ClinVar Miner

Variants from Color Health, Inc with conflicting interpretations

Location: United States — Primary collection method: clinical testing
Minimum review status of the submission from Color Health, Inc: Collection method of the submission from Color Health, Inc:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
26205 14237 0 1249 1567 2 340 2982

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
Color Health, Inc pathogenic likely pathogenic uncertain significance likely benign benign risk factor other
pathogenic 0 91 13 3 1 0 0
likely pathogenic 204 0 48 5 0 1 0
uncertain significance 87 174 0 647 21 0 0
likely benign 17 16 802 0 369 0 0
benign 9 4 125 610 0 0 1

Submitter to submitter summary #

Total submitters: 75
Download table as spreadsheet
Submitter Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
Ambry Genetics 0 13517 0 637 1031 0 131 1799
CHEO Genetics Diagnostic Laboratory,Children's Hospital of Eastern Ontario 0 514 0 130 107 0 7 244
True Health Diagnostics 0 233 0 161 37 1 1 200
Illumina Clinical Services Laboratory,Illumina 0 106 0 75 117 0 3 195
Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde,Academisch Medisch Centrum 0 78 0 68 7 0 77 152
Robarts Research Institute,Western University 0 101 0 81 39 0 6 126
LDLR-LOVD, British Heart Foundation 0 132 0 50 23 0 29 102
GeneKor MSA 0 177 0 14 79 1 2 96
Invitae 0 372 0 61 20 1 12 94
Laboratory of Genetics and Molecular Cardiology, University of São Paulo 0 48 0 15 51 0 15 81
Institute for Biomarker Research,Medical Diagnostic Laboratories, L.L.C. 0 58 0 56 16 0 2 74
Cardiovascular Research Group,Instituto Nacional de Saude Doutor Ricardo Jorge 0 65 0 17 44 0 11 72
Centre de Génétique Moléculaire et Chromosomique, Unité de génétique de l'Obésité et des Dyslipidémies,APHP, GH Hôpitaux Universitaires Pitié-Salpêtrière / Charles-Foix 0 36 0 33 9 0 24 66
U4M - Lille University & CHRU Lille, Université de Lille - CHRU de Lille 0 42 0 16 0 0 27 43
Color Health, Inc 43354 33 0 25 12 0 0 37
Fundacion Hipercolesterolemia Familiar 0 40 0 14 10 0 13 37
Molecular Genetics Laboratory,Centre for Cardiovascular Surgery and Transplantation 0 26 0 21 5 0 7 33
Iberoamerican FH Network 0 28 0 10 12 0 8 30
GeneDx 0 13 0 25 0 0 1 26
Integrated Genetics/Laboratory Corporation of America 0 66 0 15 3 0 8 26
Cardiovascular Genetics Laboratory,PathWest Laboratory Medicine WA - Fiona Stanley Hospital 0 36 0 17 2 0 5 24
Vantari Genetics 0 45 0 16 8 0 0 24
Mendelics 0 51 0 8 13 0 2 23
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics,Children's Hospital of Philadelphia 0 12 0 8 11 0 1 20
Broad Institute Rare Disease Group, Broad Institute 0 27 0 3 5 0 12 20
Fulgent Genetics,Fulgent Genetics 0 72 0 5 14 0 0 19
Brunham Lab, Centre for Heart and Lung Innovation,University of British Columbia 0 39 0 12 0 0 6 18
Natera, Inc. 0 47 0 8 6 0 1 15
Institute for Integrative and Experimental Genomics,University of Luebeck 0 3 0 7 3 0 5 15
University of Washington Department of Laboratory Medicine, University of Washington 0 38 0 11 2 0 2 15
Cardiovascular Biomarker Research Laboratory,Mayo Clinic 0 9 0 8 5 0 1 14
Institute of Human Genetics, University of Leipzig Medical Center 0 9 0 4 2 0 7 13
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen 0 10 0 10 1 0 0 11
Laboratory of Molecular Genetics,National Medical Research Center for Therapy and Preventive Medicine 0 3 0 3 1 0 7 11
Center for Advanced Laboratory Medicine, UC San Diego Health,University of California San Diego 0 18 0 3 5 0 1 9
Human Genome Sequencing Center Clinical Lab, Baylor College of Medicine 0 24 0 6 0 0 2 8
Department of Pediatric Oncology, Hematology and Clinical Immunology,University Clinics Duesseldorf 0 4 0 1 2 0 5 8
Academic Department of Medical Genetics, University of Cambridge 0 15 0 5 0 0 2 7
Knight Diagnostic Laboratories, Oregon Health and Sciences University 0 15 0 5 1 0 1 7
Department of Human Genetics,Laborarztpraxis Dres. Walther, Weindel und Kollegen 0 12 0 5 1 0 0 6
OMIM 0 19 0 2 1 0 2 5
Counsyl 0 21 0 3 1 0 1 5
Blueprint Genetics 0 14 0 1 4 0 0 5
Center for Human Genetics, Inc,Center for Human Genetics, Inc 0 8 0 1 3 0 0 4
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute 0 22 0 1 3 0 0 4
ClinGen Inherited Cardiomyopathy Variant Curation Expert Panel, 0 48 0 2 2 0 0 4
CSER _CC_NCGL, University of Washington 0 3 0 2 1 0 0 3
Centre for Genomic and Experimental Medicine,University of Edinburgh 0 0 0 0 0 0 3 3
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego 0 2 0 3 0 0 0 3
GeneID Lab - Advanced Molecular Diagnostics 0 1 0 0 2 0 1 3
Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine 0 0 0 1 0 0 1 2
Institute of Human Genetics,University Medical Center Hamburg-Eppendorf 0 0 0 0 0 0 2 2
Albrecht-Kossel-Institute,Medical University Rostock 0 1 0 0 1 0 1 2
Department of Molecular Diagnostics, Institute of Oncology Ljubljana 0 1 0 2 0 0 0 2
Baylor Genetics 0 1 0 1 0 0 0 1
Biesecker Lab/Clinical Genomics Section,National Institutes of Health 0 1 0 1 0 0 0 1
Molecular Diagnostics Lab,Nemours Alfred I. duPont Hospital for Children 0 0 0 1 0 0 0 1
Genome Diagnostics Laboratory,University Medical Center Utrecht 0 1 0 1 0 0 0 1
Laboratory of Human Genetics,Universidade de São Paulo 0 0 0 0 0 0 1 1
HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology 0 4 0 1 0 0 0 1
Forensic Genetics Laboratory,Harris County Institute of Forensic Sciences 0 0 0 0 0 0 1 1
Bioscientia Institut fuer Medizinische Diagnostik GmbH,Sonic Healthcare 0 1 0 0 0 0 1 1
Institute of Human Genetics,University of Wuerzburg 0 0 0 0 0 0 1 1
Center of Medical Genetics and Primary Health Care 0 1 0 0 1 0 0 1
Phosphorus, Inc. 0 0 0 0 1 0 0 1
Biochemical Molecular Genetic Laboratory,King Abdulaziz Medical City 0 1 0 1 0 0 0 1
UNC Molecular Genetics Laboratory,University of North Carolina at Chapel Hill 0 0 0 1 0 0 0 1
Department of Molecular Innovation in Lipidology, National Cerebral & Cardiovascular Center Reseach Institute 0 0 0 1 0 0 0 1
Cure Brain Cancer Foundation Neuro-Oncology Group, Adult Cancer Program,University of New South Wales 0 0 0 0 0 0 1 1
University of Iowa Renal Genetics Clinic,University of Iowa 0 0 0 0 1 0 0 1
Laboratory of Inherited Metabolic Diseases, Research centre for medical genetics 0 0 0 0 0 0 1 1
Division of Medical Genetics, University of Washington 0 0 0 1 0 0 0 1
CeMIA 0 0 0 0 1 0 0 1
Rajaie Cardiovascular, Medical and Research Center, Iran University of Medical Sciences 0 1 0 1 0 0 0 1
Nilou-Genome Lab 0 0 0 0 1 0 0 1

All variants with conflicting interpretations #

Total variants: 2982
Download table as spreadsheet
HGVS dbSNP
MYH11:c.503-14_503-12del rs141564071
NC_000019.10:g.11089452G>T
NM_000038.6(APC):c.1005A>G (p.Leu335=) rs3797704
NM_000038.6(APC):c.120G>A (p.Glu40=) rs142720069
NM_000038.6(APC):c.1240C>T (p.Arg414Cys) rs137854567
NM_000038.6(APC):c.1276G>T (p.Ala426Ser) rs200598389
NM_000038.6(APC):c.1408+3A>G rs534358523
NM_000038.6(APC):c.1488A>T (p.Thr496=) rs9282599
NM_000038.6(APC):c.1554G>A (p.Thr518=) rs546568052
NM_000038.6(APC):c.1589T>C (p.Val530Ala) rs202199891
NM_000038.6(APC):c.1606G>A (p.Glu536Lys) rs138098808
NM_000038.6(APC):c.1626+4C>A rs1202435147
NM_000038.6(APC):c.1631T>C (p.Ile544Thr) rs144056494
NM_000038.6(APC):c.1695A>G (p.Glu565=) rs77921116
NM_000038.6(APC):c.181G>A (p.Ala61Thr) rs786201989
NM_000038.6(APC):c.1958+1_1958+4dup rs1060503356
NM_000038.6(APC):c.1958+8T>C rs62626346
NM_000038.6(APC):c.1959G>A (p.Arg653=) rs72541809
NM_000038.6(APC):c.1984C>A (p.Leu662Ile) rs756859993
NM_000038.6(APC):c.220+4G>A rs973491846
NM_000038.6(APC):c.2204C>T (p.Ala735Val) rs147655929
NM_000038.6(APC):c.221-2A>G rs786201291
NM_000038.6(APC):c.2222A>G (p.Asn741Ser) rs150209825
NM_000038.6(APC):c.2262T>G (p.Val754=) rs148987776
NM_000038.6(APC):c.2444A>C (p.Asn815Thr) rs762990578
NM_000038.6(APC):c.2476T>G (p.Leu826Val) rs145245264
NM_000038.6(APC):c.2593C>T (p.Pro865Ser) rs192620988
NM_000038.6(APC):c.259C>T (p.Leu87=) rs569640184
NM_000038.6(APC):c.2608C>T (p.Pro870Ser) rs33974176
NM_000038.6(APC):c.2627G>A (p.Arg876Gln) rs373428732
NM_000038.6(APC):c.277C>G (p.Leu93Val) rs201567345
NM_000038.6(APC):c.3165A>T (p.Ile1055=) rs61734287
NM_000038.6(APC):c.3173A>G (p.Asp1058Gly) rs148725540
NM_000038.6(APC):c.3245C>G (p.Thr1082Ser) rs730881244
NM_000038.6(APC):c.3352A>G (p.Asn1118Asp) rs140493115
NM_000038.6(APC):c.3386T>C (p.Leu1129Ser) rs143638171
NM_000038.6(APC):c.3462AGA[2] (p.Glu1157del) rs386833391
NM_000038.6(APC):c.3471G>A (p.Glu1157=) rs143927847
NM_000038.6(APC):c.3479C>A (p.Thr1160Lys) rs201004111
NM_000038.6(APC):c.3625G>A (p.Glu1209Lys) rs201185479
NM_000038.6(APC):c.3650A>C (p.Asn1217Thr) rs138933660
NM_000038.6(APC):c.3691C>G (p.Leu1231Val) rs573020080
NM_000038.6(APC):c.3732A>G (p.Gln1244=) rs74380081
NM_000038.6(APC):c.3868A>G (p.Asn1290Asp) rs752977559
NM_000038.6(APC):c.3910A>G (p.Ile1304Val) rs770157475
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000038.6(APC):c.3932T>G (p.Ile1311Ser) rs876659190
NM_000038.6(APC):c.3949G>C (p.Glu1317Gln) rs1801166
NM_000038.6(APC):c.4072G>A (p.Ala1358Thr) rs139618756
NM_000038.6(APC):c.423-3T>A rs587782293
NM_000038.6(APC):c.423-3_423-2del rs863225354
NM_000038.6(APC):c.423-4del rs730881230
NM_000038.6(APC):c.4333A>G (p.Thr1445Ala) rs587780597
NM_000038.6(APC):c.4336G>A (p.Ala1446Thr) rs146572883
NM_000038.6(APC):c.4349G>A (p.Arg1450Gln) rs587782678
NM_000038.6(APC):c.4395T>A (p.Ser1465Arg) rs779898882
NM_000038.6(APC):c.450A>G (p.Lys150=) rs116020626
NM_000038.6(APC):c.4702GAT[3] (p.Asp1571del) rs587782888
NM_000038.6(APC):c.4765C>G (p.Arg1589Gly) rs72541813
NM_000038.6(APC):c.4765C>T (p.Arg1589Cys) rs72541813
NM_000038.6(APC):c.4893T>C (p.Ser1631=) rs35634377
NM_000038.6(APC):c.4913T>C (p.Met1638Thr) rs201797422
NM_000038.6(APC):c.4919G>A (p.Arg1640Gln) rs529480958
NM_000038.6(APC):c.5017G>A (p.Glu1673Lys) rs587779796
NM_000038.6(APC):c.5179T>C (p.Cys1727Arg) rs758815860
NM_000038.6(APC):c.5216A>G (p.Lys1739Arg) rs769558291
NM_000038.6(APC):c.5265G>A (p.Ala1755=) rs34506289
NM_000038.6(APC):c.5274T>A (p.Ser1758=) rs199600387
NM_000038.6(APC):c.5337A>G (p.Ile1779Met) rs748063409
NM_000038.6(APC):c.5372A>G (p.Lys1791Arg) rs775740112
NM_000038.6(APC):c.5421CAA[1] (p.Asn1808del) rs587782002
NM_000038.6(APC):c.5506G>A (p.Gly1836Arg) rs766739164
NM_000038.6(APC):c.5635G>T (p.Ala1879Ser) rs587779799
NM_000038.6(APC):c.5690A>C (p.His1897Pro) rs112610898
NM_000038.6(APC):c.5737A>G (p.Ile1913Val) rs1554086935
NM_000038.6(APC):c.573T>C (p.Tyr191=) rs185154886
NM_000038.6(APC):c.5752A>G (p.Ile1918Val) rs776966222
NM_000038.6(APC):c.5774C>A (p.Pro1925His) rs762682111
