0.00093
NM_001289808.2(CRYAB):c.460G>A (p.Gly154Ser) rs150516929 0.00088
NM_000256.3(MYBPC3):c.2870C>G (p.Thr957Ser) rs193922380 0.00086
NM_004281.4(BAG3):c.280A>T (p.Ile94Phe) rs145393807 0.00085
NM_007078.3(LDB3):c.466G>A (p.Ala156Thr) rs200596619 0.00082
NM_004517.4(ILK):c.65A>G (p.Asn22Ser) rs114115159 0.00080
NM_201596.3(CACNB2):c.641G>C (p.Ser214Thr) rs149253719 0.00078
NM_001148.6(ANK2):c.11231C>A (p.Thr3744Asn) rs121912705 0.00077
NM_001378969.1(KCND3):c.1456A>G (p.Thr486Ala) rs149008060 0.00077
NM_000256.3(MYBPC3):c.649A>G (p.Ser217Gly) rs138753870 0.00076
NM_024422.6(DSC2):c.304G>A (p.Glu102Lys) rs144799937 0.00070
NM_033118.4(MYLK2):c.173C>A (p.Ala58Asp) rs138130914 0.00070
NM_000335.5(SCN5A):c.659C>T (p.Thr220Ile) rs45620037 0.00068
NM_000719.7(CACNA1C):c.911T>C (p.Ile304Thr) rs201756421 0.00066
NM_001134363.3(RBM20):c.680G>T (p.Gly227Val) rs202238753 0.00066
NM_000642.3(AGL):c.334A>G (p.Ile112Val) rs147024351 0.00064
NM_000238.4(KCNH2):c.982C>T (p.Arg328Cys) rs199473505 0.00063
NM_000256.3(MYBPC3):c.3682C>T (p.Arg1228Cys) rs201312636 0.00063
NM_000238.4(KCNH2):c.442C>T (p.Arg148Trp) rs139544114 0.00062
NM_004415.4(DSP):c.6881C>G (p.Ala2294Gly) rs147000526 0.00062
NM_020297.4(ABCC9):c.2199-13G>A rs201226082 0.00062
NM_000238.4(KCNH2):c.1039C>T (p.Pro347Ser) rs138776684 0.00061
NM_001378454.1(ALMS1):c.8411G>A (p.Arg2804His) rs201252809 0.00057
NM_000256.3(MYBPC3):c.13G>C (p.Gly5Arg) rs201278114 0.00055
NM_001134363.3(RBM20):c.448G>A (p.Ala150Thr) rs199868951 0.00055
NM_001943.5(DSG2):c.437G>T (p.Arg146Leu) rs113451409 0.00054
NM_001943.5(DSG2):c.44T>A (p.Leu15Gln) rs372174546 0.00054
NM_001378454.1(ALMS1):c.9712C>T (p.Arg3238Cys) rs201252375 0.00053
NM_001035.3(RYR2):c.3320C>T (p.Thr1107Met) rs200236750 0.00051
NM_003673.4(TCAP):c.313G>C (p.Glu105Gln) rs146906267 0.00051
NM_014000.3(VCL):c.2521G>C (p.Asp841His) rs150385900 0.00051
NM_016203.4(PRKAG2):c.712G>A (p.Ala238Thr) rs200736454 0.00051
NM_000257.4(MYH7):c.2890G>C (p.Val964Leu) rs45496496 0.00050
NM_007078.3(LDB3):c.566C>T (p.Ser189Leu) rs45487699 0.00049
NM_000335.5(SCN5A):c.3875T>C (p.Phe1292Ser) rs41311127 0.00048
NM_000363.5(TNNI3):c.235C>T (p.Arg79Cys) rs3729712 0.00048
NM_001035.3(RYR2):c.10231-4T>C rs117180147 0.00048
NM_001035.3(RYR2):c.3380A>G (p.Glu1127Gly) rs200525962 0.00048
NM_020433.5(JPH2):c.572C>G (p.Pro191Arg) rs554853074 0.00048
NM_024301.5(FKRP):c.456C>G (p.Ser152Arg) rs199714523 0.00048
NM_014476.6(PDLIM3):c.715G>A (p.Asp239Asn) rs142143310 0.00046
NM_001276345.2(TNNT2):c.862C>T (p.Arg288Cys) rs121964857 0.00044
NM_001103.4(ACTN2):c.893G>A (p.Arg298His) rs142482143 0.00042
NM_006514.4(SCN10A):c.2441G>A (p.Arg814His) rs139861061 0.00041
NM_000335.5(SCN5A):c.3748G>A (p.Val1250Met) rs199473600 0.00038
NM_000432.4(MYL2):c.141C>A (p.Asn47Lys) rs199474808 0.00038
NM_001943.5(DSG2):c.716T>C (p.Val239Ala) rs200997703 0.00037
NM_000218.3(KCNQ1):c.458C>T (p.Thr153Met) rs143709408 0.00036
NM_000256.3(MYBPC3):c.3535G>A (p.Glu1179Lys) rs199669878 0.00036
NM_006073.4(TRDN):c.367G>A (p.Asp123Asn) rs201021891 0.00036
NM_000256.3(MYBPC3):c.1855G>A (p.Glu619Lys) rs200352299 0.00035
NM_005751.5(AKAP9):c.3580G>A (p.Ala1194Thr) rs139965373 0.00035
NM_000152.5(GAA):c.841C>T (p.Arg281Trp) rs142967546 0.00033
