ClinVar Miner

Variants from Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute with conflicting interpretations

Location: Canada — Primary collection method: clinical testing
Minimum review status of the submission from Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute: Collection method of the submission from Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
678 276 0 218 140 6 36 355

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute pathogenic likely pathogenic uncertain significance likely benign benign drug response risk factor other
pathogenic 0 33 3 1 0 0 0 0
likely pathogenic 22 0 16 3 1 0 0 0
uncertain significance 5 10 0 51 13 0 0 0
likely benign 0 0 58 0 104 0 1 1
benign 0 0 26 59 0 0 0 0
risk factor 0 0 1 1 1 1 0 2
other 0 0 1 1 1 0 1 0

Submitter to submitter summary #

Total submitters: 57
Download table as spreadsheet
Submitter Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
GeneDx 0 216 0 63 23 0 7 93
Ambry Genetics 0 205 0 66 15 1 4 86
Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine 0 205 0 54 29 0 2 85
EGL Genetic Diagnostics, Eurofins Clinical Diagnostics 0 73 0 25 29 4 1 59
Integrated Genetics/Laboratory Corporation of America 0 65 0 43 14 1 0 58
CeGaT Praxis fuer Humangenetik Tuebingen 0 30 0 7 29 1 0 37
Invitae 0 37 0 14 12 1 8 35
Illumina Clinical Services Laboratory,Illumina 0 13 0 16 11 0 2 29
ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories 0 73 0 22 3 1 0 26
Biesecker Lab/Clinical Genomics Section,National Institutes of Health 0 60 0 14 10 0 0 24
Stanford Center for Inherited Cardiovascular Disease, Stanford University 0 22 0 7 15 0 1 23
PreventionGenetics, PreventionGenetics 0 107 0 21 1 0 0 22
Athena Diagnostics Inc 0 23 0 16 2 0 1 19
Genetic Services Laboratory, University of Chicago 0 11 0 8 3 0 0 11
CSER _CC_NCGL, University of Washington 0 17 0 3 4 0 4 11
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 0 9 0 10 1 0 0 11
Department of Pathology and Laboratory Medicine,Sinai Health System 0 4 0 1 8 2 0 11
Quest Diagnostics Nichols Institute San Juan Capistrano 0 9 0 5 5 0 0 10
Laboratory of Genetics and Molecular Cardiology, University of São Paulo 0 9 0 9 0 0 1 10
Robarts Research Institute,Western University 0 2 0 9 1 0 0 10
Blueprint Genetics 0 24 0 7 0 0 2 9
LDLR-LOVD, British Heart Foundation 0 10 0 8 0 0 1 9
Agnes Ginges Centre for Molecular Cardiology,Centenary Institute 0 9 0 2 2 0 3 7
Centre de Génétique Moléculaire et Chromosomique, Unité de génétique de l'Obésité et des Dyslipidémies,APHP, GH Hôpitaux Universitaires Pitié-Salpêtrière / Charles-Foix 0 6 0 6 0 0 1 7
OMIM 0 19 0 1 0 2 2 5
Fundacion Hipercolesterolemia Familiar 0 4 0 5 0 0 0 5
Color Health, Inc 0 22 0 1 3 0 0 4
Molecular Genetics Laboratory,Centre for Cardiovascular Surgery and Transplantation 0 1 0 4 0 0 0 4
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics,Children's Hospital of Philadelphia 0 2 0 3 0 0 0 3
Mendelics 0 5 0 1 1 0 1 3
Center for Medical Genetics Ghent,University of Ghent 0 6 0 3 0 0 0 3
