ClinVar Miner

Variants from Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics with conflicting interpretations

Location: United States — Primary collection method: clinical testing
Minimum review status of the submission from Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics: Collection method of the submission from Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
1329 862 17 1360 489 29 86 1764

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics pathogenic likely pathogenic uncertain significance likely benign benign drug response protective risk factor other
pathogenic 0 38 19 6 4 11 1 1 6
likely pathogenic 24 0 13 2 1 1 0 0 0
uncertain significance 16 23 3 199 75 1 1 1 1
likely benign 5 7 224 7 1143 0 0 1 2
benign 4 1 35 156 7 0 0 2 4

Submitter to submitter summary #

Total submitters: 97
Download table as spreadsheet
Submitter Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
Invitae 0 302 0 486 93 0 6 585
GeneDx 0 752 0 403 118 1 26 547
EGL Genetic Diagnostics, Eurofins Clinical Diagnostics 0 554 0 347 70 8 13 436
PreventionGenetics, PreventionGenetics 0 236 0 232 23 0 1 256
Genetic Services Laboratory, University of Chicago 0 259 0 186 50 0 1 236
Athena Diagnostics Inc 0 187 0 197 35 0 2 234
Ambry Genetics 0 173 0 134 25 0 4 163
CeGaT Praxis fuer Humangenetik Tuebingen 0 249 0 19 126 0 19 163
ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories 0 210 0 122 21 0 10 153
Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine 0 157 0 114 33 0 5 152
Integrated Genetics/Laboratory Corporation of America 0 87 0 80 12 0 9 101
Biesecker Lab/Clinical Genomics Section,National Institutes of Health 0 18 17 18 15 0 0 50
Illumina Clinical Services Laboratory,Illumina 0 69 0 18 24 0 4 46
Mayo Clinic Laboratories, Mayo Clinic 0 54 0 22 19 0 4 45
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics,Children's Hospital of Philadelphia 0 28 0 31 10 0 0 41
Department of Pathology and Laboratory Medicine,Sinai Health System 0 40 0 12 10 0 9 31
OMIM 0 19 0 1 4 11 9 24
Quest Diagnostics Nichols Institute San Juan Capistrano 0 37 0 16 4 0 4 24
PharmGKB 0 0 0 0 0 12 0 12
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute 0 9 0 10 1 0 0 11
Stanford Center for Inherited Cardiovascular Disease, Stanford University 0 7 0 2 7 0 0 9
Institute for Genomic Medicine (IGM) Clinical Laboratory,Nationwide Children's Hospital 0 5 0 7 2 0 0 9
Blueprint Genetics 0 9 0 3 1 0 3 7
Centre for Mendelian Genomics,University Medical Centre Ljubljana 0 10 0 3 1 0 3 7
CHEO Genetics Diagnostic Laboratory,Children's Hospital of Eastern Ontario 0 5 0 4 2 0 0 6
Leiden Open Variation Database 0 6 0 1 4 0 1 6
Clinical Genetics Karolinska University Hospital,Karolinska University Hospital 0 18 0 3 0 0 2 5
Lupski Lab, Baylor-Hopkins CMG, Baylor College of Medicine 0 0 0 0 0 0 4 4
NIHR Bioresource Rare Diseases, University of Cambridge 0 1 0 3 0 0 1 4
Cancer Genetics and Genomics Laboratory,British Columbia Cancer Agency 0 7 0 3 1 0 0 4
Practice for Gait Abnormalities, David Pomarino,Competency Network Toe Walking c/o Practice Pomarino 0 0 0 0 3 0 1 4
Greenwood Genetic Center Diagnostic Laboratories,Greenwood Genetic Center 0 9 0 1 1 0 1 3
Foulkes Cancer Genetics LDI, Lady Davis Institute for Medical Research 0 1 0 1 1 0 1 3
Developmental Genetics Unit,King Faisal Specialist Hospital & Research Centre 0 0 0 0 1 0 2 3
RettBASE 0 5 0 3 0 0 0 3
Department of Ophthalmology and Visual Sciences Kyoto University 0 0 0 2 1 0 0 3
CSER _CC_NCGL, University of Washington 0 2 0 1 1 0 1 3
University of Washington Center for Mendelian Genomics, University of Washington 0 0 0 1 1 0 1 3
Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen 0 38 0 1 0 0 2 3
Claritas Genomics 0 1 0 1 1 0 0 2
Natera, Inc. 0 7 0 0 2 0 0 2
Mendelics 0 3 0 1 1 0 0 2
Genomic Research Center, Shahid Beheshti University of Medical Sciences 0 6 0 1 0 0 1 2
Northcott Neuroscience Laboratory, ANZAC Research Institute 0 0 0 1 1 0 0 2
Undiagnosed Diseases Network,NIH 0 0 0 0 1 0 1 2
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego 0 1 0 0 0 0 2 2
Broad Institute Rare Disease Group, Broad Institute 0 3 0 2 0 0 0 2
Gharavi Laboratory,Columbia University 0 4 0 0 0 0 2 2
CFTR-France 0 2 0 1 0 0 1 2
Baylor Genetics 0 0 0 0 0 0 1 1
Medical Genetics Laboratory, Kennedy Center,Juliane Marie Center, Rigshospitalet 0 1 0 0 0 0 1 1
Molecular Diagnostics Lab,Nemours Alfred I. duPont Hospital for Children 0 1 0 0 1 0 0 1
King Laboratory,University of Washington 0 0 0 0 1 0 0 1
Elsea Laboratory,Baylor College of Medicine 0 0 0 0 0 0 1 1
MyeliNeuroGene Lab,McGill University Health Center Research Institute 0 0 0 0 0 0 1 1
Counsyl 0 2 0 0 1 0 0 1
GeneReviews 0 3 0 1 0 0 0 1
Department of Psychiatry,Nagoya University 0 0 0 0 0 0 1 1
Center for Genetic Medicine Research,Children's National Medical Center 0 1 0 0 1 0 0 1
Center for Medical Genetics Ghent,University of Ghent 0 0 0 0 0 0 1 1
Vavilov Institute of General Genetics RAS, Laboratory of Evolutional Genomics 0 0 0 0 0 1 0 1
GeneKor MSA 0 2 0 1 0 0 0 1
HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology 0 0 0 0 0 0 1 1
Laboratory of Molecular Genetics (Pr. Bezieau's lab), CHU de Nantes 0 3 0 1 0 0 0 1
Genome Sciences Centre,British Columbia Cancer Agency 0 0 0 0 0 0 1 1
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 3952 2 0 1 0 0 0 1
Pediatric Highly Intensive Care Unit,Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico 0 0 0 0 0 0 1 1
Daryl Scott Lab,Baylor College of Medicine 0 0 0 0 0 0 1 1
Neurogenetics Laboratory - MEYER,AOU Meyer 0 2 0 0 0 0 1 1
Research and Development, ARUP Laboratories 0 0 0 0 1 0 0 1
Equipe Genetique des Anomalies du Developpement, Université de Bourgogne 0 0 0 0 0 0 1 1
Santos-Cortez Lab,University of Colorado School of Medicine 0 0 0 0 1 0 0 1
Geisinger Autism and Developmental Medicine Institute,Geisinger Health System 0 0 0 0 1 0 1 1
Department of Pathology and Molecular Medicine,Queen's University 0 2 0 1 0 0 0 1
Rare Disease Group, Clinical Genetics,Karolinska Institutet 0 0 0 0 1 0 1 1
Institute of Cellular and Molecular Medicine,Copenhagen University 0 0 0 0 0 0 1 1
Flegel Lab,National Institutes of Health 0 0 0 0 0 0 1 1
Research Molecular Genetics Laboratory,Women's College Hospital, University of Toronto 0 2 0 1 0 0 0 1
Inherited Neuropathy Consortium 0 0 0 0 0 0 1 1
Medical Genetics Summaries 0 0 0 0 0 1 0 1
Medical Genetics Lab,Policlinico S. Orsola.Malpighi 0 0 0 0 0 0 1 1
Medical Cytogenetics and Molecular Genetics Laboratory,IRCCS Istituto Auxologico Italiano 0 0 0 0 1 0 0 1
3DMed Clinical Laboratory Inc 0 0 0 0 1 0 0 1
St. Jude Clinical Genomics Lab, St. Jude Children's Research Hospital 0 0 0 0 1 0 0 1
Molecular Pathology Diagnostics Labratory,University of Iowa Hospitals & Clinics 0 0 0 0 0 0 1 1
University of Washington Department of Laboratory Medicine, University of Washington 0 0 0 0 0 1 0 1
Biochemistry Laboratory of CDMU,Chengde Medical University 0 0 0 0 0 0 1 1
Institute for Genomic Statistics and Bioinformatics, University Hospital Bonn 0 0 0 0 0 0 1 1
Center for Advanced Laboratory Medicine, UC San Diego Health,University of California San Diego 0 0 0 1 0 0 0 1
UT Southwestern Medical Center, UT Southwestern Medical Center 0 0 0 0 0 1 0 1
Central Laboratory,The First Hospital of Lanzhou University 0 0 0 0 0 0 1 1
Suna and Inan Kirac Foundation Neurodegeneration Research Laboratory, Koc University 0 0 0 0 0 0 1 1
New York Genome Center 0 4 0 1 0 0 0 1
Genetics and Prenatal Diagnosis Center,The First Affiliated Hospital of Zhengzhou University 0 0 0 0 0 0 1 1
Faculty of Health Sciences,Beirut Arab University 0 0 0 0 0 0 1 1
Dept. Genetics and Cancer, Menzies Institute for Medical Research,University of Tasmania 0 0 0 0 1 0 0 1
Wilkie Group, Clinical Genetics Lab, WIMM,University of Oxford 0 0 0 0 0 0 1 1

All variants with conflicting interpretations #

Total variants: 1764
Download table as spreadsheet
NC_012920.1(MT-CO1):m.6260G>A rs201395766
NC_012920.1(MT-CO1):m.6261G>A rs201262114
NC_012920.1(MT-ND1):m.3849G>A rs878853081
NC_012920.1:m.1555A>G rs267606617
NC_012920.1:m.5951A>G rs7340122
NC_012920.1:m.6071T>C rs7340086
NM_000016.5(ACADM):c.127G>A (p.Glu43Lys) rs147559466
NM_000016.5(ACADM):c.600-18G>A rs370523609
NM_000016.5(ACADM):c.734C>T (p.Ser245Leu) rs121434281
NM_000018.4(ACADVL):c.194C>T (p.Pro65Leu) rs28934585
NM_000026.4(ADSL):c.1342T>C (p.Ser448Pro) rs771121666
NM_000026.4(ADSL):c.440A>T (p.Lys147Met) rs11089991
NM_000030.3(AGXT):c.508G>A (p.Gly170Arg) rs121908529
NM_000033.4(ABCD1):c.757C>G (p.Leu253Val) rs150151955
NM_000036.2(AMPD1):c.433G>A (p.Val145Met) rs61741025
NM_000037.4(ANK1):c.2495G>A (p.Arg832Gln) rs34523608
NM_000038.6(APC):c.2608C>T (p.Pro870Ser) rs33974176
NM_000038.6(APC):c.3386T>C (p.Leu1129Ser) rs143638171
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000038.6(APC):c.7862C>G (p.Ser2621Cys) rs72541816
NM_000044.6(AR):c.171GCA[20] (p.Gln78_Gln80del) rs3032358
NM_000044.6(AR):c.2395C>G (p.Gln799Glu) rs137852591
NM_000046.5(ARSB):c.215T>A (p.Leu72Gln) rs397514441
NM_000046.5(ARSB):c.98C>T (p.Ala33Val) rs201168448
NM_000048.4(ASL):c.1164C>T (p.His388=) rs75300185
NM_000048.4(ASL):c.35G>A (p.Arg12Gln) rs145138923
NM_000048.4(ASL):c.556C>A (p.Arg186=) rs111407265
NM_000051.3(ATM):c.3118A>G (p.Met1040Val) rs3092857
NM_000051.3(ATM):c.3383A>G (p.Gln1128Arg) rs2229020
NM_000051.3(ATM):c.6995T>C (p.Leu2332Pro) rs4988111
NM_000051.4(ATM):c.146C>G rs1800054
NM_000051.4(ATM):c.5821G>C (p.Val1941Leu) rs147187700
NM_000053.4(ATP7B):c.1607T>C (p.Val536Ala) rs138427376
NM_000053.4(ATP7B):c.2972C>T (p.Thr991Met) rs41292782
NM_000053.4(ATP7B):c.4301C>T (p.Thr1434Met) rs60986317
NM_000053.4(ATP7B):c.628A>G (p.Ile210Val) rs61733680
NM_000053.4(ATP7B):c.865C>T (p.Gln289Ter) rs121907999
NM_000054.6(AVPR2):c.740G>A (p.Arg247His) rs149668713
NM_000057.4(BLM):c.410A>G (p.Lys137Arg) rs28384988
NM_000059.3(BRCA2):c.5704G>A (p.Asp1902Asn) rs4987048
NM_000059.3(BRCA2):c.5710C>G (p.Leu1904Val) rs55875643
NM_000059.3(BRCA2):c.6325G>A (p.Val2109Ile) rs79456940
NM_000059.4(BRCA2):c.10234A>G (p.Ile3412Val) rs1801426
NM_000059.4(BRCA2):c.1786G>C (p.Asp596His) rs56328701
NM_000059.4(BRCA2):c.2971A>G (p.Asn991Asp) rs1799944
NM_000059.4(BRCA2):c.3869G>A (p.Cys1290Tyr) rs41293485
NM_000059.4(BRCA2):c.4258G>T (p.Asp1420Tyr) rs28897727
NM_000059.4(BRCA2):c.6100C>T (p.Arg2034Cys) rs1799954
NM_000059.4(BRCA2):c.6347A>G (p.His2116Arg) rs55953736
NM_000059.4(BRCA2):c.8851G>A (p.Ala2951Thr) rs11571769
NM_000059.4(BRCA2):c.9038C>T (p.Thr3013Ile) rs28897755
NM_000059.4(BRCA2):c.978C>A (p.Ser326Arg) rs28897706
NM_000059.4(BRCA2):c.9875C>T (p.Pro3292Leu) rs56121817
NM_000059.4(BRCA2):c.9976A>T (p.Lys3326Ter) rs11571833
NM_000065.4(C6):c.542C>T (p.Thr181Ile) rs114609505
NM_000069.3(CACNA1S):c.1711G>A (p.Val571Ile) rs114191482
NM_000069.3(CACNA1S):c.895T>C (p.Tyr299His) rs35856559
NM_000070.3(CAPN3):c.1029+3A>G rs28364442
NM_000071.3(CBS):c.*540G>A rs111386779
NM_000083.3(CLCN1):c.899G>A (p.Arg300Gln) rs118066140
NM_000086.2(CLN3):c.1210C>A (p.His404Asn) rs146610181
NM_000086.2(CLN3):c.418G>A (p.Val140Ile) rs373034150
NM_000088.3(COL1A1):c.1984-5C>A rs66592376
NM_000088.3(COL1A1):c.4018G>A (p.Gly1340Ser) rs147936946
NM_000088.3(COL1A1):c.613C>G (p.Pro205Ala) rs72667032
NM_000089.3(COL1A2):c.3313G>A (p.Gly1105Ser) rs139851311
NM_000090.3(COL3A1):c.2607T>A (p.Pro869=) rs376643618
NM_000090.3(COL3A1):c.812G>A (p.Arg271Gln) rs112185887
NM_000090.4(COL3A1):c.2002C>A (p.Pro668Thr) rs1801183
NM_000090.4(COL3A1):c.3938A>G (p.Lys1313Arg) rs111840783
NM_000094.4(COL7A1):c.4612C>T (p.Arg1538Cys) rs149711883
NM_000095.3(COMP):c.2227+8G>A rs116499541
NM_000100.3(CSTB):c.121G>A (p.Val41Met) rs143153487
NM_000110.3(DPYD):c.775A>G (p.Lys259Glu) rs45589337
NM_000110.4(DPYD):c.1905+1G>A rs3918290
NM_000111.2(SLC26A3):c.357C>A (p.Phe119Leu) rs73419912
NM_000113.3(TOR1A):c.613T>A (p.Phe205Ile) rs267607134
NM_000123.3(ERCC5):c.640C>T (p.Arg214Cys) rs56255799
NM_000124.4(ERCC6):c.1337G>A (p.Gly446Asp) rs4253047
NM_000124.4(ERCC6):c.2875G>T (p.Val959Leu) rs190863815
NM_000124.4(ERCC6):c.3284C>G (p.Pro1095Arg) rs4253208
NM_000124.4(ERCC6):c.3659C>T (p.Thr1220Ile) rs34704611
NM_000124.4(ERCC6):c.3922G>C (p.Val1308Leu) rs2229761
NM_000126.4(ETFA):c.442A>G (p.Ile148Val) rs199673198
NM_000130.5(F5):c.1601= (p.Arg534=) rs6025
NM_000135.4(FANCA):c.1359+10C>T rs34159559
NM_000135.4(FANCA):c.2574C>G (p.Ser858Arg) rs17233141
NM_000135.4(FANCA):c.2859C>G (p.Asp953Glu) rs149112292
NM_000135.4(FANCA):c.3348+18A>G rs1800347
NM_000136.3(FANCC):c.1156T>C (p.Ser386Pro) rs41281202
NM_000136.3(FANCC):c.178G>A (p.Val60Ile) rs138629441
NM_000136.3(FANCC):c.416G>A (p.Gly139Glu) rs1800362
NM_000136.3(FANCC):c.584A>T (p.Asp195Val) rs1800365