NM_001267550.2(TTN):c.67706G>A (p.Arg22569Gln) rs185620750 0.00031
NM_001267550.2(TTN):c.9487C>T (p.Arg3163Cys) rs140664731 0.00031
NM_002471.4(MYH6):c.292G>A (p.Glu98Lys) rs140596256 0.00030
NM_006514.4(SCN10A):c.2428G>T (p.Gly810Trp) rs145712124 0.00030
NM_014391.3(ANKRD1):c.368C>T (p.Thr123Met) rs145387010 0.00030
NM_001035.3(RYR2):c.649A>G (p.Ile217Val) rs200642525 0.00029
NM_001035.3(RYR2):c.13291G>A (p.Glu4431Lys) rs571985775 0.00028
NM_000335.5(SCN5A):c.5870G>A (p.Arg1957Gln) rs199473331 0.00026
NM_004415.4(DSP):c.7916G>A (p.Arg2639Gln) rs116888866 0.00026
NM_007078.3(LDB3):c.1051A>G (p.Thr351Ala) rs138251566 0.00026
NM_000256.3(MYBPC3):c.2873C>T (p.Thr958Ile) rs376504548 0.00025
NM_000256.3(MYBPC3):c.961G>A (p.Val321Met) rs200119454 0.00025
NM_001134363.3(RBM20):c.850G>A (p.Gly284Arg) rs201148126 0.00025
NM_005751.5(AKAP9):c.7488T>G (p.Asn2496Lys) rs201977551 0.00025
NM_005751.5(AKAP9):c.8677G>C (p.Asp2893His) rs142573103 0.00025
NM_014000.3(VCL):c.1294C>G (p.Leu432Val) rs144146254 0.00025
NM_172201.2(KCNE2):c.80G>A (p.Arg27His) rs148968498 0.00025
NM_000256.3(MYBPC3):c.184A>C (p.Thr62Pro) rs377225516 0.00024
NM_000257.4(MYH7):c.4377G>T (p.Lys1459Asn) rs201307101 0.00024
NM_001103.4(ACTN2):c.2147C>T (p.Thr716Met) rs193922635 0.00024
NM_001148.6(ANK2):c.4315G>T (p.Gly1439Cys) rs34591340 0.00023
NM_024422.6(DSC2):c.2587G>A (p.Gly863Arg) rs147109895 0.00023
NM_000238.4(KCNH2):c.2948C>T (p.Thr983Ile) rs149955375 0.00022
NM_000257.4(MYH7):c.77C>T (p.Ala26Val) rs186964570 0.00021
NM_003673.4(TCAP):c.458G>A (p.Arg153His) rs149585781 0.00021
NM_006393.3(NEBL):c.82-4A>G rs368268112 0.00021
NM_004006.3(DMD):c.6571C>T (p.Arg2191Trp) rs149322279 0.00020
NM_000256.3(MYBPC3):c.461T>C (p.Ile154Thr) rs373946195 0.00019
NM_000337.6(SGCD):c.699+18C>G rs180898690 0.00019
NM_001035.3(RYR2):c.3356G>A (p.Arg1119His) rs201312753 0.00019
NM_001134363.3(RBM20):c.925G>A (p.Gly309Arg) rs397516625 0.00019
NM_001148.6(ANK2):c.4310C>T (p.Thr1437Met) rs142534126 0.00019
NM_014000.3(VCL):c.590C>T (p.Thr197Ile) rs189242810 0.00019
NM_000117.3(EMD):c.272A>G (p.Asn91Ser) rs137977232 0.00018
NM_001148.6(ANK2):c.9526G>T (p.Asp3176Tyr) rs138928206 0.00018
NM_004415.4(DSP):c.269A>G (p.Gln90Arg) rs188516326 0.00018
NM_007078.3(LDB3):c.1910C>T (p.Ala637Val) rs141569007 0.00018
NM_000256.3(MYBPC3):c.624G>C (p.Gln208His) rs202139499 0.00017
NM_000335.5(SCN5A):c.80G>A (p.Arg27His) rs199473045 0.00017
NM_001148.6(ANK2):c.7183A>C (p.Thr2395Pro) rs201693280 0.00017
NM_000256.3(MYBPC3):c.1321G>A (p.Glu441Lys) rs193922377 0.00016
NM_001035.3(RYR2):c.2267G>A (p.Ser756Asn) rs193922623 0.00016
NM_001035.3(RYR2):c.8145G>T (p.Glu2715Asp) rs200420897 0.00016
NM_004281.4(BAG3):c.653G>A (p.Arg218Gln) rs201638005 0.00016
NM_004415.4(DSP):c.3706A>G (p.Arg1236Gly) rs377098318 0.00016
NM_004415.4(DSP):c.943C>T (p.Arg315Cys) rs200476515 0.00016
NM_006514.4(SCN10A):c.365C>T (p.Thr122Met) rs142884499 0.00016
NM_000257.4(MYH7):c.5562G>A (p.Thr1854=) rs368706722 0.00015
NM_004415.4(DSP):c.3862A>C (p.Lys1288Gln) rs138907450 0.00014
NM_001035.3(RYR2):c.3251G>A (p.Arg1084Lys) rs193922624 0.00013
NM_001105206.3(LAMA4):c.1277T>C (p.Met426Thr) rs200112094 0.00013