Institute of Human Genetics, University of Leipzig Medical Center 0 2 0 1 0 1 1 3
Iberoamerican FH Network 0 2 0 3 0 0 0 3
Broad Institute Rare Disease Group, Broad Institute 0 5 0 3 0 0 0 3
U4M - Lille University & CHRU Lille, Université de Lille - CHRU de Lille 0 11 0 2 0 0 0 2
Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde,Academisch Medisch Centrum 0 11 0 1 0 0 1 2
Brunham Lab, Centre for Heart and Lung Innovation,University of British Columbia 0 6 0 2 0 0 0 2
Center for Human Genetics, Inc,Center for Human Genetics, Inc 0 1 0 1 0 0 0 1
Clinical Molecular Genetics Laboratory,Johns Hopkins All Children's Hospital 0 0 0 0 0 0 1 1
Molecular Diagnostics Lab,Nemours Alfred I. duPont Hospital for Children 0 0 0 1 0 0 0 1
Cardiovascular Genetics Laboratory,PathWest Laboratory Medicine WA - Fiona Stanley Hospital 0 6 0 1 0 0 0 1
Mayo Clinic Laboratories, Mayo Clinic 0 0 0 1 0 0 0 1
Fulgent Genetics,Fulgent Genetics 0 3 0 1 0 0 0 1
Human Genome Sequencing Center Clinical Lab, Baylor College of Medicine 0 7 0 1 0 0 0 1
PharmGKB 0 0 0 0 0 1 0 1
Genomic Research Center, Shahid Beheshti University of Medical Sciences 0 0 0 0 1 0 0 1
Knight Diagnostic Laboratories, Oregon Health and Sciences University 0 0 0 1 0 0 0 1
Center of Genomic medicine, Geneva,University Hospital of Geneva 0 1 0 1 0 0 0 1
Cardiovascular Research Group,Instituto Nacional de Saude Doutor Ricardo Jorge 0 4 0 1 0 0 0 1
NIHR Bioresource Rare Diseases, University of Cambridge 0 0 0 1 0 0 0 1
SIB Swiss Institute of Bioinformatics 0 0 0 1 0 0 0 1
Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen 0 1 0 0 0 0 1 1
Institute for Genomic Medicine (IGM) Clinical Laboratory,Nationwide Children's Hospital 0 4 0 0 1 0 0 1
Department of Human Genetics,Laborarztpraxis Dres. Walther, Weindel und Kollegen 0 1 0 1 0 0 0 1
Klaassen Lab,Charite University Medicine Berlin 0 0 0 1 0 0 0 1
Center for Advanced Laboratory Medicine, UC San Diego Health,University of California San Diego 0 0 0 0 1 0 0 1
Cardiology unit,Meyer University Hospital 0 0 0 1 0 0 0 1

All variants with conflicting interpretations #

Total variants: 355
Download table as spreadsheet
HGVS dbSNP
NM_000041.2(APOE):c.526C>T (p.Arg176Cys) rs7412
NM_000041.4(APOE):c.388T>C (p.Cys130Arg) rs429358
NM_000138.4(FBN1):c.1904A>G (p.Tyr635Cys) rs1555399816
NM_000138.4(FBN1):c.2080G>T (p.Glu694Ter) rs1060501024
NM_000138.4(FBN1):c.5626T>C (p.Cys1876Arg) rs1555395980
NM_000138.4(FBN1):c.6987C>G (p.Asp2329Glu) rs363831
NM_000138.4(FBN1):c.8149G>A (p.Glu2717Lys) rs187553035
NM_000138.5(FBN1):c.4588C>T (p.Arg1530Cys) rs111401431
NM_000138.5(FBN1):c.7754T>C (p.Ile2585Thr) rs727503054
NM_000169.3(GLA):c.937G>T (p.Asp313Tyr) rs28935490
NM_000218.3(KCNQ1):c.1927G>A (p.Gly643Ser) rs1800172
NM_000218.3(KCNQ1):c.1986C>T (p.Tyr662=) rs11601907
NM_000218.3(KCNQ1):c.207G>T (p.Ala69=) rs587781009
NM_000219.6(KCNE1):c.253G>A (p.Asp85Asn) rs1805128
NM_000237.3(LPL):c.1325T>G (p.Val442Gly) rs116403115
NM_000238.3(KCNH2):c.2453C>T (p.Ser818Leu) rs121912510
