ClinVar Miner

Variants from Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease, Montreal Heart Institute with conflicting interpretations

Location: Canada  Primary collection method: clinical testing
Minimum review status of the submission from Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease, Montreal Heart Institute: Collection method of the submission from Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease, Montreal Heart Institute:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
590 281 0 298 147 5 43 432

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease, Montreal Heart Institute pathogenic likely pathogenic uncertain significance likely benign benign drug response risk factor other
pathogenic 0 43 2 1 0 0 0 0
likely pathogenic 30 0 22 4 1 0 0 0
uncertain significance 8 10 0 67 25 0 0 0
likely benign 0 0 51 0 136 0 1 1
benign 1 0 25 89 0 0 0 0
risk factor 0 1 2 1 1 1 0 2
other 0 0 0 1 1 0 1 0

Submitter to submitter summary #

Total submitters: 90
Download table as spreadsheet
Submitter Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
Ambry Genetics 0 308 0 99 46 1 10 156
GeneDx 0 315 0 96 31 1 7 135
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine 0 208 0 58 30 0 2 90
Women's Health and Genetics/Laboratory Corporation of America, LabCorp 0 104 0 63 22 1 2 88
Clinical Genetics, Academic Medical Center 0 153 0 68 13 0 1 82
CeGaT Center for Human Genetics Tuebingen 0 65 0 41 16 3 0 60
Eurofins Ntd Llc (ga) 0 71 0 25 29 4 1 59
PreventionGenetics, part of Exact Sciences 0 170 0 37 13 0 0 50
Joint Genome Diagnostic Labs from Nijmegen and Maastricht, Radboudumc and MUMC+ 0 148 0 41 8 0 1 50
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories 0 97 0 34 10 1 0 45
Genome Diagnostics Laboratory, University Medical Center Utrecht 0 95 0 33 9 1 0 43
Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center 0 108 0 32 9 0 0 41
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen 0 87 0 25 9 1 1 36
Invitae 0 50 0 16 10 0 7 33
Illumina Laboratory Services, Illumina 0 17 0 17 12 0 4 33
Stanford Center for Inherited Cardiovascular Disease, Stanford University 0 22 0 7 15 0 1 23
Biesecker Lab/Clinical Genomics Section, National Institutes of Health 0 61 0 14 7 0 0 21
Athena Diagnostics Inc 0 22 0 17 2 0 1 20
Laboratory of Diagnostic Genome Analysis, Leiden University Medical Center (LUMC) 0 17 0 16 2 0 0 18
Quest Diagnostics Nichols Institute San Juan Capistrano 0 16 0 11 4 0 0 15
Genetic Services Laboratory, University of Chicago 0 13 0 10 3 0 1 14
CSER _CC_NCGL, University of Washington 0 16 0 3 4 0 4 11
Center for Pediatric Genomic Medicine, Children's Mercy Hospital and Clinics 0 9 0 10 1 0 0 11
Color Diagnostics, LLC DBA Color Health 0 41 0 7 3 0 1 11
Department of Pathology and Laboratory Medicine, Sinai Health System 0 4 0 1 8 2 0 11
Laboratory of Genetics and Molecular Cardiology, University of São Paulo 0 9 0 9 0 0 1 10
Robarts Research Institute, Western University 0 2 0 9 1 0 0 10
Blueprint Genetics 0 25 0 7 0 0 2 9
LDLR-LOVD, British Heart Foundation 0 10 0 8 0 0 1 9
Revvity Omics, Revvity 0 16 0 2 6 0 0 8
Agnes Ginges Centre for Molecular Cardiology, Centenary Institute 0 9 0 2 2 0 3 7
Centre de Génétique Moléculaire et Chromosomique, Unité de génétique de l'Obésité et des Dyslipidémies, APHP, GH Hôpitaux Universitaires Pitié-Salpêtrière / Charles-Foix 0 6 0 6 0 0 1 7
Mayo Clinic Laboratories, Mayo Clinic 0 11 0 4 2 0 0 6
All of Us Research Program, National Institutes of Health 0 27 0 2 0 0 4 6
OMIM 0 20 0 1 0 2 2 5
Mendelics 0 3 0 1 3 0 1 5
Fundacion Hipercolesterolemia Familiar 0 4 0 5 0 0 0 5
Molecular Genetics Laboratory, Centre for Cardiovascular Surgery and Transplantation 0 1 0 4 0 0 0 4
AiLife Diagnostics, AiLife Diagnostics 0 9 0 2 0 1 1 4
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics, Children's Hospital of Philadelphia 0 2 0 3 0 0 0 3
Fulgent Genetics, Fulgent Genetics 0 6 0 3 0 0 0 3
Center for Medical Genetics Ghent, University of Ghent 0 6 0 3 0 0 0 3
Institute of Human Genetics, University of Leipzig Medical Center 0 4 0 1 0 1 1 3
Iberoamerican FH Network 0 2 0 3 0 0 0 3
Broad Center for Mendelian Genomics, Broad Institute of MIT and Harvard 0 5 0 3 0 0 0 3