NM_000136.3(FANCC):c.77C>T (p.Ser26Phe) rs1800361
NM_000136.3(FANCC):c.843+4C>T rs4647506
NM_000138.5(FBN1):c.3294C>T (p.Asp1098=) rs140587
NM_000138.5(FBN1):c.5343G>A (p.Val1781=) rs140649
NM_000142.5(FGFR3):c.1150T>C (p.Phe384Leu) rs17881656
NM_000142.5(FGFR3):c.1345C>T (p.Pro449Ser) rs61735104
NM_000147.4(FUCA1):c.7G>C (p.Ala3Pro) rs61996282
NM_000152.5(GAA):c.1726G>A (p.Gly576Ser) rs1800307
NM_000153.4(GALC):c.1403C>G (p.Thr468Ser) rs34134328
NM_000153.4(GALC):c.195G>C (p.Gly65=) rs886042057
NM_000153.4(GALC):c.349A>G (p.Met117Val) rs145580093
NM_000155.4(GALT):c.1030C>A (p.Gln344Lys) rs111033814
NM_000155.4(GALT):c.563A>G (p.Gln188Arg) rs75391579
NM_000155.4(GALT):c.652C>T (p.Leu218=) rs2070075
NM_000155.4(GALT):c.940A>G (p.Asn314Asp) rs2070074
NM_000156.6(GAMT):c.79T>C (p.Tyr27His) rs200833152
NM_000157.4(GBA):c.1223C>T (p.Thr408Met) rs75548401
NM_000158.4(GBE1):c.2017G>A (p.Ala673Thr) rs193074572
NM_000161.3(GCH1):c.68C>T (p.Pro23Leu) rs41298432
NM_000162.5(GCK):c.31G>A (p.Ala11Thr) rs116093166
NM_000162.5(GCK):c.645C>T (p.Tyr215=) rs144723656
NM_000168.6(GLI3):c.1357-17C>G rs190600888
NM_000168.6(GLI3):c.1393G>C (p.Gly465Arg) rs35488756
NM_000168.6(GLI3):c.2165A>G (p.Asn722Ser) rs146130351
NM_000168.6(GLI3):c.2179G>A (p.Gly727Arg) rs121917710
NM_000168.6(GLI3):c.2424A>G (p.Ile808Met) rs62622373
NM_000168.6(GLI3):c.341G>A (p.Arg114Lys) rs146458902
NM_000168.6(GLI3):c.444C>T (p.Tyr148=) rs142241970
NM_000169.3(GLA):c.427G>A (p.Ala143Thr) rs104894845
NM_000169.3(GLA):c.937G>T (p.Asp313Tyr) rs28935490
NM_000170.2(GLDC):c.1705G>A (p.Ala569Thr) rs151268759
NM_000170.2(GLDC):c.2053-5C>G rs140877566
NM_000170.2(GLDC):c.2380G>A (p.Ala794Thr) rs141933811
NM_000170.2(GLDC):c.2919+3A>G rs73639325
NM_000179.3(MSH6):c.3259C>T (p.Pro1087Ser) rs63750998
NM_000192.3(TBX5):c.316A>G (p.Ile106Val) rs147710408
NM_000192.3(TBX5):c.331G>T (p.Asp111Tyr) rs77357563
NM_000192.3(TBX5):c.787G>A (p.Val263Met) rs147405081
NM_000195.5(HPS1):c.1846G>A (p.Glu616Lys)
NM_000195.5(HPS1):c.848G>C (p.Gly283Ala) rs74154475
NM_000203.5(IDUA):c.1225G>C (p.Gly409Arg) rs11934801
NM_000203.5(IDUA):c.235G>A (p.Ala79Thr) rs58037052
NM_000203.5(IDUA):c.296C>T (p.Thr99Ile) rs147490060
NM_000208.4(INSR):c.3034G>A (p.Val1012Met) rs1799816
NM_000209.4(PDX1):c.716C>A (p.Pro239Gln) rs199644078
NM_000212.2(ITGB3):c.40G>A (p.Val14Met) rs115600591
NM_000214.3(JAG1):c.2810G>A (p.Arg937Gln) rs145895196
NM_000215.4(JAK3):c.452C>G (p.Pro151Arg) rs55778349
NM_000218.3(KCNQ1):c.1343C>G (p.Pro448Arg) rs12720449
NM_000243.2(MEFV):c.1587+18C>T rs11466030
NM_000243.3(MEFV):c.1223G>A rs11466024
NM_000245.4(MET):c.2908C>T (p.Arg970Cys) rs34589476
NM_000251.2(MSH2):c.23C>T (p.Thr8Met) rs17217716
NM_000255.4(MMUT):c.205A>G (p.Ile69Val) rs115923556
NM_000256.3(MYBPC3):c.530G>A (p.Arg177His) rs201012766
NM_000257.4(MYH7):c.3153G>A (p.Ala1051=) rs45540831
NM_000257.4(MYH7):c.728G>A (p.Arg243His) rs267606910
NM_000259.3(MYO5A):c.5065G>A (p.Val1689Ile) rs143298463
NM_000260.4(MYO7A):c.5215C>A (p.Arg1739=) rs111033477
NM_000260.4(MYO7A):c.5324T>C (p.Ile1775Thr) rs115123584
NM_000260.4(MYO7A):c.6214G>A (p.Val2072Ile) rs200313391
NM_000261.2(MYOC):c.1193A>G (p.Lys398Arg) rs56314834
NM_000264.5(PTCH1):c.113G>T (p.Gly38Val) rs143494325
NM_000264.5(PTCH1):c.1989G>C (p.Gln663His) rs753002023
NM_000264.5(PTCH1):c.2183C>T (p.Thr728Met) rs115556836
NM_000264.5(PTCH1):c.2678G>A (p.Arg893His) rs138154222
NM_000264.5(PTCH1):c.3487G>A (p.Gly1163Ser) rs113663584
NM_000264.5(PTCH1):c.3583A>T (p.Thr1195Ser) rs2236405
NM_000266.4(NDP):c.385G>A (p.Glu129Lys) rs756474198
NM_000267.3(NF1):c.2585C>G (p.Thr862Ser) rs200302954
NM_000267.3(NF1):c.6719A>G (p.His2240Arg) rs201336602
NM_000271.5(NPC1):c.1232G>A (p.Arg411Gln) rs77080672
NM_000271.5(NPC1):c.665A>G (p.Asn222Ser) rs55680026
NM_000272.4(NPHP1):c.689C>T (p.Ala230Val) rs113450177
NM_000276.4(OCRL):c.2695G>A (p.Glu899Lys) rs749551841
NM_000276.4(OCRL):c.41C>T (p.Thr14Ile) rs61752970
NM_000277.3(PAH):c.707-7A>T rs62508624
NM_000282.4(PCCA):c.231+15C>T rs202049874
NM_000283.3(PDE6B):c.145G>T (p.Asp49Tyr) rs79826315
NM_000284.4(PDHA1):c.97G>C (p.Asp33His) rs150318528
NM_000286.3(PEX12):c.102A>T (p.Arg34Ser) rs147530802
NM_000287.4(PEX6):c.1646C>T (p.Ala549Val) rs115960224
NM_000287.4(PEX6):c.1802G>A (p.Arg601Gln) rs34324426
NM_000287.4(PEX6):c.2770G>T (p.Ala924Ser) rs34551839
NM_000287.4(PEX6):c.2936C>T (p.Ala979Val) rs115180949
NM_000288.4(PEX7):c.377A>C (p.Gln126Pro) rs113268723
NM_000293.3(PHKB):c.500A>G (p.Tyr167Cys) rs151155518
NM_000293.3(PHKB):c.555G>T (p.Met185Ile) rs56257827
NM_000297.4(PKD2):c.2420G>A (p.Arg807Gln) rs147654263
NM_000298.6(PKLR):c.1516G>A (p.Val506Ile) rs8177988
NM_000304.4(PMP22):c.245T>C (p.Leu82Pro) rs878853113
NM_000304.4(PMP22):c.353C>T (p.Thr118Met) rs104894619
NM_000310.3(PPT1):c.627+4A>G rs572153728
NM_000310.3(PPT1):c.727-2A>T rs386833664
NM_000310.3(PPT1):c.904A>G (p.Ile302Val) rs146902902
NM_000316.3(PTH1R):c.299G>A (p.Gly100Asp) rs41290646
NM_000318.3(PEX2):c.209A>G (p.Tyr70Cys) rs35689779
NM_000318.3(PEX2):c.748T>C (p.Trp250Arg) rs142645936
NM_000321.2(RB1):c.1216-29A>G rs3092886
NM_000328.3(RPGR):c.905G>C (p.Cys302Ser) rs62640590
NM_000334.4(SCN4A):c.2341G>A (p.Val781Ile) rs62070884
NM_000334.4(SCN4A):c.2722G>A (p.Glu908Lys) rs117664682
NM_000334.4(SCN4A):c.968C>T (p.Thr323Met) rs80338952
NM_000335.5(SCN5A):c.1715C>A (p.Ala572Asp) rs36210423
NM_000335.5(SCN5A):c.3305C>A (p.Ser1102Tyr) rs7626962
NM_000335.5(SCN5A):c.6007T>C (p.Phe2003Leu) rs41311117
NM_000337.5(SGCD):c.699+13_699+15del rs397517924
NM_000338.3(SLC12A1):c.347G>A (p.Arg116His) rs34819316
NM_000350.3(ABCA4):c.3899G>A (p.Arg1300Gln) rs61750129
NM_000351.6(STS):c.1746C>G (p.Ser582Arg) rs151332463
NM_000351.7(STS):c.259+8_259+10del rs773065157
NM_000352.6(ABCC8):c.4563G>T (p.Lys1521Asn) rs142272833
NM_000356.4(TCOF1):c.122C>T (p.Ala41Val) rs56180593
NM_000356.4(TCOF1):c.640-1981_640-1964del rs528897827
NM_000356.4(TCOF1):c.797G>A (p.Ser266Asn) rs144327167
NM_000356.4(TCOF1):c.889G>T (p.Ala297Ser) rs112039991
NM_000356.4(TCOF1):c.998C>T (p.Ser333Leu) rs114326915
NM_000359.3(TGM1):c.1559A>G (p.Glu520Gly) rs142404759
NM_000359.3(TGM1):c.872G>A (p.Gly291Asp) rs780990272
NM_000363.5(TNNI3):c.244C>T (p.Pro82Ser) rs77615401
NM_000368.4(TSC1):c.1208C>T (p.Ser403Leu) rs118203504
NM_000368.4(TSC1):c.1589G>C (p.Ser530Thr) rs368481360
NM_000368.5(TSC1):c.2194C>T (p.His732Tyr) rs118203657
NM_000377.2(WAS):c.538C>A (p.His180Asn) rs145040665
NM_000377.2(WAS):c.995T>C (p.Val332Ala) rs2737799
NM_000381.4(MID1):c.661-22_661-21dup rs375668839
NM_000382.3(ALDH3A2):c.563C>T (p.Ala188Val) rs115977487
NM_000383.4(AIRE):c.1411C>T (p.Arg471Cys) rs74203920
NM_000384.3(APOB):c.10294C>G (p.Gln3432Glu)
NM_000384.3(APOB):c.606A>T (p.Glu202Asp) rs61746672
NM_000384.3(APOB):c.7285T>A (p.Ser2429Thr)
NM_000387.6(SLC25A20):c.773G>A (p.Arg258Gln) rs35989076
NM_000388.4(CASR):c.748G>A (p.Glu250Lys) rs62269092
NM_000391.4(TPP1):c.1266+5G>A rs1800753
NM_000391.4(TPP1):c.299A>G (p.Gln100Arg) rs1800746
NM_000393.5(COL5A2):c.1301C>T (p.Thr434Met) rs145850743
NM_000397.3(CYBB):c.1551T>A (p.Asp517Glu) rs151344452
NM_000402.4(G6PD):c.233T>C (p.Ile78Thr) rs76645461
NM_000402.4(G6PD):c.292G>A (p.Val98Met) rs1050828
NM_000402.4(G6PD):c.466A>G (p.Asn156Asp) rs1050829
NM_000414.4(HSD17B4):c.1471G>A (p.Ala491Thr) rs28943591
NM_000420.3(KEL):c.1790T>C (p.Leu597Pro) rs8176038
NM_000424.4(KRT5):c.1636C>A (p.Leu546Ile) rs114734812
NM_000424.4(KRT5):c.631G>A (p.Val211Met) rs147498164
NM_000426.3(LAMA2):c.1303C>T (p.Arg435Ter) rs773209126
NM_000426.3(LAMA2):c.1634T>A (p.Leu545Gln) rs118083923
NM_000426.3(LAMA2):c.2476C>T (p.Arg826Trp) rs118147866
NM_000426.3(LAMA2):c.3296A>G (p.Asn1099Ser) rs35065563
NM_000426.3(LAMA2):c.4437-5T>A rs41285288
NM_000426.3(LAMA2):c.5530C>A (p.Arg1844Ser) rs56173620
NM_000426.3(LAMA2):c.5909G>C (p.Cys1970Ser) rs148451013
NM_000426.3(LAMA2):c.6161A>G (p.Gln2054Arg) rs56035053
NM_000426.3(LAMA2):c.7431A>T (p.Arg2477Ser) rs34367843
NM_000426.3(LAMA2):c.74C>T (p.Pro25Leu) rs145310035
NM_000426.3(LAMA2):c.8528A>G (p.Asn2843Ser) rs73599293
NM_000426.3(LAMA2):c.8988+15T>C rs201041465
NM_000426.3(LAMA2):c.922G>A (p.Glu308Lys) rs146462599
NM_000435.3(NOTCH3):c.3704A>T (p.His1235Leu) rs55882518
NM_000441.2(SLC26A4):c.1790T>C (p.Leu597Ser) rs55638457
NM_000441.2(SLC26A4):c.416-16G>T rs114992866
NM_000443.4(ABCB4):c.1529A>G (p.Asn510Ser) rs375315619
NM_000443.4(ABCB4):c.523A>G (p.Thr175Ala) rs58238559
NM_000466.3(PEX1):c.1142C>A (p.Ala381Asp) rs73404416
NM_000478.6(ALPL):c.1381G>A (p.Val461Ile) rs34810399
NM_000478.6(ALPL):c.455G>A (p.Arg152His) rs149344982
NM_000478.6(ALPL):c.571G>A (p.Glu191Lys) rs121918007
NM_000480.3(AMPD3):c.958G>T (p.Val320Leu) rs117706710
NM_000481.4(AMT):c.1145G>A (p.Arg382Gln) rs141246107
NM_000481.4(AMT):c.898A>G (p.Met300Val) rs144971200
NM_000487.6(ARSA):c.*96A>G rs6151429
NM_000487.6(ARSA):c.1055A>G (p.Asn352Ser) rs2071421
NM_000492.3(CFTR):c.1210-12T[9] rs1805177
NM_000492.3(CFTR):c.1251C>A (p.Asn417Lys) rs4727853
NM_000492.3(CFTR):c.1312A>G (p.Thr438Ala) rs201434579
NM_000492.3(CFTR):c.1521_1523delCTT (p.Phe508delPhe) rs113993960
NM_000492.3(CFTR):c.164+28A>G rs34010645
NM_000492.3(CFTR):c.2252G>T (p.Arg751Leu) rs397508357
NM_000492.3(CFTR):c.2506G>T (p.Asp836Tyr) rs201386642
NM_000492.3(CFTR):c.3080T>C (p.Ile1027Thr) rs1800112
NM_000492.4(CFTR):c.1040G>A (p.Arg347His) rs77932196
NM_000492.4(CFTR):c.1265C>T (p.Ser422Phe) rs201880593
NM_000492.4(CFTR):c.1584G>A (p.Glu528=) rs1800095
NM_000492.4(CFTR):c.1624G>T (p.Gly542Ter) rs113993959
NM_000492.4(CFTR):c.1651G>A (p.Gly551Ser) rs121909013
NM_000492.4(CFTR):c.1727G>C (p.Gly576Ala) rs1800098
NM_000492.4(CFTR):c.220C>T (p.Arg74Trp) rs115545701
NM_000492.4(CFTR):c.2249C>T (p.Pro750Leu) rs140455771
NM_000492.4(CFTR):c.224G>A (p.Arg75Gln) rs1800076
NM_000492.4(CFTR):c.3154T>G (p.Phe1052Val) rs150212784
NM_000492.4(CFTR):c.3454G>C (p.Asp1152His) rs75541969
NM_000492.4(CFTR):c.350G>A (p.Arg117His) rs78655421
NM_000493.4(COL10A1):c.593G>A (p.Arg198His) rs148785195
NM_000497.3(CYP11B1):c.1331G>A (p.Gly444Asp) rs779103938
NM_000500.9(CYP21A2):c.1439G>T (p.Arg480Leu) rs184649564
NM_000503.6(EYA1):c.1460C>T (p.Ser487Leu) rs139717960
NM_000515.5(GH1):c.406G>A (p.Val136Ile) rs5388
NM_000518.4(HBB):c.68A>C (p.Glu23Ala) rs33936254
NM_000518.5(HBB):c.20A>T (p.Glu7Val) rs334
NM_000521.4(HEXB):c.214C>T (p.Leu72Phe) rs147155126
NM_000522.5(HOXA13):c.633G>T (p.Met211Ile) rs35277569
NM_000528.4(MAN2B1):c.2267+3dup rs572289342
NM_000532.5(PCCB):c.49C>A (p.Leu17Met) rs200185747
NM_000533.5(PLP1):c.-31C>T rs2233695
NM_000535.7(PMS2):c.1532C>T (p.Thr511Met) rs74902811
NM_000535.7(PMS2):c.1711C>A (p.Leu571Ile) rs63750055
NM_000535.7(PMS2):c.52A>G (p.Ile18Val) rs63750123
NM_000540.2(RYR1):c.11941C>T (p.His3981Tyr) rs148772854
NM_000540.2(RYR1):c.13502C>T (p.Pro4501Leu) rs73933023
NM_000540.2(RYR1):c.271-7C>G rs192495718
NM_000540.2(RYR1):c.4088C>T (p.Ala1363Val) rs774603798
NM_000540.2(RYR1):c.4178A>G (p.Lys1393Arg) rs137933390
NM_000540.2(RYR1):c.6721C>T rs200563280
NM_000540.3(RYR1):c.2122G>A (p.Asp708Asn) rs138874610
NM_000541.5(SAG):c.301G>A (p.Ala101Thr) rs141521563
NM_000543.5(SMPD1):c.1460C>T (p.Ala487Val) rs141641266
NM_000543.5(SMPD1):c.1598C>T (p.Pro533Leu) rs199915216
NM_000543.5(SMPD1):c.1763C>T (p.Thr588Met) rs35785620
NM_000543.5(SMPD1):c.887G>A (p.Arg296Gln) rs35824453
NM_000548.3(TSC2):c.4527_4529delCTT (p.Phe1510del) rs137854239
NM_000548.5(TSC2):c.1281C>A (p.Ile427=) rs45478892
NM_000548.5(TSC2):c.1318G>A (p.Gly440Ser) rs45484298
NM_000548.5(TSC2):c.1747G>A (p.Ala583Thr) rs1800729
NM_000548.5(TSC2):c.1839+6G>A rs45517204
NM_000548.5(TSC2):c.2476C>A (p.Leu826Met) rs45517238
NM_000548.5(TSC2):c.2545+26G>A rs45517242
NM_000548.5(TSC2):c.3397+15C>T rs202246408
NM_000548.5(TSC2):c.3797dup (p.Pro1267fs) rs796053505
NM_000548.5(TSC2):c.3914C>T (p.Pro1305Leu) rs45517320
NM_000548.5(TSC2):c.3986G>A (p.Arg1329His) rs45517323
NM_000548.5(TSC2):c.4316G>A (p.Gly1439Asp) rs150397923
NM_000548.5(TSC2):c.4569+12C>T rs45517350
NM_000548.5(TSC2):c.5321G>C (p.Ser1774Thr) rs9209
NM_000548.5(TSC2):c.5359G>A (p.Gly1787Ser) rs45517419
NM_000548.5(TSC2):c.5383C>T (p.Arg1795Cys) rs45517423
NM_000551.3(VHL):c.74C>T (p.Pro25Leu) rs35460768
NM_000551.4(VHL):c.340+5G>C rs61758376
NM_000552.4(VWF):c.2451T>A (p.His817Gln) rs57950734
NM_000552.4(VWF):c.2561G>A (p.Arg854Gln) rs41276738
NM_000552.4(VWF):c.7997C>T (p.Thr2666Met) rs78353028
NM_000554.6(CRX):c.365G>A (p.Gly122Asp) rs61748441
NM_000642.3(AGL):c.1481G>A (p.Arg494His) rs141043166
NM_000666.3(ACY1):c.1057C>T (p.Arg353Cys) rs121912698
NM_000666.3(ACY1):c.536A>G (p.Asn179Ser) rs887540
NM_000702.4(ATP1A2):c.25T>A (p.Tyr9Asn) rs55858252
NM_000702.4(ATP1A2):c.340G>A (p.Gly114Ser) rs116711766
NM_000719.7(CACNA1C):c.5665C>T (p.Arg1889Cys) rs185788586