NM_000238.3(KCNH2):c.2863C>G (p.Leu955Val) rs199473012
NM_000238.3(KCNH2):c.3125T>C (p.Leu1042Pro) rs886039064
NM_000238.3(KCNH2):c.3140G>T (p.Arg1047Leu) rs36210421
NM_000238.4(KCNH2):c.2738C>T (p.Ala913Val) rs77331749
NM_000238.4(KCNH2):c.422C>T (p.Pro141Leu) rs199472864
NM_000238.4(KCNH2):c.442C>T (p.Arg148Trp) rs139544114
NM_000238.4(KCNH2):c.526C>T (p.Arg176Trp) rs36210422
NM_000238.4(KCNH2):c.551GCGCGGGCG[1] (p.184GAG[1]) rs551056698
NM_000256.3(MYBPC3):c.1144C>T (p.Arg382Trp) rs11570076
NM_000256.3(MYBPC3):c.1227-13G>A rs397515893
NM_000256.3(MYBPC3):c.1519G>A (p.Gly507Arg) rs35736435
NM_000256.3(MYBPC3):c.1564G>A (p.Ala522Thr) rs11570082
NM_000256.3(MYBPC3):c.1591G>A (p.Gly531Arg) rs397515912
NM_000256.3(MYBPC3):c.1622dup (p.Glu542fs) rs1555122143
NM_000256.3(MYBPC3):c.1934C>T (p.Pro645Leu) rs397515938
NM_000256.3(MYBPC3):c.2311G>A (p.Val771Met) rs371488302
NM_000256.3(MYBPC3):c.2670G>A (p.Trp890Ter) rs397515982
NM_000256.3(MYBPC3):c.2870C>G (p.Thr957Ser) rs193922380
NM_000256.3(MYBPC3):c.2992C>G (p.Gln998Glu) rs11570112
NM_000256.3(MYBPC3):c.3004C>T (p.Arg1002Trp) rs3729799
NM_000256.3(MYBPC3):c.3106C>T (p.Arg1036Cys) rs61729664
NM_000256.3(MYBPC3):c.3413G>A (p.Arg1138His) rs187705120
NM_000256.3(MYBPC3):c.3491-2A>T rs397516022
NM_000256.3(MYBPC3):c.3535G>A (p.Glu1179Lys) rs199669878
NM_000256.3(MYBPC3):c.450C>T (p.Pro150=) rs377520770
NM_000256.3(MYBPC3):c.46C>T (p.Pro16Ser) rs730880573
NM_000256.3(MYBPC3):c.501C>T (p.Thr167=) rs397516054
NM_000256.3(MYBPC3):c.530G>A (p.Arg177His) rs201012766
NM_000256.3(MYBPC3):c.649A>G (p.Ser217Gly) rs138753870
NM_000256.3(MYBPC3):c.655G>C (p.Val219Leu) rs397516068
NM_000256.3(MYBPC3):c.977G>A (p.Arg326Gln) rs34580776
NM_000257.4(MYH7):c.1002C>T (p.Asn334=) rs34803781
NM_000257.4(MYH7):c.1062C>T (p.Gly354=) rs735712
NM_000257.4(MYH7):c.1063G>A (p.Ala355Thr) rs397516088
NM_000257.4(MYH7):c.1357C>T (p.Arg453Cys) rs121913625
NM_000257.4(MYH7):c.1750G>C (p.Gly584Arg) rs121913626
NM_000257.4(MYH7):c.1816G>A (p.Val606Met) rs121913627
NM_000257.4(MYH7):c.1988G>A (p.Arg663His) rs371898076
NM_000257.4(MYH7):c.2156G>A (p.Arg719Gln) rs121913641
NM_000257.4(MYH7):c.2167C>G (p.Arg723Gly) rs121913630
NM_000257.4(MYH7):c.2221G>T (p.Gly741Trp) rs121913632
NM_000257.4(MYH7):c.2360G>A (p.Arg787His) rs376754645
NM_000257.4(MYH7):c.2606G>A (p.Arg869His) rs202141173
NM_000257.4(MYH7):c.2681A>G (p.Glu894Gly) rs397516161
NM_000257.4(MYH7):c.2769C>T (p.Asn923=) rs36211716
NM_000257.4(MYH7):c.2788G>C (p.Glu930Gln) rs397516171
NM_000257.4(MYH7):c.2967T>C (p.Ile989=) rs7157716
NM_000257.4(MYH7):c.297C>T (p.Pro99=) rs140245862
NM_000257.4(MYH7):c.3036C>T (p.Ala1012=) rs145379951
NM_000257.4(MYH7):c.3153G>A (p.Ala1051=) rs45540831
NM_000257.4(MYH7):c.3235C>T (p.Arg1079Trp) rs192722540
NM_000257.4(MYH7):c.3337-4dup rs45504498
NM_000257.4(MYH7):c.4182C>T (p.Ala1394=) rs765895405
NM_000257.4(MYH7):c.428G>A (p.Arg143Gln) rs397516209
NM_000257.4(MYH7):c.4377G>T (p.Lys1459Asn) rs201307101