ClinGen Familial Hypercholesterolemia Variant Curation Expert Panel 0 2 0 3 0 0 0 3
Baylor Genetics 0 1 0 2 0 0 0 2
MGZ Medical Genetics Center 0 2 0 2 0 0 0 2
Victorian Clinical Genetics Services, Murdoch Childrens Research Institute 0 3 0 1 0 0 1 2
U4M - Lille University & CHRU Lille, Université de Lille - CHRU de Lille 0 11 0 2 0 0 0 2
Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde, Academisch Medisch Centrum 0 11 0 1 0 0 1 2
Genome Diagnostics Laboratory, Amsterdam University Medical Center 0 7 0 2 0 0 0 2
Laboratory of Medical Genetics, National & Kapodistrian University of Athens 0 1 0 2 0 0 0 2
Brunham Lab, Centre for Heart and Lung Innovation, University of British Columbia 0 6 0 2 0 0 0 2
Laboratory of molecular diagnosis of dyslipidemias, Università egli studi di Napoli Federico II 0 4 0 1 0 0 1 2
Human Genetics Bochum, Ruhr University Bochum 0 0 0 2 0 0 0 2
Dept of Medical Biology, Uskudar University 0 2 0 2 0 0 0 2
Center for Human Genetics, Inc, Center for Human Genetics, Inc 0 1 0 1 0 0 0 1
Clinical Molecular Genetics Laboratory, Johns Hopkins All Children's Hospital 0 0 0 0 0 0 1 1
Molecular Diagnostics Lab, Nemours Children's Health, Delaware 0 0 0 1 0 0 0 1
Institute for Genomic Medicine (IGM) Clinical Laboratory, Nationwide Children's Hospital 0 4 0 0 1 0 0 1
Molecular Genetics Laboratory, BC Children's and BC Women's Hospitals 0 0 0 0 1 0 0 1
Cardiovascular Genetics Laboratory, PathWest Laboratory Medicine WA - Fiona Stanley Hospital 0 6 0 1 0 0 0 1
Natera, Inc. 0 4 0 0 1 0 0 1
Human Genome Sequencing Center Clinical Lab, Baylor College of Medicine 0 6 0 1 0 0 0 1
PharmGKB 0 0 0 0 0 1 0 1
Genomic Research Center, Shahid Beheshti University of Medical Sciences 0 0 0 0 1 0 0 1
Centre of Medical Genetics, University of Antwerp 0 4 0 1 0 0 0 1
Knight Diagnostic Laboratories, Oregon Health and Sciences University 0 0 0 1 0 0 0 1
Center of Genomic medicine, Geneva, University Hospital of Geneva 0 1 0 1 0 0 0 1
Institute for Clinical Genetics, University Hospital TU Dresden, University Hospital TU Dresden 0 0 0 1 0 0 0 1
Clinical Genetics, Erasmus University Medical Center 0 0 0 0 1 0 0 1
Petrovsky National Research Centre of Surgery, The Federal Agency for Scientific Organizations 0 1 0 1 0 0 0 1
Cardiovascular Research Group, Instituto Nacional de Saude Doutor Ricardo Jorge 0 4 0 1 0 0 0 1
NIHR Bioresource Rare Diseases, University of Cambridge 0 0 0 1 0 0 0 1
SIB Swiss Institute of Bioinformatics 0 0 0 1 0 0 0 1
Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen 0 2 0 0 0 0 1 1
Department of Human Genetics, Laborarztpraxis Dres. Walther, Weindel und Kollegen 0 1 0 1 0 0 0 1
Klaassen Lab, Charite University Medicine Berlin 0 0 0 1 0 0 0 1
deCODE genetics, Amgen 0 1 0 1 0 0 0 1
Center for Advanced Laboratory Medicine, UC San Diego Health, University of California San Diego 0 0 0 0 1 0 0 1
Zotz-Klimas Genetics Lab, MVZ Zotz Klimas 0 1 0 1 0 0 0 1
Cardiology unit, Meyer University Hospital 0 0 0 1 0 0 0 1
Institute of Human Genetics, University Hospital Muenster 0 1 0 0 1 0 0 1
3billion 0 6 0 1 0 0 0 1
Practice for Gait Abnormalities, David Pomarino, Competency Network Toe Walking c/o Practice Pomarino 0 0 0 1 0 0 0 1
Institute of Human Genetics, Clinical Exome/Genome Diagnostics Group, University Hospital Bonn 0 0 0 1 0 0 0 1
Clinical Center for Gene Diagnosis and Therapy, Department of Cardiovascular Surgery, The Second Xiangya Hospital of Central South University 0 1 0 1 0 0 0 1
Biology Molecular and Stem Cell Facilities Laboratory, National Cardiovascular Center, Harapan Kita Hospital 0 0 0 0 0 0 1 1
KardioGenetik, Herz- und Diabeteszentrum NRW 0 0 0 1 0 0 0 1

All variants with conflicting interpretations #

Total variants: 432
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_004415.4(DSP):c.2091A>G (p.Gly697=) rs2076304 0.76849
NM_001276345.2(TNNT2):c.348C>T (p.Ile116=) rs3729547 0.69444
NM_000257.4(MYH7):c.2967T>C (p.Ile989=) rs7157716 0.43030
NM_032578.4(MYPN):c.3403C>A (p.Pro1135Thr) rs7079481 0.40619
NM_001232.4(CASQ2):c.1185C>T (p.Asp395=) rs7413162 0.39681
NM_032578.4(MYPN):c.1884C>G (p.Phe628Leu) rs10823148 0.39447