NM_001105206.3(LAMA4):c.1673C>T (p.Ala558Val) rs137893207 0.00013
NM_001943.5(DSG2):c.545A>G (p.Asn182Ser) rs368512832 0.00013
NM_006514.4(SCN10A):c.2816C>T (p.Pro939Leu) rs202174472 0.00013
NM_000256.3(MYBPC3):c.2614G>A (p.Glu872Lys) rs190765116 0.00012
NM_001103.4(ACTN2):c.1748A>G (p.Glu583Gly) rs200631005 0.00012
NM_001005242.3(PKP2):c.2392G>A (p.Val798Ile) rs368633311 0.00011
NM_001035.3(RYR2):c.9655G>A (p.Val3219Met) rs371147744 0.00011
NM_002471.4(MYH6):c.1410C>T (p.Asp470=) rs139886074 0.00011
NM_000256.3(MYBPC3):c.1504C>T (p.Arg502Trp) rs375882485 0.00010
NM_000256.3(MYBPC3):c.529C>T (p.Arg177Cys) rs193922385 0.00010
NM_001103.4(ACTN2):c.690T>A (p.Asp230Glu) rs139489232 0.00010
NM_001267550.2(TTN):c.59729C>T (p.Thr19910Ile) rs369476725 0.00010
NM_001267550.2(TTN):c.91621G>A (p.Gly30541Arg) rs200854704 0.00010
NM_004415.4(DSP):c.1140+6T>C rs534740669 0.00010
NM_001035.3(RYR2):c.2828T>C (p.Leu943Ser) rs373665895 0.00009
NM_001103.4(ACTN2):c.2659G>A (p.Ala887Thr) rs148972050 0.00009
NM_004281.4(BAG3):c.554C>T (p.Ser185Leu) rs730880054 0.00009
NM_024422.6(DSC2):c.2251-5T>G rs374262463 0.00009
NM_024422.6(DSC2):c.82G>T (p.Ala28Ser) rs139979318 0.00009
NM_144573.4(NEXN):c.1435C>T (p.Leu479Phe) rs181520023 0.00009
NM_174934.4(SCN4B):c.22G>A (p.Gly8Ser) rs149868494 0.00009
NM_001035.3(RYR2):c.9619A>G (p.Asn3207Asp) rs372601642 0.00008
NM_004006.3(DMD):c.1724T>C (p.Leu575Pro) rs370644567 0.00008
NM_000238.4(KCNH2):c.422C>T (p.Pro141Leu) rs199472864 0.00007
NM_002230.4(JUP):c.427G>A (p.Ala143Thr) rs375788626 0.00007
NM_004006.3(DMD):c.4721G>A (p.Arg1574His) rs755206033 0.00007
NM_000238.4(KCNH2):c.2780G>T (p.Trp927Leu) rs794728399 0.00006
NM_000256.3(MYBPC3):c.1000G>A (p.Glu334Lys) rs573916965 0.00006
NM_000256.3(MYBPC3):c.1624G>C (p.Glu542Gln) rs121909374 0.00006
NM_000256.3(MYBPC3):c.2761C>G (p.Gln921Glu) rs367729718 0.00006
NM_000256.3(MYBPC3):c.94G>A (p.Glu32Lys) rs730880575 0.00006
NM_000257.4(MYH7):c.2360G>A (p.Arg787His) rs376754645 0.00006
NM_000335.5(SCN5A):c.52C>T (p.Arg18Trp) rs199473044 0.00006
NM_000540.3(RYR1):c.7300G>A (p.Gly2434Arg) rs121918593 0.00006
NM_000719.7(CACNA1C):c.3679G>A (p.Val1227Ile) rs373124557 0.00006
NM_001018008.2(TPM1):c.695G>A (p.Arg232His) rs730881128 0.00006
NM_001079802.2(FKTN):c.869A>T (p.Lys290Ile) rs755092516 0.00006
NM_001103.4(ACTN2):c.947T>C (p.Met316Thr) rs370757762 0.00006
NM_001148.6(ANK2):c.11354A>G (p.Gln3785Arg) rs150808807 0.00006
NM_004415.4(DSP):c.3338G>A (p.Arg1113Gln) rs768455823 0.00006
NM_007373.4(SHOC2):c.610A>G (p.Ile204Val) rs200015085 0.00006
NM_016203.4(PRKAG2):c.130G>A (p.Ala44Thr) rs144857453 0.00006
NM_000256.3(MYBPC3):c.2429G>A (p.Arg810His) rs375675796 0.00005
NM_001927.4(DES):c.1371+1G>A rs748323823 0.00005
NM_003060.4(SLC22A5):c.1462C>T (p.Arg488Cys) rs377216516 0.00005
NM_033337.3(CAV3):c.244G>A (p.Val82Ile) rs112626848 0.00005
NM_000238.4(KCNH2):c.2665T>G (p.Leu889Val) rs765427343 0.00004
NM_000256.3(MYBPC3):c.1484G>A (p.Arg495Gln) rs200411226 0.00004
NM_000256.3(MYBPC3):c.2381C>T (p.Pro794Leu) rs730880565 0.00004
NM_000256.3(MYBPC3):c.3330+2T>G rs387906397 0.00004
NM_000256.3(MYBPC3):c.3581C>T (p.Ala1194Val) rs730880594 0.00004
NM_000257.4(MYH7):c.1405G>A (p.Asp469Asn) rs397516106 0.00004