NM_000257.4(MYH7):c.4472C>G (p.Ser1491Cys) rs3729823
NM_000257.4(MYH7):c.480C>T (p.Asn160=) rs45500700
NM_000257.4(MYH7):c.4817G>A (p.Arg1606His) rs373514686
NM_000257.4(MYH7):c.597A>G (p.Ala199=) rs2069541
NM_000257.4(MYH7):c.646C>G (p.Leu216Val) rs772488436
NM_000257.4(MYH7):c.732C>T (p.Phe244=) rs2069542
NM_000257.4(MYH7):c.77C>T (p.Ala26Val) rs186964570
NM_000257.4(MYH7):c.975C>T (p.Asp325=) rs2231124
NM_000335.5(SCN5A):c.1441C>T (p.Arg481Trp) rs144511230
NM_000335.5(SCN5A):c.1852C>T (p.Leu618Phe) rs45488304
NM_000335.5(SCN5A):c.3575G>A (p.Arg1192Gln) rs41261344
NM_000335.5(SCN5A):c.5357G>A (p.Ser1786Asn) rs199473316
NM_000335.5(SCN5A):c.5848G>T (p.Val1950Leu) rs41315493
NM_000335.5(SCN5A):c.6007T>C (p.Phe2003Leu) rs41311117
NM_000335.5(SCN5A):c.677C>T (p.Ala226Val) rs199473561
NM_000337.5(SGCD):c.451T>G (p.Ser151Ala) rs121909298
NM_000363.5(TNNI3):c.198G>A (p.Glu66=) rs3729710
NM_000363.5(TNNI3):c.235C>T (p.Arg79Cys) rs3729712
NM_000363.5(TNNI3):c.244C>T (p.Pro82Ser) rs77615401
NM_000363.5(TNNI3):c.25-8T>A rs3729836
NM_000363.5(TNNI3):c.434G>A (p.Arg145Gln) rs397516349
NM_000363.5(TNNI3):c.557G>A (p.Arg186Gln) rs397516357
NM_000384.3(APOB):c.10672C>T (p.Arg3558Cys)
NM_000384.3(APOB):c.10780T>C (p.Trp3594Arg)
NM_000384.3(APOB):c.11319G>A (p.Lys3773=) rs780811733
NM_000384.3(APOB):c.11401T>A (p.Ser3801Thr)
NM_000384.3(APOB):c.11477C>T (p.Thr3826Met)
NM_000384.3(APOB):c.11833A>G (p.Thr3945Ala) rs1801698
NM_000384.3(APOB):c.13369G>A (p.Asp4457Asn) rs183812948
NM_000384.3(APOB):c.26TGGCGCTGC[1] (p.9LAL[1])
NM_000384.3(APOB):c.2981C>T (p.Pro994Leu)
NM_000384.3(APOB):c.3427C>T (p.Pro1143Ser)
NM_000384.3(APOB):c.4163G>A (p.Arg1388His) rs13306187
NM_000384.3(APOB):c.5066G>A (p.Arg1689His)
NM_000384.3(APOB):c.5741A>G (p.Asn1914Ser)
NM_000384.3(APOB):c.6636TGA[1] (p.Asp2213del) rs541497967
NM_000384.3(APOB):c.6895G>C (p.Asp2299His)
NM_000384.3(APOB):c.7285T>A (p.Ser2429Thr)
NM_000384.3(APOB):c.7615G>A (p.Val2539Ile) rs148170480
NM_000384.3(APOB):c.8353A>C (p.Asn2785His) rs2163204
NM_000384.3(APOB):c.8462C>T (p.Pro2821Leu) rs72653095
NM_000432.4(MYL2):c.37G>A (p.Ala13Thr) rs104894363
NM_000527.4(LDLR):c.1102T>C (p.Cys368Arg) rs879254791
NM_000527.5(LDLR):c.1027G>A (p.Gly343Ser)
NM_000527.5(LDLR):c.1073G>A (p.Cys358Tyr) rs875989915
NM_000527.5(LDLR):c.1109A>C (p.Asn370Thr) rs879254792
NM_000527.5(LDLR):c.1124A>G (p.Tyr375Cys) rs879254800
NM_000527.5(LDLR):c.1135T>C (p.Cys379Arg)
NM_000527.5(LDLR):c.1216C>A (p.Arg406=) rs121908043
NM_000527.5(LDLR):c.1216C>T (p.Arg406Trp)
NM_000527.5(LDLR):c.1432G>A (p.Gly478Arg)
NM_000527.5(LDLR):c.1467C>G (p.Tyr489Ter) rs370777955
NM_000527.5(LDLR):c.148G>T (p.Ala50Ser) rs137853960
NM_000527.5(LDLR):c.1495T>C (p.Ser499Pro) rs879254921
NM_000527.5(LDLR):c.1567G>A (p.Val523Met)
NM_000527.5(LDLR):c.1646G>A (p.Gly549Asp)
NM_000527.5(LDLR):c.1783C>T (p.Arg595Trp)
NM_000527.5(LDLR):c.2000G>A (p.Cys667Tyr) rs28942083
NM_000527.5(LDLR):c.2043C>A (p.Cys681Ter)
NM_000527.5(LDLR):c.2231G>A (p.Arg744Gln)
NM_000527.5(LDLR):c.2282C>T (p.Thr761Met) rs138477254