NM_032578.4(MYPN):c.2072G>A (p.Ser691Asn) rs10997975 0.39270
NM_032578.4(MYPN):c.2120G>A (p.Ser707Asn) rs7916821 0.39079
NM_000363.5(TNNI3):c.25-8T>A rs3729836 0.35138
NM_000257.4(MYH7):c.732C>T (p.Phe244=) rs2069542 0.27385
NM_000335.5(SCN5A):c.1673A>G (p.His558Arg) rs1805124 0.24768
NM_006514.4(SCN10A):c.3275T>C (p.Leu1092Pro) rs12632942 0.21722
NM_006514.4(SCN10A):c.2884A>G (p.Ile962Val) rs57326399 0.20797
NM_170707.4(LMNA):c.1698C>T (p.His566=) rs4641 0.20715
NM_000041.4(APOE):c.388T>C (p.Cys130Arg) rs429358 0.16059
NM_004415.4(DSP):c.4535A>G (p.Tyr1512Cys) rs2076299 0.13777
NM_001276345.2(TNNT2):c.237G>A (p.Ser79=) rs3729845 0.08311
NM_000041.2(APOE):c.526C>T (p.Arg176Cys) rs7412 0.07986
NM_002471.4(MYH6):c.166G>A (p.Gly56Arg) rs28711516 0.06950
NM_000257.4(MYH7):c.1062C>T (p.Gly354=) rs735712 0.06133
NM_001276345.2(TNNT2):c.788A>G (p.Lys263Arg) rs3730238 0.05965
NM_002230.4(JUP):c.425G>A (p.Arg142His) rs41283425 0.03910
NM_005902.4(SMAD3):c.508A>G (p.Ile170Val) rs35874463 0.03414
NM_000363.5(TNNI3):c.198G>A (p.Glu66=) rs3729710 0.03372
NM_003476.5(CSRP3):c.150G>A (p.Ala50=) rs7124801 0.03207
NM_022773.4(LMF1):c.1091G>A (p.Arg364Gln) rs35168378 0.02818
NM_004415.4(DSP):c.913A>T (p.Ile305Phe) rs17604693 0.02655
NM_000335.5(SCN5A):c.3305C>A (p.Ser1102Tyr) rs7626962 0.02208
NM_016203.4(PRKAG2):c.59G>T (p.Ser20Ile) rs116605521 0.02188
NM_001005242.3(PKP2):c.209G>T (p.Ser70Ile) rs75909145 0.01900
NM_000257.4(MYH7):c.975C>T (p.Asp325=) rs2231124 0.01865
NM_032578.4(MYPN):c.2410G>A (p.Gly804Arg) rs62620248 0.01839
NM_001035.3(RYR2):c.5654G>A (p.Gly1885Glu) rs41315858 0.01767
NM_000719.7(CACNA1C):c.5649G>A (p.Pro1883=) rs56270948 0.01676
NM_001035.3(RYR2):c.4198A>G (p.Ser1400Gly) rs56229512 0.01531
NM_005751.5(AKAP9):c.10331A>G (p.Gln3444Arg) rs34956633 0.01509
NM_000256.3(MYBPC3):c.2601C>T (p.Ile867=) rs11570097 0.01438
NM_000257.4(MYH7):c.1002C>T (p.Asn334=) rs34803781 0.01418
NM_000256.3(MYBPC3):c.1144C>T (p.Arg382Trp) rs11570076 0.01409
NM_004415.4(DSP):c.4773G>A (p.Arg1591=) rs28763968 0.01341
NM_000237.3(LPL):c.953A>G (p.Asn318Ser) rs268 0.01327
NM_004415.4(DSP):c.2815G>A (p.Gly939Ser) rs80325569 0.01244
NM_004006.3(DMD):c.1554T>A (p.Asp518Glu) rs61733587 0.01098
NM_001943.5(DSG2):c.3243C>T (p.Val1081=) rs11542379 0.01097
NM_004415.4(DSP):c.5498A>T (p.Glu1833Val) rs78652302 0.00908
NM_000257.4(MYH7):c.4472C>G (p.Ser1491Cys) rs3729823 0.00861
NM_000257.4(MYH7):c.597A>G (p.Ala199=) rs2069541 0.00853
NM_000219.6(KCNE1):c.253G>A (p.Asp85Asn) rs1805128 0.00841
NM_170707.4(LMNA):c.51C>T (p.Ser17=) rs11549668 0.00797
NM_000218.3(KCNQ1):c.1927G>A (p.Gly643Ser) rs1800172 0.00760
NM_002230.4(JUP):c.1942G>A (p.Val648Ile) rs143043662 0.00760
NM_001035.3(RYR2):c.3407C>T (p.Ala1136Val) rs72549415 0.00737
NM_001005242.3(PKP2):c.76G>A (p.Asp26Asn) rs143004808 0.00716
NM_004006.3(DMD):c.2391T>G (p.Asn797Lys) rs72468681 0.00714
NM_000363.5(TNNI3):c.244C>T (p.Pro82Ser) rs77615401 0.00699
NM_001005242.3(PKP2):c.174G>T (p.Glu58Asp) rs146708884 0.00677
NM_024334.3(TMEM43):c.698A>G (p.Tyr233Cys) rs35924492 0.00660
NM_001267550.2(TTN):c.33063A>G (p.Glu11021=) rs115744476 0.00640
NM_053025.4(MYLK):c.2101G>A (p.Ala701Thr) rs142835596 0.00637
NM_020433.5(JPH2):c.661T>C (p.Phe221Leu) rs558770240 0.00630
NM_024334.3(TMEM43):c.953C>T (p.Ala318Val) rs11924644 0.00629
NM_004006.3(DMD):c.2143A>T (p.Thr715Ser) rs16998350 0.00594
NM_002471.4(MYH6):c.2579G>A (p.Arg860His) rs115845031 0.00573
NM_004415.4(DSP):c.4455G>T (p.Arg1485Ser) rs113902911 0.00572
NM_002880.4(RAF1):c.923C>T (p.Pro308Leu) rs5746220 0.00571
NM_001134363.3(RBM20):c.1364C>T (p.Ser455Leu) rs189569984 0.00554
NM_001943.5(DSG2):c.473T>G (p.Val158Gly) rs191143292 0.00550
NM_000257.4(MYH7):c.3153G>A (p.Ala1051=) rs45540831 0.00505
NM_000371.4(TTR):c.424G>A (p.Val142Ile) rs76992529 0.00501
NM_001943.5(DSG2):c.2759T>G (p.Val920Gly) rs142841727 0.00439
NM_017636.4(TRPM4):c.618G>A (p.Ser206=) rs142788545 0.00422
NM_002471.4(MYH6):c.622G>A (p.Asp208Asn) rs142027794 0.00415
NM_001035.3(RYR2):c.7365C>T (p.Asp2455=) rs72549416 0.00413
NM_000256.3(MYBPC3):c.530G>A (p.Arg177His) rs201012766 0.00405
NM_002294.3(LAMP2):c.1093+2514G>A rs144140265 0.00404
NM_000384.3(APOB):c.607A>G (p.Ile203Val) rs72653059 0.00396