NM_000742.4(CHRNA2):c.1434C>A (p.Asp478Glu) rs56344740
NM_000744.7(CHRNA4):c.1352C>T (p.Pro451Leu) rs55915440
NM_000747.3(CHRNB1):c.1045-6C>G rs79209506
NM_000748.3(CHRNB2):c.1191G>C (p.Gln397His) rs55685423
NM_000748.3(CHRNB2):c.1432T>C (p.Phe478Leu) rs79137415
NM_000751.3(CHRND):c.243C>T (p.His81=) rs115841867
NM_000751.3(CHRND):c.862C>G (p.Gln288Glu) rs41265127
NM_000781.3(CYP11A1):c.235G>A (p.Val79Ile) rs143655263
NM_000814.6(GABRB3):c.682+20A>G rs75015217
NM_000834.4(GRIN2B):c.3993G>A (p.Met1331Ile) rs200035225
NM_000875.5(IGF1R):c.1310G>A (p.Arg437His) rs34516635
NM_000875.5(IGF1R):c.1463-5C>A rs36108138
NM_001003800.2(BICD2):c.269A>G (p.Lys90Arg) rs61754130
NM_001003841.3(SLC6A19):c.41G>A (p.Arg14Gln) rs147458082
NM_001003841.3(SLC6A19):c.517G>A (p.Asp173Asn) rs121434346
NM_001005242.3(PKP2):c.1460T>G (p.Ile487Ser) rs147240502
NM_001005242.3(PKP2):c.76G>A (p.Asp26Asn) rs143004808
NM_001005360.2(DNM2):c.235+6A>G rs113192269
NM_001005360.2(DNM2):c.236-8C>G rs143084059
NM_001007792.1(NTRK1):c.2231G>A (p.Arg744Gln) rs35669708
NM_001008537.3(NEXMIF):c.151C>A (p.Pro51Thr) rs145018752
NM_001010898.4(SLC6A17):c.2036A>G (p.Lys679Arg) rs41313405
NM_001017995.3(SH3PXD2B):c.1062+15G>A rs111572530
NM_001017995.3(SH3PXD2B):c.1612GAGCGG[2] (p.538ER[2]) rs534091900
NM_001017995.3(SH3PXD2B):c.2477C>T (p.Pro826Leu) rs73317796
NM_001018113.3(FANCB):c.1658C>T (p.Thr553Met) rs146157131
NM_001018113.3(FANCB):c.1769T>C (p.Phe590Ser) rs142959373
NM_001024630.4(RUNX2):c.1531G>A (p.Gly511Ser) rs11498198
NM_001024630.4(RUNX2):c.254C>T (p.Ala85Val) rs372138746
NM_001029882.3(AHDC1):c.1411G>A (p.Val471Met) rs147276945
NM_001029882.3(AHDC1):c.1510G>A (p.Val504Met) rs143346525
NM_001029882.3(AHDC1):c.212C>T (p.Thr71Ile) rs199719452
NM_001029882.3(AHDC1):c.811C>G (p.Pro271Ala) rs200660997
NM_001029883.3(PCARE):c.2063G>A (p.Cys688Tyr) rs149601594
NM_001029883.3(PCARE):c.3739G>A (p.Gly1247Ser) rs187333111
NM_001031737.3(CCDC78):c.492+1G>A rs138669350
NM_001033855.3(DCLRE1C):c.457G>A (p.Gly153Arg) rs41297018
NM_001035.3(RYR2):c.14809-15C>G rs790897
NM_001035.3(RYR2):c.3407C>T (p.Ala1136Val) rs72549415
NM_001036.5(RYR3):c.6125A>G (p.Asn2042Ser) rs116926961
NM_001037.5(SCN1B):c.448+193G>A rs66876876
NM_001039141.3(TRIOBP):c.4031G>A (p.Arg1344Gln) rs34066624
NM_001039591.3(USP9X):c.286G>T (p.Val96Leu) rs73480414
NM_001039591.3(USP9X):c.6084C>T (p.Pro2028=) rs146661515
NM_001039876.3(SYNE4):c.1102G>A (p.Val368Met) rs141202530
NM_001039958.2(MESP2):c.549_584del (p.180_181QG[7]) rs749710849
NM_001040142.2(SCN2A):c.2723A>G (p.Lys908Arg) rs2228980
NM_001040436.3(YARS2):c.104C>A (p.Ala35Asp) rs149447502
NM_001040436.3(YARS2):c.1275-2dup rs565781501
NM_001040616.3(LINS1):c.1813A>G (p.Met605Val) rs141855950
NM_001040716.2(PC):c.1185+5_1185+8del rs748620956
NM_001041.4(SI):c.517C>G (p.Pro173Ala) rs146960446
NM_001041.4(SI):c.598A>G (p.Ser200Gly) rs113903766
NM_001042492.3(NF1):c.3867C>T (p.Phe1289=) rs138186428
NM_001042492.3(NF1):c.5235G>A (p.Lys1745=) rs17887014
NM_001042492.3(NF1):c.528T>A (p.Asp176Glu) rs112306990
NM_001042492.3(NF1):c.846G>A (p.Gln282=) rs138840528
NM_001042545.2(LTBP4):c.1238G>A (p.Gly413Asp) rs114749335
NM_001048166.1(STIL):c.1055G>A (p.Arg352His) rs141678367
NM_001048166.1(STIL):c.1455G>C (p.Leu485Phe) rs139912214
NM_001048166.1(STIL):c.2017A>G (p.Ser673Gly) rs140448154
NM_001048174.2(MUTYH):c.228C>T (p.Tyr76=) rs121908380
NM_001059.3(TACR3):c.857A>G (p.Lys286Arg) rs2276973
NM_001063.4(TF):c.887A>G (p.Asp296Gly) rs8177238
NM_001064.4(TKT):c.339+3A>C rs180704294
NM_001077365.2(POMT1):c.1499G>A (p.Arg500Lys) rs117985576
NM_001077365.2(POMT1):c.1545C>G (p.Ser515Arg) rs150367385
NM_001077365.2(POMT1):c.1698C>T (p.Ser566=) rs150814269
NM_001077418.3(TMEM231):c.91G>A (p.Ala31Thr) rs202215735
NM_001080.3(ALDH5A1):c.1348G>A (p.Asp450Asn) rs144177566
NM_001080.3(ALDH5A1):c.961G>A (p.Val321Met) rs115784602
NM_001080414.4(CCDC88C):c.3895C>T (p.Arg1299Cys) rs142539336
NM_001080414.4(CCDC88C):c.590G>A (p.Arg197Gln) rs200769097
NM_001080414.4(CCDC88C):c.5951G>A (p.Arg1984Gln) rs61745465
NM_001080432.3(FTO):c.545G>C (p.Gly182Ala) rs61743972
NM_001080449.3(DNA2):c.2713C>A (p.Gln905Lys) rs181679245
NM_001080476.2(GRXCR1):c.272G>T (p.Gly91Val) rs113203706
NM_001080510.4(METTL23):c.136G>C (p.Glu46Gln) rs114299201
NM_001080510.4(METTL23):c.569T>C (p.Leu190Pro) rs147321492
NM_001080517.3(SETD5):c.3409A>G (p.Met1137Val) rs13327456
NM_001080522.2(CC2D2A):c.1519A>G (p.Lys507Glu) rs144439937
NM_001080522.2(CC2D2A):c.1978G>C (p.Val660Leu) rs16892134
NM_001080522.2(CC2D2A):c.2813T>C (p.Met938Thr) rs61740537
NM_001080522.2(CC2D2A):c.351T>G (p.Ser117Arg) rs186264635
NM_001082538.3(TCTN1):c.1234A>G (p.Ile412Val) rs75714509
NM_001082538.3(TCTN1):c.220+12G>C rs76843552
NM_001083116.3(PRF1):c.272C>T (p.Ala91Val) rs35947132
NM_001083614.2(EARS2):c.1412A>C (p.Lys471Thr) rs137973249
NM_001083614.2(EARS2):c.16A>G (p.Arg6Gly) rs113722817
NM_001083614.2(EARS2):c.322C>T (p.Arg108Trp) rs376103091
NM_001083961.2(WDR62):c.1225A>G (p.Asn409Asp) rs146180912
NM_001083961.2(WDR62):c.1641G>T (p.Thr547=) rs2301734
NM_001083961.2(WDR62):c.2666T>C (p.Met889Thr) rs139749569
NM_001083961.2(WDR62):c.3946C>G (p.Gln1316Glu) rs35811023
NM_001083961.2(WDR62):c.866A>G (p.Lys289Arg) rs12327568
NM_001083962.2(TCF4):c.1487-5G>A rs749176054
NM_001083962.2(TCF4):c.944C>T (p.Ala315Val) rs147445499
NM_001084.5(PLOD3):c.1144G>C (p.Asp382His) rs41281013
NM_001085372.3(UQCC3):c.226T>G (p.Trp76Gly) rs143509965
NM_001089.3(ABCA3):c.863G>A (p.Arg288Lys) rs117603931
NM_001097579.2(GPR34):c.884A>G (p.Asn295Ser) rs61746390
NM_001098484.3(SLC4A4):c.2764-2dup rs148961885
NM_001099857.5(IKBKG):c.169G>A (p.Glu57Lys) rs148695964
NM_001101.5(ACTB):c.363+16C>T rs73332405
NM_001102401.3(TTI2):c.581G>C (p.Gly194Ala) rs186443359
NM_001104631.2(PDE4D):c.1288-15dup rs143090133
NM_001110219.3(GJB6):c.63del (p.Lys22fs) rs770612890
NM_001110556.2(FLNA):c.1439C>T (p.Pro480Leu) rs782168634
NM_001110556.2(FLNA):c.1579C>T (p.Arg527Cys) rs202029322
NM_001110556.2(FLNA):c.1813G>A (p.Asp605Asn) rs201093148
NM_001110556.2(FLNA):c.2449C>T (p.Pro817Ser) rs200053635
NM_001110556.2(FLNA):c.3035C>T (p.Ser1012Leu) rs17091204
NM_001110556.2(FLNA):c.3379G>A (p.Val1127Met) rs398123617
NM_001110556.2(FLNA):c.5290G>A (p.Ala1764Thr) rs57108893
NM_001110556.2(FLNA):c.5972C>T (p.Ser1991Leu) rs187029309
NM_001110556.2(FLNA):c.6023-10C>G rs72616474
NM_001110556.2(FLNA):c.65A>G (p.Asp22Gly) rs782598729
NM_001110556.2(FLNA):c.7267C>T (p.Pro2423Ser) rs200198847
NM_001110792.2(MECP2):c.1032C>T (p.Ser344=) rs148744894
NM_001110792.2(MECP2):c.1225G>A (p.Glu409Lys) rs56268439
NM_001110792.2(MECP2):c.1366G>A (p.Ala456Thr) rs61753975
NM_001110792.2(MECP2):c.455C>T (p.Ala152Val) rs28934908
NM_001110792.2(MECP2):c.626C>T (p.Thr209Met) rs61749714
NM_001111.5(ADAR):c.1760A>G (p.Tyr587Cys) rs17843865
NM_001111307.2(PDE4A):c.991C>T (p.Pro331Ser) rs150660796
NM_001113378.1(FANCI):c.1813C>T (p.Leu605Phe) rs117125761
NM_001118887.2(ANGPT2):c.994G>A (p.Val332Ile) rs7813215
NM_001122659.3(EDNRB):c.169G>A (p.Gly57Ser) rs1801710
NM_001126108.2(SLC12A3):c.1539C>T (p.Tyr513=) rs146805986
NM_001126131.2(POLG):c.1550G>T (p.Gly517Val) rs61752783
NM_001126131.2(POLG):c.1760C>T (p.Pro587Leu) rs113994096
NM_001126131.2(POLG):c.752C>T (p.Thr251Ile) rs113994094
NM_001126131.2(POLG):c.911T>G (p.Leu304Arg) rs121918044
NM_001127222.2(CACNA1A):c.1357G>A (p.Ala453Thr) rs41276886
NM_001127222.2(CACNA1A):c.1782G>A (p.Lys594=) rs756972061
NM_001127222.2(CACNA1A):c.2687C>G (p.Pro896Arg) rs121908242
NM_001127222.2(CACNA1A):c.2737C>T (p.Pro913Ser) rs16020
NM_001127222.2(CACNA1A):c.3040G>A (p.Glu1014Lys) rs16024
NM_001127222.2(CACNA1A):c.6630CCA[8] (p.His2219del) rs759331923
NM_001127222.2(CACNA1A):c.6656_6658del (p.His2219del) rs749638821
NM_001127222.2(CACNA1A):c.6658_6659insACC (p.His2219dup) rs768950814
NM_001127649.3(PEX26):c.130C>T (p.Leu44Phe) rs150895887
NM_001127649.3(PEX26):c.728C>T (p.Ala243Val) rs149153003
NM_001127671.2(LIFR):c.1937C>A (p.Thr646Asn) rs79040751
NM_001127698.2(SPINK5):c.802C>T (p.Arg268Cys) rs142558269
NM_001128126.3(AP4S1):c.306+42G>A rs74807133
NM_001128159.3(VPS53):c.2062A>G (p.Ile688Val) rs140376049
NM_001128225.3(SLC39A13):c.439C>G (p.Gln147Glu) rs148291843
NM_001128227.3(GNE):c.-10G>A rs73449614
NM_001128228.3(TPRN):c.1261C>T (p.Pro421Ser) rs72763296
NM_001128840.3(CACNA1D):c.5767_5769del (p.Phe1923del) rs72556363
NM_001128844.2(SMARCA4):c.2275-3C>A rs117611401
NM_001128849.2(SMARCA4):c.1419+9C>T rs374635008
NM_001128849.2(SMARCA4):c.4731+12G>A rs34930626
NM_001130105.1(CERT1):c.301G>A (p.Asp101Asn) rs5744539
NM_001130144.2(LTBP3):c.1550C>T (p.Pro517Leu) rs145001056
NM_001130438.3(SPTAN1):c.3520-14C>G rs142682344
NM_001130438.3(SPTAN1):c.7102G>C (p.Glu2368Gln) rs796053329
NM_001130987.2(DYSF):c.1216G>C (p.Val406Leu) rs150724610
NM_001130987.2(DYSF):c.2107C>G (p.Leu703Val) rs74423119
NM_001134407.3(GRIN2A):c.2899G>C (p.Val967Leu) rs61731465
NM_001134407.3(GRIN2A):c.3228C>A (p.Asn1076Lys) rs61758995
NM_001134407.3(GRIN2A):c.3827C>G (p.Ala1276Gly) rs145063086
NM_001134831.2(AHI1):c.-140+1G>T rs145372075
NM_001134831.2(AHI1):c.1152-11T>G rs113317693
NM_001134831.2(AHI1):c.3053A>C (p.Gln1018Pro) rs6940875
NM_001134831.2(AHI1):c.3257A>G (p.Glu1086Gly) rs148000791
NM_001135599.3(TGFB2):c.703G>C (p.Val235Leu) rs10482810
NM_001136193.2(FASTKD2):c.-51A>G rs116297724
NM_001136193.2(FASTKD2):c.1435G>T (p.Val479Leu) rs145043229
NM_001136193.2(FASTKD2):c.149A>G (p.Lys50Arg) rs141447598
NM_001136193.2(FASTKD2):c.2093C>T (p.Ala698Val) rs146554705
NM_001136193.2(FASTKD2):c.29G>C (p.Ser10Thr) rs147727753
NM_001142301.1(TMEM67):c.2522-6del rs747342409
NM_001142301.1(TMEM67):c.264-19T>C rs138589757
NM_001142416.2(AIMP1):c.310A>G (p.Thr104Ala) rs113844295
NM_001142416.2(AIMP1):c.362_366del (p.Lys121fs) rs1057520101
NM_001145026.2(PTPRQ):c.202G>A (p.Gly68Arg) rs61729303
NM_001145809.2(MYH14):c.1150G>T (p.Gly384Cys) rs119103280
NM_001145809.2(MYH14):c.1205A>G (p.Asn402Ser) rs537153044
NM_001145809.2(MYH14):c.4033G>A (p.Ala1345Thr) rs148054042
NM_001145809.2(MYH14):c.826A>G (p.Ile276Val) rs55645295
NM_001148.6(ANK2):c.11218C>A (p.Leu3740Ile) rs35530544
NM_001148.6(ANK2):c.11791G>A (p.Glu3931Lys) rs45454496
NM_001148.6(ANK2):c.9454A>G (p.Thr3152Ala) rs61741040
NM_001159773.2(CANT1):c.967G>A (p.Ala323Thr) rs9903215
NM_001160372.4(TRAPPC9):c.2797G>A (p.Gly933Ser) rs114949291
NM_001161352.2(KCNMA1):c.117CTC[8] (p.Ser60dup) rs572827902
NM_001161352.2(KCNMA1):c.144TTC[3] (p.Ser60del) rs751901610
NM_001163809.1(WDR81):c.1877C>T (p.Pro626Leu) rs148644987
NM_001163809.1(WDR81):c.3532G>A (p.Ala1178Thr) rs151330612
NM_001163809.1(WDR81):c.5325+6G>C rs115714169
NM_001163817.2(DHCR7):c.1A>G (p.Met1Val) rs104886033
NM_001164277.1(SLC37A4):c.1275C>T (p.Ser425=) rs35010541
NM_001164617.2(GPC3):c.1354G>A (p.Val452Met) rs11539789
NM_001165927.1(MKS1):c.1358G>A (p.Arg453Gln) rs201619500
NM_001165927.1(MKS1):c.1406G>A (p.Arg469His) rs111315726
NM_001165927.1(MKS1):c.827A>G (p.Asp276Gly) rs151023718
NM_001165963.4(SCN1A):c.1811G>A (p.Arg604His) rs121918769
NM_001165963.4(SCN1A):c.5864T>C (p.Ile1955Thr) rs35735053
NM_001166114.2(PNPLA6):c.1457C>T (p.Pro486Leu) rs145191932
NM_001166114.2(PNPLA6):c.4078G>A (p.Gly1360Ser) rs145178162
NM_001167734.1(VARS2):c.1604C>T (p.Ser535Phe) rs61746524
NM_001167734.1(VARS2):c.2383G>A (p.Val795Met) rs55865499
NM_001171155.2(PET100):c.82G>A (p.Glu28Lys) rs4134804
NM_001173990.3(TMEM216):c.253C>A (p.Arg85=) rs11230683
NM_001173990.3(TMEM216):c.35-17C>T rs147953784
NM_001174116.2(DMXL2):c.2707A>G (p.Asn903Asp) rs16953073
NM_001174150.2(ARL13B):c.1186C>G (p.Pro396Ala) rs11554412
NM_001177316.2(SLC34A3):c.448+1G>A rs150841256
NM_001182.4(ALDH7A1):c.-34G>C rs140627539
NM_001182.5(ALDH7A1):c.1567A>G (p.Thr523Ala) rs61757684
NM_001184.4(ATR):c.2290A>G (p.Lys764Glu) rs77208665
NM_001184.4(ATR):c.268C>T (p.His90Tyr) rs28897763
NM_001184.4(ATR):c.4835A>G (p.Asn1612Ser) rs55894265
NM_001184.4(ATR):c.6394T>G (p.Tyr2132Asp) rs28910273
NM_001184880.2(PCDH19):c.3319C>G (p.Arg1107Gly) rs191333060
NM_001184880.2(PCDH19):c.3439G>A (p.Val1147Ile) rs138771033
NM_001185012.1(NDUFA2):c.*41del rs863224084
NM_001193466.2(KANSL1):c.1826G>A (p.Ser609Asn) rs138698439
NM_001193466.2(KANSL1):c.773T>C (p.Leu258Ser) rs145714368
NM_001194998.2(CEP152):c.1180A>G (p.Ile394Val) rs181295720
NM_001194998.2(CEP152):c.1577+6G>A rs78525896
NM_001194998.2(CEP152):c.3278G>A (p.Cys1093Tyr) rs74012142
NM_001194998.2(CEP152):c.344G>A (p.Arg115Gln) rs188101277
NM_001195248.2(APTX):c.431C>A (p.Ser144Tyr) rs34778324
NM_001195248.2(APTX):c.596G>A (p.Arg199His) rs150886026
NM_001197104.1(KMT2A):c.10850T>C (p.Leu3617Pro) rs146191865
NM_001197104.1(KMT2A):c.158C>T (p.Ala53Val) rs9332747
NM_001197104.1(KMT2A):c.89C>G (p.Ala30Gly) rs9332745
NM_001197104.1(KMT2A):c.9391G>A (p.Gly3131Ser) rs150804738