NM_000527.5(LDLR):c.241C>T (p.Arg81Cys)
NM_000527.5(LDLR):c.313_313+1del rs875989896
NM_000527.5(LDLR):c.519C>G (p.Cys173Trp) rs769318035
NM_000527.5(LDLR):c.523G>A (p.Asp175Asn) rs121908033
NM_000527.5(LDLR):c.58G>A (p.Gly20Arg) rs147509697
NM_000527.5(LDLR):c.682G>A (p.Glu228Lys)
NM_000527.5(LDLR):c.81C>G (p.Cys27Trp)
NM_000527.5(LDLR):c.858C>A (p.Ser286Arg) rs140241383
NM_000527.5(LDLR):c.970G>A (p.Gly324Ser)
NM_000719.7(CACNA1C):c.1126G>A (p.Val376Ile) rs1131653
NM_000719.7(CACNA1C):c.2280G>A (p.Glu760=) rs141633456
NM_000719.7(CACNA1C):c.3531C>T (p.Tyr1177=) rs754527651
NM_000719.7(CACNA1C):c.5649G>A (p.Pro1883=) rs56270948
NM_000722.4(CACNA2D1):c.3134A>C (p.Asp1045Ala) rs35131433
NM_000891.2(KCNJ2):c.1229A>G (p.Asn410Ser) rs141069645
NM_001005242.2(PKP2):c.2377del (p.Ser793fs) rs727504432
NM_001005242.3(PKP2):c.1012A>G (p.Thr338Ala) rs139851304
NM_001005242.3(PKP2):c.1444A>G (p.Thr482Ala) rs397516999
NM_001005242.3(PKP2):c.1445C>T (p.Thr482Met) rs146882581
NM_001005242.3(PKP2):c.1627G>A (p.Val543Ile) rs146102241
NM_001005242.3(PKP2):c.1930T>C (p.Ser644Pro) rs144601090
NM_001005242.3(PKP2):c.2014-1G>C rs193922674
NM_001005242.3(PKP2):c.209G>T (p.Ser70Ile) rs75909145
NM_001005242.3(PKP2):c.419C>T (p.Ser140Phe) rs150821281
NM_001005242.3(PKP2):c.505A>G (p.Ser169Gly) rs139139859
NM_001005242.3(PKP2):c.76G>A (p.Asp26Asn) rs143004808
NM_001018004.2(TPM1):c.775A>G (p.Lys259Glu) rs144045691
NM_001035.3(RYR2):c.12540C>T (p.Gly4180=) rs772125105
NM_001035.3(RYR2):c.2267G>A (p.Ser756Asn) rs193922623
NM_001035.3(RYR2):c.2755G>A (p.Val919Met) rs201079716
NM_001035.3(RYR2):c.3407C>T (p.Ala1136Val) rs72549415
NM_001035.3(RYR2):c.5712G>A (p.Leu1904=) rs377763336
NM_001035.3(RYR2):c.5756G>A (p.Arg1919Gln) rs199893812
NM_001035.3(RYR2):c.649A>G (p.Ile217Val) rs200642525
NM_001035.3(RYR2):c.7365C>T (p.Asp2455=) rs72549416
NM_001035.3(RYR2):c.8913T>C (p.Ile2971=) rs755520825
NM_001037.5(SCN1B):c.448+193G>A rs66876876
NM_001103.3(ACTN2):c.1235C>T (p.Thr412Met) rs139515659
NM_001103.3(ACTN2):c.1292C>T (p.Ser431Leu) rs149846886
NM_001103.3(ACTN2):c.1298C>T (p.Ser433Leu) rs143749154
NM_001103.3(ACTN2):c.26A>G (p.Gln9Arg) rs121434525
NM_001103.3(ACTN2):c.744C>T (p.Tyr248=) rs749565466
NM_001134363.3(RBM20):c.1286T>C (p.Leu429Pro) rs61735272
NM_001134363.3(RBM20):c.1364C>T (p.Ser455Leu) rs189569984
NM_001134363.3(RBM20):c.1867C>T (p.Arg623Trp) rs794729148
NM_001134363.3(RBM20):c.224C>T (p.Ser75Leu) rs191342808
NM_001134363.3(RBM20):c.2452G>T (p.Ala818Ser) rs200271618
NM_001134363.3(RBM20):c.2662G>A (p.Asp888Asn) rs201370621
NM_001134363.3(RBM20):c.3261_3262delinsG (p.Ser1087fs) rs727504763
NM_001134363.3(RBM20):c.3265C>G (p.Pro1089Ala) rs147356378
NM_001134363.3(RBM20):c.3373G>A (p.Glu1125Lys) rs116908219
NM_001134363.3(RBM20):c.3504G>A (p.Leu1168=) rs377742289
NM_001134363.3(RBM20):c.3623C>T (p.Ala1208Val) rs397516618
NM_001148.6(ANK2):c.11181C>T (p.Gly3727=) rs185569619
NM_001148.6(ANK2):c.11231C>A (p.Thr3744Asn) rs121912705
NM_001148.6(ANK2):c.4315G>T (p.Gly1439Cys) rs34591340