NM_001005242.3(PKP2):c.1445C>T (p.Thr482Met) rs146882581 0.00396
NM_014391.3(ANKRD1):c.148G>C (p.Ala50Pro) rs28730751 0.00387
NM_172201.2(KCNE2):c.22A>G (p.Thr8Ala) rs2234916 0.00387
NM_000256.3(MYBPC3):c.977G>A (p.Arg326Gln) rs34580776 0.00376
NM_000722.4(CACNA2D1):c.3134A>C (p.Asp1045Ala) rs35131433 0.00374
NM_017636.4(TRPM4):c.1682A>C (p.Asp561Ala) rs56355369 0.00373
NM_000335.5(SCN5A):c.1441C>T (p.Arg481Trp) rs144511230 0.00372
NM_001134363.3(RBM20):c.2662G>A (p.Asp888Asn) rs201370621 0.00344
NM_004281.4(BAG3):c.249C>A (p.His83Gln) rs151331972 0.00344
NM_001134363.3(RBM20):c.3373G>A (p.Glu1125Lys) rs116908219 0.00333
NM_032578.4(MYPN):c.3335C>T (p.Pro1112Leu) rs71534278 0.00318
NM_033337.3(CAV3):c.233C>T (p.Thr78Met) rs72546668 0.00317
NM_007078.3(LDB3):c.147G>A (p.Val49=) rs45591834 0.00312
NM_000169.3(GLA):c.937G>T (p.Asp313Tyr) rs28935490 0.00308
NM_000384.3(APOB):c.8353A>C (p.Asn2785His) rs2163204 0.00306
NM_003238.6(TGFB2):c.272G>A (p.Arg91His) rs10482721 0.00297
NM_004415.4(DSP):c.6208G>A (p.Asp2070Asn) rs41302885 0.00290
NM_001943.5(DSG2):c.2886T>G (p.Ile962Met) rs79229040 0.00285
NM_004006.3(DMD):c.4529A>G (p.Lys1510Arg) rs72468638 0.00279
NM_003476.5(CSRP3):c.10T>C (p.Trp4Arg) rs45550635 0.00271
NM_014391.3(ANKRD1):c.319G>T (p.Val107Leu) rs114435632 0.00269
NM_000384.3(APOB):c.8462C>T (p.Pro2821Leu) rs72653095 0.00267
NM_005477.3(HCN4):c.2275G>A (p.Val759Ile) rs62641689 0.00258
NM_001005242.3(PKP2):c.1627G>A (p.Val543Ile) rs146102241 0.00255
NM_001005242.3(PKP2):c.419C>T (p.Ser140Phe) rs150821281 0.00252
NM_001134363.3(RBM20):c.3265C>G (p.Pro1089Ala) rs147356378 0.00252
NM_000384.3(APOB):c.13369G>A (p.Asp4457Asn) rs183812948 0.00250
NM_000256.3(MYBPC3):c.2992C>G (p.Gln998Glu) rs11570112 0.00247
NM_004281.4(BAG3):c.463G>A (p.Ala155Thr) rs61756328 0.00239
NM_001148.6(ANK2):c.9286A>G (p.Ser3096Gly) rs144158934 0.00238
NM_001037.5(SCN1B):c.448+193G>A rs66876876 0.00227
NM_000256.3(MYBPC3):c.3004C>T (p.Arg1002Trp) rs3729799 0.00223
NM_001943.5(DSG2):c.3209C>T (p.Thr1070Met) rs149617776 0.00223
NM_000335.5(SCN5A):c.3575G>A (p.Arg1192Gln) rs41261344 0.00222
NM_000257.4(MYH7):c.297C>T (p.Pro99=) rs140245862 0.00220
NM_002471.4(MYH6):c.3883G>C (p.Glu1295Gln) rs34935550 0.00217
NM_003098.3(SNTA1):c.770C>G (p.Ala257Gly) rs56157422 0.00217
NM_002474.3(MYH11):c.4604G>A (p.Arg1535Gln) rs137934837 0.00216
NM_004415.4(DSP):c.2596C>T (p.Arg866Cys) rs142429411 0.00214
NM_004006.3(DMD):c.3970C>T (p.Arg1324Cys) rs143184877 0.00208
NM_033337.3(CAV3):c.-1G>A rs74377241 0.00201
NM_003098.3(SNTA1):c.221C>T (p.Pro74Leu) rs572545726 0.00198
NM_002294.3(LAMP2):c.661G>A (p.Gly221Arg) rs145169006 0.00193
NM_000335.5(SCN5A):c.6007T>C (p.Phe2003Leu) rs41311117 0.00192
NM_133379.5(TTN):c.14754T>G (p.Pro4918=) rs72648908 0.00190
NM_000256.3(MYBPC3):c.565G>A (p.Val189Ile) rs11570052 0.00187
NM_001943.5(DSG2):c.1550C>T (p.Ala517Val) rs200509948 0.00184
NM_022437.3(ABCG8):c.1201A>T (p.Thr401Ser) rs144200355 0.00179
NM_000257.4(MYH7):c.480C>T (p.Asn160=) rs45500700 0.00178
NM_000335.5(SCN5A):c.1852C>T (p.Leu618Phe) rs45488304 0.00178
NM_004415.4(DSP):c.4489C>T (p.Arg1497Trp) rs148041814 0.00178
NM_000256.3(MYBPC3):c.1519G>A (p.Gly507Arg) rs35736435 0.00177
NM_053025.4(MYLK):c.399G>T (p.Gln133His) rs140148380 0.00167
NM_033337.2(CAV3):c.216C>G (p.Cys72Trp) rs116840776 0.00164
NM_032578.4(MYPN):c.1790G>A (p.Arg597His) rs150911078 0.00158
NM_004415.4(DSP):c.1920C>T (p.Ile640=) rs74806300 0.00156
NM_002471.4(MYH6):c.1763A>C (p.Asp588Ala) rs142992009 0.00153
NM_001943.5(DSG2):c.166G>A (p.Val56Met) rs121913013 0.00150
NM_015627.3(LDLRAP1):c.605C>A (p.Ser202Tyr) rs121908326 0.00147
NM_001005242.3(PKP2):c.1012A>G (p.Thr338Ala) rs139851304 0.00142
NM_001943.5(DSG2):c.3295A>G (p.Thr1099Ala) rs79068489 0.00137
NM_005751.5(AKAP9):c.80C>T (p.Ser27Leu) rs142401936 0.00137
NM_003242.6(TGFBR2):c.1119G>A (p.Met373Ile) rs35719192 0.00130
NM_032578.4(MYPN):c.59A>G (p.Tyr20Cys) rs140148105 0.00130
NM_000256.3(MYBPC3):c.3106C>T (p.Arg1036Cys) rs61729664 0.00128
NM_001134363.3(RBM20):c.1286T>C (p.Leu429Pro) rs61735272 0.00126
NM_004006.3(DMD):c.7183G>A (p.Ala2395Thr) rs72466590 0.00126
NM_000256.3(MYBPC3):c.1564G>A (p.Ala522Thr) rs11570082 0.00120