NM_001199107.2(TBC1D24):c.1427C>A (p.Ala476Asp) rs202216463
NM_001199107.2(TBC1D24):c.179G>A (p.Arg60Gln) rs200226466
NM_001199107.2(TBC1D24):c.785C>T (p.Ser262Leu) rs201060500
NM_001199107.2(TBC1D24):c.885C>G (p.Phe295Leu) rs72768728
NM_001202.6(BMP4):c.370+28G>A rs72680532
NM_001204.7(BMPR2):c.797G>C (p.Arg266Thr) rs374694591
NM_001205254.2(OCLN):c.922G>A (p.Val308Met) rs369518478
NM_001232.4(CASQ2):c.731A>G (p.His244Arg) rs28730716
NM_001242897.2(DEPDC5):c.1870+3481C>T rs181347577
NM_001243133.2(NLRP3):c.1020C>T (p.Pro340=) rs41311573
NM_001253852.3(AP4B1):c.1723A>G (p.Ile575Val) rs114734921
NM_001253852.3(AP4B1):c.240A>G (p.Pro80=) rs34249695
NM_001256071.3(RNF213):c.1180A>G (p.Asn394Asp) rs74490096
NM_001256447.2(BCAP31):c.383C>T (p.Thr128Met) rs111450526
NM_001267550.2(TTN):c.10088G>A (p.Arg3363His) rs148169214
NM_001267550.2(TTN):c.17048A>G (p.Tyr5683Cys) rs72648942
NM_001267550.2(TTN):c.18325A>G (p.Lys6109Glu) rs73973139
NM_001267550.2(TTN):c.19150C>A (p.Pro6384Thr) rs72648953
NM_001267550.2(TTN):c.23378-10C>A rs72648975
NM_001267550.2(TTN):c.30512-19dup rs397517532
NM_001267550.2(TTN):c.4739C>T (p.Thr1580Met) rs73973147
NM_001267550.2(TTN):c.49413G>T (p.Trp16471Cys) rs202094100
NM_001267550.2(TTN):c.6727G>T (p.Asp2243Tyr) rs138787974
NM_001267550.2(TTN):c.97760G>A (p.Arg32587His) rs55704830
NM_001267550.2(TTN):c.98294C>G (p.Ala32765Gly) rs72648273
NM_001267550.2(TTN):c.98390A>G (p.Asn32797Ser) rs149001703
NM_001270974.2(HYDIN):c.14857C>T (p.Arg4953Trp) rs79607350
NM_001271.4(CHD2):c.4534C>T (p.Arg1512Trp) rs755898320
NM_001271.4(CHD2):c.4592+18G>A rs116022337
NM_001271.4(CHD2):c.5245C>T (p.Pro1749Ser) rs772907727
NM_001271208.2(NEB):c.19944G>A (p.Ser6648=) rs201553266
NM_001271208.2(NEB):c.21790G>C (p.Asp7264His) rs201979610
NM_001271208.2(NEB):c.23600C>T (p.Thr7867Ile) rs34368668
NM_001271208.2(NEB):c.4206T>A (p.Asn1402Lys) rs201169452
NM_001271208.2(NEB):c.4466G>A (p.Gly1489Asp) rs74482326
NM_001271208.2(NEB):c.539A>G (p.Lys180Arg) rs200719359
NM_001271208.2(NEB):c.9467T>A (p.Ile3156Asn) rs145770770
NM_001271620.2(ZNF423):c.2960C>T (p.Ala987Val) rs111229124
NM_001272071.2(AP1S2):c.288T>C (p.Ser96=) rs61741688
NM_001276345.2(TNNT2):c.862C>T (p.Arg288Cys) rs121964857
NM_001277115.2(DNAH11):c.11233G>A (p.Glu3745Lys) rs182389910
NM_001277115.2(DNAH11):c.12561T>G (p.Asp4187Glu) rs148429731
NM_001277115.2(DNAH11):c.3946A>G (p.Met1316Val) rs17144788
NM_001277115.2(DNAH11):c.58C>A (p.Arg20Ser) rs72655967
NM_001277115.2(DNAH11):c.6416G>A (p.Arg2139Lys) rs140048925
NM_001277115.2(DNAH11):c.7812-18C>G rs147865931
NM_001277115.2(DNAH11):c.8969G>A (p.Arg2990His) rs72657371
NM_001277269.1(OTOG):c.2548G>C (p.Gly850Arg) rs61734214
NM_001277269.1(OTOG):c.4048C>T (p.Arg1350Trp) rs61734125
NM_001277269.2(OTOG):c.[6110C>T] rs61736002
NM_001278064.2(GRM1):c.3214C>G (p.Pro1072Ala) rs146753539
NM_001278116.2(L1CAM):c.2302G>A (p.Val768Ile) rs36021462
NM_001278716.2(FBXL4):c.1444C>T (p.Arg482Trp) rs398123061
NM_001286445.3(RIPOR2):c.1613C>T (p.Ser538Leu) rs142889670
NM_001286445.3(RIPOR2):c.1773A>C (p.Leu591Phe) rs143785002
NM_001287.6(CLCN7):c.1961C>T (p.Thr654Met) rs114827619
NM_001289.6(CLIC2):c.478C>G (p.Pro160Ala) rs41304992
NM_001289.6(CLIC2):c.57+10C>T rs7050330
NM_001289910.1(IDH2):c.517G>A (p.Asp173Asn) rs142816010
NM_001291867.2(NHS):c.211C>T (p.Pro71Ser) rs398124605
NM_001298.3(CNGA3):c.592G>A (p.Glu198Lys) rs2271041
NM_001301365.1(LYST):c.5518T>G (p.Ser1840Ala) rs115330112
NM_001303.4(COX10):c.1291C>T (p.Arg431Trp) rs113058506
NM_001303.4(COX10):c.682C>T (p.Arg228Cys) rs114521946
NM_001312909.2(FAM111A):c.310T>A (p.Leu104Ile) rs74658848
NM_001318510.2(ACSL4):c.1325A>G (p.Tyr442Cys) rs200451158
NM_001318510.2(ACSL4):c.806+3A>G rs183171123
NM_001324156.1(ZNF41):c.302-72C>T rs104894955
NM_001329943.3(KIAA0586):c.94dup (p.His32fs) rs555421894
NM_001330078.2(NRXN1):c.2122C>A (p.Leu708Ile) rs56086732
NM_001330078.2(NRXN1):c.772+1140G>A rs61658382
NM_001330260.2(SCN8A):c.3148G>A (p.Gly1050Ser) rs202006479
NM_001330311.2(DVL1):c.605+2TG[2] rs573517540
NM_001330504.1(ALG1):c.221T>G (p.Phe74Cys) rs112668461
NM_001347721.2(DYRK1A):c.2008G>C (p.Ala670Pro) rs55720916
NM_001347721.2(DYRK1A):c.208-40C>G rs140466090
NM_001354663.2(OPA1):c.-260_-243del rs863224140
NM_001354712.2(THRB):c.994G>A (p.Gly332Arg) rs28999969
NM_001360.2(DHCR7):c.25A>T (p.Ile9Phe) rs115595829
NM_001360.2(DHCR7):c.99-4G>A rs140748737
NM_001363.4(DKC1):c.-142C>G rs199422241
NM_001363118.2(SLC52A2):c.935T>C (p.Leu312Pro) rs754320812
NM_001363711.2(DUOX2):c.2895_2898del (p.Phe966fs) rs530719719
NM_001365088.1(SLC12A6):c.1412G>C (p.Ser471Thr) rs140916001
NM_001365276.2(TNXB):c.6811G>C (p.Val2271Leu) rs140770834
NM_001365276.2(TNXB):c.7168+19C>A rs11752495
NM_001365276.2(TNXB):c.7297G>A (p.Val2433Ile) rs17207902
NM_001365276.2(TNXB):c.8132T>C (p.Ile2711Thr) rs28361051
NM_001365536.1(SCN9A):c.2190G>C (p.Trp730Cys) rs202055175
NM_001365536.1(SCN9A):c.2248A>G (p.Ile750Val) rs182650126
NM_001365536.1(SCN9A):c.2392A>G (p.Met798Val) rs149707354
NM_001365536.1(SCN9A):c.2437A>G (p.Ser813Gly) rs201890240
NM_001365536.1(SCN9A):c.3361C>T (p.Arg1121Trp) rs190664764
NM_001365536.1(SCN9A):c.3767A>G (p.Asn1256Ser) rs141268327
NM_001365536.1(SCN9A):c.3832C>G (p.Leu1278Val) rs180922748
NM_001365536.1(SCN9A):c.554G>A (p.Arg185His) rs73969684
NM_001365536.1(SCN9A):c.5711G>A (p.Arg1904His) rs79805025
NM_001365536.1(SCN9A):c.5779C>T (p.Leu1927Phe) rs111558968
NM_001365536.1(SCN9A):c.684C>G (p.Ile228Met) rs71428908
NM_001365999.1(SZT2):c.4531G>A (p.Val1511Ile) rs76675748
NM_001365999.1(SZT2):c.7562T>C (p.Val2521Ala) rs150113647
NM_001365999.1(SZT2):c.7573G>A (p.Val2525Ile) rs139486476
NM_001367624.1(ZNF469):c.10795G>T (p.Ala3599Ser) rs199760004
NM_001367624.1(ZNF469):c.2407G>T (p.Ala803Ser) rs113484918
NM_001367624.1(ZNF469):c.5087C>T (p.Pro1696Leu) rs115487796
NM_001367721.1(CASK):c.2297G>A (p.Arg766Gln) rs137964936
NM_001368809.2(AMPD2):c.1081-8C>A rs145268448
NM_001369.2(DNAH5):c.13338+16C>T rs115271897
NM_001369.2(DNAH5):c.299G>C (p.Gly100Ala) rs144236383
NM_001369.2(DNAH5):c.6579+20G>A rs115382993
NM_001369.2(DNAH5):c.6703T>G (p.Leu2235Val) rs115109673
NM_001369.2(DNAH5):c.6919G>A (p.Val2307Ile) rs74604638
NM_001369268.1(ACAN):c.230G>A (p.Arg77His) rs199701329
NM_001369268.1(ACAN):c.7189G>A (p.Val2397Ile) rs150555123
NM_001370466.1(NOD2):c.2183C>T (p.Ala728Val) rs61747625
NM_001370595.1(COA8):c.224A>G (p.Asn75Ser) rs35960830
NM_001370658.1(BTD):c.820A>G (p.Ile274Val) rs35976361
NM_001374258.1(BRAF):c.78G>T (p.Glu26Asp) rs371877084
NM_001374353.1(GLI2):c.3298G>T (p.Val1100Leu) rs147580961
NM_001374353.1(GLI2):c.3539G>A (p.Gly1180Asp) rs114823319
NM_001374353.1(GLI2):c.803C>T (p.Ala268Val) rs146992756
NM_001374828.1(ARID1B):c.1170CGG[9] (p.Gly402dup) rs587779747
NM_001374828.1(ARID1B):c.1292CAG[4] (p.Ala433dup) rs797045267
NM_001374828.1(ARID1B):c.1303GGC[7] (p.Gly440dup) rs797045268
NM_001374828.1(ARID1B):c.591GCA[8] (p.Gln214dup) rs587779743
NM_001374828.1(ARID1B):c.615GCA[9] (p.Gln213_Gln214dup) rs587779744
NM_001376.5(DYNC1H1):c.11942C>G (p.Thr3981Arg) rs138428684
NM_001377.3(DYNC2H1):c.9044A>G (p.Asp3015Gly) rs137853027
NM_001378454.1(ALMS1):c.10272G>C (p.Lys3424Asn) rs34398445
NM_001378454.1(ALMS1):c.10628C>G (p.Thr3543Ser) rs45501594
NM_001378454.1(ALMS1):c.36GGA[16] (p.Glu26_Glu28dup) rs55889738
NM_001378454.1(ALMS1):c.8835C>G (p.Asn2945Lys) rs35062203
NM_001379500.1(COL18A1):c.2702TTC[1] (p.Leu902del) rs371849586
NM_001397.3(ECE1):c.1385G>A (p.Ser462Asn) rs141146885
NM_001399.5(EDA):c.206G>T (p.Arg69Leu) rs132630309
NM_001440.4(EXTL3):c.1324G>C (p.Val442Leu) rs116659770
NM_001457.4(FLNB):c.1559C>T (p.Pro520Leu) rs138220431
NM_001457.4(FLNB):c.1919C>T (p.Thr640Met) rs62621999
NM_001457.4(FLNB):c.362A>T (p.Tyr121Phe) rs147846832
NM_001478.5(B4GALNT1):c.793G>A (p.Gly265Arg) rs144922627
NM_001482.3(GATM):c.407C>T (p.Thr136Met) rs148564534
NM_001497.3(B4GALT1):c.1064+5A>T rs182359666
NM_001543.5(NDST1):c.1970+10C>T rs75978931
NM_001605.2(AARS1):c.2185C>T (p.Arg729Trp) rs138081804
NM_001605.2(AARS1):c.2459A>G (p.Lys820Arg) rs147319762
NM_001605.2(AARS1):c.64G>A (p.Glu22Lys) rs151091410
NM_001611.5(ACP5):c.814C>T (p.Arg272Cys) rs147025508
NM_001614.5(ACTG1):c.123+8G>A rs536476533
NM_001625.4(AK2):c.625G>A (p.Ala209Thr) rs12116440
NM_001670.3(ARVCF):c.1616G>A (p.Arg539Gln) rs16982871
NM_001673.5(ASNS):c.829G>A (p.Ala277Thr) rs2070159
NM_001698.2(AUH):c.182C>A (p.Pro61His) rs181327211
NM_001698.2(AUH):c.20C>T (p.Ala7Val) rs863223911
NM_001737.5(C9):c.379G>T (p.Asp127Tyr) rs696763
NM_001759.4(CCND2):c.785G>A (p.Arg262His) rs142170178
NM_001813.3(CENPE):c.4204A>G (p.Ile1402Val) rs35505100
NM_001813.3(CENPE):c.6974C>G (p.Ser2325Cys) rs61751592
NM_001830.4(CLCN4):c.244+4C>G rs192492405
NM_001844.5(COL2A1):c.3151G>A (p.Ala1051Thr) rs41272041
NM_001845.6(COL4A1):c.3326-13dup rs139122216
NM_001845.6(COL4A1):c.3776C>G (p.Pro1259Arg) rs146329532
NM_001845.6(COL4A1):c.3949+10C>T rs188122235
NM_001848.2(COL6A1):c.1182+3G>A rs62215499
NM_001848.2(COL6A1):c.2042T>C (p.Ile681Thr) rs138884734
NM_001848.2(COL6A1):c.2424G>T (p.Gln808His) rs140547835
NM_001848.2(COL6A1):c.2809A>G (p.Lys937Glu) rs117583120
NM_001849.3(COL6A2):c.2983G>A (p.Ala995Thr) rs35139588
NM_001849.3(COL6A2):c.316G>A (p.Glu106Lys) rs141703710
NM_001849.3(COL6A2):c.832G>A (p.Glu278Lys) rs61735835
NM_001849.4(COL6A2):c.1970-9G>A rs747900252
NM_001849.4(COL6A2):c.2351G>A (p.Arg784His) rs75120695
NM_001852.4(COL9A2):c.364-16A>G rs1979785
NM_001854.4(COL11A1):c.2556+92T>A rs550991929
NM_001854.4(COL11A1):c.328G>C (p.Gly110Arg) rs141978499
NM_001875.5(CPS1):c.3141+15del rs577707531
NM_001875.5(CPS1):c.3355G>A (p.Ala1119Thr) rs76340296
NM_001909.5(CTSD):c.844G>A (p.Gly282Arg) rs147278302
NM_001916.5(CYC1):c.227T>C (p.Met76Thr) rs144257411
NM_001918.4(DBT):c.724T>C (p.Ser242Pro) rs146249007
NM_001943.5(DSG2):c.3209C>T (p.Thr1070Met) rs149617776
NM_001953.4(TYMP):c.929-6_929-3del rs201685922
NM_001953.5(TYMP):c.1127G>A (p.Arg376Gln) rs765007158
NM_001953.5(TYMP):c.242G>A (p.Arg81Gln) rs143789597
NM_001963.6(EGF):c.3127C>T (p.Leu1043Phe) rs11569098
NM_001972.4(ELANE):c.170C>T (p.Ala57Val) rs1057520110
NM_001972.4(ELANE):c.770C>T (p.Pro257Leu) rs17216663
NM_001983.4(ERCC1):c.*863T>C rs3212989
NM_001985.3(ETFB):c.58-96G>A rs140608276
NM_001999.4(FBN2):c.1040G>A (p.Arg347His) rs112428886
NM_001999.4(FBN2):c.7181T>C (p.Ile2394Thr) rs28763926
NM_001999.4(FBN2):c.728T>C (p.Ile243Thr) rs117524265
NM_001999.4(FBN2):c.829G>A (p.Val277Ile) rs146849637
NM_002047.4(GARS1):c.1163G>A (p.Arg388Gln) rs17159287
NM_002055.5(GFAP):c.140C>T (p.Pro47Leu) rs57474185
NM_002087.4(GRN):c.1297C>T (p.Arg433Trp) rs63750412
NM_002160.4(TNC):c.2620A>G (p.Ile874Val) rs61737743
NM_002161.5(IARS1):c.3136G>A (p.Val1046Ile) rs34737051
NM_002180.2(IGHMBP2):c.548-10T>G rs139207271
NM_002206.3(ITGA7):c.1281+13G>A rs143895796
NM_002206.3(ITGA7):c.1609C>T (p.Arg537Trp) rs61733050
NM_002206.3(ITGA7):c.2701A>G (p.Ile901Val) rs113651939
NM_002206.3(ITGA7):c.459C>G (p.Ile153Met) rs149000088
NM_002206.3(ITGA7):c.46T>G (p.Cys16Gly) rs142060614
NM_002222.6(ITPR1):c.1435G>A (p.Val479Ile) rs41289628
NM_002222.6(ITPR1):c.4191C>G (p.His1397Gln) rs61757110
NM_002222.6(ITPR1):c.5432T>G (p.Val1811Gly) rs143093165
NM_002230.4(JUP):c.1942G>A (p.Val648Ile) rs143043662
NM_002291.3(LAMB1):c.2542G>C (p.Ala848Pro) rs145746791
NM_002291.3(LAMB1):c.3124G>A (p.Gly1042Ser) rs149204722
NM_002294.3(LAMP2):c.1093+2514G>A rs144140265
NM_002296.4(LBR):c.1609T>G (p.Ser537Ala) rs80299691
NM_002317.7(LOX):c.476C>A (p.Pro159Gln) rs41407546
NM_002351.4(SH2D1A):c.48C>T (p.Gly16=) rs72610640
NM_002435.3(MPI):c.982C>T (p.Arg328Trp) rs117089191
NM_002454.3(MTRR):c.1982A>G (p.His661Arg) rs148909799
NM_002470.4(MYH3):c.3592G>A (p.Ala1198Thr) rs61735358
NM_002470.4(MYH3):c.3938C>T (p.Thr1313Ile) rs35230241
NM_002471.4(MYH6):c.3883G>C (p.Glu1295Gln) rs34935550
NM_002472.3(MYH8):c.5513A>C (p.Glu1838Ala) rs111567318
NM_002485.4(NBN):c.1882G>A (p.Glu628Lys) rs115321485
NM_002487.3(NDN):c.953T>C (p.Val318Ala) rs114077338
NM_002488.4(NDUFA2):c.40C>G (p.Leu14Val) rs35672074
NM_002547.3(OPHN1):c.133G>A (p.Ala45Thr) rs148262378
NM_002547.3(OPHN1):c.2029C>A (p.Leu677Met) rs143713841
NM_002547.3(OPHN1):c.2079G>A (p.Met693Ile) rs36095561
NM_002609.4(PDGFRB):c.1033C>T (p.Pro345Ser) rs2229558
NM_002609.4(PDGFRB):c.946G>A (p.Val316Met) rs41287112
NM_002618.4(PEX13):c.674A>G (p.Asp225Gly) rs116059308
NM_002661.5(PLCG2):c.1565C>G (p.Pro522Arg) rs72824905
NM_002693.2(POLG):c.1156C>T (p.Arg386Cys) rs199759055
NM_002693.2(POLG):c.2492A>G (p.Tyr831Cys) rs41549716
NM_002693.2(POLG):c.2554C>T rs144500145
NM_002693.2(POLG):c.264C>T (p.Phe88=) rs144439703
NM_002693.2(POLG):c.3139C>T (p.Arg1047Trp) rs181860632
NM_002693.2(POLG):c.803G>C (p.Gly268Ala) rs61752784
NM_002693.3(POLG):c.119GGC[4] (p.Arg42dup) rs761080016