NM_000257.4(MYH7):c.5305C>A (p.Leu1769Met) rs139222507 0.00004
NM_000335.5(SCN5A):c.2102C>T (p.Pro701Leu) rs199473147 0.00004
NM_000335.5(SCN5A):c.4874G>A (p.Arg1625His) rs199473283 0.00004
NM_000363.5(TNNI3):c.422G>A (p.Arg141Gln) rs397516347 0.00004
NM_000371.4(TTR):c.148G>A (p.Val50Met) rs28933979 0.00004
NM_000527.5(LDLR):c.798T>A (p.Asp266Glu) rs139043155 0.00004
NM_001458.5(FLNC):c.7560C>T (p.Thr2520=) rs527921534 0.00004
NM_002230.4(JUP):c.2122G>A (p.Asp708Asn) rs781804177 0.00004
NM_003098.3(SNTA1):c.820C>T (p.Arg274Trp) rs201763667 0.00004
NM_005751.5(AKAP9):c.5251C>T (p.Arg1751Cys) rs144269839 0.00004
NM_005751.5(AKAP9):c.8189A>G (p.Gln2730Arg) rs80191629 0.00004
NM_006393.3(NEBL):c.1108C>A (p.Gln370Lys) rs146198369 0.00004
NM_014476.6(PDLIM3):c.11C>T (p.Thr4Met) rs781358846 0.00004
NM_020297.4(ABCC9):c.3589C>T (p.Arg1197Cys) rs778849288 0.00004
NM_024422.6(DSC2):c.408A>G (p.Arg136=) rs561653481 0.00004
NM_000219.6(KCNE1):c.137A>G (p.Tyr46Cys) rs1402178514 0.00003
NM_000219.6(KCNE1):c.163G>A (p.Gly55Ser) rs199473644 0.00003
NM_000256.3(MYBPC3):c.1624+4A>T rs397515916 0.00003
NM_000257.4(MYH7):c.2389G>A (p.Ala797Thr) rs3218716 0.00003
NM_000257.4(MYH7):c.427C>T (p.Arg143Trp) rs727503278 0.00003
NM_000257.4(MYH7):c.611G>A (p.Arg204His) rs397516260 0.00003
NM_000335.5(SCN5A):c.3206C>T (p.Thr1069Met) rs199473187 0.00003
NM_000527.5(LDLR):c.1061A>T (p.Asp354Val) rs755449669 0.00003
NM_000719.7(CACNA1C):c.3946-45C>G rs201551454 0.00003
NM_001018005.2(TPM1):c.845C>G (p.Thr282Ser) rs397516395 0.00003
NM_001037.5(SCN1B):c.363C>G (p.Cys121Trp) rs104894718 0.00003
NM_001134363.3(RBM20):c.2231A>G (p.Asn744Ser) rs755241667 0.00003
NM_001148.6(ANK2):c.10147G>A (p.Ala3383Thr) rs374257100 0.00003
NM_001943.5(DSG2):c.1303G>A (p.Asp435Asn) rs370509593 0.00003
NM_004415.4(DSP):c.4741A>G (p.Lys1581Glu) rs186842903 0.00003
NM_000218.3(KCNQ1):c.1768G>A (p.Ala590Thr) rs199472813 0.00002
NM_000256.3(MYBPC3):c.2374T>C (p.Trp792Arg) rs187830361 0.00002
NM_000256.3(MYBPC3):c.3190+5G>A rs587782958 0.00002
NM_000256.3(MYBPC3):c.713G>A (p.Arg238His) rs727504396 0.00002
NM_000256.3(MYBPC3):c.927-9G>A rs397516083 0.00002
NM_000257.4(MYH7):c.2167C>T (p.Arg723Cys) rs121913630 0.00002
NM_000257.4(MYH7):c.3637G>A (p.Val1213Met) rs397516182 0.00002
NM_000257.4(MYH7):c.4031G>A (p.Arg1344Gln) rs797045097 0.00002
NM_000257.4(MYH7):c.4078G>A (p.Val1360Ile) rs373231077 0.00002
NM_000257.4(MYH7):c.5135G>A (p.Arg1712Gln) rs193922390 0.00002
NM_000257.4(MYH7):c.5704G>C (p.Glu1902Gln) rs187073962 0.00002
NM_000335.5(SCN5A):c.2014G>A (p.Ala672Thr) rs199473140 0.00002
NM_004006.3(DMD):c.10889G>A (p.Arg3630Gln) rs1057522606 0.00002
NM_005472.5(KCNE3):c.20C>T (p.Thr7Met) rs547194943 0.00002
NM_033337.3(CAV3):c.442C>T (p.Arg148Trp) rs730880422 0.00002
NM_000169.3(GLA):c.1196G>C (p.Trp399Ser) rs782449839 0.00001
NM_000169.3(GLA):c.247G>A (p.Asp83Asn) rs782722577 0.00001
NM_000169.3(GLA):c.868A>C (p.Met290Leu) rs375538532 0.00001
NM_000218.3(KCNQ1):c.1085A>G (p.Lys362Arg) rs12720458 0.00001
NM_000218.3(KCNQ1):c.1615C>T (p.Arg539Trp) rs199472795 0.00001
NM_000218.3(KCNQ1):c.1781G>A (p.Arg594Gln) rs199472815 0.00001
NM_000218.3(KCNQ1):c.674C>T (p.Ser225Leu) rs199473456 0.00001