NM_002294.3(LAMP2):c.755T>G (p.Ile252Ser) rs141541387 0.00119
NM_170707.4(LMNA):c.1930C>T (p.Arg644Cys) rs142000963 0.00117
NM_000256.3(MYBPC3):c.3413G>A (p.Arg1138His) rs187705120 0.00106
NM_001267550.2(TTN):c.41958A>G (p.Ala13986=) rs186699871 0.00106
NM_001005242.3(PKP2):c.505A>G (p.Ser169Gly) rs139139859 0.00096
NM_004415.4(DSP):c.5218G>A (p.Glu1740Lys) rs142885240 0.00091
NM_001148.6(ANK2):c.4745G>A (p.Arg1582Gln) rs138842207 0.00090
NM_000138.5(FBN1):c.6987C>G (p.Asp2329Glu) rs363831 0.00089
NM_000384.3(APOB):c.4163G>A (p.Arg1388His) rs13306187 0.00088
NM_000256.3(MYBPC3):c.2870C>G (p.Thr957Ser) rs193922380 0.00086
NM_000238.4(KCNH2):c.51C>G (p.Thr17=) rs144338227 0.00083
NM_005751.5(AKAP9):c.5369T>G (p.Val1790Gly) rs151021935 0.00082
NM_007078.3(LDB3):c.466G>A (p.Ala156Thr) rs200596619 0.00082
NM_001148.6(ANK2):c.11231C>A (p.Thr3744Asn) rs121912705 0.00077
NM_000238.4(KCNH2):c.568G>A (p.Ala190Thr) rs150817714 0.00076
NM_000256.3(MYBPC3):c.649A>G (p.Ser217Gly) rs138753870 0.00076
NM_004006.3(DMD):c.1731A>T (p.Glu577Asp) rs150199251 0.00073
NM_001267550.2(TTN):c.106580A>T (p.Glu35527Val) rs55725279 0.00071
NM_001103.4(ACTN2):c.26A>G (p.Gln9Arg) rs121434525 0.00070
NM_001103.4(ACTN2):c.1298C>T (p.Ser433Leu) rs143749154 0.00068
NM_001148.6(ANK2):c.4456G>C (p.Val1486Leu) rs149678604 0.00068
NM_001378969.1(KCND3):c.5C>A (p.Ala2Glu) rs201340369 0.00066
NM_002471.4(MYH6):c.4986G>A (p.Ala1662=) rs77416370 0.00066
NM_024422.6(DSC2):c.172T>G (p.Phe58Val) rs138749562 0.00066
NM_000335.5(SCN5A):c.5357G>A (p.Ser1786Asn) rs199473316 0.00063
NM_000384.3(APOB):c.2630C>T (p.Pro877Leu) rs12714097 0.00063
NM_004006.3(DMD):c.1028G>A (p.Arg343His) rs61733589 0.00062
NM_004415.4(DSP):c.6881C>G (p.Ala2294Gly) rs147000526 0.00062
NM_000238.4(KCNH2):c.526C>T (p.Arg176Trp) rs36210422 0.00061
NM_000257.4(MYH7):c.2769C>T (p.Asn923=) rs36211716 0.00060
NM_001943.5(DSG2):c.1003A>G (p.Thr335Ala) rs191564916 0.00060
NM_024422.6(DSC2):c.1787C>T (p.Ala596Val) rs148185335 0.00060
NM_000238.4(KCNH2):c.2738C>T (p.Ala913Val) rs77331749 0.00056
NM_000527.5(LDLR):c.58G>A (p.Gly20Arg) rs147509697 0.00053
NM_001018004.2(TPM1):c.775A>G (p.Lys259Glu) rs144045691 0.00052
NM_000257.4(MYH7):c.3036C>T (p.Ala1012=) rs145379951 0.00050
NM_033337.3(CAV3):c.443G>A (p.Arg148Gln) rs140575619 0.00049
NM_000363.5(TNNI3):c.235C>T (p.Arg79Cys) rs3729712 0.00048
NM_002834.5(PTPN11):c.1658C>T (p.Thr553Met) rs148176616 0.00048
NM_020433.5(JPH2):c.572C>G (p.Pro191Arg) rs554853074 0.00048
NM_001134363.3(RBM20):c.1659G>A (p.Ser553=) rs375626512 0.00046
NM_001276345.2(TNNT2):c.862C>T (p.Arg288Cys) rs121964857 0.00044
NM_020433.5(JPH2):c.1380G>A (p.Ala460=) rs531877510 0.00044
NM_000891.3(KCNJ2):c.1229A>G (p.Asn410Ser) rs141069645 0.00042
NM_004006.3(DMD):c.2824A>G (p.Met942Val) rs371648742 0.00042
NM_002294.3(LAMP2):c.586A>T (p.Thr196Ser) rs138991195 0.00039
NM_002474.3(MYH11):c.5529G>A (p.Ser1843=) rs146024732 0.00039
NM_004415.4(DSP):c.3923G>A (p.Arg1308Gln) rs184154918 0.00037
NM_000256.3(MYBPC3):c.3535G>A (p.Glu1179Lys) rs199669878 0.00036
NM_002471.4(MYH6):c.4136C>T (p.Thr1379Met) rs145611185 0.00036
NM_004006.3(DMD):c.1934A>G (p.Asp645Gly) rs147822019 0.00036
NM_004415.4(DSP):c.5178C>A (p.Asn1726Lys) rs147415451 0.00033
NM_000384.3(APOB):c.2853G>A (p.Glu951=) rs151193347 0.00031
NM_001035.3(RYR2):c.649A>G (p.Ile217Val) rs200642525 0.00029
NM_002474.3(MYH11):c.1502G>A (p.Arg501His) rs144244239 0.00029
NM_014000.3(VCL):c.366G>A (p.Leu122=) rs199562976 0.00029
NM_002834.5(PTPN11):c.925A>G (p.Ile309Val) rs201787206 0.00026
NM_005751.5(AKAP9):c.4826G>A (p.Arg1609Lys) rs148146011 0.00026
NM_014000.3(VCL):c.1297C>T (p.Arg433Cys) rs139559937 0.00026
NM_000719.7(CACNA1C):c.2280G>A (p.Glu760=) rs141633456 0.00025
NM_001103.4(ACTN2):c.1235C>T (p.Thr412Met) rs139515659 0.00025
NM_000257.4(MYH7):c.4377G>T (p.Lys1459Asn) rs201307101 0.00024
NM_001134363.3(RBM20):c.2452G>T (p.Ala818Ser) rs200271618 0.00024
NM_007078.3(LDB3):c.1606G>A (p.Val536Ile) rs113817827 0.00024
NM_001148.6(ANK2):c.4315G>T (p.Gly1439Cys) rs34591340 0.00023
NM_002230.4(JUP):c.2207C>T (p.Pro736Leu) rs151178348 0.00022
NM_000257.4(MYH7):c.77C>T (p.Ala26Val) rs186964570 0.00021
NM_004006.3(DMD):c.2827C>T (p.Arg943Cys) rs199986217 0.00021