NM_002693.3(POLG):c.126GCA[13] (p.Gln54_Gln55dup) rs41550117
NM_002693.3(POLG):c.126GCA[14] (p.Gln53_Gln55dup) rs41550117
NM_002693.3(POLG):c.2209G>C (p.Gly737Arg) rs121918054
NM_002693.3(POLG):c.830A>T (p.His277Leu) rs138929605
NM_002693.3(POLG):c.948G>A (p.Lys316=) rs61756401
NM_002742.3(PRKD1):c.2422A>G (p.Ile808Val) rs139355024
NM_002834.5(PTPN11):c.1658C>T (p.Thr553Met) rs148176616
NM_002834.5(PTPN11):c.526-8C>A rs184804143
NM_002855.5(NECTIN1):c.988G>A (p.Glu330Lys) rs150553818
NM_002857.3(PEX19):c.771+3A>G rs141133579
NM_002857.3(PEX19):c.879T>C (p.Gly293=) rs74125561
NM_002894.3(RBBP8):c.1071A>C (p.Lys357Asn) rs34678569
NM_002968.2(SALL1):c.379G>C (p.Val127Leu) rs138635817
NM_002968.2(SALL1):c.809C>T (p.Pro270Leu) rs140827311
NM_002972.4(SBF1):c.2127+4C>T rs151027707
NM_003000.3(SDHB):c.170A>G (p.His57Arg) rs35962811
NM_003000.3(SDHB):c.423+20T>A rs190139590
NM_003000.3(SDHB):c.8C>G (p.Ala3Gly) rs11203289
NM_003002.4(SDHD):c.149A>G (p.His50Arg) rs11214077
NM_003036.4(SKI):c.1163C>T (p.Ala388Val) rs75280988
NM_003042.4(SLC6A1):c.1243C>A (p.Leu415Ile) rs112095333
NM_003060.4(SLC22A5):c.1345T>G (p.Tyr449Asp) rs11568514
NM_003060.4(SLC22A5):c.136C>T (p.Pro46Ser) rs202088921
NM_003108.4(SOX11):c.1039AGCGGCAGCAGC[1] (p.347SGSS[1]) rs751221446
NM_003108.4(SOX11):c.1039AGCGGCAGCAGC[3] (p.347SGSS[3]) rs751221446
NM_003122.4(SPINK1):c.88-23A>T rs199929811
NM_003124.5(SPR):c.112G>A (p.Val38Ile) rs146099322
NM_003126.4(SPTA1):c.6559A>G (p.Lys2187Glu) rs111980420
NM_003156.3(STIM1):c.1571C>T (p.Ser524Phe) rs141215990
NM_003165.4(STXBP1):c.1351G>A (p.Val451Ile) rs150259704
NM_003193.5(TBCE):c.100+13TG[17] rs10524346
NM_003193.5(TBCE):c.253A>G (p.Ile85Val) rs143886167
NM_003193.5(TBCE):c.998G>C (p.Ser333Thr) rs35579976
NM_003235.5(TG):c.7755-9T>G rs190979363
NM_003239.4(TGFB3):c.898C>T (p.Arg300Trp) rs796051885
NM_003413.4(ZIC3):c.649C>G (p.Pro217Ala) rs104894963
NM_003476.5(CSRP3):c.299G>A (p.Arg100His) rs138218523
NM_003477.3(PDHX):c.976G>C (p.Val326Leu) rs35560997
NM_003482.3(KMT2D):c.10256A>G (p.Asp3419Gly) rs146044282
NM_003482.3(KMT2D):c.10993C>G (p.Pro3665Ala) rs112170602
NM_003482.3(KMT2D):c.12524C>A (p.Pro4175Gln) rs200315963
NM_003482.3(KMT2D):c.12913G>A (p.Val4305Ile) rs199895011
NM_003482.3(KMT2D):c.13045C>G (p.Pro4349Ala) rs181733689
NM_003482.3(KMT2D):c.2074C>A (p.Pro692Thr) rs202076833
NM_003482.3(KMT2D):c.3572C>T (p.Pro1191Leu) rs112236653
NM_003482.3(KMT2D):c.6629C>T (p.Pro2210Leu) rs201190869
NM_003482.4(KMT2D):c.15088C>T rs1555185875
NM_003502.4(AXIN1):c.2186+7C>T rs189357878
NM_003560.4(PLA2G6):c.898G>A (p.Ala300Thr) rs528966598
NM_003590.5(CUL3):c.173A>G (p.Tyr58Cys) rs1553535841
NM_003611.3(OFD1):c.2060C>T (p.Pro687Leu) rs146251034
NM_003619.4(PRSS12):c.1270G>A (p.Val424Ile) rs77322543
NM_003619.4(PRSS12):c.28C>G (p.Leu10Val) rs143520192
NM_003640.5(ELP1):c.2543C>A (p.Thr848Asn) rs10979599
NM_003718.5(CDK13):c.1066C>G (p.Pro356Ala) rs17537669
NM_003722.5(TP63):c.192-9_192-8del rs794727498
NM_003730.6(RNASET2):c.643G>A (p.Glu215Lys) rs41269593
NM_003737.4(DCHS1):c.1245C>A (p.Ser415Arg) rs117368891
NM_003737.4(DCHS1):c.1546G>A (p.Ala516Thr) rs142972252
NM_003737.4(DCHS1):c.379G>A (p.Val127Ile) rs112402535
NM_003737.4(DCHS1):c.4555C>T (p.Pro1519Ser) rs199544459
NM_003737.4(DCHS1):c.8758G>A (p.Val2920Met) rs115534913
NM_003742.4(ABCB11):c.127G>A (p.Val43Ile) rs183406496
NM_003742.4(ABCB11):c.2093G>A (p.Arg698His) rs138642043
NM_003742.4(ABCB11):c.2594C>T (p.Ala865Val) rs118109635
NM_003793.4(CTSF):c.1261C>T (p.Arg421Trp) rs28464796
NM_003829.4(MPDZ):c.1041G>C (p.Leu347Phe) rs34911705
NM_003829.4(MPDZ):c.1990T>C (p.Phe664Leu) rs149169783
NM_003829.4(MPDZ):c.3582T>G (p.Ser1194Arg) rs188840960
NM_003850.2(SUCLA2):c.256A>G (p.Ile86Val) rs61756204
NM_003850.2(SUCLA2):c.811A>G (p.Met271Val) rs142020748
NM_003922.4(HERC1):c.11036G>A (p.Arg3679His) rs143508709
NM_003922.4(HERC1):c.3374G>A (p.Gly1125Asp) rs80203202
NM_003922.4(HERC1):c.4714T>G (p.Ser1572Ala) rs16947363
NM_003998.4(NFKB1):c.1519A>G (p.Met507Val) rs4648072
NM_004006.2(DMD):c.10087-20C>T rs41303187
NM_004006.2(DMD):c.1554T>A (p.Asp518Glu) rs61733587
NM_004006.2(DMD):c.1666G>A (p.Asp556Asn) rs182708940
NM_004006.2(DMD):c.1934A>G (p.Asp645Gly) rs147822019
NM_004006.3(DMD):c.2143A>T (p.Thr715Ser) rs16998350
NM_004006.3(DMD):c.5182C>T (p.Arg1728Cys) rs34102501
NM_004044.7(ATIC):c.1234G>A (p.Glu412Lys) rs141872658
NM_004044.7(ATIC):c.1670C>T (p.Ala557Val) rs76436141
NM_004046.6(ATP5F1A):c.25G>A (p.Ala9Thr) rs141639003
NM_004082.4(DCTN1):c.3699+16G>A rs747490958
NM_004104.5(FASN):c.2155G>A (p.Glu719Lys) rs12946178
NM_004153.4(ORC1):c.57G>C (p.Arg19Ser) rs3087473
NM_004168.4(SDHA):c.17G>A (p.Gly6Asp) rs187964306
NM_004168.4(SDHA):c.550G>A (p.Gly184Arg) rs148246073
NM_004208.4(AIFM1):c.452G>A (p.Arg151Gln) rs752742151
NM_004239.4(TRIP11):c.2134G>A (p.Glu712Lys) rs143524436
NM_004247.4(EFTUD2):c.1058+3_1058+7del rs536749831
NM_004260.3(RECQL4):c.161A>G (p.Gln54Arg) rs35198096
NM_004260.3(RECQL4):c.1879-15C>A rs35126141
NM_004278.4(PIGL):c.424C>A (p.Leu142Met) rs115958467
NM_004278.4(PIGL):c.500T>C (p.Leu167Pro) rs145303331
NM_004281.4(BAG3):c.1138C>T (p.Pro380Ser) rs144692954
NM_004281.4(BAG3):c.280A>T (p.Ile94Phe) rs145393807
NM_004321.7(KIF1A):c.2782G>A (p.Val928Met) rs183359489
NM_004321.7(KIF1A):c.4301C>T (p.Ala1434Val) rs141441058
NM_004321.7(KIF1A):c.4718+16C>T rs138847355
NM_004360.5(CDH1):c.1774G>A (p.Ala592Thr) rs35187787
NM_004366.6(CLCN2):c.143C>G (p.Pro48Arg) rs115661422
NM_004366.6(CLCN2):c.1981T>A (p.Ser661Thr) rs115380062
NM_004366.6(CLCN2):c.2173C>T (p.Arg725Trp) rs114702742
NM_004366.6(CLCN2):c.2271+8T>G rs114350071
NM_004366.6(CLCN2):c.2415+4_2415+5dup rs146494980
NM_004369.3(COL6A3):c.1786G>T (p.Ala596Ser) rs34934127
NM_004369.3(COL6A3):c.1791C>T (p.Phe597=) rs76576170
NM_004369.3(COL6A3):c.4184G>A (p.Arg1395Gln) rs80272723
NM_004369.3(COL6A3):c.4285+9G>A rs75780727
NM_004369.3(COL6A3):c.5610C>A (p.Ser1870Arg) rs113153193
NM_004369.3(COL6A3):c.9524T>C (p.Met3175Thr) rs148183839
NM_004369.4(COL6A3):c.4156G>A rs146092501
NM_004369.4(COL6A3):c.5261A>G (p.Lys1754Arg) rs77632596
NM_004370.6(COL12A1):c.8237T>C (p.Val2746Ala) rs34369939
NM_004380.3(CREBBP):c.1651C>A (p.Leu551Ile) rs61753381
NM_004380.3(CREBBP):c.2678C>T (p.Ser893Leu) rs142047649
NM_004380.3(CREBBP):c.2728A>G (p.Thr910Ala) rs143247685
NM_004380.3(CREBBP):c.5719G>A (p.Ala1907Thr) rs199990883
NM_004387.4(NKX2-5):c.61G>C (p.Glu21Gln) rs104893904
NM_004393.6(DAG1):c.259A>G (p.Ile87Val) rs116717961
NM_004408.4(DNM1):c.1894-18G>T rs116335289
NM_004408.4(DNM1):c.1905+17C>T rs115623280
NM_004415.4(DSP):c.*9T>A rs11558732
NM_004415.4(DSP):c.2723G>A (p.Arg908His) rs142494121
NM_004415.4(DSP):c.2815G>A (p.Gly939Ser) rs80325569
NM_004415.4(DSP):c.4141A>T (p.Thr1381Ser) rs77758574
NM_004415.4(DSP):c.4609C>T (p.Arg1537Cys) rs28763967
NM_004415.4(DSP):c.6208G>A (p.Asp2070Asn) rs41302885
NM_004425.4(ECM1):c.1083+10C>T rs55770822
NM_004425.4(ECM1):c.1100A>T (p.Asp367Val) rs151102225
NM_004456.4(EZH2):c.2028T>C (p.Asn676=) rs115842196
NM_004463.3(FGD1):c.395G>A (p.Arg132Gln) rs145644275
NM_004463.3(FGD1):c.676G>A (p.Ala226Thr) rs138723423
NM_004463.3(FGD1):c.935C>T (p.Pro312Leu) rs28935498
NM_004484.3(GPC3):c.826G>A (p.Gly276Ser) rs141100113
NM_004525.3(LRP2):c.10403C>T (p.Pro3468Leu) rs143367996
NM_004525.3(LRP2):c.10804G>A (p.Ala3602Thr) rs144081819
NM_004525.3(LRP2):c.11092G>A (p.Val3698Met) rs34355135
NM_004525.3(LRP2):c.1167T>G (p.Asp389Glu) rs111704488
NM_004525.3(LRP2):c.11759-5T>G rs76488092
NM_004525.3(LRP2):c.13610A>C (p.Gln4537Pro) rs188918037
NM_004525.3(LRP2):c.149C>G (p.Thr50Ser) rs114460450
NM_004525.3(LRP2):c.5293G>A (p.Val1765Met) rs116456291
NM_004541.4(NDUFA1):c.94G>C (p.Gly32Arg) rs1801316
NM_004544.4(NDUFA10):c.1000-10del rs863224081
NM_004544.4(NDUFA10):c.712G>A (p.Glu238Lys) rs35462421
NM_004550.4(NDUFS2):c.968G>A (p.Arg323Gln) rs35086265
NM_004560.4(ROR2):c.2805C>G (p.Asp935Glu) rs41277835
NM_004562.3(PRKN):c.719C>T (p.Thr240Met) rs137853054
NM_004589.4(SCO1):c.16C>G (p.Leu6Val) rs61753148
NM_004606.5(TAF1):c.830AGG[3] (p.Glu278dup) rs773753966
NM_004629.1(FANCG):c.890C>T (p.Thr297Ile) rs2237857
NM_004667.5(HERC2):c.10274C>T (p.Pro3425Leu) rs147705404
NM_004733.4(SLC33A1):c.1525G>A (p.Gly509Ser) rs76440173
NM_004737.6(LARGE1):c.1548C>T (p.Tyr516=) rs34292743
NM_004738.5(VAPB):c.656G>T (p.Gly219Val) rs786205553
NM_004782.4(SNAP29):c.265G>A (p.Glu89Lys) rs151146863
NM_004793.4(LONP1):c.727AAG[1] (p.Lys244del) rs560898148
NM_004826.4(ECEL1):c.967-7C>G rs76735188
NM_004836.7(EIF2AK3):c.1697A>T (p.Asp566Val) rs55791823
NM_004836.7(EIF2AK3):c.1756A>T (p.Ile586Leu) rs75385605
NM_004836.7(EIF2AK3):c.2014G>A (p.Glu672Lys) rs35226268
NM_004840.3(ARHGEF6):c.891G>T (p.Gln297His) rs5974620
NM_004863.3(SPTLC2):c.1664C>T (p.Thr555Met) rs138652708
NM_004895.4(NLRP3):c.403+7G>A rs192297357
NM_004895.4(NLRP3):c.598G>A (p.Val200Met) rs121908147
NM_004933.3(CDH15):c.1876C>T (p.Leu626Phe) rs78261372
NM_004937.3(CTNS):c.124G>A (p.Val42Ile) rs35086888
NM_004984.4(KIF5A):c.820-19G>T rs181688415
NM_004985.5(KRAS):c.528GAA[1] (p.Lys180del) rs397517043
NM_004992.3(MECP2):c.378-17del rs61753982
NM_005006.7(NDUFS1):c.1291C>G (p.Leu431Val) rs78042826
NM_005045.4(RELN):c.1290-11dup rs146986040
NM_005045.4(RELN):c.2932A>G (p.Thr978Ala) rs3025962
NM_005045.4(RELN):c.5108C>G (p.Pro1703Arg) rs2229860
NM_005045.4(RELN):c.5156C>T (p.Ser1719Leu) rs115913736
NM_005045.4(RELN):c.5618C>T (p.Thr1873Ile) rs41275239
NM_005045.4(RELN):c.5923G>A (p.Gly1975Ser) rs114807343
NM_005045.4(RELN):c.6343G>A (p.Gly2115Ser) rs116716038
NM_005045.4(RELN):c.8086G>A (p.Ala2696Thr) rs115640958
NM_005045.4(RELN):c.9730G>A (p.Gly3244Ser) rs73714410
NM_005050.4(ABCD4):c.1736G>A (p.Arg579Gln) rs143288344
NM_005120.3(MED12):c.1248+15T>C rs187377817
NM_005120.3(MED12):c.5650G>A (p.Gly1884Ser) rs147354926
NM_005120.3(MED12):c.5711C>T (p.Ala1904Val) rs200663107
NM_005188.3(CBL):c.2036+9G>T rs142704935
NM_005188.4(CBL):c.107ACC[8] (p.His42dup) rs373212940
NM_005188.4(CBL):c.2269G>A (p.Ala757Thr) rs146517083
NM_005188.4(CBL):c.2710G>A (p.Val904Ile) rs17122769
NM_005198.4(CHKB):c.983A>G (p.Gln328Arg) rs141381896
NM_005199.5(CHRNG):c.1115C>T (p.Ser372Phe) rs145433186
NM_005199.5(CHRNG):c.125G>A (p.Arg42Gln) rs148468628
NM_005199.5(CHRNG):c.1516C>T (p.Pro506Ser) rs71421651
NM_005219.5(DIAPH1):c.1423G>A (p.Glu475Lys) rs193036129
NM_005219.5(DIAPH1):c.1821TCC[12] (p.Pro620dup) rs3075570
NM_005219.5(DIAPH1):c.1821TCC[13] (p.Pro619_Pro620dup) rs3075570
NM_005236.2(ERCC4):c.1135C>T (p.Pro379Ser) rs1799802
NM_005236.2(ERCC4):c.2617A>G (p.Ile873Val) rs2020957
NM_005236.2(ERCC4):c.2624A>G (p.Glu875Gly) rs1800124
NM_005249.5(FOXG1):c.1045T>G (p.Ser349Ala) rs796052472
NM_005327.5(HADH):c.275T>G (p.Phe92Cys) rs61735992
NM_005334.3(HCFC1):c.3794C>T (p.Ser1265Leu) rs189548179
NM_005334.3(HCFC1):c.4159G>A (p.Val1387Met) rs200164926
NM_005334.3(HCFC1):c.5418G>A (p.Met1806Ile) rs199511876
NM_005445.3(SMC3):c.1092-8T>G rs79912955
NM_005450.6(NOG):c.275G>A (p.Gly92Glu) rs199566527
NM_005476.7(GNE):c.2086G>T (p.Val696Leu) rs121908627
NM_005529.7(HSPG2):c.10702G>A (p.Val3568Ile) rs115616224
NM_005529.7(HSPG2):c.12004C>G (p.Leu4002Val) rs140403186
NM_005529.7(HSPG2):c.9719C>T (p.Ala3240Val) rs62642505
NM_005559.4(LAMA1):c.2657C>T (p.Ala886Val) rs144738522
NM_005559.4(LAMA1):c.5660+7A>G rs144775658
NM_005559.4(LAMA1):c.5867A>G (p.Asn1956Ser) rs117433399
NM_005592.4(MUSK):c.1931T>C (p.Val644Ala) rs41279055
NM_005592.4(MUSK):c.398T>C (p.Ile133Thr) rs55980069
NM_005603.6(ATP8B1):c.1739G>A (p.Ser580Asn) rs33963153
NM_005619.5(RTN2):c.1168G>A (p.Gly390Ser) rs143937661
NM_005629.4(SLC6A8):c.1141+18G>A rs187400676
NM_005631.5(SMO):c.1939C>T (p.Pro647Ser) rs34545616
NM_005633.3(SOS1):c.1074+5G>C rs145155424
NM_005633.3(SOS1):c.2167+6T>G rs186640807
NM_005633.3(SOS1):c.749T>C (p.Val250Ala) rs139290271
NM_005634.2(SOX3):c.14G>A (p.Arg5Gln) rs112180170
NM_005670.4(EPM2A):c.680C>T (p.Ala227Val) rs147399860
NM_005726.6(TSFM):c.539G>C (p.Gly180Ala) rs138534976
NM_005726.6(TSFM):c.754G>A (p.Val252Ile) rs114694283
NM_005726.6(TSFM):c.796C>A (p.Leu266Ile) rs62000432
NM_005732.4(RAD50):c.3036+5G>A rs181016343
NM_005732.4(RAD50):c.572C>T (p.Thr191Ile) rs2230017
NM_005751.4(AKAP9):c.8485G>A (p.Glu2829Lys) rs149946443
NM_005763.4(AASS):c.1678C>T (p.Pro560Ser) rs74882337
NM_005802.5(TOPORS):c.74C>G (p.Ser25Trp) rs61758066
NM_005883.2(APC2):c.971C>T (p.Thr324Ile) rs201709261
NM_005912.3(MC4R):c.751A>C (p.Ile251Leu) rs52820871
NM_006005.3(WFS1):c.2335G>A (p.Val779Met) rs141328044
NM_006005.3(WFS1):c.2611G>A (p.Val871Met) rs71532874
NM_006005.3(WFS1):c.577A>C (p.Lys193Gln) rs41264699
NM_006005.3(WFS1):c.712+16G>A rs71524367
NM_006015.6(ARID1A):c.2123A>C (p.Gln708Pro) rs367889013
NM_006015.6(ARID1A):c.3978GCA[9] (p.Gln1334dup) rs374564889