NM_000038.6(APC):c.5790A>G (p.Gln1930=) rs141152252
NM_000038.6(APC):c.5801C>T (p.Pro1934Leu) rs587780600
NM_000038.6(APC):c.5894A>G (p.His1965Arg) rs773776516
NM_000038.6(APC):c.5931A>G (p.Gln1977=) rs975299630
NM_000038.6(APC):c.5957C>T (p.Pro1986Leu) rs756266694
NM_000038.6(APC):c.5981A>T (p.Asp1994Val) rs774815653
NM_000038.6(APC):c.607C>G (p.Gln203Glu) rs141576417
NM_000038.6(APC):c.6387G>A (p.Ser2129=) rs374310157
NM_000038.6(APC):c.647G>A (p.Arg216Gln) rs76685252
NM_000038.6(APC):c.6554G>A (p.Ser2185Asn) rs764255983
NM_000038.6(APC):c.6639G>A (p.Met2213Ile) rs35540155
NM_000038.6(APC):c.6669A>G (p.Ser2223=) rs372680843
NM_000038.6(APC):c.6679G>T (p.Gly2227Cys) rs367905430
NM_000038.6(APC):c.669A>C (p.Gln223His) rs769482880
NM_000038.6(APC):c.6724A>G (p.Ser2242Gly) rs201375478
NM_000038.6(APC):c.6782C>T (p.Pro2261Leu) rs376494248
NM_000038.6(APC):c.6821C>T (p.Ala2274Val) rs34919187
NM_000038.6(APC):c.6857C>T (p.Ala2286Val) rs200587641
NM_000038.6(APC):c.6873A>T (p.Gln2291His) rs148878262
NM_000038.6(APC):c.6921G>A (p.Ser2307=) rs2229993
NM_000038.6(APC):c.6965A>G (p.Gln2322Arg) rs1057517549
NM_000038.6(APC):c.705A>G (p.Leu235=) rs147036141
NM_000038.6(APC):c.7174C>A (p.Pro2392Thr) rs730881257
NM_000038.6(APC):c.7201C>T (p.Leu2401=) rs2229994
NM_000038.6(APC):c.730-3C>T rs786203125
NM_000038.6(APC):c.7399C>A (p.Pro2467Thr) rs372305287
NM_000038.6(APC):c.7415C>T (p.Ala2472Val) rs200399245
NM_000038.6(APC):c.7543A>G (p.Ile2515Val) rs554356011
NM_000038.6(APC):c.7574G>A (p.Arg2525His) rs762034315
NM_000038.6(APC):c.757G>A (p.Gly253Ser) rs772806807
NM_000038.6(APC):c.7645C>T (p.Arg2549Cys) rs199539353
NM_000038.6(APC):c.768T>G (p.Asp256Glu) rs764268036
NM_000038.6(APC):c.7704A>G (p.Gly2568=) rs35043160
NM_000038.6(APC):c.7717A>G (p.Ile2573Val) rs145444830
NM_000038.6(APC):c.7781C>G (p.Ser2594Cys) rs543396310
NM_000038.6(APC):c.7821C>T (p.Ser2607=) rs532235331
NM_000038.6(APC):c.7822G>A (p.Ala2608Thr) rs878853471
NM_000038.6(APC):c.7858T>A (p.Phe2620Ile) rs587781816
NM_000038.6(APC):c.7862C>G (p.Ser2621Cys) rs72541816
NM_000038.6(APC):c.8043G>C (p.Pro2681=) rs149347068
NM_000038.6(APC):c.8057T>C (p.Val2686Ala) rs757901425
NM_000038.6(APC):c.8068G>A (p.Ala2690Thr) rs140868933
NM_000038.6(APC):c.8141G>A (p.Arg2714His) rs747362422
NM_000038.6(APC):c.8261G>A (p.Ser2754Asn) rs369721828
NM_000038.6(APC):c.8332G>T (p.Ala2778Ser) rs587778046
NM_000038.6(APC):c.835-3T>C rs372090940
NM_000038.6(APC):c.8383G>A (p.Ala2795Thr) rs369264968
NM_000038.6(APC):c.8411A>G (p.Gln2804Arg) rs1475247315
NM_000038.6(APC):c.841A>G (p.Thr281Ala) rs769727966
NM_000038.6(APC):c.8429A>G (p.Asn2810Ser) rs758044862
NM_000038.6(APC):c.95A>G (p.Asn32Ser) rs539108537
NM_000038.6(APC):c.995G>A (p.Arg332Gln) rs377665107
NM_000051.3(ATM):c.1138T>A (p.Tyr380Asn) rs34083085
NM_000051.3(ATM):c.1176C>G (p.Gly392=) rs1800727
NM_000051.3(ATM):c.118A>G (p.Ile40Val) rs1064796002
NM_000051.3(ATM):c.1229T>C (p.Val410Ala) rs56128736
NM_000051.3(ATM):c.1236-3dup rs34325032
NM_000051.3(ATM):c.1254A>G (p.Gln418=) rs4987943
NM_000051.3(ATM):c.1464G>T (p.Trp488Cys) rs377597949
NM_000051.3(ATM):c.162T>C (p.Tyr54=) rs3218690
NM_000051.3(ATM):c.1695A>G (p.Glu565=) rs780932013
NM_000051.3(ATM):c.1744T>C (p.Phe582Leu) rs2235006
NM_000051.3(ATM):c.1855A>C (p.Asn619His) rs140882609
NM_000051.3(ATM):c.1888G>A (p.Val630Met) rs148191382
NM_000051.3(ATM):c.1898+1G>T rs758325274
NM_000051.3(ATM):c.1960C>A (p.Gln654Lys) rs528165789
NM_000051.3(ATM):c.2019G>A (p.Lys673=) rs786203021
NM_000051.3(ATM):c.202A>G (p.Ile68Val) rs35389822
NM_000051.3(ATM):c.2074C>T (p.Arg692Cys) rs765965513
NM_000051.3(ATM):c.2096A>G (p.Glu699Gly) rs147934285
NM_000051.3(ATM):c.2119T>C (p.Ser707Pro) rs4986761
NM_000051.3(ATM):c.2127T>C (p.Ile709=) rs56252953
NM_000051.3(ATM):c.2127T>G (p.Ile709Met) rs56252953
NM_000051.3(ATM):c.2193C>T (p.Tyr731=) rs2229019
NM_000051.3(ATM):c.2250G>A (p.Lys750=) rs1137887
NM_000051.3(ATM):c.2251-10T>G rs730881346
NM_000051.3(ATM):c.2251-4A>G rs786202935
NM_000051.3(ATM):c.2362A>C (p.Ser788Arg) rs641252
NM_000051.3(ATM):c.2396C>T (p.Ala799Val) rs199954262
NM_000051.3(ATM):c.2442C>A (p.Asp814Glu) rs3218695
NM_000051.3(ATM):c.2446_2447delinsCT (p.Ala816Leu) rs587781956
NM_000051.3(ATM):c.2476A>C (p.Ile826Leu) rs587782397
NM_000051.3(ATM):c.2495G>T (p.Arg832Leu) rs199875915
NM_000051.3(ATM):c.2567A>G (p.Asn856Ser) rs1555082253
NM_000051.3(ATM):c.2572T>C (p.Phe858Leu) rs1800056
NM_000051.3(ATM):c.2614C>T (p.Pro872Ser) rs3218673
NM_000051.3(ATM):c.2630G>C (p.Ser877Thr) rs370269552
NM_000051.3(ATM):c.2638+3A>G rs876660552
NM_000051.3(ATM):c.2685A>G (p.Leu895=) rs3218687
NM_000051.3(ATM):c.275A>C (p.Lys92Thr) rs200151849
NM_000051.3(ATM):c.2836A>G (p.Met946Val) rs587781992
NM_000051.3(ATM):c.2839-4T>C rs1057522619
NM_000051.3(ATM):c.2873A>G (p.Glu958Gly) rs587778069
NM_000051.3(ATM):c.2887A>G (p.Met963Val) rs374353016
NM_000051.3(ATM):c.2921+1G>C rs587781558
NM_000051.3(ATM):c.2921+1G>T rs587781558
NM_000051.3(ATM):c.2989G>A (p.Val997Ile) rs1487902875
NM_000051.3(ATM):c.3014A>G (p.Asn1005Ser) rs146531614
NM_000051.3(ATM):c.3016A>G (p.Met1006Val) rs139893395
NM_000051.3(ATM):c.3078-1G>A rs750663117
NM_000051.3(ATM):c.3118A>G (p.Met1040Val) rs3092857
NM_000051.3(ATM):c.3190A>G (p.Met1064Val) rs79431304
NM_000051.3(ATM):c.3242A>G (p.Asn1081Ser) rs368111672
NM_000051.3(ATM):c.3285-5T>C rs876659715
NM_000051.3(ATM):c.3295G>A (p.Asp1099Asn) rs372966951
NM_000051.3(ATM):c.331+1G>A rs1555055356
NM_000051.3(ATM):c.3341A>G (p.Lys1114Arg) rs777705500
NM_000051.3(ATM):c.3342G>A (p.Lys1114=) rs138393322
NM_000051.3(ATM):c.3352A>G (p.Thr1118Ala) rs572564322
NM_000051.3(ATM):c.3383A>G (p.Gln1128Arg) rs2229020
NM_000051.3(ATM):c.3478G>C (p.Val1160Leu) rs567344545
NM_000051.3(ATM):c.3577-12del rs730881288
NM_000051.3(ATM):c.3614G>A (p.Arg1205His) rs769106895
NM_000051.3(ATM):c.378T>A (p.Asp126Glu) rs2234997
NM_000051.3(ATM):c.3806A>G (p.Lys1269Arg) rs146017595
NM_000051.3(ATM):c.3919G>A (p.Gly1307Arg) rs568451087
NM_000051.3(ATM):c.3964C>A (p.Leu1322Ile) rs144535256
NM_000051.3(ATM):c.3993+1G>A rs200196781
NM_000051.3(ATM):c.3993+5G>T rs3092842
NM_000051.3(ATM):c.3994-2A>G rs587782276
NM_000051.3(ATM):c.4109+4T>C rs754706599
NM_000051.3(ATM):c.4110-1G>A rs1060501692
NM_000051.3(ATM):c.4110-9C>G rs730881367
NM_000051.3(ATM):c.4138C>T (p.His1380Tyr) rs3092856
NM_000051.3(ATM):c.4167A>G (p.Thr1389=) rs183214437
NM_000051.3(ATM):c.4258C>T (p.Leu1420Phe) rs1800058
NM_000051.3(ATM):c.4279G>A (p.Ala1427Thr) rs2229021
NM_000051.3(ATM):c.4324T>C (p.Tyr1442His) rs201666889
NM_000051.3(ATM):c.4362A>C (p.Lys1454Asn) rs148993589
NM_000051.3(ATM):c.4365T>A (p.Ser1455Arg) rs527471560
NM_000051.3(ATM):c.4396C>G (p.Arg1466Gly) rs730881369
NM_000051.3(ATM):c.4437-1G>C rs759520465
NM_000051.3(ATM):c.4473C>T (p.Phe1491=) rs4988008
NM_000051.3(ATM):c.4576C>T (p.Pro1526Ser) rs748898098
NM_000051.3(ATM):c.4612-4T>G rs569983068
NM_000051.3(ATM):c.4703A>G (p.His1568Arg) rs368830730
NM_000051.3(ATM):c.4735C>T (p.Gln1579Ter) rs869312755
NM_000051.3(ATM):c.4776+1G>T rs771117943
NM_000051.3(ATM):c.4776+2T>A rs587781927
NM_000051.3(ATM):c.4853G>A (p.Arg1618Gln) rs765759912
NM_000051.3(ATM):c.4910-4C>T rs786202493
NM_000051.3(ATM):c.4910A>G (p.Asp1637Gly) rs763457172
NM_000051.3(ATM):c.4949A>G (p.Asn1650Ser) rs55870064
NM_000051.3(ATM):c.497-4T>A rs876659621
NM_000051.3(ATM):c.5005+7_5005+8del rs587780626
NM_000051.3(ATM):c.5080G>A (p.Ala1694Thr) rs756197350
NM_000051.3(ATM):c.5089A>G (p.Thr1697Ala) rs142455912
NM_000051.3(ATM):c.5178-4dup rs747750958
NM_000051.3(ATM):c.5319+3C>A rs371640963
NM_000051.3(ATM):c.5320-4C>G rs1316146972
NM_000051.3(ATM):c.5375T>C (p.Ile1792Thr) rs776309355
NM_000051.3(ATM):c.544G>C (p.Val182Leu) rs3218707
NM_000051.3(ATM):c.5497-2A>G rs786203796
NM_000051.3(ATM):c.5497-8T>C rs3092829
NM_000051.3(ATM):c.5558A>T (p.Asp1853Val) rs1801673
NM_000051.3(ATM):c.5596G>A (p.Val1866Ile) rs1468995507
NM_000051.3(ATM):c.5618G>A (p.Cys1873Tyr) rs587782239
NM_000051.3(ATM):c.5630T>C (p.Phe1877Ser) rs202028401
NM_000051.3(ATM):c.5675-4T>A rs56075338
NM_000051.3(ATM):c.5693G>A (p.Arg1898Gln) rs370680798
NM_000051.3(ATM):c.5762+1G>T rs869312756
NM_000051.3(ATM):c.5763A>G (p.Arg1921=) rs1057523784
NM_000051.3(ATM):c.5825C>T (p.Ala1942Val) rs730881394
NM_000051.3(ATM):c.5858C>T (p.Thr1953Ile) rs587781963
NM_000051.3(ATM):c.6056A>G (p.Tyr2019Cys) rs876658415
NM_000051.3(ATM):c.6088A>G (p.Ile2030Val) rs145847315
NM_000051.3(ATM):c.6095+5A>G rs757328753
NM_000051.3(ATM):c.6095+5del rs1555113628
NM_000051.3(ATM):c.609C>T (p.Asp203=) rs144709948
NM_000051.3(ATM):c.6100C>T (p.Arg2034Ter) rs532480170
NM_000051.3(ATM):c.6154G>A (p.Glu2052Lys) rs202206540
NM_000051.3(ATM):c.6179G>A (p.Arg2060His) rs376521407
NM_000051.3(ATM):c.6198+5A>G rs771047560
NM_000051.3(ATM):c.6200C>A (p.Ala2067Asp) rs397514577
NM_000051.3(ATM):c.6338C>G (p.Thr2113Ser) rs573290117
NM_000051.3(ATM):c.6443A>G (p.Lys2148Arg) rs730881382
NM_000051.3(ATM):c.657T>C (p.Cys219=) rs2235003
NM_000051.3(ATM):c.6652A>C (p.Ser2218Arg) rs749261367
NM_000051.3(ATM):c.6807G>A (p.Gln2269=) rs587780638
NM_000051.3(ATM):c.6891A>G (p.Gln2297=) rs773545588
NM_000051.3(ATM):c.6919C>T (p.Leu2307Phe) rs56009889
NM_000051.3(ATM):c.6975+2T>C rs879254199
NM_000051.3(ATM):c.6976-10_6989del rs587779859
NM_000051.3(ATM):c.6995T>C (p.Leu2332Pro) rs4988111
NM_000051.3(ATM):c.6998C>A (p.Thr2333Lys) rs150503164
NM_000051.3(ATM):c.712A>G (p.Ile238Val) rs754275014
NM_000051.3(ATM):c.7307G>A (p.Arg2436Lys) rs786203394
NM_000051.3(ATM):c.735C>T (p.Val245=) rs3218674
NM_000051.3(ATM):c.7566A>G (p.Gln2522=) rs775621333
NM_000051.3(ATM):c.7618G>A (p.Val2540Ile) rs35203200
NM_000051.3(ATM):c.7630-17T>C rs116047570
NM_000051.3(ATM):c.7630-3C>T rs587782448
NM_000051.3(ATM):c.7775C>G (p.Ser2592Cys) rs755009196
NM_000051.3(ATM):c.7778A>G (p.Gln2593Arg) rs587779867
NM_000051.3(ATM):c.7788G>A (p.Glu2596=) rs587780639
NM_000051.3(ATM):c.7927+13dup rs587781324
NM_000051.3(ATM):c.7988T>C (p.Val2663Ala) rs377648506
NM_000051.3(ATM):c.8122G>A (p.Asp2708Asn) rs587782719
NM_000051.3(ATM):c.8187A>G (p.Gln2729=) rs587781946
NM_000051.3(ATM):c.8353G>A (p.Asp2785Asn) rs587782417
NM_000051.3(ATM):c.8419-19A>G rs12279930
NM_000051.3(ATM):c.8425C>T (p.Gln2809Ter) rs1555137973
NM_000051.3(ATM):c.8530A>G (p.Ile2844Val) rs756230327
NM_000051.3(ATM):c.8732C>T (p.Thr2911Ile) rs794728018
NM_000051.3(ATM):c.8786+1G>T rs17174393
NM_000051.3(ATM):c.8786+8A>C rs4986839
NM_000051.3(ATM):c.8787-5T>C rs1479499265
NM_000051.3(ATM):c.8850+4A>C rs587782335
NM_000051.3(ATM):c.8850+5A>C rs1057522186
NM_000051.3(ATM):c.8851-3T>G rs748874219