NM_000218.3(KCNQ1):c.830C>T (p.Ser277Leu) rs199472730 0.00001
NM_000238.4(KCNH2):c.2467C>T (p.Arg823Trp) rs199473538 0.00001
NM_000256.3(MYBPC3):c.1227-2A>G rs730880531 0.00001
NM_000256.3(MYBPC3):c.148A>G (p.Ser50Gly) rs373164247 0.00001
NM_000256.3(MYBPC3):c.2490dup (p.His831fs) rs397515966 0.00001
NM_000256.3(MYBPC3):c.3362G>A (p.Arg1121His) rs397516018 0.00001
NM_000256.3(MYBPC3):c.821+1G>A rs397516073 0.00001
NM_000257.4(MYH7):c.1324C>T (p.Arg442Cys) rs148808089 0.00001
NM_000257.4(MYH7):c.1358G>A (p.Arg453His) rs397516101 0.00001
NM_000257.4(MYH7):c.1491G>T (p.Glu497Asp) rs267606911 0.00001
NM_000257.4(MYH7):c.1954A>G (p.Arg652Gly) rs727504239 0.00001
NM_000257.4(MYH7):c.2681A>G (p.Glu894Gly) rs397516161 0.00001
NM_000257.4(MYH7):c.3551A>T (p.Gln1184Leu) rs546586969 0.00001
NM_000257.4(MYH7):c.4066G>A (p.Glu1356Lys) rs727503246 0.00001
NM_000257.4(MYH7):c.4588C>T (p.Arg1530Ter) rs397516225 0.00001
NM_000257.4(MYH7):c.709C>T (p.Arg237Trp) rs45516091 0.00001
NM_000258.3(MYL3):c.220G>A (p.Gly74Arg) rs730880956 0.00001
NM_000258.3(MYL3):c.427G>A (p.Glu143Lys) rs104893750 0.00001
NM_000335.5(SCN5A):c.1345A>G (p.Thr449Ala) rs199473571 0.00001
NM_000335.5(SCN5A):c.2893C>T (p.Arg965Cys) rs199473180 0.00001
NM_000335.5(SCN5A):c.4928G>A (p.Arg1643His) rs28937316 0.00001
NM_000335.5(SCN5A):c.5126C>T (p.Ser1709Leu) rs137854604 0.00001
NM_000335.5(SCN5A):c.5375T>A (p.Met1792Lys) rs794728897 0.00001
NM_000335.5(SCN5A):c.680T>C (p.Leu227Pro) rs760011764 0.00001
NM_000363.5(TNNI3):c.433C>T (p.Arg145Trp) rs104894724 0.00001
NM_000363.5(TNNI3):c.485G>A (p.Arg162Gln) rs397516354 0.00001
NM_000363.5(TNNI3):c.497C>T (p.Ser166Phe) rs727504242 0.00001
NM_000363.5(TNNI3):c.610C>T (p.Arg204Cys) rs727504243 0.00001
NM_000371.4(TTR):c.130C>T (p.Pro44Ser) rs11541790 0.00001
NM_000371.4(TTR):c.238A>G (p.Thr80Ala) rs121918070 0.00001
NM_000371.4(TTR):c.337-3T>C rs774027595 0.00001
NM_000371.4(TTR):c.349G>T (p.Ala117Ser) rs267607161 0.00001
NM_000432.4(MYL2):c.173G>A (p.Arg58Gln) rs104894369 0.00001
NM_000527.5(LDLR):c.1055G>A (p.Cys352Tyr) rs193922566 0.00001
NM_000527.5(LDLR):c.1061-1G>C rs879254774 0.00001
NM_000527.5(LDLR):c.1133A>C (p.Gln378Pro) rs730882098 0.00001
NM_000527.5(LDLR):c.190+4A>T rs769446356 0.00001
NM_000527.5(LDLR):c.299A>T (p.Asp100Val) rs879254460 0.00001
NM_000527.5(LDLR):c.631C>T (p.His211Tyr) rs771917370 0.00001
NM_000719.7(CACNA1C):c.2517C>A (p.Asn839Lys) rs774002530 0.00001
NM_001018005.2(TPM1):c.644C>T (p.Ser215Leu) rs199476316 0.00001
NM_001018005.2(TPM1):c.64G>A (p.Ala22Thr) rs397516382 0.00001
NM_001035.3(RYR2):c.10125A>G (p.Arg3375=) rs764396074 0.00001
NM_001035.3(RYR2):c.4040T>G (p.Met1347Arg) rs193922625 0.00001
NM_001134363.3(RBM20):c.1901G>A (p.Arg634Gln) rs267607001 0.00001
NM_001148.6(ANK2):c.9880A>C (p.Asn3294His) rs763211298 0.00001
NM_001267550.2(TTN):c.45307C>T (p.Arg15103Ter) rs397517580 0.00001
NM_001267550.2(TTN):c.47758A>C (p.Lys15920Gln) rs775513269 0.00001
NM_001267550.2(TTN):c.54166C>T (p.Arg18056Ter) rs768431507 0.00001
NM_001267550.2(TTN):c.57769C>T (p.Arg19257Ter) rs794729275 0.00001
NM_001267550.2(TTN):c.90246A>G (p.Ile30082Met) rs886038812 0.00001
NM_001276345.2(TNNT2):c.418C>T (p.Arg140Cys) rs397516463 0.00001