NM_006015.6(ARID1A):c.5717G>A (p.Arg1906Gln) rs41303631
NM_006019.4(TCIRG1):c.1249G>A (p.Ala417Thr) rs140963213
NM_006031.6(PCNT):c.4285C>T (p.Arg1429Cys) rs62224222
NM_006031.6(PCNT):c.5771C>T (p.Ala1924Val) rs184420466
NM_006031.6(PCNT):c.6634C>T (p.Arg2212Trp) rs144471022
NM_006031.6(PCNT):c.7159G>A (p.Val2387Met) rs75024419
NM_006031.6(PCNT):c.7404G>C (p.Gln2468His) rs77075366
NM_006031.6(PCNT):c.8671G>A (p.Ala2891Thr) rs33956783
NM_006059.4(LAMC3):c.146A>G (p.Gln49Arg) rs201962705
NM_006059.4(LAMC3):c.1630+5C>G rs184221540
NM_006059.4(LAMC3):c.1792G>A (p.Gly598Arg) rs116422150
NM_006059.4(LAMC3):c.2039C>T (p.Thr680Met) rs73658916
NM_006059.4(LAMC3):c.2438G>A (p.Ser813Asn) rs55741126
NM_006059.4(LAMC3):c.2439C>G (p.Ser813Arg) rs61637370
NM_006059.4(LAMC3):c.2516C>T (p.Thr839Met) rs57816762
NM_006059.4(LAMC3):c.3250G>C (p.Glu1084Gln) rs146221263
NM_006059.4(LAMC3):c.3379G>A (p.Glu1127Lys) rs140955110
NM_006059.4(LAMC3):c.42_50dup (p.Pro15_Ala17dup) rs1057520165
NM_006059.4(LAMC3):c.4348C>T (p.Arg1450Cys) rs201785610
NM_006063.3(KLHL41):c.1441A>G (p.Met481Val) rs34623017
NM_006129.5(BMP1):c.2234-20C>T rs142089697
NM_006182.4(DDR2):c.1382C>T (p.Ser461Leu) rs140710321
NM_006192.5(PAX1):c.1520C>T (p.Pro507Leu) rs138641387
NM_006231.3(POLE):c.16G>C (p.Gly6Arg) rs202220778
NM_006231.3(POLE):c.2089C>T (p.Pro697Ser) rs5744800
NM_006231.3(POLE):c.776G>A (p.Arg259His) rs61732929
NM_006267.5(RANBP2):c.3226T>G (p.Leu1076Val) rs142768885
NM_006267.5(RANBP2):c.7751A>G (p.Asp2584Gly) rs138022657
NM_006302.3(MOGS):c.1838G>A (p.Arg613Gln) rs142032474
NM_006331.8(EMG1):c.38G>T (p.Arg13Leu) rs36061201
NM_006348.5(COG5):c.1247A>G (p.Tyr416Cys) rs41276187
NM_006359.3(SLC9A6):c.1607G>A (p.Arg536Gln) rs146263125
NM_006359.3(SLC9A6):c.25G>T (p.Ala9Ser) rs201523857
NM_006416.5(SLC35A1):c.133A>G (p.Thr45Ala) rs145006535
NM_006416.5(SLC35A1):c.19A>C (p.Asn7His) rs114156788
NM_006416.5(SLC35A1):c.7G>T (p.Ala3Ser) rs149903512
NM_006420.3(ARFGEF2):c.169C>T (p.Pro57Ser) rs73113975
NM_006432.4(NPC2):c.441+1G>A rs140130028
NM_006493.2(CLN5):c.49G>C (p.Gly17Arg) rs202118652
NM_006493.4(CLN5):c.-87C>T rs200353554
NM_006495.4(EVI2B):c.157G>A (p.Gly53Arg) rs9903564
NM_006495.4(EVI2B):c.758G>T (p.Cys253Phe) rs115271229
NM_006517.5(SLC16A2):c.412C>G (p.Gln138Glu) rs145061343
NM_006565.4(CTCF):c.1927C>T (p.Pro643Ser) rs145727304
NM_006612.6(KIF1C):c.1165+4G>A rs192489748
NM_006662.3(SRCAP):c.1559G>A (p.Ser520Asn) rs139339184
NM_006662.3(SRCAP):c.3302C>A (p.Thr1101Lys) rs149248373
NM_006662.3(SRCAP):c.3868A>G (p.Ser1290Gly) rs150246733
NM_006662.3(SRCAP):c.4603C>G (p.Pro1535Ala) rs117804715
NM_006662.3(SRCAP):c.6495-8C>A rs75991082
NM_006734.4(HIVEP2):c.1033A>G (p.Ile345Val) rs141050437
NM_006734.4(HIVEP2):c.7036C>T (p.Leu2346Phe) rs117019703
NM_006755.2(TALDO1):c.962A>G (p.Lys321Arg) rs11302
NM_006765.4(TUSC3):c.193A>G (p.Ile65Val) rs11545035
NM_006766.5(KAT6A):c.3859GAG[2] (p.Glu1289del) rs747034971
NM_006766.5(KAT6A):c.4324G>A (p.Ala1442Thr) rs113195648
NM_006766.5(KAT6A):c.5740A>G (p.Met1914Val) rs750315709
NM_006767.4(LZTR1):c.1353+8C>G rs75959644
NM_006904.6(PRKDC):c.10376A>G (p.Asn3459Ser) rs8178228
NM_006939.4(SOS2):c.2014C>A (p.Leu672Ile) rs34139502
NM_006939.4(SOS2):c.3235A>G (p.Thr1079Ala) rs61755576
NM_006939.4(SOS2):c.3755_3757del (p.Ile1252del) rs775506222
NM_006947.4(SRP72):c.20G>C (p.Gly7Ala) rs139502866
NM_006950.3(SYN1):c.1699A>G (p.Thr567Ala) rs200533370
NM_007055.4(POLR3A):c.1724A>T (p.Lys575Met) rs56214655
NM_007055.4(POLR3A):c.1745G>A (p.Arg582His) rs34588967
NM_007055.4(POLR3A):c.2938A>G (p.Ile980Val) rs146253630
NM_007059.4(KPTN):c.188G>A (p.Arg63Gln) rs142867197
NM_007059.4(KPTN):c.631G>C (p.Gly211Arg) rs182019900
NM_007078.3(LDB3):c.690-4823G>A rs121908338
NM_007078.3(LDB3):c.752A>G (p.Lys251Arg) rs34423165
NM_007103.4(NDUFV1):c.1163-12del rs147787116
NM_007117.5(TRH):c.248G>A (p.Arg83His) rs61740106
NM_007118.4(TRIO):c.9110A>T (p.Lys3037Met) rs55900671
NM_007137.3(ZNF81):c.1495A>G (p.Ile499Val) rs182239885
NM_007137.3(ZNF81):c.470A>G (p.Asn157Ser) rs41312157
NM_007198.4(PLPBP):c.70G>A (p.Val24Met) rs35423325
NM_007208.4(MRPL3):c.931G>A (p.Gly311Ser) rs148679749
NM_007215.4(POLG2):c.122G>A (p.Gly41Glu) rs146504115
NM_007215.4(POLG2):c.674G>A (p.Arg225Gln) rs148101254
NM_007215.4(POLG2):c.694G>A (p.Gly232Ser) rs143660836
NM_007254.4(PNKP):c.1189-22_1189-19del rs368832563
NM_007254.4(PNKP):c.416G>A (p.Arg139His) rs34472250
NM_007254.4(PNKP):c.538C>A (p.Arg180Ser) rs3739185
NM_007254.4(PNKP):c.586T>A (p.Tyr196Asn) rs3739186
NM_007286.6(SYNPO):c.814C>T (p.Pro272Ser) rs146345840
NM_007294.4(BRCA1):c.4039A>G (p.Arg1347Gly) rs28897689
NM_007294.4(BRCA1):c.557C>A (p.Ser186Tyr) rs55688530
NM_007325.5(GRIA3):c.397G>A (p.Ala133Thr) rs151086692
NM_007347.5(AP4E1):c.1283A>G (p.Asn428Ser) rs116796602
NM_007347.5(AP4E1):c.2755A>G (p.Met919Val) rs115188375
NM_007374.3(SIX6):c.385G>A (p.Glu129Lys) rs146737847
NM_012188.5(FOXI1):c.308G>C (p.Gly103Ala) rs370450076
NM_012216.4(MID2):c.1074-4del rs758037994
NM_012233.3(RAB3GAP1):c.1006C>T (p.Arg336Cys) rs150478342
NM_012280.4(FTSJ1):c.307C>G (p.Gln103Glu) rs78979358
NM_012330.4(KAT6B):c.4079AAGAGGAAG[4] (p.Glu1366_Glu1368dup) rs375513122
NM_012434.5(SLC17A5):c.1324G>A (p.Val442Ile) rs74360232
NM_012434.5(SLC17A5):c.899C>T (p.Ser300Phe) rs142553916
NM_012452.2(TNFRSF13B):c.310T>C (p.Cys104Arg) rs34557412
NM_012452.2(TNFRSF13B):c.563A>T (p.Lys188Met) rs74811083
NM_012463.4(ATP6V0A2):c.2054G>A (p.Arg685Gln) rs7969410
NM_012472.6(DNAAF11):c.914+13A>G rs113135637
NM_013275.6(ANKRD11):c.2175_2178del (p.Asn725fs) rs886039734
NM_013275.6(ANKRD11):c.5088C>G (p.Asp1696Glu) rs146205997
NM_013275.6(ANKRD11):c.6020C>T (p.Pro2007Leu) rs200531141
NM_013275.6(ANKRD11):c.744+18C>G rs147328392
NM_013296.5(GPSM2):c.1820C>T (p.Ser607Phe) rs35322815
NM_013296.5(GPSM2):c.742del (p.Gly249fs) rs528069912
NM_013335.4(GMPPA):c.40+15G>A rs80239182
NM_013339.4(ALG6):c.751A>G (p.Thr251Ala) rs61755863
NM_014008.5(CCDC22):c.1150C>T (p.Arg384Cys) rs143790434
NM_014008.5(CCDC22):c.1636G>A (p.Asp546Asn) rs147222955
NM_014009.4(FOXP3):c.543C>T (p.Ser181=) rs2232367
NM_014026.6(DCPS):c.677G>A (p.Gly226Asp) rs35836343
NM_014026.6(DCPS):c.791G>A (p.Arg264Gln) rs140377449
NM_014049.5(ACAD9):c.988A>C (p.Lys330Gln) rs79530903
NM_014141.6(CNTNAP2):c.1083G>A (p.Val361=) rs139180845
NM_014141.6(CNTNAP2):c.73G>A (p.Ala25Thr) rs200866893
NM_014159.7(SETD2):c.2251C>A (p.Pro751Thr) rs115788094
NM_014159.7(SETD2):c.2543C>T (p.Ala848Val) rs75248784
NM_014165.4(NDUFAF4):c.40C>A (p.Leu14Ile) rs145392673
NM_014210.4(EVI2A):c.527A>G (p.Gln176Arg) rs144778786
NM_014244.5(ADAMTS2):c.1993G>A (p.Gly665Arg) rs35372714
NM_014249.4(NR2E3):c.951del (p.Thr318fs) rs11351249
NM_014254.3(RXYLT1):c.275C>T (p.Thr92Met) rs73122634
NM_014297.5(ETHE1):c.61G>T (p.Ala21Ser) rs116440799
NM_014314.4(DDX58):c.2317G>A (p.Glu773Lys) rs144181118
NM_014324.6(AMACR):c.554T>C (p.Val185Ala) rs145786819
NM_014336.5(AIPL1):c.1126C>T (p.Pro376Ser) rs61757484
NM_014361.4(CNTN5):c.1047A>T (p.Lys349Asn) rs186615197
NM_014363.6(SACS):c.12649A>G (p.Asn4217Asp) rs35799469
NM_014363.6(SACS):c.4118C>T (p.Ala1373Val) rs61548169
NM_014363.6(SACS):c.8344G>A (p.Ala2782Thr) rs61742502
NM_014363.6(SACS):c.8393C>A (p.Pro2798Gln) rs140551762
NM_014402.5(UQCRQ):c.10G>A (p.Glu4Lys) rs137995316
NM_014444.5(TUBGCP4):c.1746G>T (p.Leu582=) rs200092283
NM_014467.3(SRPX2):c.460C>G (p.His154Asp) rs73636611
NM_014491.3(FOXP2):c.618_620dupGCA (p.Gln209_Leu210insGln)
NM_014495.4(ANGPTL3):c.379C>T (p.Leu127Phe) rs72649573
NM_014639.3(TTC37):c.130G>A (p.Val44Ile) rs114914951
NM_014639.3(TTC37):c.1765G>A (p.Ala589Thr) rs147622709
NM_014639.3(TTC37):c.4187A>G (p.Asn1396Ser) rs116690692
NM_014646.2(LPIN2):c.1801G>A (p.Glu601Lys) rs61735393
NM_014780.4(CUL7):c.1846A>G (p.Ser616Gly) rs7774330
NM_014780.4(CUL7):c.3490C>T (p.Arg1164Trp) rs201135654
NM_014795.4(ZEB2):c.1480C>T (p.Pro494Ser) rs144952836
NM_014795.4(ZEB2):c.2141C>T (p.Pro714Leu) rs112581563
NM_014795.4(ZEB2):c.2255C>T (p.Thr752Met) rs143438888
NM_014804.3(KIAA0753):c.1756A>G (p.Lys586Glu) rs61735441
NM_014804.3(KIAA0753):c.2338C>T (p.Arg780Cys) rs73342622
NM_014804.3(KIAA0753):c.754C>T (p.Arg252Cys) rs141632537
NM_014822.4(SEC24D):c.1042-6C>G rs117971741
NM_014822.4(SEC24D):c.578C>T (p.Pro193Leu) rs6844109
NM_014846.4(WASHC5):c.3319G>A (p.Val1107Met) rs138407503
NM_014874.3(MFN2):c.647T>C (p.Phe216Ser) rs387906990
NM_014875.3(KIF14):c.3808A>C (p.Ser1270Arg) rs75449932
NM_014908.4(DOLK):c.1dup (p.Met1fs) rs531969689
NM_014946.3(SPAST):c.131C>T (p.Ser44Leu) rs121908515
NM_014946.4(SPAST):c.879G>A (p.Pro293=) rs145264166
NM_015046.7(SETX):c.2216G>A (p.Gly739Glu) rs36024203
NM_015046.7(SETX):c.7640T>C (p.Ile2547Thr) rs151117904
NM_015047.3(EMC1):c.719C>T (p.Pro240Leu) rs141614470
NM_015072.5(TTLL5):c.2637A>C (p.Leu879Phe) rs146036604
NM_015074.3(KIF1B):c.1977+6956A>G rs148481786
NM_015074.3(KIF1B):c.5294C>T (p.Pro1765Leu) rs61999305
NM_015102.5(NPHP4):c.1705C>G (p.Gln569Glu) rs113413307
NM_015102.5(NPHP4):c.2914A>G (p.Ser972Gly) rs187947581
NM_015102.5(NPHP4):c.511G>A (p.Ala171Thr) rs113765431
NM_015107.3(PHF8):c.2131G>A (p.Glu711Lys) rs41306749
NM_015107.3(PHF8):c.2720G>A (p.Arg907His) rs142630105
NM_015107.3(PHF8):c.2790CTC[2] (p.Ser933del) rs782660284
NM_015120.4(ALMS1):c.10754A>T (p.Gln3585Leu) rs144486524
NM_015120.4(ALMS1):c.11356A>G (p.Ile3786Val) rs201819880
NM_015120.4(ALMS1):c.11872+18G>A rs139647347
NM_015120.4(ALMS1):c.1270G>A (p.Val424Ile) rs45630557
NM_015120.4(ALMS1):c.2419G>C (p.Val807Leu) rs138921247
NM_015120.4(ALMS1):c.3095C>G (p.Thr1032Ser) rs199922877
NM_015120.4(ALMS1):c.39_77= (p.Glu13_Glu26=) rs55889738
NM_015192.4(PLCB1):c.2191C>G (p.Pro731Ala) rs61755434
NM_015192.4(PLCB1):c.3116T>C (p.Ile1039Thr) rs75820839
NM_015192.4(PLCB1):c.458A>T (p.Glu153Val) rs45496299
NM_015272.5(RPGRIP1L):c.1340T>C (p.Leu447Ser) rs138155747
NM_015272.5(RPGRIP1L):c.2643T>A (p.Asn881Lys) rs139503476
NM_015275.3(WASHC4):c.878G>A (p.Arg293Gln) rs35267264
NM_015294.6(TRIM37):c.398C>T (p.Ala133Val) rs61758100
NM_015311.3(OBSL1):c.3649G>A (p.Glu1217Lys) rs72957510
NM_015311.3(OBSL1):c.3950T>A (p.Leu1317Gln) rs115283876
NM_015330.5(SPECC1L):c.562C>T (p.Leu188Phe) rs56168869
NM_015335.4(MED13L):c.1283A>G (p.His428Arg) rs144410580
NM_015338.5(ASXL1):c.3498C>G (p.Ser1166Arg) rs75887545
NM_015346.4(ZFYVE26):c.2887G>C (p.Val963Leu) rs116890187
NM_015386.3(COG4):c.1759C>A (p.Gln587Lys) rs113455884
NM_015404.4(WHRN):c.229A>T (p.Thr77Ser) rs56204273
NM_015425.6(POLR1A):c.1187G>A (p.Ser396Asn) rs35443467
NM_015531.6(C2CD3):c.3695A>G (p.Asn1232Ser) rs140307393
NM_015548.5(DST):c.22del (p.Tyr8fs) rs775912185
NM_015548.5(DST):c.3319-3641T>C rs141573097
NM_015559.3(SETBP1):c.1483T>A (p.Ser495Thr) rs138515058
NM_015559.3(SETBP1):c.4640C>A (p.Thr1547Asn) rs201973930
NM_015570.4(AUTS2):c.1774C>G (p.Pro592Ala) rs199756061
NM_015570.4(AUTS2):c.3377ACC[9] (p.His1133dup) rs538005366
NM_015631.6(TCTN3):c.1030G>A (p.Gly344Arg) rs141088838
NM_015631.6(TCTN3):c.224C>T (p.Ala75Val) rs41291570
NM_015697.8(COQ2):c.344A>C (p.Asp115Ala) rs375934957
NM_015697.8(COQ2):c.574A>G (p.Thr192Ala) rs144913206
NM_015697.8(COQ2):c.587A>G (p.Asn196Ser) rs150295921
NM_015702.3(MMADHC):c.473G>A (p.Arg158Gln) rs114276563
NM_015702.3(MMADHC):c.87A>C (p.Lys29Asn) rs61750442
NM_015909.4(NBAS):c.1093G>C (p.Asp365His) rs76459791
NM_015910.7(WDPCP):c.1333G>C (p.Ala445Pro) rs61734466
NM_015910.7(WDPCP):c.2063A>G (p.Asn688Ser) rs61734468
NM_015910.7(WDPCP):c.68C>A (p.Pro23Gln) rs141340867
NM_015922.3(NSDHL):c.25A>G (p.Met9Val) rs35529894
NM_015937.6(PIGT):c.367G>T (p.Val123Leu) rs141420243
NM_016006.6(ABHD5):c.341G>T (p.Arg114Leu) rs148743497
NM_016013.4(NDUFAF1):c.708G>A (p.Met236Ile) rs150539399
NM_016111.4(TELO2):c.32C>A (p.Ala11Asp) rs144863771
NM_016138.5(COQ7):c.136C>T (p.Arg46Trp) rs77337400
NM_016169.3(SUFU):c.1018G>T (p.Ala340Ser) rs34135067
NM_016219.5(MAN1B1):c.337T>C (p.Phe113Leu) rs147529965
NM_016219.5(MAN1B1):c.602C>T (p.Pro201Leu) rs73569515
NM_016219.5(MAN1B1):c.794G>A (p.Arg265His) rs114057640
NM_016239.4(MYO15A):c.2238G>T (p.Arg746Ser) rs79760961
NM_016239.4(MYO15A):c.9478C>T (p.Leu3160Phe) rs140029076
NM_016302.3(CRBN):c.88G>A (p.Glu30Lys) rs78564552
NM_016335.5(PRODH):c.1322T>C (p.Leu441Pro) rs2904551
NM_016373.4(WWOX):c.1141C>T (p.Arg381Cys) rs200461412
NM_016373.4(WWOX):c.358C>T (p.Arg120Trp) rs141361080
NM_016373.4(WWOX):c.613C>A (p.His205Asn) rs74860463
NM_016373.4(WWOX):c.816G>T (p.Leu272Phe) rs186745328
NM_016373.4(WWOX):c.835C>T (p.Arg279Cys) rs77314072
NM_016474.5(CCDC174):c.1106-10T>A rs144121914
NM_016513.4(CILK1):c.831+5del rs200780900
NM_016529.6(ATP8A2):c.3075A>G (p.Lys1025=) rs62636611
NM_016553.5(NUP62):c.560C>T (p.Thr187Met) rs140655913
NM_016579.4(CD320):c.256GAG[2] (p.Glu88del) rs150384171
NM_016592.5(GNAS):c.*42+13057T>G rs201332059