NM_000051.3(ATM):c.8921C>T (p.Pro2974Leu) rs139379666
NM_000051.3(ATM):c.8944C>T (p.Pro2982Ser) rs1485620194
NM_000051.3(ATM):c.8988-1G>C rs730881386
NM_000051.3(ATM):c.8988-2A>G rs786202087
NM_000051.3(ATM):c.8993T>C (p.Ile2998Thr) rs778670498
NM_000051.3(ATM):c.9006C>T (p.Phe3002=) rs540172506
NM_000051.3(ATM):c.901+1G>T rs748840480
NM_000051.3(ATM):c.9079dup (p.Ser3027fs) rs587780645
NM_000051.3(ATM):c.95G>A (p.Arg32His) rs368161489
NM_000051.3(ATM):c.967A>G (p.Ile323Val) rs587781511
NM_000051.4(ATM):c.1010G>A (p.Arg337His) rs202160435
NM_000051.4(ATM):c.103C>T (p.Arg35Ter) rs55861249
NM_000051.4(ATM):c.1066-6T>G rs201686625
NM_000051.4(ATM):c.1444A>C (p.Lys482Gln) rs202173660
NM_000051.4(ATM):c.146C>G rs1800054
NM_000051.4(ATM):c.1595G>A (p.Cys532Tyr) rs35963548
NM_000051.4(ATM):c.1703G>T (p.Arg568Ile) rs200381392
NM_000051.4(ATM):c.2021A>G (p.His674Arg) rs201762714
NM_000051.4(ATM):c.2289T>A (p.Phe763Leu) rs34231402
NM_000051.4(ATM):c.2606C>G (p.Ala869Gly) rs145513717
NM_000051.4(ATM):c.2735A>G (p.Gln912Arg) rs730881353
NM_000051.4(ATM):c.2927T>C (p.Val976Ala) rs146145357
NM_000051.4(ATM):c.2932T>C (p.Ser978Pro) rs139552233
NM_000051.4(ATM):c.295A>G (p.Ser99Gly) rs137882485
NM_000051.4(ATM):c.320G>A (p.Cys107Tyr) rs142358238
NM_000051.4(ATM):c.3299C>T (p.Thr1100Met) rs189445371
NM_000051.4(ATM):c.334G>A (p.Ala112Thr) rs146382972
NM_000051.4(ATM):c.3712_3716del (p.Leu1238fs) rs786201675
NM_000051.4(ATM):c.3925G>A (p.Ala1309Thr) rs149711770
NM_000051.4(ATM):c.4060C>A (p.Pro1354Thr) rs145119475
NM_000051.4(ATM):c.4388T>G (p.Phe1463Cys) rs138327406
NM_000051.4(ATM):c.4402G>A (p.Val1468Ile) rs369903995
NM_000051.4(ATM):c.4578C>T (p.Pro1526=) rs1800889
NM_000051.4(ATM):c.4709T>C (p.Val1570Ala) rs140856217
NM_000051.4(ATM):c.496+4T>C rs587781375
NM_000051.4(ATM):c.5071A>C (p.Ser1691Arg) rs1800059
NM_000051.4(ATM):c.5185G>C (p.Val1729Leu) rs3092907
NM_000051.4(ATM):c.5793T>C (p.Ala1931=) rs3092910
NM_000051.4(ATM):c.5821G>C (p.Val1941Leu) rs147187700
NM_000051.4(ATM):c.5975A>C (p.Lys1992Thr) rs150757822
NM_000051.4(ATM):c.6067G>A (p.Gly2023Arg) rs11212587
NM_000051.4(ATM):c.6198+1G>A rs778031266
NM_000051.4(ATM):c.6975G>A (p.Ala2325=) rs556778314
NM_000051.4(ATM):c.7092A>G (p.Ala2364=) rs1591150359
NM_000051.4(ATM):c.7187C>G (p.Thr2396Ser) rs370559102
NM_000051.4(ATM):c.7313C>T (p.Thr2438Ile) rs147604227
NM_000051.4(ATM):c.749G>A (p.Arg250Gln) rs56123940
NM_000051.4(ATM):c.7740A>C (p.Arg2580Ser) rs199915459
NM_000051.4(ATM):c.7789-3T>G rs864622185
NM_000051.4(ATM):c.8151G>A (p.Lys2717=) rs1591192550
NM_000051.4(ATM):c.9086G>A (p.Gly3029Asp) rs201199629
NM_000051.4(ATM):c.9166G>T (p.Val3056Leu) rs371767164
NM_000059.3(BRCA2):c.-11C>T rs76874770
NM_000059.3(BRCA2):c.10024G>A (p.Glu3342Lys) rs28897761
NM_000059.3(BRCA2):c.10070C>T (p.Thr3357Ile) rs80358388
NM_000059.3(BRCA2):c.10076A>G (p.Glu3359Gly) rs80358389
NM_000059.3(BRCA2):c.10082A>C (p.Gln3361Pro) rs751250810
NM_000059.3(BRCA2):c.10089A>G (p.Ile3363Met) rs80358390
NM_000059.3(BRCA2):c.10111A>G (p.Thr3371Ala) rs80358393
NM_000059.3(BRCA2):c.10120A>G (p.Thr3374Ala) rs80358395
NM_000059.3(BRCA2):c.10160C>G (p.Thr3387Ser) rs863224584
NM_000059.3(BRCA2):c.10189T>A (p.Ser3397Thr) rs876660044
NM_000059.3(BRCA2):c.10238C>A (p.Thr3413Lys) rs730881584
NM_000059.3(BRCA2):c.10240A>G (p.Thr3414Ala) rs80358405
NM_000059.3(BRCA2):c.10249T>C (p.Tyr3417His) rs535952730
NM_000059.3(BRCA2):c.1040A>G (p.Gln347Arg) rs55800493
NM_000059.3(BRCA2):c.1054T>C (p.Tyr352His) rs542343726
NM_000059.3(BRCA2):c.1124C>T (p.Pro375Leu) rs80358409
NM_000059.3(BRCA2):c.1141G>A (p.Asp381Asn) rs398122723
NM_000059.3(BRCA2):c.1166C>A (p.Pro389Gln) rs397507263
NM_000059.3(BRCA2):c.1166C>T (p.Pro389Leu) rs397507263
NM_000059.3(BRCA2):c.1167G>A (p.Pro389=) rs148607710
NM_000059.3(BRCA2):c.1225G>A (p.Glu409Lys) rs80358416
NM_000059.3(BRCA2):c.122C>T (p.Pro41Leu) rs786201716
NM_000059.3(BRCA2):c.1232T>C (p.Ile411Thr) rs79597821
NM_000059.3(BRCA2):c.1244A>G (p.His415Arg) rs80358417
NM_000059.3(BRCA2):c.1275A>G (p.Glu425=) rs34355306
NM_000059.3(BRCA2):c.1342C>T (p.Arg448Cys) rs80358422
NM_000059.3(BRCA2):c.1343G>A (p.Arg448His) rs80358423
NM_000059.3(BRCA2):c.136C>T (p.Pro46Ser) rs80358425
NM_000059.3(BRCA2):c.1427C>G (p.Ser476Cys) rs80358431
NM_000059.3(BRCA2):c.1441A>G (p.Ile481Val) rs760559435
NM_000059.3(BRCA2):c.1460C>A (p.Ala487Glu) rs56390402
NM_000059.3(BRCA2):c.1462A>G (p.Ile488Val) rs864622352
NM_000059.3(BRCA2):c.1466C>G (p.Ser489Cys) rs587782535
NM_000059.3(BRCA2):c.1591A>G (p.Lys531Glu) rs876659050
NM_000059.3(BRCA2):c.1624A>G (p.Ile542Val) rs730881511
NM_000059.3(BRCA2):c.1630A>G (p.Thr544Ala) rs80358447
NM_000059.3(BRCA2):c.1631C>T (p.Thr544Ile) rs80358448
NM_000059.3(BRCA2):c.1644G>A (p.Gln548=) rs55986646
NM_000059.3(BRCA2):c.1666A>G (p.Asn556Asp) rs587781794
NM_000059.3(BRCA2):c.167A>C (p.Asn56Thr) rs80358454
NM_000059.3(BRCA2):c.1763A>G (p.Asn588Ser) rs373400041
NM_000059.3(BRCA2):c.1788T>C (p.Asp596=) rs11571642
NM_000059.3(BRCA2):c.1813dupA (p.Ile605Asnfs) rs80359306
NM_000059.3(BRCA2):c.182T>C (p.Leu61Pro) rs1555280374
NM_000059.3(BRCA2):c.1838T>G (p.Leu613Arg) rs587780646
NM_000059.3(BRCA2):c.1889C>T (p.Thr630Ile) rs80358479
NM_000059.3(BRCA2):c.1911T>C (p.Gly637=) rs11571652
NM_000059.3(BRCA2):c.1951G>T (p.Asp651Tyr) rs80358482
NM_000059.3(BRCA2):c.2014A>G (p.Arg672Gly) rs587781647
NM_000059.3(BRCA2):c.2044A>T (p.Ile682Phe) rs398122738
NM_000059.3(BRCA2):c.2125C>G (p.Leu709Val) rs80358489
NM_000059.3(BRCA2):c.2145A>G (p.Gly715=) rs112566179
NM_000059.3(BRCA2):c.2148G>C (p.Gln716His) rs876659550
NM_000059.3(BRCA2):c.215A>G (p.Asn72Ser) rs276174818
NM_000059.3(BRCA2):c.2320A>G (p.Thr774Ala) rs55968715
NM_000059.3(BRCA2):c.2332G>A (p.Val778Ile) rs587779360
NM_000059.3(BRCA2):c.2348T>G (p.Val783Gly) rs768143929
NM_000059.3(BRCA2):c.235A>G (p.Ile79Val) rs80358502
NM_000059.3(BRCA2):c.2461G>A (p.Val821Ile) rs756411508
NM_000059.3(BRCA2):c.2484T>C (p.Tyr828=) rs45619134
NM_000059.3(BRCA2):c.2490C>A (p.Asn830Lys) rs56331088
NM_000059.3(BRCA2):c.2492T>C (p.Val831Ala) rs779520270
NM_000059.3(BRCA2):c.2524G>C (p.Val842Leu) rs587782454
NM_000059.3(BRCA2):c.257T>C (p.Leu86Pro) rs572782576
NM_000059.3(BRCA2):c.2667T>C (p.Asn889=) rs587782469
NM_000059.3(BRCA2):c.2679A>G (p.Gln893=) rs786203640
NM_000059.3(BRCA2):c.2683G>A (p.Ala895Thr) rs786203045
NM_000059.3(BRCA2):c.2771A>T (p.Asn924Ile) rs80358530
NM_000059.3(BRCA2):c.2803G>C (p.Asp935His) rs28897716
NM_000059.3(BRCA2):c.2813C>A (p.Ala938Glu) rs55773834
NM_000059.3(BRCA2):c.2817C>T (p.Thr939=) rs367921107
NM_000059.3(BRCA2):c.2837A>G (p.Asp946Gly) rs55972907
NM_000059.3(BRCA2):c.2849T>A (p.Val950Asp) rs80358535
NM_000059.3(BRCA2):c.28A>G (p.Thr10Ala) rs786203080
NM_000059.3(BRCA2):c.2926T>A (p.Ser976Thr) rs144862123
NM_000059.3(BRCA2):c.2927C>T (p.Ser976Phe) rs11571656
NM_000059.3(BRCA2):c.2944A>C (p.Ile982Leu) rs28897717
NM_000059.3(BRCA2):c.3032C>G (p.Thr1011Arg) rs80358548
NM_000059.3(BRCA2):c.3211C>T (p.His1071Tyr) rs80358564
NM_000059.3(BRCA2):c.3262C>T (p.Pro1088Ser) rs80358572
NM_000059.3(BRCA2):c.3304A>T (p.Asn1102Tyr) rs28897719
NM_000059.3(BRCA2):c.338G>A (p.Arg113Lys) rs876659161
NM_000059.3(BRCA2):c.3392G>A (p.Arg1131Lys) rs1555283214
NM_000059.3(BRCA2):c.341A>G (p.His114Arg) rs80358586
NM_000059.3(BRCA2):c.3420T>C (p.Ser1140=) rs118093942
NM_000059.3(BRCA2):c.3431T>G (p.Val1144Gly) rs80358587
NM_000059.3(BRCA2):c.343A>G (p.Lys115Glu) rs56242644
NM_000059.3(BRCA2):c.3451A>G (p.Ile1151Val) rs80358591
NM_000059.3(BRCA2):c.3458A>G (p.Lys1153Arg) rs80358594
NM_000059.3(BRCA2):c.3479G>A (p.Arg1160Lys) rs183920365
NM_000059.3(BRCA2):c.3485C>T (p.Ala1162Val) rs587778122
NM_000059.3(BRCA2):c.3494A>G (p.His1165Arg) rs587782201
NM_000059.3(BRCA2):c.3539A>G (p.Lys1180Arg) rs28897720
NM_000059.3(BRCA2):c.3562A>G (p.Ile1188Val) rs202230438
NM_000059.3(BRCA2):c.3568C>T (p.Arg1190Trp) rs80358604
NM_000059.3(BRCA2):c.3644G>A (p.Gly1215Glu) rs773442698
NM_000059.3(BRCA2):c.3682A>G (p.Asn1228Asp) rs28897722
NM_000059.3(BRCA2):c.3749A>G (p.Glu1250Gly) rs56400215
NM_000059.3(BRCA2):c.3767A>G (p.His1256Arg) rs80358618
NM_000059.3(BRCA2):c.3814A>G (p.Met1272Val) rs80358624
NM_000059.3(BRCA2):c.4046T>C (p.Ile1349Thr) rs80358654
NM_000059.3(BRCA2):c.4061C>T (p.Thr1354Met) rs80358656
NM_000059.3(BRCA2):c.4090A>C (p.Ile1364Leu) rs56248502
NM_000059.3(BRCA2):c.4178C>T (p.Ala1393Val) rs398122776
NM_000059.3(BRCA2):c.4241C>T (p.Thr1414Met) rs70953664
NM_000059.3(BRCA2):c.4268C>T (p.Thr1423Ile) rs1593901864
NM_000059.3(BRCA2):c.4277C>T (p.Thr1426Ile) rs748591104
NM_000059.3(BRCA2):c.4315G>A (p.Ala1439Thr) rs80358666
NM_000059.3(BRCA2):c.4316C>A (p.Ala1439Asp) rs80358667
NM_000059.3(BRCA2):c.4376A>G (p.Asn1459Ser) rs117187202
NM_000059.3(BRCA2):c.4535G>A (p.Arg1512His) rs80358685
NM_000059.3(BRCA2):c.4570T>G (p.Phe1524Val) rs56386506
NM_000059.3(BRCA2):c.4599A>C (p.Lys1533Asn) rs80358694
NM_000059.3(BRCA2):c.4672A>C (p.Ser1558Arg) rs587782822
NM_000059.3(BRCA2):c.4681C>A (p.His1561Asn) rs2219594
NM_000059.3(BRCA2):c.4686A>G (p.Gln1562=) rs28897730
NM_000059.3(BRCA2):c.4703A>G (p.Lys1568Arg) rs80358699
NM_000059.3(BRCA2):c.475+1G>T rs81002797
NM_000059.3(BRCA2):c.4759G>A (p.Ala1587Thr) rs56137239
NM_000059.3(BRCA2):c.475G>A (p.Val159Met) rs80358702
NM_000059.3(BRCA2):c.4828G>A (p.Val1610Met) rs80358705
NM_000059.3(BRCA2):c.4901T>C (p.Phe1634Ser) rs80358715
NM_000059.3(BRCA2):c.4915G>A (p.Val1639Ile) rs80358716
NM_000059.3(BRCA2):c.4977C>T (p.Ser1659=) rs45484897
NM_000059.3(BRCA2):c.497A>T (p.His166Leu) rs876658364
NM_000059.3(BRCA2):c.4988T>C (p.Val1663Ala) rs1060502436
NM_000059.3(BRCA2):c.5020A>G (p.Ser1674Gly) rs80358725
NM_000059.3(BRCA2):c.502C>A (p.Pro168Thr) rs80358726
NM_000059.3(BRCA2):c.5153A>G (p.Asn1718Ser) rs80358739
NM_000059.3(BRCA2):c.5165G>A (p.Ser1722Asn) rs773707172
NM_000059.3(BRCA2):c.517-19C>T rs11571623
NM_000059.3(BRCA2):c.5170A>G (p.Ile1724Val) rs35335654
NM_000059.3(BRCA2):c.5200G>A (p.Glu1734Lys) rs786202543
NM_000059.3(BRCA2):c.521G>A (p.Arg174His) rs80358747
NM_000059.3(BRCA2):c.5365A>G (p.Lys1789Glu) rs587782240
NM_000059.3(BRCA2):c.5378A>G (p.Asn1793Ser) rs80358759
NM_000059.3(BRCA2):c.53G>A (p.Arg18His) rs80358762
NM_000059.3(BRCA2):c.5414A>G (p.Asn1805Ser) rs80358765
NM_000059.3(BRCA2):c.5427C>T (p.Cys1809=) rs80359791
NM_000059.3(BRCA2):c.5428G>A (p.Val1810Ile) rs80358766
NM_000059.3(BRCA2):c.5455C>T (p.Pro1819Ser) rs80358768
NM_000059.3(BRCA2):c.5474C>T (p.Ala1825Val) rs397507352
NM_000059.3(BRCA2):c.5529A>C (p.Ala1843=) rs372951842
NM_000059.3(BRCA2):c.5535G>C (p.Arg1845Ser) rs786201997
NM_000059.3(BRCA2):c.5552T>G (p.Ile1851Ser) rs80358776
NM_000059.3(BRCA2):c.5606G>A (p.Ser1869Asn) rs1555284296