NM_001276345.2(TNNT2):c.601-1G>A rs483352835 0.00001
NM_001613.4(ACTA2):c.445C>T (p.Arg149Cys) rs121434526 0.00001
NM_001943.5(DSG2):c.137G>A (p.Arg46Gln) rs121913008 0.00001
NM_002230.4(JUP):c.266T>C (p.Met89Thr) rs542745694 0.00001
NM_003280.3(TNNC1):c.23C>T (p.Ala8Val) rs267607125 0.00001
NM_003476.5(CSRP3):c.449G>A (p.Cys150Tyr) rs761507504 0.00001
NM_004281.4(BAG3):c.367C>T (p.Arg123Ter) rs387906875 0.00001
NM_004415.4(DSP):c.3701A>G (p.Asn1234Ser) rs185367490 0.00001
NM_004415.4(DSP):c.6902T>C (p.Ile2301Thr) rs772381363 0.00001
NM_004415.4(DSP):c.939+1G>A rs727504443 0.00001
NM_004982.4(KCNJ8):c.720G>A (p.Val240=) rs876661349 0.00001
NM_005751.5(AKAP9):c.9881G>A (p.Arg3294Gln) rs752685614 0.00001
NM_007078.3(LDB3):c.550A>G (p.Lys184Glu) rs774886148 0.00001
NM_020433.5(JPH2):c.458T>C (p.Val153Ala) rs776045429 0.00001
NM_144670.6(A2ML1):c.2147A>G (p.Glu716Gly) rs770357451 0.00001
NM_170707.4(LMNA):c.1129C>T (p.Arg377Cys) rs397517889 0.00001
NM_170707.4(LMNA):c.398G>A (p.Arg133Gln) rs60864230 0.00001
NM_170707.4(LMNA):c.640-10A>G rs80356807 0.00001
NM_170707.4(LMNA):c.646C>T (p.Arg216Cys) rs794728591 0.00001
NC_012920.1:m.14484T>C rs199476104
NM_000090.4(COL3A1):c.1744G>A (p.Gly582Ser) rs121912923
NM_000169.3(GLA):c.1125_1140del (p.Val376fs) rs876661347
NM_000214.3(JAG1):c.1339T>C (p.Cys447Arg) rs863223651
NM_000218.3(KCNQ1):c.1031C>A (p.Ala344Glu) rs199472763
NM_000218.3(KCNQ1):c.1075C>T (p.Gln359Ter) rs397508075
NM_000218.3(KCNQ1):c.1097G>A (p.Arg366Gln) rs199473410
NM_000218.3(KCNQ1):c.1121T>A (p.Leu374His) rs199472767
NM_000218.3(KCNQ1):c.1383T>A (p.Tyr461Ter) rs794728527
NM_000218.3(KCNQ1):c.1394-1G>T rs775537394
NM_000218.3(KCNQ1):c.1565A>C (p.Tyr522Ser) rs199472789
NM_000218.3(KCNQ1):c.1686-2A>G rs878854350
NM_000218.3(KCNQ1):c.565G>A (p.Gly189Arg) rs104894252
NM_000218.3(KCNQ1):c.573_577del (p.Arg192fs) rs397508118
NM_000218.3(KCNQ1):c.580G>C (p.Ala194Pro) rs199472699
NM_000218.3(KCNQ1):c.724G>A (p.Asp242Asn) rs199472712
NM_000218.3(KCNQ1):c.775C>T (p.Arg259Cys) rs199472719
NM_000218.3(KCNQ1):c.797T>C (p.Leu266Pro) rs199473460
NM_000218.3(KCNQ1):c.958C>T (p.Pro320Ser) rs199472753
NM_000218.3(KCNQ1):c.973G>A (p.Gly325Arg) rs199472756
NM_000238.4(KCNH2):c.1496T>G (p.Leu499Arg) rs794728370
NM_000238.4(KCNH2):c.1838C>T (p.Thr613Met) rs199473524
NM_000238.4(KCNH2):c.1882G>A (p.Gly628Ser) rs121912507
NM_000238.4(KCNH2):c.215C>A (p.Pro72Gln) rs199473421
NM_000238.4(KCNH2):c.2390C>A (p.Ala797Asp) rs794728389
NM_000238.4(KCNH2):c.3099_3109del (p.Pro1034fs) rs794728466
NM_000256.3(MYBPC3):c.1015C>T (p.Gln339Ter) rs730880631
NM_000256.3(MYBPC3):c.1084dup (p.Ser362fs) rs730880723
NM_000256.3(MYBPC3):c.1090G>A (p.Ala364Thr) rs794727046
NM_000256.3(MYBPC3):c.1224-2A>G rs397515891
NM_000256.3(MYBPC3):c.1522C>T (p.Gln508Ter) rs730880544
NM_000256.3(MYBPC3):c.1577_1580dup (p.Cys528fs) rs730880712
NM_000256.3(MYBPC3):c.1838dup (p.Asp613fs) rs730880649
NM_000256.3(MYBPC3):c.1898-1G>A rs730880558
NM_000256.3(MYBPC3):c.2670G>A (p.Trp890Ter) rs397515982
NM_000256.3(MYBPC3):c.2792dup (p.Lys932fs) rs730880716
NM_000256.3(MYBPC3):c.2833_2834del (p.Arg945fs) rs397515987
NM_000256.3(MYBPC3):c.2869dup (p.Thr957fs) rs876661365
NM_000256.3(MYBPC3):c.2905+1G>A rs397515991