NM_001148.6(ANK2):c.4456G>C (p.Val1486Leu) rs149678604
NM_001148.6(ANK2):c.4745G>A (p.Arg1582Gln) rs138842207
NM_001148.6(ANK2):c.9286A>G (p.Ser3096Gly) rs144158934
NM_001232.4(CASQ2):c.1185C>T (p.Asp395=) rs7413162
NM_001232.4(CASQ2):c.421-15C>G rs199939582
NM_001267550.2(TTN):c.106580A>T (p.Glu35527Val) rs55725279
NM_001267550.2(TTN):c.11311+5478T>G rs72648908
NM_001267550.2(TTN):c.11312-5194_11312-5162dup rs397517815
NM_001267550.2(TTN):c.22745_22746del (p.Ser7582fs) rs779549899
NM_001267550.2(TTN):c.32970_32987del (p.10987_10989EEY[1]) rs766756026
NM_001267550.2(TTN):c.33063A>G (p.Glu11021=) rs115744476
NM_001267550.2(TTN):c.34129GTTCTACCTGAAGAAGAGGAA[1] (p.11363VLPEEEE[3]) rs587780487
NM_001267550.2(TTN):c.39731TTGCTCCTGAAGAGGAAA[1] (p.13244IAPEEE[1]) rs139512154
NM_001267550.2(TTN):c.40576GAA[3] (p.Glu13529del) rs727504199
NM_001267550.2(TTN):c.41958A>G (p.Ala13986=) rs186699871
NM_001267550.2(TTN):c.44272C>T (p.Arg14758Ter) rs140743001
NM_001267550.2(TTN):c.5373C>A (p.Thr1791=) rs727503693
NM_001267550.2(TTN):c.587AAG[2] (p.Glu198del) rs771898264
NM_001267550.2(TTN):c.90758GAG[2] (p.Gly30255del) rs748912340
NM_001267550.2(TTN):c.97492+1G>C rs727505319
NM_001276345.2(TNNT2):c.237G>A (p.Ser79=) rs3729845
NM_001276345.2(TNNT2):c.348C>T (p.Ile116=) rs3729547
NM_001276345.2(TNNT2):c.548G>A (p.Arg183Gln) rs397516471
NM_001276345.2(TNNT2):c.68-5_68-3delinsTT rs397516362
NM_001276345.2(TNNT2):c.788A>G (p.Lys263Arg) rs3730238
NM_001276345.2(TNNT2):c.862C>T (p.Arg288Cys) rs121964857
NM_001354689.3(RAF1):c.983C>T (p.Pro328Leu) rs5746220
NM_001613.4(ACTA2):c.720G>C (p.Lys240Asn) rs727502878
NM_001943.5(DSG2):c.1003A>G (p.Thr335Ala) rs191564916
NM_001943.5(DSG2):c.1550C>T (p.Ala517Val) rs200509948
NM_001943.5(DSG2):c.166G>A (p.Val56Met) rs121913013
NM_001943.5(DSG2):c.2759T>G (p.Val920Gly) rs142841727
NM_001943.5(DSG2):c.2886T>G (p.Ile962Met) rs79229040
NM_001943.5(DSG2):c.3209C>T (p.Thr1070Met) rs149617776
NM_001943.5(DSG2):c.3295A>G (p.Thr1099Ala) rs79068489
NM_001943.5(DSG2):c.473T>G (p.Val158Gly) rs191143292
NM_002230.4(JUP):c.1942G>A (p.Val648Ile) rs143043662
NM_002230.4(JUP):c.2139G>A (p.Pro713=) rs782165431
NM_002230.4(JUP):c.425G>A (p.Arg142His) rs41283425
NM_002294.3(LAMP2):c.1093+2514G>A rs144140265
NM_002294.3(LAMP2):c.586A>T (p.Thr196Ser) rs138991195
NM_002294.3(LAMP2):c.591G>A (p.Val197=) rs201030806
NM_002294.3(LAMP2):c.661G>A (p.Gly221Arg) rs145169006
NM_002294.3(LAMP2):c.755T>G (p.Ile252Ser) rs141541387
NM_002471.3(MYH6):c.2547G>A (p.Lys849=) rs770629886
NM_002471.3(MYH6):c.3876G>A (p.Gln1292=) rs145290322
NM_002471.3(MYH6):c.635C>T (p.Ala212Val) rs780456381
NM_002471.4(MYH6):c.1131C>T (p.Asp377=) rs61742472
NM_002471.4(MYH6):c.1763A>C (p.Asp588Ala) rs142992009
NM_002471.4(MYH6):c.2579G>A (p.Arg860His) rs115845031
NM_002471.4(MYH6):c.3883G>C (p.Glu1295Gln) rs34935550
NM_002471.4(MYH6):c.4136C>T (p.Thr1379Met) rs145611185
NM_002471.4(MYH6):c.4986G>A (p.Ala1662=) rs77416370
NM_002471.4(MYH6):c.622G>A (p.Asp208Asn) rs142027794