NM_000059.3(BRCA2):c.5651T>C (p.Ile1884Thr) rs80358788
NM_000059.3(BRCA2):c.5659A>G (p.Thr1887Ala) rs786202618
NM_000059.3(BRCA2):c.5663A>G (p.Lys1888Arg) rs80358791
NM_000059.3(BRCA2):c.5681dupA (p.Tyr1894Terfs) rs80359527
NM_000059.3(BRCA2):c.5695G>A (p.Asp1899Asn) rs371189402
NM_000059.3(BRCA2):c.5704G>A (p.Asp1902Asn) rs4987048
NM_000059.3(BRCA2):c.5714A>G (p.His1905Arg) rs80358796
NM_000059.3(BRCA2):c.5723T>C (p.Leu1908Pro) rs80358797
NM_000059.3(BRCA2):c.5728_5730del (p.Asn1910del) rs28897736
NM_000059.3(BRCA2):c.5733T>G (p.Asp1911Glu) rs367823201
NM_000059.3(BRCA2):c.5737T>C (p.Cys1913Arg) rs80358799
NM_000059.3(BRCA2):c.5808G>A (p.Met1936Ile) rs759138390
NM_000059.3(BRCA2):c.5836T>C (p.Ser1946Pro) rs80358811
NM_000059.3(BRCA2):c.5882G>A (p.Ser1961Asn) rs80358820
NM_000059.3(BRCA2):c.5893C>T (p.Leu1965Phe) rs398122542
NM_000059.3(BRCA2):c.5975C>T (p.Ser1992Leu) rs80358830
NM_000059.3(BRCA2):c.599C>T (p.Thr200Ile) rs587781402
NM_000059.3(BRCA2):c.59A>G (p.Asn20Ser) rs398122544
NM_000059.3(BRCA2):c.6101G>A (p.Arg2034His) rs80358849
NM_000059.3(BRCA2):c.6131G>T (p.Gly2044Val) rs56191579
NM_000059.3(BRCA2):c.6225A>C (p.Lys2075Asn) rs80358863
NM_000059.3(BRCA2):c.6269A>G (p.His2090Arg) rs397507366
NM_000059.3(BRCA2):c.6293C>T (p.Ser2098Phe) rs80358867
NM_000059.3(BRCA2):c.632-3C>A rs568027879
NM_000059.3(BRCA2):c.6323G>T (p.Arg2108Leu) rs35029074
NM_000059.3(BRCA2):c.6338A>G (p.Asn2113Ser) rs80358874
NM_000059.3(BRCA2):c.6399_6401del (p.Asn2135del) rs80359581
NM_000059.3(BRCA2):c.6412G>T (p.Val2138Phe) rs11571659
NM_000059.3(BRCA2):c.6458C>T (p.Pro2153Leu) rs276174873
NM_000059.3(BRCA2):c.6461A>C (p.Tyr2154Ser) rs80358882
NM_000059.3(BRCA2):c.6475C>G (p.Gln2159Glu) rs398122558
NM_000059.3(BRCA2):c.6479A>G (p.Gln2160Arg) rs587781610
NM_000059.3(BRCA2):c.6482A>G (p.Asp2161Gly) rs786201744
NM_000059.3(BRCA2):c.6523G>C (p.Glu2175Gln) rs876658412
NM_000059.3(BRCA2):c.6541G>C (p.Gly2181Arg) rs371067421
NM_000059.3(BRCA2):c.6550C>G (p.Gln2184Glu) rs80358887
NM_000059.3(BRCA2):c.6568G>A (p.Val2190Ile) rs80358888
NM_000059.3(BRCA2):c.6613G>A (p.Val2205Met) rs80358889
NM_000059.3(BRCA2):c.6626T>C (p.Ile2209Thr) rs431825344
NM_000059.3(BRCA2):c.6691G>A (p.Ala2231Thr) rs758379999
NM_000059.3(BRCA2):c.67+4T>C rs373546450
NM_000059.3(BRCA2):c.6714T>G (p.Asp2238Glu) rs28897742
NM_000059.3(BRCA2):c.6739A>G (p.Ser2247Gly) rs80358896
NM_000059.3(BRCA2):c.6785T>G (p.Met2262Arg) rs80358904
NM_000059.3(BRCA2):c.68-1G>A rs1060502376
NM_000059.3(BRCA2):c.68-1G>T rs1060502376
NM_000059.3(BRCA2):c.6803G>A (p.Arg2268Lys) rs80358906
NM_000059.3(BRCA2):c.6821G>T (p.Gly2274Val) rs55712212
NM_000059.3(BRCA2):c.6832A>G (p.Ile2278Val) rs772645059
NM_000059.3(BRCA2):c.6886A>C (p.Ile2296Leu) rs576279166
NM_000059.3(BRCA2):c.6892G>A (p.Glu2298Lys) rs80358914
NM_000059.3(BRCA2):c.6935A>T (p.Asp2312Val) rs80358916
NM_000059.3(BRCA2):c.6938-15A>G rs587782358
NM_000059.3(BRCA2):c.7008-2A>T rs81002823
NM_000059.3(BRCA2):c.7051G>A (p.Ala2351Thr) rs80358930
NM_000059.3(BRCA2):c.7052C>G (p.Ala2351Gly) rs80358932
NM_000059.3(BRCA2):c.7121A>G (p.Asn2374Ser) rs1379054137
NM_000059.3(BRCA2):c.7188G>T (p.Leu2396Phe) rs587780871
NM_000059.3(BRCA2):c.7222C>T (p.Pro2408Ser) rs398122577
NM_000059.3(BRCA2):c.7232A>C (p.Lys2411Thr) rs80358950
NM_000059.3(BRCA2):c.7241C>T (p.Ser2414Leu) rs80358951
NM_000059.3(BRCA2):c.7241_7242inv (p.Ser2414Leu)
NM_000059.3(BRCA2):c.7252A>G (p.Arg2418Gly) rs80358953
NM_000059.3(BRCA2):c.7313A>G (p.Asp2438Gly) rs80358957
NM_000059.3(BRCA2):c.7354A>G (p.Asn2452Asp) rs398122580
NM_000059.3(BRCA2):c.7402G>A (p.Val2468Ile) rs730881553
NM_000059.3(BRCA2):c.7415A>C (p.Lys2472Thr) rs80358963
NM_000059.3(BRCA2):c.7418G>A (p.Cys2473Tyr) rs55924966
NM_000059.3(BRCA2):c.7462A>G (p.Arg2488Gly) rs746057464
NM_000059.3(BRCA2):c.7464A>C (p.Arg2488Ser) rs80358969
NM_000059.3(BRCA2):c.7507G>A (p.Val2503Ile) rs587782191
NM_000059.3(BRCA2):c.750G>A (p.Val250=) rs143214959
NM_000059.3(BRCA2):c.7522G>A (p.Gly2508Ser) rs80358978
NM_000059.3(BRCA2):c.7534C>T (p.Leu2512Phe) rs80358980
NM_000059.3(BRCA2):c.7559G>T (p.Arg2520Leu) rs80358982
NM_000059.3(BRCA2):c.7580T>C (p.Val2527Ala) rs587782676
NM_000059.3(BRCA2):c.7598C>G (p.Ser2533Cys) rs80358987
NM_000059.3(BRCA2):c.7601C>T (p.Ala2534Val) rs74047012
NM_000059.3(BRCA2):c.7618-2A>G rs886040940
NM_000059.3(BRCA2):c.7625C>T (p.Thr2542Met) rs80358989
NM_000059.3(BRCA2):c.7651A>C (p.Lys2551Gln) rs398122587
NM_000059.3(BRCA2):c.7759C>T (p.Leu2587Phe) rs56335340
NM_000059.3(BRCA2):c.7766C>A (p.Pro2589His) rs80359005
NM_000059.3(BRCA2):c.7786G>A (p.Gly2596Arg) rs398122591
NM_000059.3(BRCA2):c.7822C>G (p.Pro2608Ala) rs879255308
NM_000059.3(BRCA2):c.7857G>C (p.Trp2619Cys) rs80359011
NM_000059.3(BRCA2):c.7915C>G (p.Pro2639Ala) rs80359017
NM_000059.3(BRCA2):c.793G>A (p.Gly265Arg) rs1403242422
NM_000059.3(BRCA2):c.7940T>C (p.Leu2647Pro) rs80359021
NM_000059.3(BRCA2):c.7958T>C (p.Leu2653Pro) rs80359022
NM_000059.3(BRCA2):c.7964A>G (p.Gln2655Arg) rs80359024
NM_000059.3(BRCA2):c.7985C>T (p.Thr2662Met) rs431825362
NM_000059.3(BRCA2):c.7993G>T (p.Asp2665Tyr) rs921017191
NM_000059.3(BRCA2):c.79A>G (p.Ile27Val) rs80359034
NM_000059.3(BRCA2):c.8007A>T (p.Arg2669Ser) rs143999963
NM_000059.3(BRCA2):c.8011G>T (p.Ala2671Ser) rs786201976
NM_000059.3(BRCA2):c.8027T>C (p.Met2676Thr) rs80359038
NM_000059.3(BRCA2):c.8036A>G (p.Asp2679Gly) rs80359041
NM_000059.3(BRCA2):c.8057T>C (p.Leu2686Pro) rs28897746
NM_000059.3(BRCA2):c.8063T>C (p.Leu2688Pro) rs80359045
NM_000059.3(BRCA2):c.8084C>T (p.Ser2695Leu) rs80359048
NM_000059.3(BRCA2):c.8111C>T (p.Ser2704Phe) rs80359054
NM_000059.3(BRCA2):c.8113A>G (p.Ser2705Gly) rs756105620
NM_000059.3(BRCA2):c.8115C>G (p.Ser2705Arg) rs587781889
NM_000059.3(BRCA2):c.8162T>A (p.Leu2721His) rs80359061
NM_000059.3(BRCA2):c.8165C>G (p.Thr2722Arg) rs80359062
NM_000059.3(BRCA2):c.8169T>A (p.Asp2723Glu) rs1060502432
NM_000059.3(BRCA2):c.8182G>C (p.Val2728Leu) rs28897749
NM_000059.3(BRCA2):c.8192A>G (p.Gln2731Arg) rs753837544
NM_000059.3(BRCA2):c.8233C>G (p.Leu2745Val) rs786201752
NM_000059.3(BRCA2):c.8299C>T (p.Pro2767Ser) rs587782619
NM_000059.3(BRCA2):c.8303T>A (p.Leu2768His) rs587782732
NM_000059.3(BRCA2):c.8309C>A (p.Ala2770Asp) rs28897750
NM_000059.3(BRCA2):c.8342A>T (p.Asn2781Ile) rs1434821822
NM_000059.3(BRCA2):c.8350C>T (p.Arg2784Trp) rs80359075
NM_000059.3(BRCA2):c.8351G>T (p.Arg2784Leu) rs80359076
NM_000059.3(BRCA2):c.8359C>T (p.Arg2787Cys) rs41293517
NM_000059.3(BRCA2):c.8360G>A (p.Arg2787His) rs80359078
NM_000059.3(BRCA2):c.8378G>A (p.Gly2793Glu) rs80359083
NM_000059.3(BRCA2):c.8382C>G (p.Phe2794Leu) rs80359084
NM_000059.3(BRCA2):c.8386C>T (p.Pro2796Ser) rs146120136
NM_000059.3(BRCA2):c.8417C>T (p.Ser2806Leu) rs587782785
NM_000059.3(BRCA2):c.8420C>T (p.Ser2807Leu) rs55763607
NM_000059.3(BRCA2):c.8435G>A (p.Gly2812Glu) rs80359091
NM_000059.3(BRCA2):c.8447G>A (p.Gly2816Asp) rs56096120
NM_000059.3(BRCA2):c.8450G>T (p.Cys2817Phe) rs786201992
NM_000059.3(BRCA2):c.847A>G (p.Ile283Val) rs80359097
NM_000059.3(BRCA2):c.8487+3A>G rs81002806
NM_000059.3(BRCA2):c.8525G>T (p.Arg2842Leu) rs80359105
NM_000059.3(BRCA2):c.8539G>A (p.Glu2847Lys) rs80359108
NM_000059.3(BRCA2):c.8545A>G (p.Lys2849Glu) rs80359109
NM_000059.3(BRCA2):c.8554G>A (p.Ala2852Thr) rs1555287769
NM_000059.3(BRCA2):c.865A>G (p.Asn289Asp) rs766173
NM_000059.3(BRCA2):c.8687G>A (p.Arg2896His) rs80359128
NM_000059.3(BRCA2):c.8702G>A (p.Gly2901Asp) rs80359129
NM_000059.3(BRCA2):c.8775G>C (p.Gln2925His) rs80359136
NM_000059.3(BRCA2):c.8854A>G (p.Met2952Val) rs397508016
NM_000059.3(BRCA2):c.8866G>C (p.Glu2956Gln) rs142040996
NM_000059.3(BRCA2):c.8893G>C (p.Asp2965His) rs80359141
NM_000059.3(BRCA2):c.8897T>C (p.Val2966Ala) rs876658955
NM_000059.3(BRCA2):c.8954-3C>G rs81002844
NM_000059.3(BRCA2):c.905C>T (p.Thr302Ile) rs80359158
NM_000059.3(BRCA2):c.9082G>C (p.Ala3028Pro) rs80359161
NM_000059.3(BRCA2):c.9085G>A (p.Ala3029Thr) rs56179254
NM_000059.3(BRCA2):c.9098C>T (p.Thr3033Ile) rs431825374
NM_000059.3(BRCA2):c.9104A>G (p.Tyr3035Cys) rs80359165
NM_000059.3(BRCA2):c.9190G>A (p.Asp3064Asn) rs80359177
NM_000059.3(BRCA2):c.9205T>C (p.Cys3069Arg) rs398122611
NM_000059.3(BRCA2):c.9234C>T (p.Val3078=) rs587782428
NM_000059.3(BRCA2):c.9302T>G (p.Leu3101Arg) rs28897758
NM_000059.3(BRCA2):c.9383G>A (p.Arg3128Gln) rs397507427
NM_000059.3(BRCA2):c.9433G>A (p.Val3145Met) rs587776476
NM_000059.3(BRCA2):c.9433G>C (p.Val3145Leu) rs587776476
NM_000059.3(BRCA2):c.943T>A (p.Cys315Ser) rs79483201
NM_000059.3(BRCA2):c.9477C>A (p.Phe3159Leu) rs80359221
NM_000059.3(BRCA2):c.9496G>A (p.Val3166Ile) rs398122615
NM_000059.3(BRCA2):c.9509A>G (p.Asp3170Gly) rs80359224
NM_000059.3(BRCA2):c.9547A>G (p.Ile3183Val) rs377123889
NM_000059.3(BRCA2):c.956A>C (p.Asn319Thr) rs55939572
NM_000059.3(BRCA2):c.9583A>G (p.Thr3195Ala) rs80359227
NM_000059.3(BRCA2):c.9592T>C (p.Cys3198Arg) rs80359229
NM_000059.3(BRCA2):c.9605C>T (p.Pro3202Leu) rs397507432
NM_000059.3(BRCA2):c.9606G>C (p.Pro3202=) rs755890067
NM_000059.3(BRCA2):c.9616C>G (p.Gln3206Glu) rs80359233
NM_000059.3(BRCA2):c.9632C>A (p.Thr3211Lys) rs730881583
NM_000059.3(BRCA2):c.9647T>C (p.Leu3216Pro) rs431825377
NM_000059.3(BRCA2):c.9651G>A (p.Met3217Ile) rs431825379
NM_000059.3(BRCA2):c.9672dup (p.Tyr3225fs) rs80359773
NM_000059.3(BRCA2):c.971G>A (p.Arg324Lys) rs397507435
NM_000059.3(BRCA2):c.9770A>G (p.Lys3257Arg) rs55847618
NM_000059.3(BRCA2):c.9808del (p.Ala3270fs) rs398122622
NM_000059.3(BRCA2):c.9838C>T (p.Pro3280Ser) rs55835607
NM_000059.3(BRCA2):c.9839C>A (p.Pro3280His) rs80359246
NM_000059.3(BRCA2):c.9872C>G (p.Ser3291Cys) rs200210279
NM_000059.3(BRCA2):c.9924C>T (p.Tyr3308=) rs4987049
NM_000059.3(BRCA2):c.9934A>G (p.Ile3312Val) rs80359254
NM_000059.3(BRCA2):c.9952A>C (p.Asn3318His) rs80359256
NM_000059.4(BRCA2):c.10045A>G (p.Thr3349Ala) rs80358387
NM_000059.4(BRCA2):c.10095delinsGAATTATATCT (p.Ser3366fs) rs276174803
NM_000059.4(BRCA2):c.10110G>A (p.Arg3370=) rs28897762
NM_000059.4(BRCA2):c.10121C>T (p.Thr3374Ile) rs56309455
NM_000059.4(BRCA2):c.1012G>A (p.Ala338Thr) rs80358396
NM_000059.4(BRCA2):c.10154G>A (p.Arg3385His) rs80358398
NM_000059.4(BRCA2):c.10202C>T (p.Thr3401Met) rs55853199
NM_000059.4(BRCA2):c.1151C>T (p.Ser384Phe) rs41293475
NM_000059.4(BRCA2):c.125A>G (p.Tyr42Cys) rs4987046
NM_000059.4(BRCA2):c.1385A>G (p.Glu462Gly) rs56403624
NM_000059.4(BRCA2):c.1395A>C (p.Val465=) rs11571641
NM_000059.4(BRCA2):c.1504A>C (p.Lys502Gln) rs276174809
NM_000059.4(BRCA2):c.1514T>C (p.Ile505Thr) rs28897708
NM_000059.4(BRCA2):c.1538A>G (p.Lys513Arg) rs28897709
NM_000059.4(BRCA2):c.1564G>C (p.Gly522Arg) rs80358442
NM_000059.4(BRCA2):c.162CAA[1] (p.Asn56del) rs11571587
NM_000059.4(BRCA2):c.1662T>G (p.Cys554Trp) rs80358451