NM_000256.3(MYBPC3):c.2942A>C (p.Gln981Pro) rs730880582
NM_000256.3(MYBPC3):c.3297dup (p.Tyr1100fs) rs397516014
NM_000256.3(MYBPC3):c.3330+5G>C rs373746463
NM_000256.3(MYBPC3):c.3584G>T (p.Gly1195Val) rs730880595
NM_000256.3(MYBPC3):c.3742_3759dup (p.Gly1248_Cys1253dup) rs193922384
NM_000256.3(MYBPC3):c.3771C>A (p.Asn1257Lys) rs730880603
NM_000256.3(MYBPC3):c.459del (p.Ile154fs) rs397516052
NM_000256.3(MYBPC3):c.551dup (p.Lys185fs) rs397516059
NM_000256.3(MYBPC3):c.655G>C (p.Val219Leu) rs397516068
NM_000256.3(MYBPC3):c.710A>C (p.Tyr237Ser) rs397516070
NM_000256.3(MYBPC3):c.833del (p.Gly278fs) rs727503212
NM_000257.4(MYH7):c.1003G>C (p.Ala335Pro) rs727503272
NM_000257.4(MYH7):c.1208G>T (p.Arg403Leu) rs121913624
NM_000257.4(MYH7):c.1358G>T (p.Arg453Leu) rs397516101
NM_000257.4(MYH7):c.1750G>C (p.Gly584Arg) rs121913626
NM_000257.4(MYH7):c.2153T>G (p.Phe718Cys) rs1060501432
NM_000257.4(MYH7):c.2156G>A (p.Arg719Gln) rs121913641
NM_000257.4(MYH7):c.2207T>C (p.Ile736Thr) rs727503261
NM_000257.4(MYH7):c.2213G>C (p.Ser738Thr) rs730880894
NM_000257.4(MYH7):c.2221G>T (p.Gly741Trp) rs121913632
NM_000257.4(MYH7):c.2302G>A (p.Gly768Arg) rs727503260
NM_000257.4(MYH7):c.2497T>C (p.Tyr833His) rs730880746
NM_000257.4(MYH7):c.2593A>G (p.Lys865Glu) rs730880749
NM_000257.4(MYH7):c.2602G>C (p.Ala868Pro) rs727504356
NM_000257.4(MYH7):c.2609G>T (p.Arg870Leu) rs36211715
NM_000257.4(MYH7):c.2770G>A (p.Glu924Lys) rs121913628
NM_000257.4(MYH7):c.2858A>T (p.Asp953Val) rs730880901
NM_000257.4(MYH7):c.3981C>A (p.Asn1327Lys) rs141764279
NM_000257.4(MYH7):c.4159G>A (p.Glu1387Lys) rs730880792
NM_000257.4(MYH7):c.4402G>A (p.Glu1468Lys) rs876657884
NM_000257.4(MYH7):c.5378T>C (p.Leu1793Pro) rs121913654
NM_000257.4(MYH7):c.5399C>T (p.Ala1800Val) rs730880817
NM_000257.4(MYH7):c.676G>A (p.Ala226Thr) rs1057517773
NM_000257.4(MYH7):c.746G>A (p.Arg249Gln) rs3218713
NM_000257.4(MYH7):c.773T>C (p.Leu258Ser) rs876661377
NM_000257.4(MYH7):c.788T>C (p.Ile263Thr) rs397516269
NM_000258.3(MYL3):c.170C>A (p.Ala57Asp) rs139794067
NM_000335.5(SCN5A):c.1993G>T (p.Ala665Ser) rs756474485
NM_000335.5(SCN5A):c.2440C>T (p.Arg814Trp) rs199473161
NM_000335.5(SCN5A):c.268C>A (p.Gln90Lys) rs794728839
NM_000335.5(SCN5A):c.4978G>A (p.Gly1660Arg) rs199473292
NM_000335.5(SCN5A):c.5461_5464del (p.Glu1822fs) rs794728924
NM_000335.5(SCN5A):c.5848G>T (p.Val1950Leu) rs41315493
NM_000363.5(TNNI3):c.204del (p.Arg69fs) rs727504872
NM_000363.5(TNNI3):c.302A>G (p.His101Arg) rs730881087
NM_000363.5(TNNI3):c.509G>A (p.Arg170Gln) rs727503503
NM_000363.5(TNNI3):c.523C>T (p.Gln175Ter) rs876661394
NM_000384.3(APOB):c.2981C>T (p.Pro994Leu)
NM_000432.4(MYL2):c.484G>A (p.Gly162Arg) rs199474814
NM_000432.4(MYL2):c.488A>G (p.Glu163Gly) rs397516407
NM_000527.4(LDLR):c.313+1G>A
NM_000527.5(LDLR):c.1586+5G>A rs781362878
NM_000527.5(LDLR):c.519C>G (p.Cys173Trp) rs769318035
NM_000527.5(LDLR):c.682G>A (p.Glu228Lys)
NM_000719.7(CACNA1C):c.1552C>T (p.Arg518Cys) rs786205748
NM_001005242.3(PKP2):c.730C>G (p.Pro244Ala) rs756376477
NM_001018005.2(TPM1):c.115-238G>C rs730881126
NM_001018005.2(TPM1):c.389T>C (p.Ile130Thr) rs727503517
NM_001018005.2(TPM1):c.574G>A (p.Glu192Lys) rs199476315
NM_001035.3(RYR2):c.1259G>A (p.Arg420Gln) rs794728721