NM_016592.5(GNAS):c.*42+14177C>G rs74897360
NM_016824.5(ADD3):c.304T>C (p.Ser102Pro) rs41291886
NM_016953.4(PDE11A):c.2632A>G (p.Met878Val) rs74357545
NM_017429.3(BCO1):c.1622G>A (p.Cys541Tyr) rs141781255
NM_017433.5(MYO3A):c.4465A>G (p.Ile1489Val) rs147376000
NM_017534.6(MYH2):c.5780G>A (p.Arg1927Gln) rs34161789
NM_017636.4(TRPM4):c.2740A>T (p.Lys914Ter) rs140799936
NM_017651.4(AHI1):c.3368C>T rs117447608
NM_017653.5(DYM):c.421A>G (p.Ser141Gly) rs61729806
NM_017654.4(SAMD9):c.995T>C (p.Ile332Thr) rs76377166
NM_017668.3(NDE1):c.572C>T (p.Thr191Ile) rs113493697
NM_017721.5(CC2D1A):c.1234A>G (p.Ile412Val) rs191830054
NM_017721.5(CC2D1A):c.1739C>T (p.Thr580Ile) rs202057391
NM_017721.5(CC2D1A):c.2440G>T (p.Ala814Ser) rs56359259
NM_017721.5(CC2D1A):c.2508G>C (p.Glu836Asp) rs34146052
NM_017721.5(CC2D1A):c.905G>A (p.Arg302Gln) rs73922801
NM_017721.5(CC2D1A):c.980C>T (p.Ser327Leu) rs200121704
NM_017739.3(POMGNT1):c.1324C>T (p.Arg442Cys) rs28940869
NM_017755.6(NSUN2):c.2143G>A (p.Val715Ile) rs112951498
NM_017755.6(NSUN2):c.2300G>A (p.Arg767Gln) rs140673211
NM_017780.4(CHD7):c.1018A>G (p.Met340Val) rs41305525
NM_017780.4(CHD7):c.2053_2058dup (p.Ala685_Lys686dup) rs377139749
NM_017780.4(CHD7):c.2377-3dup rs752271550
NM_017780.4(CHD7):c.2436A>T (p.Lys812Asn) rs61978638
NM_017780.4(CHD7):c.4534-13T>G rs114996731
NM_017802.4(DNAAF5):c.1024+11G>T rs201554395
NM_017819.4(TRMT10C):c.492G>C (p.Lys164Asn) rs16844031
NM_017827.4(SARS2):c.393+149del rs375344827
NM_017837.3(PIGV):c.349A>G (p.Ile117Val) rs142192097
NM_017837.3(PIGV):c.615C>T (p.Asn205=) rs34512715
NM_017838.3(NHP2):c.302G>A (p.Arg101Gln) rs145890370
NM_017866.6(TMEM70):c.684C>G (p.Asn228Lys) rs35564486
NM_017890.4(VPS13B):c.10124C>T (p.Thr3375Ile) rs138127778
NM_017890.4(VPS13B):c.10310C>T (p.Ala3437Val) rs112045467
NM_017890.4(VPS13B):c.1559A>G (p.His520Arg) rs143205296
NM_017890.4(VPS13B):c.2275G>C (p.Val759Leu) rs140848350
NM_017890.4(VPS13B):c.2485G>A (p.Ala829Thr) rs61753721
NM_017890.4(VPS13B):c.2596G>A (p.Val866Ile) rs150185067
NM_017890.4(VPS13B):c.3203C>T (p.Thr1068Ile) rs61753722
NM_017890.4(VPS13B):c.4247G>A (p.Arg1416Gln) rs75933366
NM_017890.4(VPS13B):c.7052G>A (p.Arg2351Gln) rs61754113
NM_017890.4(VPS13B):c.7753G>A (p.Glu2585Lys) rs111751379
NM_017890.4(VPS13B):c.8978A>G (p.Asn2993Ser) rs28940272
NM_017909.4(RMND1):c.668C>T (p.Pro223Leu) rs142521318
NM_017950.4(CCDC40):c.856-18G>A rs189118723
NM_018013.4(SOBP):c.1615A>G (p.Ile539Val) rs146747167
NM_018013.4(SOBP):c.2232GCC[6] (p.Pro751del) rs541688197
NM_018013.4(SOBP):c.319A>G (p.Thr107Ala) rs148915050
NM_018100.4(EFHC1):c.1069G>A (p.Glu357Lys) rs505760
NM_018100.4(EFHC1):c.229C>A (p.Pro77Thr) rs149055334
NM_018100.4(EFHC1):c.475C>G (p.Arg159Gly) rs3804506
NM_018100.4(EFHC1):c.629A>T (p.Asp210Val) rs73740379
NM_018100.4(EFHC1):c.662G>A (p.Arg221His) rs79761183
NM_018100.4(EFHC1):c.685T>C (p.Phe229Leu) rs137852776
NM_018122.5(DARS2):c.1642C>A (p.Leu548Met) rs149660059
NM_018136.5(ASPM):c.223G>A (p.Ala75Thr) rs61995747
NM_018136.5(ASPM):c.4213C>T (p.Arg1405Cys) rs139367209
NM_018136.5(ASPM):c.5741A>G (p.Gln1914Arg) rs113325473
NM_018136.5(ASPM):c.6727G>T (p.Val2243Leu) rs148425392
NM_018136.5(ASPM):c.7787T>C (p.Val2596Ala) rs79572771
NM_018136.5(ASPM):c.9773A>G (p.His3258Arg) rs7528827
NM_018139.2(DNAAF2):c.1367C>T (p.Pro456Leu) rs137991407
NM_018263.6(ASXL2):c.140+186A>G rs138250852
NM_018263.6(ASXL2):c.4111C>A (p.Gln1371Lys) rs115221221
NM_018328.4(MBD5):c.3044A>G (p.Gln1015Arg) rs143028540
NM_018328.4(MBD5):c.3310A>G (p.Ile1104Val) rs115940994
NM_018341.3(ERMARD):c.1162A>G (p.Asn388Asp) rs151283330
NM_018341.3(ERMARD):c.563T>C (p.Val188Ala) rs74451194
NM_018389.5(SLC35C1):c.503_505del (p.Phe168del) rs587777655
NM_018451.5(CENPJ):c.287A>G (p.His96Arg) rs61739263
NM_018684.4(ZC4H2):c.199C>T (p.Arg67Ter) rs1131691616
NM_018706.7(DHTKD1):c.1550C>T (p.Ala517Val) rs142006153
NM_018714.3(COG1):c.1712G>A (p.Arg571Gln) rs141750466
NM_018714.3(COG1):c.401C>T (p.Ser134Leu) rs146066919
NM_018714.3(COG1):c.903G>C (p.Gln301His) rs117208167
NM_018718.3(CEP41):c.1009T>C (p.Ser337Pro) rs147444165
NM_018718.3(CEP41):c.320C>G (p.Ala107Gly) rs141025803
NM_018718.3(CEP41):c.422+7G>A rs190680511
NM_018718.3(CEP41):c.718T>G (p.Cys240Gly) rs113941736
NM_018941.3(CLN8):c.274C>T (p.His92Tyr) rs34030778
NM_018941.3(CLN8):c.685C>G (p.Pro229Ala) rs150047904
NM_018943.3(TUBA8):c.250C>T (p.Arg84Cys) rs115847686
NM_018965.3(TREM2):c.*73G>A rs2234258
NM_018965.3(TREM2):c.185G>A (p.Arg62His) rs143332484
NM_018965.3(TREM2):c.469C>T (p.His157Tyr) rs2234255
NM_019023.5(PRMT7):c.1718G>A (p.Ser573Asn) rs61745807
NM_019066.5(MAGEL2):c.1079C>T (p.Ala360Val) rs111759069
NM_019066.5(MAGEL2):c.1344ACCCGTGATCCGCCAGGCCCC[1] (p.442PVIRQAP[2]) rs794726941
NM_019066.5(MAGEL2):c.2074G>A (p.Val692Ile) rs200926181
NM_019066.5(MAGEL2):c.2281G>C (p.Ala761Pro) rs146970674
NM_019066.5(MAGEL2):c.2611G>T (p.Ala871Ser) rs2233066
NM_019066.5(MAGEL2):c.2612C>T (p.Ala871Val) rs74004212
NM_019066.5(MAGEL2):c.3017C>G (p.Thr1006Ser) rs138628273
NM_019885.3(CYP26B1):c.1259C>G (p.Ala420Gly) rs7568553
NM_020066.5(FMN2):c.1259A>C (p.Lys420Thr) rs146681532
NM_020166.5(MCCC1):c.974T>G (p.Met325Arg) rs119103212
NM_020207.5(ERCC6L2):c.54G>C (p.Gln18His) rs139286981
NM_020223.4(FAM20C):c.1681G>A (p.Val561Met) rs145750007
NM_020247.5(COQ8A):c.238C>T (p.His80Tyr) rs76249490
NM_020247.5(COQ8A):c.989A>G (p.Tyr330Cys) rs150243147
NM_020312.4(COQ9):c.835G>A (p.Asp279Asn) rs76508383
NM_020344.3(SLC24A2):c.1802A>G (p.Asn601Ser) rs61745273
NM_020361.5(CPA6):c.1237C>T (p.Leu413Phe) rs142597675
NM_020365.5(EIF2B3):c.975+9A>G rs79174967
NM_020435.4(GJC2):c.108C>T (p.Ile36=) rs75469429
NM_020435.4(GJC2):c.947C>T (p.Pro316Leu) rs760502262
NM_020461.4(TUBGCP6):c.3307C>T (p.Arg1103Trp) rs61739385
NM_020461.4(TUBGCP6):c.89G>A (p.Arg30Gln) rs148626062
NM_020549.4(CHAT):c.1682G>A (p.Arg561Gln) rs80097077
NM_020631.5(PLEKHG5):c.1932T>C (p.Pro644=) rs150807400
NM_020699.4(GATAD2B):c.1469C>T (p.Ala490Val) rs145131801
NM_020699.4(GATAD2B):c.676C>G (p.Pro226Ala) rs115193744
NM_020717.3(SHROOM4):c.4066G>A (p.Val1356Ile) rs137923286
NM_020732.3(ARID1B):c.197A>G (p.Asn66Ser) rs776745618
NM_020732.3(ARID1B):c.2896G>A (p.Gly966Ser) rs34786733
NM_020732.3(ARID1B):c.3025+6C>T rs148976215
NM_020745.4(AARS2):c.1196A>G (p.Asn399Ser) rs113433939
NM_020745.4(AARS2):c.2629C>T (p.Arg877Trp) rs112247130
NM_020751.3(COG6):c.898C>T (p.His300Tyr) rs34555836
NM_020754.4(ARHGAP31):c.2344C>A (p.Pro782Thr) rs139659618
NM_020754.4(ARHGAP31):c.820C>T (p.Pro274Ser) rs139600783
NM_020785.2(CC2D2A):c.100C>T (p.Arg34Ter) rs896947430
NM_020810.3(TRMT5):c.312_315del (p.Ile105fs) rs755184077
NM_020810.3(TRMT5):c.535C>A (p.His179Asn) rs76079086
NM_020812.4(DOCK6):c.3913C>T (p.Arg1305Cys) rs112911897
NM_020812.4(DOCK6):c.4205C>T (p.Thr1402Met) rs147554257
NM_020812.4(DOCK6):c.434G>A (p.Arg145Gln) rs140883567
NM_020812.4(DOCK6):c.5939+6C>T rs200393834
NM_020822.3(KCNT1):c.2543A>G (p.Glu848Gly) rs149804567
NM_020822.3(KCNT1):c.2943+6C>T rs28612938
NM_020822.3(KCNT1):c.3239G>T (p.Gly1080Val) rs200250181
NM_020822.3(KCNT1):c.3295C>T (p.Pro1099Ser) rs200642629
NM_020822.3(KCNT1):c.3388G>A (p.Ala1130Thr) rs138421850
NM_020822.3(KCNT1):c.522G>A (p.Met174Ile) rs147551342
NM_020822.3(KCNT1):c.59G>C (p.Gly20Ala) rs146292575
NM_020921.3(NIN):c.264A>T (p.Pro88=) rs61755037
NM_020956.2(PRX):c.*936C>T rs118071705
NM_020975.6(RET):c.1946C>T (p.Ser649Leu) rs148935214
NM_020975.6(RET):c.200G>A (p.Arg67His) rs192489011
NM_020975.6(RET):c.874G>A (p.Val292Met) rs34682185
NM_020987.5(ANK3):c.10953A>C (p.Lys3651Asn) rs115903343
NM_020987.5(ANK3):c.382A>G (p.Thr128Ala) rs114937210
NM_020987.5(ANK3):c.6953A>G (p.Lys2318Arg) rs59021407
NM_020987.5(ANK3):c.6955G>A (p.Asp2319Asn) rs140463162
NM_021072.4(HCN1):c.203GCG[4] (p.Gly72_Gly74del) rs747975797
NM_021072.4(HCN1):c.203GCG[5] (p.Gly73_Gly74del) rs747975797
NM_021098.3(CACNA1H):c.2759C>T (p.Thr920Met) rs59052554
NM_021098.3(CACNA1H):c.4817C>T (p.Thr1606Met) rs59286323
NM_021120.4(DLG3):c.1405+5_1405+7del rs797045525
NM_021625.4(TRPV4):c.2518G>A (p.Glu840Lys) rs55728855
NM_021625.4(TRPV4):c.649G>T (p.Ala217Ser) rs187864727
NM_021828.4(HPSE2):c.943G>A (p.Ala315Thr) rs17110744
NM_021927.3(GUF1):c.748C>T (p.Arg250Cys) rs116062572
NM_021939.3(FKBP10):c.1400-4C>G rs114199361
NM_021956.4(GRIK2):c.2296G>A (p.Val766Ile) rs3213608
NM_022041.3(GAN):c.1684C>G (p.Pro562Ala) rs79901179
NM_022068.3(PIEZO2):c.6191G>C (p.Arg2064Thr) rs79992793
NM_022095.4(ZNF335):c.1102+9T>C rs112458662
NM_022095.4(ZNF335):c.1963C>T (p.Pro655Ser) rs117132825
NM_022095.4(ZNF335):c.808C>T (p.Arg270Cys) rs145110365
NM_022095.4(ZNF335):c.826G>A (p.Ala276Thr) rs117802609
NM_022114.4(PRDM16):c.553A>G (p.Met185Val) rs376567517
NM_022124.6(CDH23):c.1096G>A (p.Ala366Thr) rs143282422
NM_022124.6(CDH23):c.7630T>C (p.Leu2544=) rs114819374
NM_022167.4(XYLT2):c.2312A>G (p.Asn771Ser) rs199705453
NM_022168.4(IFIH1):c.1879G>T (p.Glu627Ter) rs35744605
NM_022445.4(TPK1):c.98G>A (p.Arg33His) rs77358162
NM_022464.5(SIL1):c.1232G>A (p.Arg411His) rs192255604
NM_022464.5(SIL1):c.189T>G (p.Asp63Glu) rs115591710
NM_022464.5(SIL1):c.239A>G (p.Gln80Arg) rs35581768
NM_022464.5(SIL1):c.368C>T (p.Thr123Ile) rs115800498
NM_022726.4(ELOVL4):c.814G>C (p.Glu272Gln) rs148919174
NM_022786.3(ARV1):c.94T>C (p.Tyr32His) rs34745784
NM_022835.3(PLEKHG2):c.1708G>A (p.Gly570Arg) rs370673772
NM_022970.3(FGFR2):c.170C>T (p.Ser57Leu) rs56226109
NM_023073.3(CPLANE1):c.5314A>G (p.Ser1772Gly) rs79377186
NM_023073.3(CPLANE1):c.5421G>A (p.Lys1807=) rs149313666
NM_023073.3(CPLANE1):c.8796+4A>C rs199810663
NM_023073.3(CPLANE1):c.9292G>A (p.Gly3098Arg) rs144081297
NM_024027.5(COLEC11):c.23T>C (p.Val8Ala) rs113269917
NM_024301.5(FKRP):c.235G>A (p.Val79Met) rs104894683
NM_024301.5(FKRP):c.826C>A (p.Leu276Ile) rs28937900
NM_024306.5(FA2H):c.338G>A (p.Arg113Gln) rs147632811
NM_024312.5(GNPTAB):c.1042A>C (p.Ile348Leu) rs7958709
NM_024312.5(GNPTAB):c.2611G>A (p.Gly871Ser) rs56212569
NM_024408.4(NOTCH2):c.3625T>G (p.Phe1209Val) rs147223770
NM_024408.4(NOTCH2):c.4238T>A (p.Leu1413His) rs41313282
NM_024411.5(PDYN):c.575A>T (p.Glu192Val) rs45469293
NM_024422.6(DSC2):c.1073C>T (p.Thr358Ile) rs139399951
NM_024529.4(CDC73):c.*12C>A rs193025205
NM_024537.4(CARS2):c.1624-12C>G rs115116722
NM_024582.4(FAT4):c.10804A>C (p.Ile3602Leu) rs76491994
NM_024582.4(FAT4):c.14657C>G (p.Ala4886Gly) rs35340865
NM_024582.4(FAT4):c.14660G>A (p.Arg4887Lys) rs35845544
NM_024582.4(FAT4):c.5275A>G (p.Ile1759Val) rs145639192
NM_024582.4(FAT4):c.6733G>A (p.Val2245Ile) rs112971995
NM_024589.2(ROGDI):c.117+10C>G rs113858060
NM_024589.2(ROGDI):c.713G>A (p.Arg238His) rs138409264
NM_024592.5(SRD5A3):c.925C>G (p.His309Asp) rs61733673
NM_024596.5(MCPH1):c.1738A>G (p.Ser580Gly) rs17076894
NM_024665.6(TBL1XR1):c.1424C>T (p.Ala475Val) rs753533374
NM_024675.3(PALB2):c.2590C>T (p.Pro864Ser) rs45568339
NM_024675.3(PALB2):c.2794G>A (p.Val932Met) rs45624036
NM_024675.3(PALB2):c.53A>G (p.Lys18Arg) rs138789658
NM_024685.4(BBS10):c.1631A>G (p.Asn544Ser) rs34737974
NM_024685.4(BBS10):c.424G>A (p.Asp142Asn) rs142863601
NM_024685.4(BBS10):c.765G>A (p.Met255Ile) rs139658279
NM_024700.4(SNIP1):c.559C>T (p.Arg187Trp) rs186332019
NM_024735.5(FBXO31):c.1181G>A (p.Arg394Gln) rs34412175
NM_024740.2(ALG9):c.1383C>T (p.Thr461=) rs45516107
NM_024740.2(ALG9):c.1604T>G (p.Ile535Ser) rs12575909
NM_024740.2(ALG9):c.764C>T (p.Ser255Leu) rs17113312
NM_024753.5(TTC21B):c.1387C>T (p.Pro463Ser) rs16851307
NM_024753.5(TTC21B):c.3004C>G (p.Leu1002Val) rs146496725
NM_024757.5(EHMT1):c.3011G>A (p.Ser1004Asn) rs138283222
NM_024757.5(EHMT1):c.316C>G (p.Gln106Glu) rs144603232
NM_024790.6(CSPP1):c.212A>G (p.Lys71Arg) rs200158932
NM_024996.5(GFM1):c.568A>C (p.Met190Leu) rs75450876
NM_025074.7(FRAS1):c.109-15del rs548267943
NM_025074.7(FRAS1):c.1769T>C (p.Met590Thr) rs35030041
NM_025074.7(FRAS1):c.2956G>A (p.Ala986Thr) rs111554790
NM_025074.7(FRAS1):c.776T>G (p.Leu259Arg) rs148509395
NM_025077.4(TOE1):c.1141G>A (p.Glu381Lys) rs61323219
NM_025099.6(CTC1):c.248G>C (p.Ser83Thr) rs78870822
NM_025114.4(CEP290):c.1825-17CT[2] rs367600498
NM_025114.4(CEP290):c.2484-18GTTTT[4] rs745522483
NM_025114.4(CEP290):c.251-11T>A rs200666995
NM_025114.4(CEP290):c.2980G>A (p.Glu994Lys) rs182369459
NM_025114.4(CEP290):c.4102G>A (p.Asp1368Asn) rs184143186
NM_025114.4(CEP290):c.4237G>C (p.Asp1413His) rs183655276
NM_025114.4(CEP290):c.5237G>A (p.Arg1746Gln) rs61941020
NM_025114.4(CEP290):c.523C>A (p.Gln175Lys) rs202159966
NM_025114.4(CEP290):c.5506A>G (p.Ile1836Val) rs11104729
NM_025114.4(CEP290):c.6401T>C (p.Ile2134Thr) rs117852025
NM_025114.4(CEP290):c.6787A>G (p.Ser2263Gly) rs77778467
NM_025137.4(SPG11):c.258-6del rs373234269
NM_025137.4(SPG11):c.3818A>G (p.Lys1273Arg) rs76389165
NM_025137.4(SPG11):c.6319G>A (p.Val2107Ile) rs115970214