NM_000059.4(BRCA2):c.1744A>C (p.Thr582Pro) rs80358457
NM_000059.4(BRCA2):c.175C>G (p.Pro59Ala) rs56091799
NM_000059.4(BRCA2):c.1786G>C (p.Asp596His) rs56328701
NM_000059.4(BRCA2):c.1792A>G (p.Thr598Ala) rs28897710
NM_000059.4(BRCA2):c.1798T>C (p.Tyr600His) rs75419644
NM_000059.4(BRCA2):c.179A>G (p.Asn60Ser) rs80358463
NM_000059.4(BRCA2):c.1804G>A (p.Gly602Arg) rs80358466
NM_000059.4(BRCA2):c.1909+9_1909+10del rs527732001
NM_000059.4(BRCA2):c.1938C>T (p.Ser646=) rs28897711
NM_000059.4(BRCA2):c.1964C>G (p.Pro655Arg) rs28897712
NM_000059.4(BRCA2):c.2123C>A (p.Ser708Tyr) rs1593896146
NM_000059.4(BRCA2):c.2150G>A (p.Cys717Tyr) rs1184992634
NM_000059.4(BRCA2):c.2233A>G (p.Lys745Glu) rs374691587
NM_000059.4(BRCA2):c.223G>C (p.Ala75Pro) rs28897701
NM_000059.4(BRCA2):c.2274T>G (p.Ser758Arg) rs142243359
NM_000059.4(BRCA2):c.2287C>G (p.His763Asp) rs863224585
NM_000059.4(BRCA2):c.2350A>G (p.Met784Val) rs11571653
NM_000059.4(BRCA2):c.241T>A (p.Phe81Ile) rs80358507
NM_000059.4(BRCA2):c.2538A>C (p.Ser846=) rs11571654
NM_000059.4(BRCA2):c.2716A>G (p.Thr906Ala) rs80358528
NM_000059.4(BRCA2):c.2803G>A (p.Asp935Asn) rs28897716
NM_000059.4(BRCA2):c.2857GAG[1] (p.Glu954del) rs80359360
NM_000059.4(BRCA2):c.2883G>A (p.Gln961=) rs11571655
NM_000059.4(BRCA2):c.2918C>T (p.Ser973Leu) rs397507296
NM_000059.4(BRCA2):c.2926_2927delinsAT (p.Ser976Ile) rs276174831
NM_000059.4(BRCA2):c.2957A>G (p.Asn986Ser) rs28897718
NM_000059.4(BRCA2):c.2999T>C (p.Ile1000Thr) rs374769365
NM_000059.4(BRCA2):c.3055C>G (p.Leu1019Val) rs55638633
NM_000059.4(BRCA2):c.3073A>G (p.Lys1025Glu) rs80358550
NM_000059.4(BRCA2):c.3256A>G (p.Ile1086Val) rs80358571
NM_000059.4(BRCA2):c.3264T>C (p.Pro1088=) rs36060526
NM_000059.4(BRCA2):c.3509C>T (p.Ala1170Val) rs80358599
NM_000059.4(BRCA2):c.3516G>A (p.Ser1172=) rs1799952
NM_000059.4(BRCA2):c.3861TAA[1] (p.Asn1288del) rs276174837
NM_000059.4(BRCA2):c.3869G>A (p.Cys1290Tyr) rs41293485
NM_000059.4(BRCA2):c.3910A>G (p.Thr1304Ala) rs28897723
NM_000059.4(BRCA2):c.4068G>A (p.Leu1356=) rs28897724
NM_000059.4(BRCA2):c.4143AGA[1] (p.Glu1382del) rs80359432
NM_000059.4(BRCA2):c.4187A>G (p.Gln1396Arg) rs55969723
NM_000059.4(BRCA2):c.4258G>T (p.Asp1420Tyr) rs28897727
NM_000059.4(BRCA2):c.430GTT[1] (p.Val145del) rs80359442
NM_000059.4(BRCA2):c.440A>G (p.Gln147Arg) rs80358674
NM_000059.4(BRCA2):c.4436G>C (p.Ser1479Thr) rs80358678
NM_000059.4(BRCA2):c.4585G>A (p.Gly1529Arg) rs28897728
NM_000059.4(BRCA2):c.4614T>C (p.Ser1538=) rs45520945
NM_000059.4(BRCA2):c.4795AAT[1] (p.Asn1600del) rs276174851
NM_000059.4(BRCA2):c.4928T>C (p.Val1643Ala) rs28897731
NM_000059.4(BRCA2):c.5070A>C (p.Lys1690Asn) rs56087561
NM_000059.4(BRCA2):c.517-2A>G rs81002858
NM_000059.4(BRCA2):c.5198C>T (p.Ser1733Phe) rs55639415
NM_000059.4(BRCA2):c.5199C>T (p.Ser1733=) rs28897734
NM_000059.4(BRCA2):c.5312G>A (p.Gly1771Asp) rs80358755
NM_000059.4(BRCA2):c.5635G>A (p.Glu1879Lys) rs55996097
NM_000059.4(BRCA2):c.5640T>G (p.Asn1880Lys) rs11571657
NM_000059.4(BRCA2):c.5729A>G (p.Asn1910Ser) rs276174863
NM_000059.4(BRCA2):c.5744C>T (p.Thr1915Met) rs4987117
NM_000059.4(BRCA2):c.5869A>G (p.Ile1957Val) rs80358817
NM_000059.4(BRCA2):c.5885T>C (p.Ile1962Thr) rs1060502377
NM_000059.4(BRCA2):c.5897A>G (p.His1966Arg) rs80358823
NM_000059.4(BRCA2):c.5986G>A (p.Ala1996Thr) rs80358833
NM_000059.4(BRCA2):c.6095C>T (p.Ala2032Val) rs786202701
NM_000059.4(BRCA2):c.6100C>T (p.Arg2034Cys) rs1799954
NM_000059.4(BRCA2):c.6131G>C (p.Gly2044Ala) rs56191579
NM_000059.4(BRCA2):c.6275_6276del rs11571658
NM_000059.4(BRCA2):c.627C>A (p.Leu209=) rs28897704
NM_000059.4(BRCA2):c.62A>G (p.Lys21Arg) rs397507367
NM_000059.4(BRCA2):c.6322C>T (p.Arg2108Cys) rs55794205
NM_000059.4(BRCA2):c.6323G>A (p.Arg2108His) rs35029074
NM_000059.4(BRCA2):c.6347A>G (p.His2116Arg) rs55953736
NM_000059.4(BRCA2):c.6405_6409del (p.Asn2135fs) rs80359584
NM_000059.4(BRCA2):c.6665A>G (p.Tyr2222Cys) rs397507875
NM_000059.4(BRCA2):c.6748A>G (p.Thr2250Ala) rs80358899
NM_000059.4(BRCA2):c.676A>G (p.Thr226Ala) rs80358902
NM_000059.4(BRCA2):c.68-2A>G rs769152395
NM_000059.4(BRCA2):c.68-7T>A rs81002830
NM_000059.4(BRCA2):c.7017G>C (p.Lys2339Asn) rs45574331
NM_000059.4(BRCA2):c.7319A>G (p.His2440Arg) rs4986860
NM_000059.4(BRCA2):c.7435+6G>A rs81002852
NM_000059.4(BRCA2):c.7436-4A>G rs81002904
NM_000059.4(BRCA2):c.7448G>A (p.Ser2483Asn) rs80358967
NM_000059.4(BRCA2):c.7484T>C (p.Ile2495Thr) rs80358974
NM_000059.4(BRCA2):c.7504C>T (p.Arg2502Cys) rs55716624
NM_000059.4(BRCA2):c.7544C>T (p.Thr2515Ile) rs28897744
NM_000059.4(BRCA2):c.7712A>G (p.Glu2571Gly) rs55689095
NM_000059.4(BRCA2):c.7868A>G (p.His2623Arg) rs80359012
NM_000059.4(BRCA2):c.7878G>C (p.Trp2626Cys) rs80359013
NM_000059.4(BRCA2):c.7879A>T (p.Ile2627Phe) rs80359014
NM_000059.4(BRCA2):c.7976+5G>A rs786201180
NM_000059.4(BRCA2):c.7994A>G (p.Asp2665Gly) rs28897745
NM_000059.4(BRCA2):c.8007A>G (p.Arg2669=) rs143999963
NM_000059.4(BRCA2):c.8009C>T (p.Ser2670Leu) rs80359035
NM_000059.4(BRCA2):c.8010G>A (p.Ser2670=) rs146430937
NM_000059.4(BRCA2):c.8117A>G (p.Asn2706Ser) rs80359055
NM_000059.4(BRCA2):c.8149G>T (p.Ala2717Ser) rs28897747
NM_000059.4(BRCA2):c.8182G>A (p.Val2728Ile) rs28897749
NM_000059.4(BRCA2):c.8243G>A (p.Gly2748Asp) rs80359071
NM_000059.4(BRCA2):c.8331+2T>C rs398122602
NM_000059.4(BRCA2):c.8432A>G (p.Asp2811Gly) rs80359090
NM_000059.4(BRCA2):c.8488-1G>A rs397507404
NM_000059.4(BRCA2):c.8503T>C (p.Ser2835Pro) rs11571746
NM_000059.4(BRCA2):c.8524C>T (p.Arg2842Cys) rs80359104
NM_000059.4(BRCA2):c.8525G>A (p.Arg2842His) rs80359105
NM_000059.4(BRCA2):c.8567A>C (p.Glu2856Ala) rs11571747
NM_000059.4(BRCA2):c.8647C>T (p.Pro2883Ser) rs80359122
NM_000059.4(BRCA2):c.8739C>G (p.Asp2913Glu) rs786201996
NM_000059.4(BRCA2):c.8755-1G>A rs81002812
NM_000059.4(BRCA2):c.8850G>T (p.Lys2950Asn) rs28897754
NM_000059.4(BRCA2):c.8905G>A (p.Val2969Met) rs59004709
NM_000059.4(BRCA2):c.8941G>A (p.Glu2981Lys) rs139052578
NM_000059.4(BRCA2):c.9004G>A (p.Glu3002Lys) rs80359152
NM_000059.4(BRCA2):c.9038C>T (p.Thr3013Ile) rs28897755
NM_000059.4(BRCA2):c.9086C>T (p.Ala3029Val) rs80359162
NM_000059.4(BRCA2):c.9116C>T (p.Pro3039Leu) rs80359167
NM_000059.4(BRCA2):c.9271G>A (p.Val3091Ile) rs80359194
NM_000059.4(BRCA2):c.9292T>C (p.Tyr3098His) rs41293521
NM_000059.4(BRCA2):c.9353T>C (p.Met3118Thr) rs56204128
NM_000059.4(BRCA2):c.9442G>T (p.Ala3148Ser) rs949790323
NM_000059.4(BRCA2):c.9458G>C (p.Gly3153Ala) rs80359220
NM_000059.4(BRCA2):c.9472A>G (p.Thr3158Ala) rs786204284
NM_000059.4(BRCA2):c.9501+3A>T rs61757642
NM_000059.4(BRCA2):c.9502-12T>G rs81002803
NM_000059.4(BRCA2):c.964A>C (p.Lys322Gln) rs11571640
NM_000059.4(BRCA2):c.9677A>G (p.Tyr3226Cys) rs80359237
NM_000059.4(BRCA2):c.9699_9702del rs80359775
NM_000059.4(BRCA2):c.9730G>A (p.Val3244Ile) rs11571831
NM_000059.4(BRCA2):c.978C>A (p.Ser326Arg) rs28897706
NM_000059.4(BRCA2):c.9875C>T (p.Pro3292Leu) rs56121817
NM_000077.4(CDKN2A):c.104G>C (p.Gly35Ala) rs746834149
NM_000077.4(CDKN2A):c.146T>C (p.Ile49Thr) rs199907548
NM_000077.4(CDKN2A):c.149A>G (p.Gln50Arg) rs587778189
NM_000077.4(CDKN2A):c.151-4G>C rs529380972
NM_000077.4(CDKN2A):c.168C>T (p.Ser56=) rs771138120
NM_000077.4(CDKN2A):c.170C>T (p.Ala57Val) rs372266620
NM_000077.4(CDKN2A):c.194T>C (p.Leu65Pro) rs1587332314
NM_000077.4(CDKN2A):c.197A>G (p.His66Arg) rs756750256
NM_000077.4(CDKN2A):c.203C>T (p.Ala68Val) rs1060501260
NM_000077.4(CDKN2A):c.206A>G (p.Glu69Gly) rs372670098
NM_000077.4(CDKN2A):c.225C>G (p.Pro75=) rs762397298
NM_000077.4(CDKN2A):c.250G>T (p.Asp84Tyr) rs11552822
NM_000077.4(CDKN2A):c.266G>A (p.Gly89Asp) rs137854599
NM_000077.4(CDKN2A):c.298G>T (p.Ala100Ser) rs200863613
NM_000077.4(CDKN2A):c.315C>A (p.Asp105Glu) rs763269347
NM_000077.4(CDKN2A):c.318G>A (p.Val106=) rs199888003
NM_000077.4(CDKN2A):c.320G>A (p.Arg107His) rs370823171
NM_000077.4(CDKN2A):c.322G>A (p.Asp108Asn) rs121913381
NM_000077.4(CDKN2A):c.339G>A (p.Leu113=) rs575031539
NM_000077.4(CDKN2A):c.370C>T (p.Arg124Cys) rs34170727
NM_000077.4(CDKN2A):c.379G>C (p.Ala127Pro) rs6413464
NM_000077.4(CDKN2A):c.430C>T (p.Arg144Cys) rs116150891
NM_000077.4(CDKN2A):c.434T>C (p.Ile145Thr) rs730881680
NM_000077.4(CDKN2A):c.47T>G (p.Leu16Arg) rs864622263
NM_000077.4(CDKN2A):c.51C>A (p.Ala17=) rs764362225
NM_000077.4(CDKN2A):c.67G>T (p.Gly23Cys) rs1131691186
NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) rs587780668
NM_000090.3(COL3A1):c.1550C>T (p.Pro517Leu) rs142085247
NM_000090.3(COL3A1):c.2287C>T (p.Pro763Ser) rs771671892
NM_000090.3(COL3A1):c.2700C>T (p.Gly900=) rs112164939
NM_000090.3(COL3A1):c.3117T>C (p.Ser1039=) rs1559061716
NM_000090.3(COL3A1):c.898-5T>C rs535434618
NM_000090.4(COL3A1):c.3938A>G (p.Lys1313Arg) rs111840783
NM_000138.4(FBN1):c.1027G>A (p.Gly343Arg) rs146726731
NM_000138.4(FBN1):c.1371C>G (p.Arg457=) rs25436
NM_000138.4(FBN1):c.1602T>C (p.Cys534=) rs377386372
NM_000138.4(FBN1):c.1821T>C (p.Asp607=) rs149133920
NM_000138.4(FBN1):c.1884C>T (p.Cys628=) rs150421653
NM_000138.4(FBN1):c.2094G>T (p.Pro698=) rs144775475
NM_000138.4(FBN1):c.2420-8T>C rs140582
NM_000138.4(FBN1):c.2979C>T (p.Cys993=) rs150126098
NM_000138.4(FBN1):c.3069G>A (p.Lys1023=) rs199789628
NM_000138.4(FBN1):c.3089A>G (p.Asn1030Ser) rs375996640
NM_000138.4(FBN1):c.3590-8T>C rs140600
NM_000138.4(FBN1):c.3890A>G (p.Glu1297Gly) rs200342067
NM_000138.4(FBN1):c.3896C>T (p.Thr1299Met) rs774851476
NM_000138.4(FBN1):c.3936C>T (p.Ser1312=) rs779913610
NM_000138.4(FBN1):c.3937G>A (p.Gly1313Ser) rs1156984408
NM_000138.4(FBN1):c.396T>C (p.Asp132=) rs147481356
NM_000138.4(FBN1):c.4211-10C>T rs28730793
NM_000138.4(FBN1):c.4998C>T (p.Thr1666=) rs141925790
NM_000138.4(FBN1):c.538+4A>G rs375721252
NM_000138.4(FBN1):c.539-15del rs193922211
NM_000138.4(FBN1):c.5672-15C>G rs776163620
NM_000138.4(FBN1):c.5724A>G (p.Thr1908=) rs141219664
NM_000138.4(FBN1):c.5788+4C>A rs577301285
NM_000138.4(FBN1):c.6054C>T (p.Val2018=) rs542953863
NM_000138.4(FBN1):c.6163+2dup rs794728315
NM_000138.4(FBN1):c.6302C>T (p.Thr2101Met) rs200816828
NM_000138.4(FBN1):c.6801C>T (p.Asn2267=) rs886051245
NM_000138.4(FBN1):c.6832C>G (p.Pro2278Ala) rs363835
NM_000138.4(FBN1):c.6987C>G (p.Asp2329Glu) rs363831
NM_000138.4(FBN1):c.7056C>T (p.Ser2352=) rs149697299
NM_000138.4(FBN1):c.7516G>A (p.Gly2506Ser) rs756295016
NM_000138.4(FBN1):c.7560G>A (p.Thr2520=) rs760425899
NM_000138.4(FBN1):c.7820-4G>A rs750036723
NM_000138.4(FBN1):c.783T>C (p.Asn261=) rs113721547
NM_000138.4(FBN1):c.7846A>G (p.Ile2616Val) rs143677764
NM_000138.4(FBN1):c.8011C>T (p.Leu2671=) rs886051244
NM_000138.4(FBN1):c.8149G>A (p.Glu2717Lys) rs187553035
NM_000138.4(FBN1):c.8185A>C (p.Lys2729Gln) rs370096856
NM_000138.4(FBN1):c.8202C>T (p.Asn2734=) rs113904256