NM_002474.3(MYH11):c.1502G>A (p.Arg501His) rs144244239
NM_002474.3(MYH11):c.5529G>A (p.Ser1843=) rs146024732
NM_002834.5(PTPN11):c.1403C>T (p.Thr468Met) rs121918457
NM_002834.5(PTPN11):c.1658C>T (p.Thr553Met) rs148176616
NM_002834.5(PTPN11):c.925A>G (p.Ile309Val) rs201787206
NM_003098.2(SNTA1):c.221C>T (p.Pro74Leu) rs572545726
NM_003098.2(SNTA1):c.770C>G (p.Ala257Gly) rs56157422
NM_003238.5(TGFB2):c.272G>A (p.Arg91His) rs10482721
NM_003242.6(TGFBR2):c.1119G>A (p.Met373Ile) rs35719192
NM_003319.4(TTN):c.13282+39166del rs1553868981
NM_003476.5(CSRP3):c.10T>C (p.Trp4Arg) rs45550635
NM_003476.5(CSRP3):c.150G>A (p.Ala50=) rs7124801
NM_003673.4(TCAP):c.34GAG[1] (p.Glu13del) rs397516862
NM_004006.2(DMD):c.1028G>A (p.Arg343His) rs61733589
NM_004006.2(DMD):c.1554T>A (p.Asp518Glu) rs61733587
NM_004006.2(DMD):c.1731A>T (p.Glu577Asp) rs150199251
NM_004006.2(DMD):c.1934A>G (p.Asp645Gly) rs147822019
NM_004006.2(DMD):c.2291A>G (p.Asn764Ser) rs199588981
NM_004006.2(DMD):c.2824A>G (p.Met942Val) rs371648742
NM_004006.2(DMD):c.2827C>T (p.Arg943Cys) rs199986217
NM_004006.2(DMD):c.3419A>T (p.His1140Leu) rs201297190
NM_004006.2(DMD):c.4529A>G (p.Lys1510Arg) rs72468638
NM_004006.2(DMD):c.7323T>C (p.Thr2441=) rs201919981
NM_004006.3(DMD):c.2143A>T (p.Thr715Ser) rs16998350
NM_004006.3(DMD):c.2391T>G (p.Asn797Lys) rs72468681
NM_004006.3(DMD):c.3970C>T (p.Arg1324Cys) rs143184877
NM_004006.3(DMD):c.7183G>A (p.Ala2395Thr) rs72466590
NM_004281.4(BAG3):c.249C>A (p.His83Gln) rs151331972
NM_004281.4(BAG3):c.463G>A (p.Ala155Thr) rs61756328
NM_004281.4(BAG3):c.468GGC[4] (p.Ala160dup) rs139438727
NM_004415.4(DSP):c.1557C>T (p.Ala519=) rs769629611
NM_004415.4(DSP):c.1920C>T (p.Ile640=) rs74806300
NM_004415.4(DSP):c.2091A>G (p.Gly697=) rs2076304
NM_004415.4(DSP):c.2596C>T (p.Arg866Cys) rs142429411
NM_004415.4(DSP):c.2815G>A (p.Gly939Ser) rs80325569
NM_004415.4(DSP):c.3923G>A (p.Arg1308Gln) rs184154918
NM_004415.4(DSP):c.4455G>T (p.Arg1485Ser) rs113902911
NM_004415.4(DSP):c.4489C>T (p.Arg1497Trp) rs148041814
NM_004415.4(DSP):c.4535A>G (p.Tyr1512Cys) rs2076299
NM_004415.4(DSP):c.5218G>A (p.Glu1740Lys) rs142885240
NM_004415.4(DSP):c.5498A>T (p.Glu1833Val) rs78652302
NM_004415.4(DSP):c.5555G>A (p.Arg1852His) rs193922669
NM_004415.4(DSP):c.6208G>A (p.Asp2070Asn) rs41302885
NM_004415.4(DSP):c.6881C>G (p.Ala2294Gly) rs147000526
NM_004415.4(DSP):c.8496ATCTCGCTCCGG[1] (p.2827SGSR[4]) rs397516971
NM_004415.4(DSP):c.913A>T (p.Ile305Phe) rs17604693
NM_004572.3(PKP2):c.2299+1G>A rs794729116
NM_004980.4(KCND3):c.5C>A (p.Ala2Glu) rs201340369
NM_005477.3(HCN4):c.2275G>A (p.Val759Ile) rs62641689
NM_005691.3(ABCC9):c.4570T>A (p.Leu1524Ile) rs139703258
NM_005691.3(ABCC9):c.4571T>A (p.Leu1524Ter) rs150631550
NM_005691.3(ABCC9):c.4572_4573insT (p.Val1525fs) rs761784169
NM_005751.4(AKAP9):c.10331A>G (p.Gln3444Arg) rs34956633
NM_005751.4(AKAP9):c.2945C>A (p.Ser982Tyr) rs374340343
NM_005751.4(AKAP9):c.5369T>G (p.Val1790Gly) rs151021935
NM_005751.4(AKAP9):c.80C>T (p.Ser27Leu) rs142401936