NM_025150.5(TARS2):c.1034A>G (p.His345Arg) rs115390773
NM_025152.3(NUBPL):c.545T>C (p.Val182Ala) rs61752327
NM_025152.3(NUBPL):c.815-27T>C rs118161496
NM_025243.4(SLC19A3):c.421G>A (p.Gly141Ser) rs148144444
NM_025265.4(TSEN2):c.272-4C>G rs41293385
NM_030582.4(COL18A1):c.4204G>A (p.Val1402Met) rs77326997
NM_030582.4(COL18A1):c.4354G>T (p.Val1452Leu) rs61736805
NM_030582.4(COL18A1):c.56C>T (p.Ala19Val) rs7277693
NM_030632.3(ASXL3):c.1409A>C (p.His470Pro) rs80040227
NM_030653.4(DDX11):c.2223C>G (p.Ser741Arg) rs151210946
NM_030662.4(MAP2K2):c.580+6G>A rs201435249
NM_030665.4(RAI1):c.1775G>A (p.Arg592Gln) rs141808855
NM_030665.4(RAI1):c.3778GAG[1] (p.Glu1261del) rs149716029
NM_030665.4(RAI1):c.4693G>A (p.Val1565Met) rs368106957
NM_030665.4(RAI1):c.5036C>T (p.Ala1679Val) rs142981643
NM_030665.4(RAI1):c.610C>T (p.Pro204Ser) rs138332224
NM_030665.4(RAI1):c.725C>T (p.Pro242Leu) rs150563155
NM_030665.4(RAI1):c.834GCA[10] (p.Gln289_Gln291del) rs371983878
NM_030773.3(TUBB1):c.1075C>T (p.Arg359Trp) rs140943896
NM_030957.4(ADAMTS10):c.2157C>G (p.Ala719=) rs150468696
NM_030962.3(SBF2):c.2323G>A (p.Gly775Ser) rs141330687
NM_030962.3(SBF2):c.513+17G>C rs73410819
NM_031407.7(HUWE1):c.5716+5G>A rs139135300
NM_031407.7(HUWE1):c.6031-4T>A rs139283158
NM_031475.3(ESPN):c.1104T>G (p.Phe368Leu) rs142638391
NM_031475.3(ESPN):c.1709C>T (p.Pro570Leu) rs527968078
NM_031885.4(BBS2):c.1864C>T (p.Arg622Ter) rs201196733
NM_031885.4(BBS2):c.805-20A>G rs41280892
NM_032040.5(CCDC8):c.954T>G (p.Asn318Lys) rs143086771
NM_032043.2(BRIP1):c.1433A>G (p.His478Arg) rs45501097
NM_032119.4(ADGRV1):c.10769+9A>G rs116184119
NM_032119.4(ADGRV1):c.10936T>C (p.Ser3646Pro) rs13171868
NM_032119.4(ADGRV1):c.12212G>A (p.Arg4071Gln) rs202190568
NM_032119.4(ADGRV1):c.12269C>A (p.Thr4090Asn) rs199839743
NM_032119.4(ADGRV1):c.12592G>A (p.Val4198Met) rs2460169
NM_032119.4(ADGRV1):c.1652T>C (p.Val551Ala) rs6889939
NM_032119.4(ADGRV1):c.17017A>G (p.Lys5673Glu) rs41303350
NM_032119.4(ADGRV1):c.17987G>T (p.Trp5996Leu) rs544077645
NM_032119.4(ADGRV1):c.1839+7G>A rs142011700
NM_032119.4(ADGRV1):c.3559A>G (p.Ile1187Val) rs16868935
NM_032119.4(ADGRV1):c.5747C>T (p.Thr1916Ile) rs35791889
NM_032119.4(ADGRV1):c.5830G>A (p.Asp1944Asn) rs41302834
NM_032119.4(ADGRV1):c.6095C>T (p.Ala2032Val) rs142013761
NM_032119.4(ADGRV1):c.6133G>A (p.Gly2045Arg) rs41308846
NM_032119.4(ADGRV1):c.7079G>A (p.Arg2360His) rs111033470
NM_032119.4(ADGRV1):c.746G>A (p.Arg249Lys) rs41303344
NM_032119.4(ADGRV1):c.7813T>G (p.Leu2605Val) rs79915053
NM_032119.4(ADGRV1):c.7874G>A (p.Arg2625His) rs201214794
NM_032119.4(ADGRV1):c.7945+6C>T rs139278305
NM_032119.4(ADGRV1):c.8572A>G (p.Ile2858Val) rs41308297
NM_032119.4(ADGRV1):c.9607T>A (p.Ser3203Thr) rs116480183
NM_032119.4(ADGRV1):c.9650C>T (p.Ala3217Val) rs114137750
NM_032322.4(RNF135):c.299A>G (p.His100Arg) rs368080023
NM_032382.4(COG8):c.1591C>T (p.Pro531Ser) rs76253513
NM_032436.4(CHAMP1):c.755C>T (p.Ala252Val) rs114331585
NM_032444.4(SLX4):c.2746G>T (p.Ala916Ser) rs79448721
NM_032444.4(SLX4):c.2824G>C (p.Glu942Gln) rs114014006
NM_032444.4(SLX4):c.4115G>A (p.Arg1372Gln) rs79174372
NM_032444.4(SLX4):c.5029C>T (p.Pro1677Ser) rs7196345
NM_032444.4(SLX4):c.5501A>G (p.Asn1834Ser) rs111738042
NM_032444.4(SLX4):c.710G>A (p.Arg237Gln) rs138615800
NM_032504.1(UNC80):c.3256+3A>G rs144170692
NM_032504.1(UNC80):c.9305C>T (p.Pro3102Leu) rs61271372
NM_032504.1(UNC80):c.9554C>G (p.Thr3185Arg) rs59504201
NM_032551.5(KISS1R):c.565G>A (p.Ala189Thr) rs73507527
NM_032578.4(MYPN):c.3481C>A (p.Leu1161Ile) rs138313730
NM_032608.7(MYO18B):c.7147C>T (p.Arg2383Trp) rs192639023
NM_032634.4(PIGO):c.461C>A (p.Ala154Asp) rs142562923
NM_032667.6(BSCL2):c.653C>T (p.Ala218Val) rs185341934
NM_032682.6(FOXP1):c.1702C>T (p.Pro568Ser) rs147674680
NM_032806.6(POMGNT2):c.364G>A (p.Val122Met) rs149948290
NM_032861.4(SERAC1):c.89T>C (p.Ile30Thr) rs34270473
NM_032978.7(DTNA):c.229A>G (p.Asn77Asp) rs147782267
NM_033028.5(BBS4):c.137A>G (p.Lys46Arg) rs75295839
NM_033056.4(PCDH15):c.2435T>C (p.Ile812Thr) rs61731363
NM_033056.4(PCDH15):c.4024C>A (p.Gln1342Lys) rs61731387
NM_033056.4(PCDH15):c.4850A>G (p.Asn1617Ser) rs111033362
NM_033056.4(PCDH15):c.92-493A>T rs77290854
NM_033084.5(FANCD2):c.1367T>G (p.Leu456Arg) rs35782247
NM_033084.5(FANCD2):c.1634A>G (p.Asn545Ser) rs145522204
NM_033084.5(FANCD2):c.983G>A (p.Arg328Gln) rs35625434
NM_033087.4(ALG2):c.17G>C (p.Gly6Ala) rs180849348
NM_033087.4(ALG2):c.30C>G (p.Asp10Glu) rs7023652
NM_033109.5(PNPT1):c.944A>G (p.Lys315Arg) rs35405862
NM_033337.3(CAV3):c.166G>A (p.Gly56Ser) rs72546667
NM_033380.3(COL4A5):c.1289C>A (p.Ala430Asp) rs142883891
NM_033380.3(COL4A5):c.3148C>T (p.Pro1050Ser) rs143945573
NM_033419.5(PGAP3):c.422C>G (p.Ala141Gly) rs35464006
NM_033517.1(SHANK3):c.1803G>A (p.Thr601=) rs73892912
NM_033641.4(COL4A6):c.2653G>T (p.Val885Phe) rs112034997
NM_052865.4(MGME1):c.532C>T (p.Arg178Trp) rs143417446
NM_052865.4(MGME1):c.794C>T (p.Thr265Ile) rs76599088
NM_052865.4(MGME1):c.86C>G (p.Ser29Cys) rs143811282
NM_053025.4(MYLK):c.4620-18G>A rs41305835
NM_054012.4(ASS1):c.106-10T>G rs73541957
NM_054012.4(ASS1):c.766G>A (p.Glu256Lys) rs74923032
NM_054021.1(GPR101):c.712G>A (p.Val238Ile) rs139111924
NM_054021.1(GPR101):c.924G>A (p.Glu308=) rs73637412
NM_058216.3(RAD51C):c.859A>G (p.Thr287Ala) rs28363317
NM_078470.6(COX15):c.988-8C>A rs542092025
NM_080669.6(SLC46A1):c.1366C>T (p.Pro456Ser) rs186143284
NM_080680.3(COL11A2):c.2017-5T>G rs200523422
NM_080680.3(COL11A2):c.2336C>T (p.Pro779Leu) rs150877886
NM_080680.3(COL11A2):c.5000G>A (p.Arg1667His) rs146555195
NM_080916.3(DGUOK):c.4G>T (p.Ala2Ser) rs147551003
NM_130797.4(DPP6):c.227A>T (p.Asp76Val) rs572667303
NM_133433.4(NIPBL):c.1985A>G (p.Lys662Arg) rs140100861
NM_133433.4(NIPBL):c.2294G>A (p.Arg765Lys) rs185678374
NM_133433.4(NIPBL):c.535G>A (p.Ala179Thr) rs142923613
NM_133433.4(NIPBL):c.6109-3T>C rs145778995
NM_138361.5(LRSAM1):c.965A>G (p.Gln322Arg) rs56380300
NM_138691.2(TMC1):c.924C>G (p.Asp308Glu) rs113342704
NM_138694.4(PKHD1):c.10585G>C (p.Glu3529Gln) rs145184792
NM_138694.4(PKHD1):c.107C>T (p.Thr36Met) rs137852944
NM_138694.4(PKHD1):c.2027C>G (p.Pro676Arg) rs115045643
NM_138694.4(PKHD1):c.2414C>T (p.Pro805Leu) rs199531851
NM_138694.4(PKHD1):c.3122G>A (p.Gly1041Asp) rs794727466
NM_138694.4(PKHD1):c.3407A>G (p.Tyr1136Cys) rs41273726
NM_138694.4(PKHD1):c.4343A>G (p.Glu1448Gly) rs116809571
NM_138694.4(PKHD1):c.5725C>T (p.Arg1909Trp) rs115338476
NM_138694.4(PKHD1):c.5912G>A (p.Gly1971Asp) rs180675584
NM_138694.4(PKHD1):c.9530T>C (p.Ile3177Thr) rs200511261
NM_138959.3(VANGL1):c.274A>G (p.Ile92Val) rs143196463
NM_139025.4(ADAMTS13):c.3287G>A (p.Arg1096His) rs61751476
NM_139242.4(MTFMT):c.16C>T (p.Arg6Trp) rs199599204
NM_139343.3(BIN1):c.696C>A (p.Asn232Lys) rs143820618
NM_144508.5(KNL1):c.6212+5G>A rs115900739
NM_144596.4(TTC8):c.1253A>G (p.Gln418Arg) rs142938748
NM_144612.6(LOXHD1):c.1570C>T (p.Arg524Cys) rs192376005
NM_144670.6(A2ML1):c.158C>G (p.Thr53Arg) rs79149293
NM_144670.6(A2ML1):c.462+9GGA[2] rs750639846
NM_144672.4(OTOA):c.236G>A (p.Arg79Gln) rs147088274
NM_145046.4(CALR3):c.850G>A (p.Asp284Asn) rs10404156
NM_145207.3(SPATA5):c.1877G>C (p.Trp626Ser) rs375343753
NM_145207.3(SPATA5):c.983CAA[2] (p.Thr330del) rs796052243
NM_145239.3(PRRT2):c.412C>G (p.Pro138Ala) rs79182085
NM_145239.3(PRRT2):c.647C>T (p.Pro216Leu) rs76335820
NM_145262.4(GLYCTK):c.1181C>T (p.Thr394Ile) rs9813489
NM_145691.4(ATPAF2):c.511G>A (p.Val171Met) rs62073570
NM_147127.5(EVC2):c.1711-20_1711-19dup rs35103377
NM_147127.5(EVC2):c.1730T>C (p.Met577Thr) rs113869406
NM_147127.5(EVC2):c.2029C>A (p.Arg677=) rs73198165
NM_147127.5(EVC2):c.3138C>G (p.Ser1046Arg) rs73074138
NM_152296.5(ATP1A3):c.2324C>T (p.Pro775Leu) rs886041396
NM_152296.5(ATP1A3):c.357C>T (p.Asn119=) rs143547136
NM_152299.4(NCAPH2):c.*261G>A rs8139305
NM_152384.3(BBS5):c.551A>G (p.Asn184Ser) rs137853921
NM_152416.4(NDUFAF6):c.838G>A (p.Val280Ile) rs61743028
NM_152419.3(HGSNAT):c.1843G>A (p.Ala615Thr) rs112029032
NM_152424.4(AMER1):c.2651C>T (p.Pro884Leu) rs201092215
NM_152424.4(AMER1):c.832G>T (p.Ala278Ser) rs35718712
NM_152464.3(TMEM199):c.256T>C (p.Tyr86His) rs35276012
NM_152618.3(BBS12):c.1115_1116del (p.Gly371_Phe372insTer) rs587777803
NM_152618.3(BBS12):c.116T>C (p.Ile39Thr) rs138036823
NM_152743.4(BRAT1):c.2041G>A (p.Glu681Lys) rs145833100
NM_152743.4(BRAT1):c.2353C>T (p.Arg785Trp) rs61729932
NM_152743.4(BRAT1):c.294dup (p.Leu99fs) rs776913277
NM_152743.4(BRAT1):c.866G>C (p.Cys289Ser) rs140451075
NM_152783.5(D2HGDH):c.1276G>A (p.Ala426Thr) rs146578303
NM_152783.5(D2HGDH):c.43C>G (p.Arg15Gly) rs4675887
NM_152906.7(TANGO2):c.419G>A (p.Arg140Gln) rs142442293
NM_153006.3(NAGS):c.182A>G (p.Glu61Gly) rs113134544
NM_153240.5(NPHP3):c.1157A>G (p.Asn386Ser) rs142021049
NM_153240.5(NPHP3):c.154G>A (p.Ala52Thr) rs145643112
NM_153240.5(NPHP3):c.3550G>A (p.Ala1184Thr) rs34391943
NM_153240.5(NPHP3):c.3913C>T (p.Arg1305Cys) rs35485382
NM_153252.5(BRWD3):c.769G>A (p.Val257Ile) rs112829587
NM_153676.4(USH1C):c.2410G>A (p.Ala804Thr) rs150593932
NM_153700.2(STRC):c.4127+8C>T rs2470137
NM_153704.6(TMEM67):c.2161C>T (p.Pro721Ser) rs116445698
NM_153704.6(TMEM67):c.579_580del (p.Gly195fs) rs386834202
NM_153717.3(EVC):c.284A>G (p.Asp95Gly) rs41269547
NM_170707.4(LMNA):c.357C>T (p.Arg119=) rs41313880
NM_172107.4(KCNQ2):c.1545G>T (p.Glu515Asp) rs117067974
NM_172107.4(KCNQ2):c.1639C>T (p.Arg547Trp) rs796052650
NM_172107.4(KCNQ2):c.1689C>T (p.Asp563=) rs35450031
NM_172362.3(KCNH1):c.1136T>C (p.Leu379Pro) rs878853026
NM_173076.3(ABCA12):c.485C>T (p.Ala162Val) rs149399707
NM_173076.3(ABCA12):c.5617G>A (p.Val1873Ile) rs114258385
NM_173354.5(SIK1):c.1215G>A (p.Met405Ile) rs34987632
NM_173354.5(SIK1):c.274-3del rs550878772
NM_173472.2(FANCD2OS):c.44-5713G>A rs147675860
NM_173477.5(USH1G):c.83C>T (p.Pro28Leu) rs145448362
NM_173591.3(OTOGL):c.6202T>G (p.Cys2068Gly) rs145929269
NM_173602.3(DIP2B):c.793G>A (p.Asp265Asn) rs73093419
NM_173630.4(RTTN):c.5143A>G (p.Asn1715Asp) rs35374168
NM_173630.4(RTTN):c.6038G>T (p.Cys2013Phe) rs145976466
NM_173630.4(RTTN):c.6445G>A (p.Ala2149Thr) rs34989098
NM_173660.5(DOK7):c.134C>T (p.Ser45Leu) rs62272670
NM_176787.5(PIGN):c.283C>T (p.Arg95Trp) rs558341655
NM_177433.3(MAGED2):c.130A>G (p.Lys44Glu) rs11555928
NM_177438.2(DICER1):c.20A>G (p.Gln7Arg) rs117358479
NM_177986.5(DSG4):c.1568C>T (p.Pro523Leu) rs34620697
NM_181332.3(NLGN4X):c.897A>G (p.Ile299Met) rs151073358
NM_181426.2(CCDC39):c.1433A>G (p.Gln478Arg) rs115545935
NM_181503.3(EXOSC8):c.815G>C (p.Ser272Thr) rs36027220
NM_182914.2(SYNE2):c.17561T>C (p.Leu5854Pro) rs117070973
NM_182914.2(SYNE2):c.20161G>A (p.Ala6721Thr) rs140897155
NM_182925.5(FLT4):c.1921C>T (p.Pro641Ser) rs55667289
NM_182961.4(SYNE1):c.13636G>A (p.Val4546Ile) rs4870093
NM_182961.4(SYNE1):c.1964A>G (p.Gln655Arg) rs9397509
NM_182961.4(SYNE1):c.23315G>A (p.Arg7772Gln) rs138787771
NM_182961.4(SYNE1):c.8164G>A (p.Val2722Ile) rs151091241
NM_183059.2(RD3):c.584A>T (p.Asp195Val) rs143207434
NM_194248.3(OTOF):c.1424A>G (p.Glu475Gly) rs111033396
NM_194248.3(OTOF):c.2375G>A (p.Arg792Gln) rs144800506
NM_194248.3(OTOF):c.3966C>G (p.Asp1322Glu) rs80356576
NM_194318.4(B3GLCT):c.733G>A (p.Val245Met) rs34830061
NM_198076.6(COX20):c.92G>A (p.Arg31Gln) rs764620077
NM_198253.3(TERT):c.1234C>T (p.His412Tyr) rs34094720
NM_198428.3(BBS9):c.1280C>T (p.Ala427Val) rs138072724
NM_198428.3(BBS9):c.1648A>G (p.Ile550Val) rs150399299
NM_198428.3(BBS9):c.1849A>C (p.Ile617Leu) rs34209904
NM_198525.3(KIF7):c.1429G>A (p.Ala477Thr) rs527804875
NM_198525.3(KIF7):c.1895C>T (p.Pro632Leu) rs115857753
NM_198569.3(ADGRG6):c.794G>C (p.Gly265Ala) rs111589388
NM_198576.4(AGRN):c.1123G>T (p.Ala375Ser) rs138031468
NM_198576.4(AGRN):c.1660G>A (p.Val554Met) rs79016973
NM_198576.4(AGRN):c.2690C>T (p.Ala897Val) rs116836855
NM_198576.4(AGRN):c.3077C>A (p.Thr1026Asn) rs3813188
NM_198576.4(AGRN):c.3264G>C (p.Leu1088Phe) rs150132566
NM_198576.4(AGRN):c.4540G>A (p.Ala1514Thr) rs111818381
NM_201384.3(PLEC):c.12671C>G (p.Ala4224Gly) rs368212208
NM_201384.3(PLEC):c.4598G>A (p.Arg1533Gln) rs201430180
NM_201384.3(PLEC):c.4651C>T (p.Arg1551Cys) rs2857824
NM_201384.3(PLEC):c.5476C>T (p.Arg1826Trp) rs200575795
NM_201384.3(PLEC):c.5477G>A (p.Arg1826Gln) rs147838690
NM_201384.3(PLEC):c.8012G>A (p.Arg2671Gln) rs28526657
NM_201384.3(PLEC):c.9961G>A (p.Gly3321Arg) rs34132016
NM_203447.3(DOCK8):c.54-1G>T rs192864327
NM_203447.4(DOCK8):c.3840+3A>G rs16938572
NM_206965.2(FTCD):c.990dup (p.Pro331fs) rs398124234
NM_207346.3(TSEN54):c.1328C>G (p.Ser443Cys) rs150169668
NM_207361.6(FREM2):c.8902G>A (p.Val2968Ile) rs116099212
NM_213599.2(ANO5):c.2354T>G (p.Leu785Arg) rs146136277
NM_213599.2(ANO5):c.2698A>C (p.Met900Leu) rs148293985
NR_001566.1(TERC):n.228G>A rs141686314
Single allele rs375986475
m.1393G>A rs111033325
m.4336T>C rs41456348

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.