NM_000138.4(FBN1):c.8310C>T (p.His2770=) rs112189340
NM_000138.4(FBN1):c.8363C>T (p.Thr2788Met) rs143007898
NM_000138.4(FBN1):c.902G>T (p.Gly301Val) rs142888621
NM_000138.5(FBN1):c.1029G>A (p.Gly343=) rs75655780
NM_000138.5(FBN1):c.1345G>A (p.Val449Ile) rs139058991
NM_000138.5(FBN1):c.1746C>T (p.Cys582=) rs112366266
NM_000138.5(FBN1):c.2175T>C (p.Asn725=) rs140606
NM_000138.5(FBN1):c.2855-9C>T rs140590
NM_000138.5(FBN1):c.2895G>A (p.Glu965=) rs140591
NM_000138.5(FBN1):c.2956G>A (p.Ala986Thr) rs112287730
NM_000138.5(FBN1):c.306C>T (p.Cys102=) rs25388
NM_000138.5(FBN1):c.3294C>T (p.Asp1098=) rs140587
NM_000138.5(FBN1):c.3422C>T (p.Pro1141Leu) rs2228241
NM_000138.5(FBN1):c.3423G>A (p.Pro1141=) rs140396599
NM_000138.5(FBN1):c.3463+3A>G rs80344206
NM_000138.5(FBN1):c.3675G>A (p.Pro1225=) rs148147223
NM_000138.5(FBN1):c.3965-8T>C rs140637
NM_000138.5(FBN1):c.4640C>T (p.Thr1547Ile) rs183306990
NM_000138.5(FBN1):c.4905C>G (p.Thr1635=) rs113115949
NM_000138.5(FBN1):c.510C>T (p.Tyr170=) rs111671429
NM_000138.5(FBN1):c.5343G>A (p.Val1781=) rs140649
NM_000138.5(FBN1):c.59A>G (p.Tyr20Cys) rs201309310
NM_000138.5(FBN1):c.6314-15G>A rs200841830
NM_000138.5(FBN1):c.6393C>T (p.Cys2131=) rs61730051
NM_000138.5(FBN1):c.6594C>T (p.Pro2198=) rs111844882
NM_000138.5(FBN1):c.6681A>C (p.Ser2227=) rs363824
NM_000138.5(FBN1):c.6700G>A (p.Val2234Met) rs112084407
NM_000138.5(FBN1):c.6832C>T (p.Pro2278Ser) rs363835
NM_000138.5(FBN1):c.7098C>T (p.Asp2366=) rs1005074
NM_000138.5(FBN1):c.7346A>G (p.Asn2449Ser) rs146166400
NM_000138.5(FBN1):c.7497A>G (p.Leu2499=) rs148516442
NM_000138.5(FBN1):c.7661G>A (p.Arg2554Gln) rs199522781
NM_000138.5(FBN1):c.79G>A (p.Ala27Thr) rs25397
NM_000138.5(FBN1):c.8283A>T (p.Thr2761=) rs146120912
NM_000138.5(FBN1):c.8385C>T (p.Ile2795=) rs138574576
NM_000138.5(FBN1):c.8502T>C (p.Thr2834=) rs363847
NM_000138.5(FBN1):c.986T>C (p.Ile329Thr) rs12324002
NM_000169.2(GLA):c.1067G>A (p.Arg356Gln) rs869312163
NM_000169.2(GLA):c.1277_1278del (p.Lys426fs) rs869312249
NM_000169.2(GLA):c.335G>A (p.Arg112His) rs372966991
NM_000169.2(GLA):c.724A>G (p.Ile242Val) rs397515873
NM_000169.2(GLA):c.755G>C (p.Arg252Thr) rs147026639
NM_000169.2(GLA):c.868A>C (p.Met290Leu) rs375538532
NM_000169.2(GLA):c.886A>G (p.Met296Val) rs104894830
NM_000169.3(GLA):c.-12G>A rs3027585
NM_000169.3(GLA):c.1055C>G (p.Ala352Gly) rs869312162
NM_000169.3(GLA):c.1102G>A (p.Ala368Thr) rs144994244
NM_000169.3(GLA):c.1153A>G (p.Thr385Ala) rs397515869
NM_000169.3(GLA):c.196G>C (p.Glu66Gln) rs104894833
NM_000169.3(GLA):c.352C>T (p.Arg118Cys) rs148158093
NM_000169.3(GLA):c.376A>G (p.Ser126Gly) rs149391489
NM_000169.3(GLA):c.427G>A (p.Ala143Thr) rs104894845
NM_000169.3(GLA):c.639+6A>C rs200096940
NM_000169.3(GLA):c.8T>C (p.Leu3Pro) rs150547672
NM_000169.3(GLA):c.937G>T (p.Asp313Tyr) rs28935490
NM_000179.2(MSH6):c.-8C>T rs565211544
NM_000179.2(MSH6):c.1049C>T (p.Ala350Val) rs587782331
NM_000179.2(MSH6):c.1050C>T (p.Ala350=) rs730881802
NM_000179.2(MSH6):c.1063G>A (p.Gly355Ser) rs587778531
NM_000179.2(MSH6):c.1144C>T (p.His382Tyr) rs587779207
NM_000179.2(MSH6):c.115G>A (p.Gly39Arg) rs751838296
NM_000179.2(MSH6):c.1168G>A (p.Asp390Asn) rs147737737
NM_000179.2(MSH6):c.131C>T (p.Pro44Leu) rs863224615
NM_000179.2(MSH6):c.1364A>C (p.Asn455Thr) rs200938360
NM_000179.2(MSH6):c.1403G>A (p.Arg468His) rs41295268
NM_000179.2(MSH6):c.1508C>G (p.Ser503Cys) rs63750897
NM_000179.2(MSH6):c.1565A>G (p.Gln522Arg) rs63751009
NM_000179.2(MSH6):c.161G>C (p.Gly54Ala) rs63751098
NM_000179.2(MSH6):c.1740G>T (p.Ser580=) rs762089407
NM_000179.2(MSH6):c.1746T>G (p.Phe582Leu) rs201518545
NM_000179.2(MSH6):c.182C>T (p.Ala61Val) rs572336612
NM_000179.2(MSH6):c.1847C>G (p.Ser616Cys) rs772363120
NM_000179.2(MSH6):c.1870G>A (p.Gly624Ser) rs868760377
NM_000179.2(MSH6):c.187T>C (p.Ser63Pro) rs763702846
NM_000179.2(MSH6):c.1937A>G (p.Lys646Arg) rs201096652
NM_000179.2(MSH6):c.194C>T (p.Ser65Leu) rs41294984
NM_000179.2(MSH6):c.2141C>G (p.Ser714Cys) rs730881796
NM_000179.2(MSH6):c.2147C>T (p.Thr716Ile) rs587782805
NM_000179.2(MSH6):c.2171C>G (p.Ala724Gly) rs587779922
NM_000179.2(MSH6):c.2175C>G (p.Ile725Met) rs63750304
NM_000179.2(MSH6):c.2249C>A (p.Thr750Lys) rs730881817
NM_000179.2(MSH6):c.2314C>T (p.Arg772Trp) rs63750138
NM_000179.2(MSH6):c.2319C>T (p.Leu773=) rs63749895
NM_000179.2(MSH6):c.2384T>C (p.Ile795Thr) rs202127474
NM_000179.2(MSH6):c.2413A>G (p.Ile805Val) rs928923556
NM_000179.2(MSH6):c.241G>A (p.Ala81Thr) rs587779239
NM_000179.2(MSH6):c.242C>T (p.Ala81Val) rs587779924
NM_000179.2(MSH6):c.2479A>G (p.Asn827Asp) rs878853716
NM_000179.2(MSH6):c.251C>T (p.Ala84Val) rs878853717
NM_000179.2(MSH6):c.257C>T (p.Thr86Ile) rs768444916
NM_000179.2(MSH6):c.2600T>G (p.Val867Gly) rs139598980
NM_000179.2(MSH6):c.2661T>G (p.Leu887=) rs267608069
NM_000179.2(MSH6):c.2724A>G (p.Glu908=) rs35389622
NM_000179.2(MSH6):c.2780T>C (p.Ile927Thr) rs587779926
NM_000179.2(MSH6):c.2827G>T (p.Asp943Tyr) rs143520357
NM_000179.2(MSH6):c.2857G>A (p.Glu953Lys) rs753034685
NM_000179.2(MSH6):c.3079G>C (p.Val1027Leu) rs876658397
NM_000179.2(MSH6):c.3151G>A (p.Val1051Ile) rs576269342
NM_000179.2(MSH6):c.3172+1G>T rs587779255
NM_000179.2(MSH6):c.3173-10C>T rs587780559
NM_000179.2(MSH6):c.3203G>A (p.Arg1068Gln) rs398123230
NM_000179.2(MSH6):c.3226C>G (p.Arg1076Gly) rs63750617
NM_000179.2(MSH6):c.3227G>A (p.Arg1076His) rs779617676
NM_000179.2(MSH6):c.3265T>C (p.Leu1089=) rs34490141
NM_000179.2(MSH6):c.3283C>T (p.Arg1095Cys) rs376243329
NM_000179.2(MSH6):c.3306T>A (p.Thr1102=) rs2020910
NM_000179.2(MSH6):c.3354G>A (p.Glu1118=) rs35642130
NM_000179.2(MSH6):c.3364C>G (p.Gln1122Glu) rs1060502892
NM_000179.2(MSH6):c.3379_3438+5del rs1553331676
NM_000179.2(MSH6):c.3438+11_3438+14del rs377746844
NM_000179.2(MSH6):c.3469G>T (p.Gly1157Cys) rs587779264
NM_000179.2(MSH6):c.3537C>G (p.Ala1179=) rs200120044
NM_000179.2(MSH6):c.3557-4del rs267608102
NM_000179.2(MSH6):c.3557-4dup rs267608102
NM_000179.2(MSH6):c.3605T>C (p.Met1202Thr) rs587779273
NM_000179.2(MSH6):c.3647-6T>A rs182871847
NM_000179.2(MSH6):c.364G>A (p.Glu122Lys) rs143036974
NM_000179.2(MSH6):c.3725G>A (p.Arg1242His) rs63750119
NM_000179.2(MSH6):c.3727A>T (p.Thr1243Ser) rs147453999
NM_000179.2(MSH6):c.3729A>G (p.Thr1243=) rs773807182
NM_000179.2(MSH6):c.3832C>A (p.Pro1278Thr) rs587782109
NM_000179.2(MSH6):c.3911G>A (p.Arg1304Lys) rs34625968
NM_000179.2(MSH6):c.3992G>A (p.Arg1331Gln) rs184131049
NM_000179.2(MSH6):c.4001+11_4001+15dup rs587779302
NM_000179.2(MSH6):c.4053_4081dup (p.Ter1361Leufs)
NM_000179.2(MSH6):c.457+13A>G rs1800933
NM_000179.2(MSH6):c.476C>T (p.Ala159Val) rs587778528
NM_000179.2(MSH6):c.532C>T (p.Arg178Cys) rs730881813
NM_000179.2(MSH6):c.643G>A (p.Val215Ile) rs145959653
NM_000179.2(MSH6):c.660A>C (p.Glu220Asp) rs1800938
NM_000179.2(MSH6):c.905G>A (p.Arg302Lys) rs587781510
NM_000179.2(MSH6):c.926C>G (p.Ser309Cys) rs544222338
NM_000179.2(MSH6):c.942C>G (p.Ser314Arg) rs150440246
NM_000179.2(MSH6):c.956C>T (p.Thr319Met) rs188252826
NM_000179.2(MSH6):c.984C>T (p.Ser328=) rs138143769
NM_000179.3(MSH6):c.1019T>C (p.Phe340Ser) rs61753793
NM_000179.3(MSH6):c.1037C>T (p.Ser346Phe) rs567785169
NM_000179.3(MSH6):c.107C>T (p.Ala36Val) rs61756469
NM_000179.3(MSH6):c.1164C>T (p.His388=) rs55708305
NM_000179.3(MSH6):c.1346T>C (p.Leu449Pro) rs63750741
NM_000179.3(MSH6):c.1474A>G (p.Met492Val) rs61754783
NM_000179.3(MSH6):c.1526T>C (p.Val509Ala) rs63751005
NM_000179.3(MSH6):c.1844G>C (p.Cys615Ser) rs730881793
NM_000179.3(MSH6):c.1875C>T (p.Ser625=) rs63749886
NM_000179.3(MSH6):c.2272C>T (p.Leu758=) rs56371757
NM_000179.3(MSH6):c.2398G>C (p.Val800Leu) rs61748083
NM_000179.3(MSH6):c.2561A>T (p.Lys854Met) rs34374438
NM_000179.3(MSH6):c.3037AAG[1] (p.Lys1014del) rs267608073
NM_000179.3(MSH6):c.3160A>T (p.Ile1054Phe) rs267608075
NM_000179.3(MSH6):c.3246G>T (p.Pro1082=) rs3136351
NM_000179.3(MSH6):c.3259C>T (p.Pro1087Ser) rs63750998
NM_000179.3(MSH6):c.3260C>G (p.Pro1087Arg) rs63750753
NM_000179.3(MSH6):c.3334G>A (p.Asp1112Asn) rs773955368
NM_000179.3(MSH6):c.3482CTG[1] (p.Ala1162del) rs63751427
NM_000179.3(MSH6):c.3804A>G (p.Ala1268=) rs1572746044
NM_000179.3(MSH6):c.3961A>G (p.Arg1321Gly) rs41295278
NM_000179.3(MSH6):c.3999dup (p.Arg1334fs) rs863225418
NM_000179.3(MSH6):c.4001+2TAAC[2] rs267608132
NM_000179.3(MSH6):c.4001+2TAAC[4] rs267608132
NM_000179.3(MSH6):c.4001+4_4001+8dup rs587782853
NM_000179.3(MSH6):c.4001G>A (p.Arg1334Gln) rs267608122
NM_000179.3(MSH6):c.4002-4T>C rs370428032
NM_000179.3(MSH6):c.4068_4071dup (p.Lys1358delinsAspTer) rs55740729
NM_000179.3(MSH6):c.431G>T (p.Ser144Ile) rs3211299
NM_000179.3(MSH6):c.503C>G (p.Ala168Gly) rs774162322
NM_000179.3(MSH6):c.650A>G (p.Asp217Gly) rs554012110
NM_000179.3(MSH6):c.663A>C (p.Glu221Asp) rs41557217
NM_000179.3(MSH6):c.998C>T (p.Thr333Ile) rs587781983
NM_000238.4(KCNH2):c.442C>T (p.Arg148Trp) rs139544114
NM_000249.3(MLH1):c.1024_1038+1del rs1553648201
NM_000249.3(MLH1):c.1039-6dup rs1553650466
NM_000249.3(MLH1):c.1039-8_1039-7insTA rs535965616
NM_000249.3(MLH1):c.1103C>T (p.Ser368Leu) rs201673334
NM_000249.3(MLH1):c.1136A>C (p.Tyr379Ser) rs143009528
NM_000249.3(MLH1):c.1136A>G (p.Tyr379Cys) rs143009528
NM_000249.3(MLH1):c.1266C>T (p.Gly422=) rs63750791
NM_000249.3(MLH1):c.1318G>A (p.Val440Met) rs864622250
NM_000249.3(MLH1):c.1359G>C (p.Lys453Asn) rs756099600
NM_000249.3(MLH1):c.1410-4G>T rs1057520517
NM_000249.3(MLH1):c.1421G>A (p.Arg474Gln) rs63751083
NM_000249.3(MLH1):c.1460G>A (p.Arg487Gln) rs587778917
NM_000249.3(MLH1):c.1558+4C>T rs531873434
NM_000249.3(MLH1):c.1558+5G>A rs199935667
NM_000249.3(MLH1):c.1569G>T (p.Glu523Asp) rs63751680
NM_000249.3(MLH1):c.1577A>G (p.His526Arg) rs1304802474
NM_000249.3(MLH1):c.1652A>C (p.Asn551Thr) rs63750271
NM_000249.3(MLH1):c.1667+1G>A rs1434898623
NM_000249.3(MLH1):c.1667+4A>G rs983986337
NM_000249.3(MLH1):c.1667G>C (p.Ser556Thr) rs63751596
NM_000249.3(MLH1):c.1709A>G (p.Asn570Ser) rs375853155
NM_000249.3(MLH1):c.1730C>T (p.Ser577Leu) rs56185292
NM_000249.3(MLH1):c.187G>A (p.Asp63Asn) rs63750850
NM_000249.3(MLH1):c.1897-2A>G rs267607871
NM_000249.3(MLH1):c.1963A>G (p.Ile655Val) rs55907433
NM_000249.3(MLH1):c.1964T>C (p.Ile655Thr) rs63751225
NM_000249.3(MLH1):c.1976G>T (p.Arg659Leu) rs63749900
NM_000249.3(MLH1):c.198C>T (p.Thr66=) rs61751642
NM_000249.3(MLH1):c.1990-1G>C rs267607884
NM_000249.3(MLH1):c.207+1G>A rs267607718
NM_000249.3(MLH1):c.2101C>A (p.Gln701Lys) rs63750114
NM_000249.3(MLH1):c.2174G>A (p.Arg725His) rs566928243
NM_000249.3(MLH1):c.2210A>T (p.Asp737Val) rs267607885
NM_000249.3(MLH1):c.2252A>G (p.Lys751Arg) rs140195825
NM_000249.3(MLH1):c.245C>T (p.Thr82Ile) rs63750005
NM_000249.3(MLH1):c.306+3A>G rs267607731
NM_000249.3(MLH1):c.306G>T (p.Glu102Asp) rs63751665