NM_000432.4(MYL2):c.37G>A (p.Ala13Thr) rs104894363 0.00020
NM_014000.3(VCL):c.590C>T (p.Thr197Ile) rs189242810 0.00019
NM_004006.3(DMD):c.2291A>G (p.Asn764Ser) rs199588981 0.00018
NM_000335.5(SCN5A):c.80G>A (p.Arg27His) rs199473045 0.00017
NM_000237.3(LPL):c.1325T>G (p.Val442Gly) rs116403115 0.00016
NM_001035.3(RYR2):c.2267G>A (p.Ser756Asn) rs193922623 0.00016
NM_001035.3(RYR2):c.2755G>A (p.Val919Met) rs201079716 0.00016
NM_002471.4(MYH6):c.3195G>C (p.Gln1065His) rs267606904 0.00015
NM_002294.3(LAMP2):c.591G>A (p.Val197=) rs201030806 0.00014
NM_000256.3(MYBPC3):c.501C>T (p.Thr167=) rs397516054 0.00013
NM_004415.4(DSP):c.2774G>A (p.Arg925Gln) rs139799237 0.00013
NM_000337.6(SGCD):c.451T>G (p.Ser151Ala) rs121909298 0.00012
NM_000335.5(SCN5A):c.5364C>T (p.Asp1788=) rs375752426 0.00011
NM_001005242.3(PKP2):c.1930T>C (p.Ser644Pro) rs144601090 0.00011
NM_000256.3(MYBPC3):c.450C>T (p.Pro150=) rs377520770 0.00010
NM_004006.3(DMD):c.7323T>C (p.Thr2441=) rs201919981 0.00010
NM_007078.3(LDB3):c.273G>A (p.Thr91=) rs45613039 0.00010
NM_000257.4(MYH7):c.2606G>A (p.Arg869His) rs202141173 0.00009
NM_001103.4(ACTN2):c.1292C>T (p.Ser431Leu) rs149846886 0.00009
NM_001134363.3(RBM20):c.3504G>A (p.Leu1168=) rs377742289 0.00009
NM_001148.6(ANK2):c.11181C>T (p.Gly3727=) rs185569619 0.00009
NM_000257.4(MYH7):c.1407T>C (p.Asp469=) rs112172952 0.00008
NM_000238.4(KCNH2):c.422C>T (p.Pro141Leu) rs199472864 0.00007
NM_000384.3(APOB):c.12736T>G (p.Phe4246Val) rs200260789 0.00007
NM_000256.3(MYBPC3):c.132C>T (p.Arg44=) rs377579620 0.00006
NM_000257.4(MYH7):c.2360G>A (p.Arg787His) rs376754645 0.00006
NM_000257.4(MYH7):c.4182C>T (p.Ala1394=) rs765895405 0.00006
NM_000527.5(LDLR):c.2282C>T (p.Thr761Met) rs138477254 0.00006
NM_001005242.3(PKP2):c.1444A>G (p.Thr482Ala) rs397516999 0.00006
NM_001103.4(ACTN2):c.744C>T (p.Tyr248=) rs749565466 0.00006
NM_002471.4(MYH6):c.2685G>A (p.Ala895=) rs752345245 0.00006
NM_005902.4(SMAD3):c.207-26869C>A rs958007552 0.00006
NM_178172.6(GPIHBP1):c.191G>A (p.Arg64Gln) rs578073937 0.00006
NM_000138.5(FBN1):c.8149G>A (p.Glu2717Lys) rs187553035 0.00005
NM_000219.6(KCNE1):c.226G>A (p.Asp76Asn) rs74315445 0.00005
NM_000257.4(MYH7):c.1988G>A (p.Arg663His) rs371898076 0.00005
NM_004415.4(DSP):c.5555G>A (p.Arg1852His) rs193922669 0.00005
NM_000238.4(KCNH2):c.2717C>T (p.Ser906Leu) rs199473435 0.00004
NM_000238.4(KCNH2):c.2863C>G (p.Leu955Val) rs199473012 0.00004
NM_000256.3(MYBPC3):c.2311G>A (p.Val771Met) rs371488302 0.00004
NM_000335.5(SCN5A):c.3080G>A (p.Arg1027Gln) rs763891399 0.00004
NM_000335.5(SCN5A):c.53G>A (p.Arg18Gln) rs41311087 0.00004
NM_000335.5(SCN5A):c.677C>T (p.Ala226Val) rs199473561 0.00004
NM_001035.3(RYR2):c.5588C>T (p.Thr1863Met) rs770863319 0.00004
NM_001134363.3(RBM20):c.224C>T (p.Ser75Leu) rs191342808 0.00004
NM_001943.5(DSG2):c.2959G>T (p.Val987Phe) rs141405267 0.00004
NM_000257.4(MYH7):c.427C>T (p.Arg143Trp) rs727503278 0.00003
NM_000257.4(MYH7):c.611G>A (p.Arg204His) rs397516260 0.00003
NM_000335.5(SCN5A):c.3715G>C (p.Glu1239Gln) rs199473211 0.00003
NM_000719.7(CACNA1C):c.3531C>T (p.Tyr1177=) rs754527651 0.00003
NM_000719.7(CACNA1C):c.6059G>A (p.Ser2020Asn) rs373503739 0.00003
NM_001005242.3(PKP2):c.2014-1G>C rs193922674 0.00003
NM_001035.3(RYR2):c.12540C>T (p.Gly4180=) rs772125105 0.00003
NM_001134363.3(RBM20):c.1867C>T (p.Arg623Trp) rs794729148 0.00003
NM_002471.4(MYH6):c.635C>T (p.Ala212Val) rs780456381 0.00003
NM_004415.4(DSP):c.1557C>T (p.Ala519=) rs769629611 0.00003
NM_007078.3(LDB3):c.398C>T (p.Pro133Leu) rs200239096 0.00003
NM_016203.4(PRKAG2):c.591C>T (p.Pro197=) rs587781126 0.00003
NM_000138.5(FBN1):c.7754T>C (p.Ile2585Thr) rs727503054 0.00002
NM_000257.4(MYH7):c.5135G>A (p.Arg1712Gln) rs193922390 0.00002
NM_000335.5(SCN5A):c.3381C>T (p.Cys1127=) rs561922849 0.00002
NM_000363.5(TNNI3):c.434G>A (p.Arg145Gln) rs397516349 0.00002
NM_000719.7(CACNA1C):c.1126G>A (p.Val376Ile) rs1131653 0.00002
NM_000719.7(CACNA1C):c.4578G>A (p.Pro1526=) rs376555924 0.00002
NM_001134363.3(RBM20):c.1338-1G>T rs1265727354 0.00002
NM_001267550.2(TTN):c.5373C>A (p.Thr1791=) rs727503693 0.00002
NM_004006.3(DMD):c.6072T>C (p.Cys2024=) rs373804251 0.00002
NM_000218.3(KCNQ1):c.1085A>G (p.Lys362Arg) rs12720458 0.00001