NM_001035.3(RYR2):c.14173T>A (p.Tyr4725Asn) rs876661387
NM_001103.4(ACTN2):c.2578C>T (p.Gln860Ter) rs763078071
NM_001134363.3(RBM20):c.1222dup (p.Leu408fs) rs1564844428
NM_001134363.3(RBM20):c.2737G>A (p.Glu913Lys) rs397516607
NM_001148.6(ANK2):c.2460CAC[4] (p.Thr826del) rs770530257
NM_001184880.2(PCDH19):c.2728G>T (p.Glu910Ter) rs2147485081
NM_001232.4(CASQ2):c.1188TGA[2] (p.Asp398del) rs72554070
NM_001232.4(CASQ2):c.97C>T (p.Arg33Ter) rs397507556
NM_001267550.2(TTN):c.31846+1G>A rs794727043
NM_001267550.2(TTN):c.44281+1G>A rs771562210
NM_001267550.2(TTN):c.52307_52310dup (p.Glu17437delinsAspTer) rs794729323
NM_001267550.2(TTN):c.53259del (p.Lys17753fs) rs1389777522
NM_001267550.2(TTN):c.57331C>T (p.Arg19111Ter) rs72646831
NM_001267550.2(TTN):c.62217T>A (p.Tyr20739Ter) rs727503586
NM_001267550.2(TTN):c.63601C>T (p.Arg21201Ter) rs764243269
NM_001267550.2(TTN):c.64688del (p.Pro21563fs) rs774395395
NM_001267550.2(TTN):c.75328C>T (p.Arg25110Ter) rs794729382
NM_001267550.2(TTN):c.75663del (p.Lys25221fs) rs1131691542
NM_001267550.2(TTN):c.76397_76398del (p.Ile25466fs) rs794729342
NM_001276345.2(TNNT2):c.310C>T (p.Arg104Cys) rs727503513
NM_001276345.2(TNNT2):c.311G>T (p.Arg104Leu) rs397516457
NM_001276345.2(TNNT2):c.321G>T (p.Lys107Asn) rs397516459
NM_001276345.2(TNNT2):c.508GAG[3] (p.Glu173del) rs397516470
NM_001276345.2(TNNT2):c.547C>T (p.Arg183Trp) rs727503512
NM_001276345.2(TNNT2):c.548G>A (p.Arg183Gln) rs397516471
NM_001276345.2(TNNT2):c.644G>A (p.Arg215Gln) rs121964860
NM_001613.4(ACTA2):c.773G>A (p.Arg258His) rs121434527
NM_003280.3(TNNC1):c.161C>A (p.Pro54His) rs876661393
NM_004281.4(BAG3):c.699C>A (p.Tyr233Ter) rs876661342
NM_004387.4(NKX2-5):c.334+1G>T rs876661380
NM_004387.4(NKX2-5):c.443del (p.Ala148fs) rs876661381
NM_004387.4(NKX2-5):c.627GCC[6] (p.Pro214dup) rs746833511
NM_004415.4(DSP):c.4822C>T (p.Gln1608Ter) rs1060500610
NM_004415.4(DSP):c.5460dup (p.Val1821fs) rs1554108609
NM_004415.4(DSP):c.8529_8540del (p.2827_2830SGSR[4]) rs794728151
NM_005477.3(HCN4):c.2804C>T (p.Ser935Phe) rs775803239
NM_005751.5(AKAP9):c.10118C>G (p.Ser3373Cys) rs140470576
NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[1] (p.434APAYTPSP[1]) rs397517209
NM_017636.4(TRPM4):c.2214G>A (p.Thr738=) rs1490908470
NM_018127.7(ELAC2):c.155C>G (p.Ser52Cys) rs9895963
NM_024334.3(TMEM43):c.1061G>C (p.Cys354Ser) rs187262922
NM_032578.4(MYPN):c.3122T>A (p.Ile1041Asn) rs754227127
NM_032578.4(MYPN):c.3205C>A (p.Arg1069Ser) rs368448794
NM_133379.5(TTN):c.15285_15317dup (p.5058TLERYSTPPGE[6]) rs397517815
NM_144573.4(NEXN):c.1416AAG[1] (p.Arg475del) rs794729091
NM_144573.4(NEXN):c.1671GGA[2] (p.Glu561_Glu562del) rs397517848
NM_144573.4(NEXN):c.1935C>G (p.Phe645Leu) rs794729086
NM_170707.4(LMNA):c.1294C>T (p.Gln432Ter) rs267607618
NM_170707.4(LMNA):c.1622G>A (p.Arg541His) rs61444459
NM_170707.4(LMNA):c.344A>T (p.Glu115Val) rs794728588
NM_170707.4(LMNA):c.356G>C (p.Arg119Pro) rs397517902
NM_170707.4(LMNA):c.513+2T>G rs1553264668
NM_170707.4(LMNA):c.736C>T (p.Gln246Ter) rs267607587
NM_174936.4(PCSK9):c.212C>T (p.Pro71Leu) rs569379713
NM_174936.4(PCSK9):c.45GCT[8] (p.Leu23dup) rs35574083
m.7468C>T rs111033173
m.8342G>A rs118192103

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.