NM_000249.3(MLH1):c.344T>A (p.Ile115Asn) rs764120517
NM_000249.3(MLH1):c.375A>G (p.Ala125=) rs1800144
NM_000249.3(MLH1):c.479C>T (p.Ala160Val) rs63749924
NM_000249.3(MLH1):c.492A>C (p.Lys164Asn) rs765014361
NM_000249.3(MLH1):c.52C>T (p.Arg18Cys) rs367654552
NM_000249.3(MLH1):c.595G>C (p.Glu199Gln) rs63749887
NM_000249.3(MLH1):c.678-2A>G rs587779035
NM_000249.3(MLH1):c.778C>T (p.Leu260Phe) rs63750642
NM_000249.3(MLH1):c.791-2A>G rs267607794
NM_000249.3(MLH1):c.80G>A (p.Arg27Gln) rs138705565
NM_000249.3(MLH1):c.885-5G>T rs267607802
NM_000249.3(MLH1):c.925C>T (p.Pro309Ser) rs267607808
NM_000249.3(MLH1):c.955G>A (p.Glu319Lys) rs63750796
NM_000249.4(MLH1):c.1013A>G (p.Asn338Ser) rs63751467
NM_000249.4(MLH1):c.1039-8T>A rs193922367
NM_000249.4(MLH1):c.1040C>A (p.Thr347Asn) rs201541505
NM_000249.4(MLH1):c.1151T>A (p.Val384Asp) rs63750447
NM_000249.4(MLH1):c.1154G>A (p.Arg385His) rs63750430
NM_000249.4(MLH1):c.1166G>A (p.Arg389Gln) rs63750361
NM_000249.4(MLH1):c.1217G>A (p.Ser406Asn) rs41294980
NM_000249.4(MLH1):c.1268G>A (p.Arg423Lys) rs370687064
NM_000249.4(MLH1):c.1270G>A (p.Ala424Thr) rs377433038
NM_000249.4(MLH1):c.1321G>A (p.Ala441Thr) rs63750365
NM_000249.4(MLH1):c.1360G>C (p.Gly454Arg) rs63750527
NM_000249.4(MLH1):c.1668-1G>A rs267607845
NM_000249.4(MLH1):c.1742C>T (p.Pro581Leu) rs63751684
NM_000249.4(MLH1):c.1852A>G (p.Lys618Glu) rs35001569
NM_000249.4(MLH1):c.1943C>T rs63750610
NM_000249.4(MLH1):c.1959G>T (p.Leu653=) rs1800146
NM_000249.4(MLH1):c.1976G>A (p.Arg659Gln) rs63749900
NM_000249.4(MLH1):c.199G>A (p.Gly67Arg) rs63750206
NM_000249.4(MLH1):c.649C>T (p.Arg217Cys) rs4986984
NM_000249.4(MLH1):c.65G>C (p.Gly22Ala) rs41295280
NM_000249.4(MLH1):c.794G>A (p.Arg265His) rs63751448
NM_000249.4(MLH1):c.885-21TC[2] rs267607804
NM_000249.4(MLH1):c.94A>G (p.Ile32Val) rs2020872
NM_000251.2(MSH2):c.1077-1G>C rs267607944
NM_000251.2(MSH2):c.1087G>T (p.Val363Leu) rs377345366
NM_000251.2(MSH2):c.1099G>A (p.Val367Ile) rs80285180
NM_000251.2(MSH2):c.1189C>G (p.Gln397Glu) rs63750611
NM_000251.2(MSH2):c.118G>A (p.Gly40Ser) rs63751260
NM_000251.2(MSH2):c.1217G>A (p.Arg406Gln) rs146567853
NM_000251.2(MSH2):c.1270C>T (p.His424Tyr) rs587782278
NM_000251.2(MSH2):c.1276+1G>A rs267607950
NM_000251.2(MSH2):c.1277-8T>C rs145400590
NM_000251.2(MSH2):c.1319T>C (p.Leu440Pro) rs587779084
NM_000251.2(MSH2):c.1321A>C (p.Thr441Pro) rs587779086
NM_000251.2(MSH2):c.1360A>G (p.Ile454Val) rs587781627
NM_000251.2(MSH2):c.1387-5T>C rs757458333
NM_000251.2(MSH2):c.1387-8G>T rs187525243
NM_000251.2(MSH2):c.1461C>G (p.Asp487Glu) rs35107951
NM_000251.2(MSH2):c.1462T>G (p.Leu488Val) rs587781314
NM_000251.2(MSH2):c.1483A>G (p.Thr495Ala) rs730881757
NM_000251.2(MSH2):c.1489A>G (p.Ile497Val) rs755501968
NM_000251.2(MSH2):c.1549G>A (p.Ala517Thr) rs1553366545
NM_000251.2(MSH2):c.1659C>T (p.Asn553=) rs869312796
NM_000251.2(MSH2):c.1666T>C (p.Leu556=) rs61756466
NM_000251.2(MSH2):c.1680T>C (p.Asn560=) rs200056411
NM_000251.2(MSH2):c.1737A>G (p.Lys579=) rs61756467
NM_000251.2(MSH2):c.1748A>G (p.Asn583Ser) rs201118107
NM_000251.2(MSH2):c.1759+1G>A rs587779108
NM_000251.2(MSH2):c.1760-1G>A rs587779110
NM_000251.2(MSH2):c.1760-4A>G rs1060504409
NM_000251.2(MSH2):c.1761C>G (p.Gly587=) rs920449426
NM_000251.2(MSH2):c.182A>C (p.Gln61Pro) rs587779113
NM_000251.2(MSH2):c.1837A>C (p.Asn613His) rs200147804
NM_000251.2(MSH2):c.1871T>G (p.Ile624Ser) rs1114167870
NM_000251.2(MSH2):c.1898T>C (p.Ile633Thr) rs864622093
NM_000251.2(MSH2):c.1945G>A (p.Ala649Thr) rs786201822
NM_000251.2(MSH2):c.1963G>A (p.Val655Ile) rs549467183
NM_000251.2(MSH2):c.1979A>G (p.Asp660Gly) rs1085308057
NM_000251.2(MSH2):c.1A>C (p.Met1Leu) rs267607911
NM_000251.2(MSH2):c.2005+8dup rs267607992
NM_000251.2(MSH2):c.2005G>T (p.Gly669Cys) rs63751668
NM_000251.2(MSH2):c.2060T>C (p.Leu687Pro) rs587779133
NM_000251.2(MSH2):c.2074G>A (p.Gly692Arg) rs63750232
NM_000251.2(MSH2):c.2074G>C (p.Gly692Arg) rs63750232
NM_000251.2(MSH2):c.2105T>A (p.Val702Glu) rs587779137
NM_000251.2(MSH2):c.211G>C (p.Gly71Arg) rs587782659
NM_000251.2(MSH2):c.2154A>G (p.Gln718=) rs63750810
NM_000251.2(MSH2):c.2205C>T (p.Ile735=) rs533553381
NM_000251.2(MSH2):c.2210+11_2210+22del rs730881782
NM_000251.2(MSH2):c.2211-10T>A rs267608006
NM_000251.2(MSH2):c.2308A>G (p.Ile770Val) rs63750684
NM_000251.2(MSH2):c.23C>T (p.Thr8Met) rs17217716
NM_000251.2(MSH2):c.2437A>G (p.Met813Val) rs63749841
NM_000251.2(MSH2):c.2439G>A (p.Met813Ile) rs587781678
NM_000251.2(MSH2):c.2457A>G (p.Lys819=) rs774152293
NM_000251.2(MSH2):c.2458+1G>A rs267608010
NM_000251.2(MSH2):c.2516A>G (p.His839Arg) rs63750027
NM_000251.2(MSH2):c.2517T>A (p.His839Gln) rs267608016
NM_000251.2(MSH2):c.2528G>A (p.Cys843Tyr) rs747700106
NM_000251.2(MSH2):c.2615A>G (p.Lys872Arg) rs587780686
NM_000251.2(MSH2):c.2680dup (p.Met894fs) rs876658211
NM_000251.2(MSH2):c.2714C>G (p.Thr905Arg) rs267608022
NM_000251.2(MSH2):c.2714C>T (p.Thr905Ile) rs267608022
NM_000251.2(MSH2):c.2766T>C (p.Phe922=) rs55859129
NM_000251.2(MSH2):c.2801C>A (p.Thr934Lys) rs587779969
NM_000251.2(MSH2):c.2801C>T (p.Thr934Met) rs587779969
NM_000251.2(MSH2):c.317G>C (p.Arg106Thr) rs41295286
NM_000251.2(MSH2):c.366+1G>A rs267607924
NM_000251.2(MSH2):c.409G>C (p.Gly137Arg) rs587781795
NM_000251.2(MSH2):c.499G>C (p.Asp167His) rs63750255
NM_000251.2(MSH2):c.512G>A (p.Arg171Lys) rs63750902
NM_000251.2(MSH2):c.51C>A (p.Val17=) rs397515879
NM_000251.2(MSH2):c.557A>G (p.Asn186Ser) rs151129360
NM_000251.2(MSH2):c.560T>C (p.Leu187Pro) rs63751444
NM_000251.2(MSH2):c.766G>A (p.Ala256Thr) rs377403073
NM_000251.2(MSH2):c.793-1G>A rs863225397
NM_000251.2(MSH2):c.817G>A (p.Val273Ile) rs530814648
NM_000251.2(MSH2):c.835C>G (p.Leu279Val) rs375351205
NM_000251.2(MSH2):c.885C>G (p.Asp295Glu) rs201334592
NM_000251.2(MSH2):c.942+1G>T rs587779193
NM_000251.2(MSH2):c.942+2T>A rs587779195
NM_000251.2(MSH2):c.942+3A>G rs193922376
NM_000251.2(MSH2):c.944G>T (p.Gly315Val) rs202026056
NM_000251.2(MSH2):c.972G>A (p.Gln324=) rs63750505
NM_000251.2(MSH2):c.984C>T (p.Ala328=) rs4987189
NM_000251.3(MSH2):c.1045C>G (p.Pro349Ala) rs267607939
NM_000251.3(MSH2):c.128A>G (p.Tyr43Cys) rs17217723
NM_000251.3(MSH2):c.1313CTC[1] (p.Pro439del) rs587779082
NM_000251.3(MSH2):c.138C>G (p.His46Gln) rs33946261
NM_000251.3(MSH2):c.1774A>G (p.Met592Val) rs371614039
NM_000251.3(MSH2):c.1787A>G (p.Asn596Ser) rs41295288
NM_000251.3(MSH2):c.1847C>G (p.Pro616Arg) rs587779965
NM_000251.3(MSH2):c.2354A>C (p.His785Pro) rs200252727
NM_000251.3(MSH2):c.2503A>C (p.Asn835His) rs41295296
NM_000251.3(MSH2):c.2537A>G (p.Gln846Arg) rs140754514
NM_000251.3(MSH2):c.2579C>T (p.Ser860Leu) rs63750849
NM_000251.3(MSH2):c.382C>G (p.Leu128Val) rs145649774
NM_000251.3(MSH2):c.435T>G (p.Ile145Met) rs63750124
NM_000251.3(MSH2):c.471C>A (p.Gly157=) rs61756463
NM_000251.3(MSH2):c.645+3A>G rs587779168
NM_000256.3(MYBPC3):c.1038C>T (p.Arg346=) rs758016271
NM_000256.3(MYBPC3):c.1104G>A (p.Lys368=) rs1565628536
NM_000256.3(MYBPC3):c.1144C>T (p.Arg382Trp) rs11570076
NM_000256.3(MYBPC3):c.1282T>C (p.Leu428=) rs758253767
NM_000256.3(MYBPC3):c.148A>G (p.Ser50Gly) rs373164247
NM_000256.3(MYBPC3):c.1519G>A (p.Gly507Arg) rs35736435
NM_000256.3(MYBPC3):c.1608T>A (p.Ala536=) rs200224422
NM_000256.3(MYBPC3):c.1721G>A (p.Arg574Gln) rs397515922
NM_000256.3(MYBPC3):c.1813G>A (p.Asp605Asn) rs376736293
NM_000256.3(MYBPC3):c.2034T>C (p.Ala678=) rs757832991
NM_000256.3(MYBPC3):c.2460G>A (p.Arg820=) rs532996422
NM_000256.3(MYBPC3):c.2800C>T (p.Leu934=) rs367980215
NM_000256.3(MYBPC3):c.2870C>G (p.Thr957Ser) rs193922380
NM_000256.3(MYBPC3):c.2873C>T (p.Thr958Ile) rs376504548
NM_000256.3(MYBPC3):c.2877G>A (p.Thr959=) rs727503181
NM_000256.3(MYBPC3):c.3004C>T (p.Arg1002Trp) rs3729799
NM_000256.3(MYBPC3):c.3102C>T (p.Ala1034=) rs200663253
NM_000256.3(MYBPC3):c.3107G>A (p.Arg1036His) rs374255381
NM_000256.3(MYBPC3):c.3148G>A (p.Glu1050Lys) rs780449220
NM_000256.3(MYBPC3):c.3190+4C>T rs571457875
NM_000256.3(MYBPC3):c.3392T>C (p.Ile1131Thr) rs370890951
NM_000256.3(MYBPC3):c.3413G>A (p.Arg1138His) rs187705120
NM_000256.3(MYBPC3):c.3535G>A (p.Glu1179Lys) rs199669878
NM_000256.3(MYBPC3):c.3628-41_3628-17del rs36212066
NM_000256.3(MYBPC3):c.362C>T (p.Pro121Leu) rs551888783
NM_000256.3(MYBPC3):c.3672C>T (p.Asp1224=) rs368221517
NM_000256.3(MYBPC3):c.3699G>A (p.Gln1233=) rs200162906
NM_000256.3(MYBPC3):c.461T>C (p.Ile154Thr) rs373946195
NM_000256.3(MYBPC3):c.534G>T (p.Val178=) rs759249105
NM_000256.3(MYBPC3):c.565G>A (p.Val189Ile) rs11570052
NM_000256.3(MYBPC3):c.624G>C (p.Gln208His) rs202139499
NM_000256.3(MYBPC3):c.643C>T (p.Arg215Cys) rs397516063
NM_000256.3(MYBPC3):c.906-7G>T rs397516079
NM_000256.3(MYBPC3):c.927-9G>A rs397516083
NM_000256.3(MYBPC3):c.961G>A (p.Val321Met) rs200119454
NM_000257.4(MYH7):c.1000-7C>T rs200129563
NM_000257.4(MYH7):c.2631G>C (p.Met877Ile) rs1060505018
NM_000257.4(MYH7):c.2859C>T (p.Asp953=) rs370800700
NM_000257.4(MYH7):c.2945T>C (p.Met982Thr) rs145532615
NM_000257.4(MYH7):c.3147G>A (p.Glu1049=) rs1216521596
NM_000257.4(MYH7):c.3156G>A (p.Lys1052=) rs138294643
NM_000257.4(MYH7):c.3157C>T (p.Arg1053Trp) rs730880903
NM_000257.4(MYH7):c.3382G>A (p.Ala1128Thr) rs199552354
NM_000257.4(MYH7):c.3770A>G (p.Asn1257Ser) rs574005462
NM_000257.4(MYH7):c.3960G>A (p.Glu1320=) rs147797612
NM_000257.4(MYH7):c.3981C>A (p.Asn1327Lys) rs141764279
NM_000257.4(MYH7):c.3993C>T (p.His1331=) rs200288088
NM_000257.4(MYH7):c.4259G>A (p.Arg1420Gln) rs397516207
NM_000257.4(MYH7):c.4377G>T (p.Lys1459Asn) rs201307101
NM_000257.4(MYH7):c.4557C>T (p.Ser1519=) rs150552664
NM_000257.4(MYH7):c.4588C>T (p.Arg1530Ter) rs397516225
NM_000257.4(MYH7):c.4659C>T (p.His1553=) rs570079347
NM_000257.4(MYH7):c.4668C>A (p.Gly1556=) rs762762532
NM_000257.4(MYH7):c.4806C>T (p.Asp1602=) rs142034311
NM_000257.4(MYH7):c.4992C>T (p.Asn1664=) rs763538103
NM_000257.4(MYH7):c.5013C>T (p.Ile1671=) rs779978846
NM_000257.4(MYH7):c.5178G>A (p.Gln1726=) rs747252861
NM_000257.4(MYH7):c.5736C>T (p.Ile1912=) rs200728597
NM_000257.4(MYH7):c.715G>A (p.Asp239Asn) rs397516264
NM_000257.4(MYH7):c.930T>C (p.Tyr310=) rs111626355
NM_000257.4(MYH7):c.968T>C (p.Ile323Thr) rs397516275
NM_000258.2(MYL3):c.411G>T (p.Leu137=) rs2233265
NM_000258.3(MYL3):c.532G>A (p.Asp178Asn) rs145520567
NM_000258.3(MYL3):c.92G>A (p.Arg31His) rs199639940
NM_000314.7(PTEN):c.*10del rs756681683
NM_000314.7(PTEN):c.1027-2A>G rs1085308041
NM_000314.7(PTEN):c.253+4_253+7del rs876659695
NM_000314.8(PTEN):c.235G>A (p.Ala79Thr) rs202004587
NM_000335.5(SCN5A):c.4744C>T (p.Arg1582Cys) rs45514691
NM_000335.5(SCN5A):c.5848G>T (p.Val1950Leu) rs41315493
NM_000363.5(TNNI3):c.244C>T (p.Pro82Ser) rs77615401
NM_000363.5(TNNI3):c.373-10= rs7252610