NM_000218.3(KCNQ1):c.674C>T (p.Ser225Leu) rs199473456 0.00001
NM_000256.3(MYBPC3):c.1227-13G>A rs397515893 0.00001
NM_000256.3(MYBPC3):c.2241C>T (p.Gly747=) rs755910458 0.00001
NM_000256.3(MYBPC3):c.3491-2A>T rs397516022 0.00001
NM_000257.4(MYH7):c.1357C>T (p.Arg453Cys) rs121913625 0.00001
NM_000257.4(MYH7):c.1816G>A (p.Val606Met) rs121913627 0.00001
NM_000257.4(MYH7):c.2681A>G (p.Glu894Gly) rs397516161 0.00001
NM_000257.4(MYH7):c.2862C>T (p.Ile954=) rs982198020 0.00001
NM_000257.4(MYH7):c.3235C>T (p.Arg1079Trp) rs192722540 0.00001
NM_000257.4(MYH7):c.428G>A (p.Arg143Gln) rs397516209 0.00001
NM_000257.4(MYH7):c.4817G>A (p.Arg1606His) rs373514686 0.00001
NM_000335.5(SCN5A):c.2678G>A (p.Arg893His) rs199473172 0.00001
NM_000335.5(SCN5A):c.5935G>T (p.Val1979Phe) rs772258197 0.00001
NM_000363.5(TNNI3):c.557G>A (p.Arg186Gln) rs397516357 0.00001
NM_000384.3(APOB):c.10734C>T (p.Phe3578=) rs773361538 0.00001
NM_000384.3(APOB):c.5693C>G (p.Ser1898Cys) rs769220751 0.00001
NM_000384.3(APOB):c.9445G>A (p.Asp3149Asn) rs759354804 0.00001
NM_000527.5(LDLR):c.1784G>A (p.Arg595Gln) rs201102492 0.00001
NM_000527.5(LDLR):c.259T>G (p.Trp87Gly) rs121908025 0.00001
NM_000527.5(LDLR):c.523G>A (p.Asp175Asn) rs121908033 0.00001
NM_000527.5(LDLR):c.783C>T (p.Cys261=) rs1057519663 0.00001
NM_001035.3(RYR2):c.5712G>A (p.Leu1904=) rs377763336 0.00001
NM_001103.4(ACTN2):c.375C>T (p.Gly125=) rs781385336 0.00001
NM_001134363.3(RBM20):c.1907G>A (p.Arg636His) rs267607004 0.00001
NM_001148.6(ANK2):c.3882C>T (p.Asn1294=) rs780187690 0.00001
NM_001267550.2(TTN):c.44272C>T (p.Arg14758Ter) rs140743001 0.00001
NM_001943.5(DSG2):c.269C>T (p.Thr90Ile) rs772744115 0.00001
NM_001943.5(DSG2):c.391G>A (p.Ala131Thr) rs373542380 0.00001
NM_001943.5(DSG2):c.880A>G (p.Lys294Glu) rs752432726 0.00001
NM_002471.4(MYH6):c.2547G>A (p.Lys849=) rs770629886 0.00001
NM_002471.4(MYH6):c.3876G>A (p.Gln1292=) rs145290322 0.00001
NM_002834.5(PTPN11):c.1403C>T (p.Thr468Met) rs121918457 0.00001
NM_024422.6(DSC2):c.561T>C (p.Tyr187=) rs749063028 0.00001
NM_174936.4(PCSK9):c.523G>A (p.Asp175Asn) rs150898485 0.00001
NM_000138.5(FBN1):c.1904A>G (p.Tyr635Cys) rs1555399816
NM_000138.5(FBN1):c.2645C>T (p.Ala882Val) rs794728195
NM_000138.5(FBN1):c.4588C>T (p.Arg1530Cys) rs111401431
NM_000138.5(FBN1):c.5626T>C (p.Cys1876Arg) rs1555395980
NM_000218.3(KCNQ1):c.1024C>T (p.Leu342Phe) rs199472760
NM_000218.3(KCNQ1):c.1049G>T (p.Gly350Val) rs794728524
NM_000218.3(KCNQ1):c.1096C>T (p.Arg366Trp) rs199473411
NM_000218.3(KCNQ1):c.1700T>C (p.Ile567Thr) rs199472805
NM_000218.3(KCNQ1):c.1986C>T (p.Tyr662=) rs11601907
NM_000218.3(KCNQ1):c.207G>T (p.Ala69=) rs587781009
NM_000218.3(KCNQ1):c.919_921+9del rs794728557
NM_000238.4(KCNH2):c.1056C>T (p.Pro352=) rs1554427342
NM_000238.4(KCNH2):c.2453C>T (p.Ser818Leu) rs121912510
NM_000238.4(KCNH2):c.3125T>C (p.Leu1042Pro) rs886039064
NM_000238.4(KCNH2):c.3140G>T (p.Arg1047Leu) rs36210421
NM_000238.4(KCNH2):c.551GCGCGGGCG[1] (p.184GAG[1]) rs551056698
NM_000238.4(KCNH2):c.66dup (p.Glu23Ter) rs1554431441
NM_000256.3(MYBPC3):c.1591G>A (p.Gly531Arg) rs397515912
NM_000256.3(MYBPC3):c.1622dup (p.Glu542fs) rs1555122143
NM_000256.3(MYBPC3):c.1934C>T (p.Pro645Leu) rs397515938
NM_000256.3(MYBPC3):c.2670G>A (p.Trp890Ter) rs397515982
NM_000256.3(MYBPC3):c.3404ACT[1] (p.Tyr1136del) rs730880674
NM_000256.3(MYBPC3):c.655G>C (p.Val219Leu) rs397516068
NM_000257.4(MYH7):c.1063G>A (p.Ala355Thr) rs397516088
NM_000257.4(MYH7):c.1750G>C (p.Gly584Arg) rs121913626
NM_000257.4(MYH7):c.2156G>A (p.Arg719Gln) rs121913641
NM_000257.4(MYH7):c.2167C>G (p.Arg723Gly) rs121913630
NM_000257.4(MYH7):c.2221G>T (p.Gly741Trp) rs121913632
NM_000257.4(MYH7):c.2788G>C (p.Glu930Gln) rs397516171
NM_000257.4(MYH7):c.3337-4dup rs45504498
NM_000257.4(MYH7):c.646C>G (p.Leu216Val) rs772488436
NM_000335.5(SCN5A):c.5620_5622dup (p.Met1874dup) rs1474459822
NM_000335.5(SCN5A):c.5848G>T (p.Val1950Leu) rs41315493
NM_000384.3(APOB):c.10061C>G (p.Ala3354Gly)
NM_000384.3(APOB):c.10580G>A (p.Arg3527Gln)
NM_000384.3(APOB):c.10672C>T (p.Arg3558Cys)
NM_000384.3(APOB):c.10780T>C (p.Trp3594Arg)
NM_000384.3(APOB):c.11477C>T (p.Thr3826Met)
NM_000384.3(APOB):c.149G>A (p.Arg50Gln) rs1465696669