NM_005902.4(SMAD3):c.207-26869C>A rs958007552
NM_006073.4(TRDN):c.1598-6dup rs147062785
NM_007078.3(LDB3):c.147G>A (p.Val49=) rs45591834
NM_007078.3(LDB3):c.1609del (p.Gln537fs) rs727503129
NM_007078.3(LDB3):c.273G>A (p.Thr91=) rs45613039
NM_007078.3(LDB3):c.466G>A (p.Ala156Thr) rs200596619
NM_014000.3(VCL):c.366G>A (p.Leu122=) rs199562976
NM_014391.3(ANKRD1):c.148G>C (p.Ala50Pro) rs28730751
NM_014391.3(ANKRD1):c.319G>T (p.Val107Leu) rs114435632
NM_015627.2(LDLRAP1):c.605C>A (p.Ser202Tyr) rs121908326
NM_016203.4(PRKAG2):c.591C>T (p.Pro197=) rs587781126
NM_016203.4(PRKAG2):c.59G>T (p.Ser20Ile) rs116605521
NM_016492.5(RANGRF):c.181G>T (p.Glu61Ter) rs140704891
NM_017636.4(TRPM4):c.1682A>C (p.Asp561Ala) rs56355369
NM_017636.4(TRPM4):c.2283_2294del (p.759_762CGGR[1]) rs113100797
NM_017636.4(TRPM4):c.618G>A (p.Ser206=) rs142788545
NM_020433.4(JPH2):c.1380G>A (p.Ala460=) rs531877510
NM_020433.5(JPH2):c.572C>G (p.Pro191Arg) rs554853074
NM_020433.5(JPH2):c.661T>C (p.Phe221Leu) rs558770240
NM_022437.3(ABCG8):c.1201A>T (p.Thr401Ser) rs144200355
NM_024334.3(TMEM43):c.953C>T (p.Ala318Val) rs11924644
NM_024422.6(DSC2):c.172T>G (p.Phe58Val) rs138749562
NM_024422.6(DSC2):c.1787C>T (p.Ala596Val) rs148185335
NM_024422.6(DSC2):c.2686_2687dup (p.Ala897fs) rs200056085
NM_024422.6(DSC2):c.561T>C (p.Tyr187=)
NM_024422.6(DSC2):c.608G>A (p.Arg203His) rs758527425
NM_032578.4(MYPN):c.1790G>A (p.Arg597His) rs150911078
NM_032578.4(MYPN):c.3335C>T (p.Pro1112Leu) rs71534278
NM_032578.4(MYPN):c.59A>G (p.Tyr20Cys) rs140148105
NM_033337.2(CAV3):c.216C>G (p.Cys72Trp) rs116840776
NM_033337.3(CAV3):c.-1G>A rs74377241
NM_033337.3(CAV3):c.233C>T (p.Thr78Met) rs72546668
NM_033337.3(CAV3):c.443G>A (p.Arg148Gln) rs140575619
NM_053025.4(MYLK):c.399G>T (p.Gln133His) rs140148380
NM_144573.4(NEXN):c.1671GGA[2] (p.Glu561_Glu562del) rs397517848
NM_170707.4(LMNA):c.1698C>T (p.His566=) rs4641
NM_170707.4(LMNA):c.1930C>T (p.Arg644Cys) rs142000963
NM_170707.4(LMNA):c.51C>T (p.Ser17=) rs11549668
NM_170707.4(LMNA):c.725C>T (p.Ala242Val) rs397517906
NM_172056.2(KCNH2):c.1056C>T (p.Pro352=) rs1554427342
NM_172056.2(KCNH2):c.51C>G (p.Thr17=) rs144338227
NM_172056.2(KCNH2):c.568G>A (p.Ala190Thr) rs150817714
NM_172056.2(KCNH2):c.66dup (p.Glu23Ter) rs1554431441
NM_174936.3(PCSK9):c.1405C>T (p.Arg469Trp)
NM_174936.4(PCSK9):c.45GCT[8] (p.Leu23dup) rs35574083
NM_174936.4(PCSK9):c.523G>A (p.Asp175Asn)
NM_181798.1(KCNQ1):c.1319T>C (p.Ile440Thr) rs199472805
NM_181798.1(KCNQ1):c.538_540+9del rs794728557
NM_181798.1(KCNQ1):c.643C>T (p.Leu215Phe) rs199472760
NM_181798.1(KCNQ1):c.704A>G (p.Lys235Arg) rs12720458
NM_181798.1(KCNQ1):c.754T>C (p.Trp252Arg) rs199472768
NM_198056.2(SCN5A):c.3384C>T (p.Cys1128=) rs561922849
NM_198056.2(SCN5A):c.3718G>C (p.Glu1240Gln) rs199473211
NM_198056.2(SCN5A):c.4981G>A (p.Gly1661Arg) rs199473292
NM_198056.2(SCN5A):c.5367C>T (p.Asp1789=) rs375752426
NM_198056.2(SCN5A):c.656G>A (p.Arg219His) rs878855296
NM_198056.2(SCN5A):c.80G>A (p.Arg27His) rs199473045

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.