NM_000384.3(APOB):c.1661C>T (p.Pro554Leu)
NM_000384.3(APOB):c.26TGGCGCTGC[1] (p.9LAL[1])
NM_000384.3(APOB):c.2981C>T (p.Pro994Leu)
NM_000384.3(APOB):c.3427C>T (p.Pro1143Ser)
NM_000384.3(APOB):c.4796G>A (p.Arg1599His) rs746414462
NM_000384.3(APOB):c.5066G>A (p.Arg1689His)
NM_000384.3(APOB):c.5741A>G (p.Asn1914Ser)
NM_000384.3(APOB):c.6636TGA[1] (p.Asp2213del) rs541497967
NM_000384.3(APOB):c.6895G>C (p.Asp2299His)
NM_000384.3(APOB):c.7285T>A (p.Ser2429Thr)
NM_000527.5(LDLR):c.1027G>A (p.Gly343Ser)
NM_000527.5(LDLR):c.1073G>A (p.Cys358Tyr) rs875989915
NM_000527.5(LDLR):c.1102T>C (p.Cys368Arg) rs879254791
NM_000527.5(LDLR):c.1109A>C (p.Asn370Thr) rs879254792
NM_000527.5(LDLR):c.1124A>G (p.Tyr375Cys) rs879254800
NM_000527.5(LDLR):c.1135T>C (p.Cys379Arg)
NM_000527.5(LDLR):c.1145G>T (p.Gly382Val) rs752951310
NM_000527.5(LDLR):c.1216C>A (p.Arg406=) rs121908043
NM_000527.5(LDLR):c.1216C>T (p.Arg406Trp)
NM_000527.5(LDLR):c.1432G>A (p.Gly478Arg)
NM_000527.5(LDLR):c.1467C>G (p.Tyr489Ter) rs370777955
NM_000527.5(LDLR):c.148G>T (p.Ala50Ser) rs137853960
NM_000527.5(LDLR):c.1495T>C (p.Ser499Pro) rs879254921
NM_000527.5(LDLR):c.1567G>A (p.Val523Met)
NM_000527.5(LDLR):c.1646G>A (p.Gly549Asp)
NM_000527.5(LDLR):c.1783C>T (p.Arg595Trp)
NM_000527.5(LDLR):c.1922T>A (p.Leu641Ter) rs2077524952
NM_000527.5(LDLR):c.2000G>A (p.Cys667Tyr) rs28942083
NM_000527.5(LDLR):c.2043C>A (p.Cys681Ter)
NM_000527.5(LDLR):c.2231G>A (p.Arg744Gln)
NM_000527.5(LDLR):c.241C>T (p.Arg81Cys)
NM_000527.5(LDLR):c.313_313+1del rs875989896
NM_000527.5(LDLR):c.519C>G (p.Cys173Trp) rs769318035
NM_000527.5(LDLR):c.682G>A (p.Glu228Lys)
NM_000527.5(LDLR):c.769C>T (p.Arg257Trp)
NM_000527.5(LDLR):c.81C>G (p.Cys27Trp)
NM_000527.5(LDLR):c.858C>A (p.Ser286Arg) rs140241383
NM_000527.5(LDLR):c.938_939delinsAT (p.Cys313Tyr) rs875989910
NM_000527.5(LDLR):c.970G>A (p.Gly324Ser)
NM_000891.3(KCNJ2):c.461G>A (p.Cys154Tyr) rs199473380
NM_001001430.3(TNNT2):c.68-1623_68-1621delinsTT rs397516362
NM_001005242.3(PKP2):c.2167+1G>A rs794729116
NM_001005242.3(PKP2):c.2377del (p.Ser793fs) rs727504432
NM_001005242.3(PKP2):c.964G>T (p.Gly322Cys) rs200069860
NM_001018005.2(TPM1):c.45G>A (p.Lys15=) rs199476301
NM_001134363.3(RBM20):c.3261_3262delinsG (p.Ser1087fs) rs727504763
NM_001232.4(CASQ2):c.421-15C>G rs199939582
NM_001267550.2(TTN):c.22745_22746del (p.Ser7582fs) rs779549899
NM_001267550.2(TTN):c.30683-2del rs1553868981
NM_001267550.2(TTN):c.32970_32987del (p.10987_10989EEY[1]) rs766756026
NM_001267550.2(TTN):c.34129GTTCTACCTGAAGAAGAGGAA[1] (p.11363VLPEEEE[3]) rs587780487
NM_001267550.2(TTN):c.39731TTGCTCCTGAAGAGGAAA[1] (p.13244IAPEEE[1]) rs139512154
NM_001267550.2(TTN):c.40576GAA[3] (p.Glu13529del) rs727504199
NM_001267550.2(TTN):c.587AAG[2] (p.Glu198del) rs771898264
NM_001267550.2(TTN):c.90758GAG[2] (p.Gly30255del) rs748912340
NM_001267550.2(TTN):c.97492+1G>C rs727505319
NM_001276345.2(TNNT2):c.508GAG[3] (p.Glu173del) rs397516470
NM_001276345.2(TNNT2):c.548G>A (p.Arg183Gln) rs397516471
NM_001371904.1(APOA5):c.990_993del (p.Asp332fs) rs774150500
NM_001613.4(ACTA2):c.720G>C (p.Lys240Asn) rs727502878
NM_001927.4(DES):c.1034T>C (p.Leu345Pro) rs57639980
NM_002230.4(JUP):c.2139G>A (p.Pro713=) rs782165431
NM_002471.4(MYH6):c.1131C>T (p.Asp377=) rs61742472
NM_003673.4(TCAP):c.34GAG[1] (p.Glu13del) rs397516862
NM_004281.4(BAG3):c.212G>A (p.Arg71Gln) rs35434411
NM_004281.4(BAG3):c.468GGC[4] (p.Ala160dup) rs139438727
NM_004415.4(DSP):c.8496ATCTCGCTCCGG[1] (p.2827SGSR[4]) rs397516971
NM_005751.5(AKAP9):c.2945C>A (p.Ser982Tyr) rs374340343
NM_005751.5(AKAP9):c.4825_4826delinsCA (p.Arg1609Gln) rs786205707
NM_006073.4(TRDN):c.1598-6dup rs147062785
NM_007078.3(LDB3):c.1609del (p.Gln537fs) rs727503129
NM_016203.4(PRKAG2):c.66C>G (p.Gly22=) rs730880971
NM_016492.5(RANGRF):c.181G>T (p.Glu61Ter) rs140704891
NM_017636.4(TRPM4):c.2283_2294del (p.759_762CGGR[1]) rs113100797
NM_024422.6(DSC2):c.2686_2687dup (p.Ala897fs) rs200056085
NM_133379.5(TTN):c.15285_15317dup (p.5058TLERYSTPPGE[6]) rs397517815
NM_144573.4(NEXN):c.1671GGA[2] (p.Glu561_Glu562del) rs397517848
NM_174936.4(PCSK9):c.1405C>T (p.Arg469Trp)
NM_174936.4(PCSK9):c.45GCT[8] (p.Leu23dup) rs35574083

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.