NM_000363.5(TNNI3):c.384G>A (p.Leu128=) rs373130533
NM_000363.5(TNNI3):c.485G>A (p.Arg162Gln) rs397516354
NM_000384.3(APOB):c.10061C>G (p.Ala3354Gly)
NM_000384.3(APOB):c.10131G>A (p.Leu3377=) rs1799812
NM_000384.3(APOB):c.10294C>G (p.Gln3432Glu)
NM_000384.3(APOB):c.10579C>T (p.Arg3527Trp) rs144467873
NM_000384.3(APOB):c.10580G>A (p.Arg3527Gln)
NM_000384.3(APOB):c.10672C>T (p.Arg3558Cys)
NM_000384.3(APOB):c.10700C>T (p.Thr3567Met) rs368278927
NM_000384.3(APOB):c.10701G>A (p.Thr3567=) rs12713558
NM_000384.3(APOB):c.10708C>T (p.His3570Tyr) rs201736972
NM_000384.3(APOB):c.10724G>A (p.Gly3575Asp) rs1418775778
NM_000384.3(APOB):c.10737C>T (p.Thr3579=) rs12713554
NM_000384.3(APOB):c.10739A>G (p.Asn3580Ser) rs762028704
NM_000384.3(APOB):c.10740C>G (p.Asn3580Lys) rs150312765
NM_000384.3(APOB):c.10780T>C (p.Trp3594Arg)
NM_000384.3(APOB):c.10808A>G (p.His3603Arg) rs370481987
NM_000384.3(APOB):c.11354C>T (p.Thr3785Ile) rs143710616
NM_000384.3(APOB):c.11356C>T (p.Leu3786Phe) rs571485213
NM_000384.3(APOB):c.11401T>A (p.Ser3801Thr)
NM_000384.3(APOB):c.11466G>A (p.Val3822=) rs755842633
NM_000384.3(APOB):c.11477C>T (p.Thr3826Met)
NM_000384.3(APOB):c.11563A>G (p.Ile3855Val) rs762255105
NM_000384.3(APOB):c.11761G>A (p.Val3921Ile)
NM_000384.3(APOB):c.11808C>T (p.Ile3936=) rs12720852
NM_000384.3(APOB):c.11833A>G (p.Thr3945Ala) rs1801698
NM_000384.3(APOB):c.11911G>A (p.Glu3971Lys) rs373477107
NM_000384.3(APOB):c.12088-13del rs751121092
NM_000384.3(APOB):c.12088-23dup rs751121092
NM_000384.3(APOB):c.12219C>T (p.Asn4073=) rs886055573
NM_000384.3(APOB):c.1223T>C (p.Ile408Thr)
NM_000384.3(APOB):c.12252T>C (p.Tyr4084=) rs138157751
NM_000384.3(APOB):c.12310C>A (p.Leu4104Met) rs199668351
NM_000384.3(APOB):c.12382G>A (p.Val4128Met)
NM_000384.3(APOB):c.1266A>G (p.Ser422=) rs752197838
NM_000384.3(APOB):c.12696T>A (p.Tyr4232Ter) rs1466172660
NM_000384.3(APOB):c.12697T>A (p.Ser4233Thr)
NM_000384.3(APOB):c.12766G>A (p.Glu4256Lys) rs61743313
NM_000384.3(APOB):c.12794T>C (p.Val4265Ala) rs61743502
NM_000384.3(APOB):c.1280G>A (p.Arg427Gln) rs755407886
NM_000384.3(APOB):c.12940A>G (p.Ile4314Val)
NM_000384.3(APOB):c.13028_13029del (p.Tyr4343fs) rs760832994
NM_000384.3(APOB):c.13102C>G (p.Gln4368Glu) rs72654424
NM_000384.3(APOB):c.1310G>A (p.Arg437His)
NM_000384.3(APOB):c.13183G>A (p.Gly4395Ser) rs151333262
NM_000384.3(APOB):c.13196A>C (p.Lys4399Thr) rs1553382300
NM_000384.3(APOB):c.13441G>A (p.Ala4481Thr)
NM_000384.3(APOB):c.13451C>T (p.Thr4484Met)
NM_000384.3(APOB):c.13477CAG[1] (p.Gln4494del) rs562574661
NM_000384.3(APOB):c.1353-12C>T rs76202659
NM_000384.3(APOB):c.1470+15T>C rs185550846
NM_000384.3(APOB):c.1493C>T (p.Thr498Ile) rs758928147
NM_000384.3(APOB):c.1594C>T (p.Arg532Trp)
NM_000384.3(APOB):c.1661C>T (p.Pro554Leu)
NM_000384.3(APOB):c.1785C>G (p.Ser595=) rs139864087
NM_000384.3(APOB):c.2068-4T>A rs41291161
NM_000384.3(APOB):c.2160C>T (p.Tyr720=) rs756184175
NM_000384.3(APOB):c.2188G>A (p.Val730Ile)
NM_000384.3(APOB):c.2222C>A (p.Thr741Asn)
NM_000384.3(APOB):c.2585T>C (p.Val862Ala) rs145142090
NM_000384.3(APOB):c.2630C>T (p.Pro877Leu) rs12714097
NM_000384.3(APOB):c.2706C>T (p.Asn902=) rs1801700
NM_000384.3(APOB):c.2853G>A (p.Glu951=) rs151193347
NM_000384.3(APOB):c.2863C>T (p.Pro955Ser)
NM_000384.3(APOB):c.288G>T (p.Gln96His) rs186544754
NM_000384.3(APOB):c.2950G>A (p.Ala984Thr) rs752149683
NM_000384.3(APOB):c.2968G>A (p.Ala990Thr)
NM_000384.3(APOB):c.2981C>T (p.Pro994Leu)
NM_000384.3(APOB):c.3052G>A (p.Ala1018Thr) rs149357946
NM_000384.3(APOB):c.307T>C (p.Tyr103His)
NM_000384.3(APOB):c.3122-6G>A rs72653071
NM_000384.3(APOB):c.3337G>C (p.Asp1113His)
NM_000384.3(APOB):c.3383G>A (p.Arg1128His) rs12713843
NM_000384.3(APOB):c.3426G>A (p.Ser1142=) rs142448733
NM_000384.3(APOB):c.3427C>T (p.Pro1143Ser)
NM_000384.3(APOB):c.3491G>A (p.Arg1164Lys) rs759845943
NM_000384.3(APOB):c.3491G>C (p.Arg1164Thr)
NM_000384.3(APOB):c.3509-10G>A rs12720770
NM_000384.3(APOB):c.3509-11C>T rs200768300
NM_000384.3(APOB):c.3634C>A (p.Leu1212Met)
NM_000384.3(APOB):c.3712C>A (p.Leu1238Ile) rs72653078
NM_000384.3(APOB):c.3740A>G (p.Tyr1247Cys) rs61741164
NM_000384.3(APOB):c.3843C>T (p.Ser1281=) rs72653079
NM_000384.3(APOB):c.403A>G (p.Ile135Val) rs769296548
NM_000384.3(APOB):c.4178C>T (p.Ala1393Val) rs143282164
NM_000384.3(APOB):c.433C>T (p.Pro145Ser)
NM_000384.3(APOB):c.4365C>T (p.Phe1455=) rs12720847
NM_000384.3(APOB):c.4663A>G (p.Ile1555Val)
NM_000384.3(APOB):c.4825T>C (p.Leu1609=) rs72653083
NM_000384.3(APOB):c.4929G>A (p.Ala1643=) rs200623857
NM_000384.3(APOB):c.499C>T (p.Pro167Ser) rs139842930
NM_000384.3(APOB):c.5066G>A (p.Arg1689His)
NM_000384.3(APOB):c.5690G>A (p.Arg1897His) rs199510126
NM_000384.3(APOB):c.5741A>G (p.Asn1914Ser)
NM_000384.3(APOB):c.5763A>G (p.Gly1921=) rs141022509
NM_000384.3(APOB):c.5768A>G (p.His1923Arg)
NM_000384.3(APOB):c.581C>T (p.Thr194Met) rs13306198
NM_000384.3(APOB):c.5863G>A (p.Val1955Met) rs368970025
NM_000384.3(APOB):c.5913G>A (p.Leu1971=) rs374251542
NM_000384.3(APOB):c.606A>T (p.Glu202Asp) rs61746672
NM_000384.3(APOB):c.6261C>A (p.Thr2087=) rs61744855
NM_000384.3(APOB):c.6636TGA[1] (p.Asp2213del) rs541497967
NM_000384.3(APOB):c.6656G>A (p.Arg2219His) rs200106845
NM_000384.3(APOB):c.6895G>C (p.Asp2299His)
NM_000384.3(APOB):c.6936_6937inv (p.Ile2313Val)
NM_000384.3(APOB):c.7283A>G (p.Lys2428Arg) rs1369533953
NM_000384.3(APOB):c.7285T>A (p.Ser2429Thr)
NM_000384.3(APOB):c.7367C>A (p.Ala2456Asp)
NM_000384.3(APOB):c.7612C>T (p.Leu2538=) rs72653093
NM_000384.3(APOB):c.7615G>A (p.Val2539Ile) rs148170480
NM_000384.3(APOB):c.7696G>A (p.Glu2566Lys) rs1801696
NM_000384.3(APOB):c.7853T>C (p.Ile2618Thr) rs531273434
NM_000384.3(APOB):c.8148C>T (p.Ile2716=) rs6413458
NM_000384.3(APOB):c.8462C>T (p.Pro2821Leu) rs72653095
NM_000384.3(APOB):c.8469T>C (p.Ala2823=) rs531216195
NM_000384.3(APOB):c.8720G>A (p.Arg2907His) rs751437976
NM_000384.3(APOB):c.8877G>A (p.Leu2959=) rs765899256
NM_000384.3(APOB):c.905-15C>G rs72653061
NM_000384.3(APOB):c.905-16A>C rs12720810
NM_000384.3(APOB):c.9105T>C (p.Asn3035=) rs147510760
NM_000384.3(APOB):c.9477G>A (p.Lys3159=) rs13306196
NM_000384.3(APOB):c.9639C>A (p.Asn3213Lys) rs574725520
NM_000384.3(APOB):c.9694A>G (p.Lys3232Glu) rs544521341
NM_000384.3(APOB):c.9811G>A (p.Gly3271Ser) rs142422341
NM_000384.3(APOB):c.9835A>G (p.Ser3279Gly)
NM_000384.3(APOB):c.9880T>C (p.Ser3294Pro)
NM_000384.3(APOB):c.9883T>C (p.Tyr3295His) rs186299244
NM_000432.3(MYL2):c.275-7G>A rs373241541
NM_000432.3(MYL2):c.431_432del (p.Pro144fs) rs1566147422
NM_000432.3(MYL2):c.92_93+1del rs751392310
NM_000432.3(MYL2):c.94-3C>T rs112865045
NM_000432.4(MYL2):c.243G>T (p.Val81=) rs368851472
NM_000432.4(MYL2):c.279G>A (p.Ala93=) rs28645088
NM_000432.4(MYL2):c.355G>A (p.Val119Ile) rs730880940
NM_000455.4(STK11):c.*8C>T rs587782259
NM_000455.4(STK11):c.-1C>T rs759284466
NM_000455.4(STK11):c.1045G>A (p.Glu349Lys) rs553752236
NM_000455.4(STK11):c.1108+3G>A rs755746417
NM_000455.4(STK11):c.1109-4C>T rs1407794756
NM_000455.4(STK11):c.1109-5C>T rs587782020
NM_000455.4(STK11):c.1150C>T (p.Arg384Trp) rs752015385
NM_000455.4(STK11):c.1229C>T (p.Ala410Val) rs372329880
NM_000455.4(STK11):c.1245C>T (p.Arg415=) rs878853985
NM_000455.4(STK11):c.369G>A (p.Gln123=) rs140112347
NM_000455.4(STK11):c.464+3G>A rs1060499956
NM_000455.4(STK11):c.464+4C>T rs373167735
NM_000455.4(STK11):c.464+9G>A rs376313955
NM_000455.4(STK11):c.597+14del rs536282050
NM_000455.4(STK11):c.598-8C>T rs373610101
NM_000455.4(STK11):c.617C>T (p.Ala206Val) rs764244639
NM_000455.4(STK11):c.666C>T (p.Pro222=) rs542189325
NM_000455.4(STK11):c.735-6_735-2del rs759090799
NM_000455.4(STK11):c.816C>T (p.Tyr272=) rs9282859
NM_000455.4(STK11):c.825G>A (p.Pro275=) rs202011521
NM_000455.4(STK11):c.827G>T (p.Gly276Val) rs749927908
NM_000455.4(STK11):c.902G>A (p.Arg301Gln) rs370222210
NM_000455.4(STK11):c.96C>G (p.Thr32=) rs79175212
NM_000455.4(STK11):c.992G>A (p.Arg331Gln) rs371264852
NM_000455.5(STK11):c.1062C>G (p.Phe354Leu) rs59912467
NM_000455.5(STK11):c.1071G>T rs556651007
NM_000455.5(STK11):c.1225C>T (p.Arg409Trp) rs368466538
NM_000455.5(STK11):c.1226G>A (p.Arg409Gln) rs587782364
NM_000455.5(STK11):c.1261_1262inv (p.Ser421Leu)
NM_000455.5(STK11):c.264C>A rs56354945
NM_000455.5(STK11):c.542A>G (p.Asn181Ser) rs886037859
NM_000455.5(STK11):c.613G>A (p.Ala205Thr) rs730881981
NM_000455.5(STK11):c.842C>T (p.Pro281Leu) rs121913322
NM_000455.5(STK11):c.863-5_863-3del rs764739106
NM_000455.5(STK11):c.920+5G>A rs587780013
NM_000465.3(BARD1):c.1518_1519invTG (p.Val507Met)
NM_000465.4(BARD1):c.-4G>A rs761863671
NM_000465.4(BARD1):c.1028C>T (p.Thr343Ile) rs201032007
NM_000465.4(BARD1):c.1070T>C (p.Ile357Thr) rs587781555
NM_000465.4(BARD1):c.1127C>T (p.Ser376Leu) rs587782333
NM_000465.4(BARD1):c.1147A>T (p.Met383Leu) rs761516178
NM_000465.4(BARD1):c.1395+4G>T rs1025329798
NM_000465.4(BARD1):c.1448A>G (p.His483Arg) rs587781874
NM_000465.4(BARD1):c.144G>A (p.Leu48=) rs151168457
NM_000465.4(BARD1):c.1568T>C (p.Val523Ala) rs587780017
NM_000465.4(BARD1):c.160A>G (p.Thr54Ala) rs200254470
NM_000465.4(BARD1):c.1678A>G (p.Met560Val) rs587780020
NM_000465.4(BARD1):c.1694G>A (p.Arg565His) rs146946984
NM_000465.4(BARD1):c.1822G>A (p.Val608Ile) rs778987552
NM_000465.4(BARD1):c.1877A>G (p.Asn626Ser) rs587781443
NM_000465.4(BARD1):c.1904-5G>A rs376639978
NM_000465.4(BARD1):c.1932_1933del (p.Val644_Cys645insTer) rs587782504
NM_000465.4(BARD1):c.1977A>G (p.Arg659=) rs147215925
NM_000465.4(BARD1):c.2075T>C (p.Ile692Thr) rs587782555
NM_000465.4(BARD1):c.2179G>A (p.Asp727Asn) rs730881424
NM_000465.4(BARD1):c.2191C>G (p.Arg731Gly) rs76744638
NM_000465.4(BARD1):c.2229dup (p.Asn744Ter) rs1259296823
NM_000465.4(BARD1):c.2282G>A (p.Ser761Asn) rs142155101
NM_000465.4(BARD1):c.2300_2301del (p.Val767fs) rs750413473
NM_000465.4(BARD1):c.335G>A (p.Arg112Gln) rs587781591
NM_000465.4(BARD1):c.353A>G (p.Asn118Ser) rs142864491
NM_000465.4(BARD1):c.382C>T (p.Pro128Ser) rs878854011
NM_000465.4(BARD1):c.44G>T (p.Arg15Leu) rs545107676
NM_000465.4(BARD1):c.521G>A (p.Ser174Asn) rs1277839212
NM_000465.4(BARD1):c.556A>G (p.Ser186Gly) rs16852741
NM_000465.4(BARD1):c.581G>A (p.Arg194Lys) rs181748854
NM_000465.4(BARD1):c.659T>C (p.Leu220Ser) rs138593305
NM_000465.4(BARD1):c.684A>G (p.Glu228=) rs780627045
NM_000465.4(BARD1):c.716T>A (p.Leu239Gln) rs200359745
NM_000465.4(BARD1):c.73G>C (p.Ala25Pro) rs751646468
NM_000465.4(BARD1):c.773T>C (p.Ile258Thr) rs146223579
NM_000465.4(BARD1):c.79G>C (p.Glu27Gln) rs587780037
NM_000465.4(BARD1):c.835T>C (p.Ser279Pro) rs587781456
NM_000465.4(BARD1):c.86A>C (p.Asp29Ala) rs777491507
NM_000465.4(BARD1):c.90T>A (p.Gly30=) rs150354152
NM_000527.4(LDLR):c.*19G>A rs56270417
NM_000527.4(LDLR):c.-101T>C rs747068848
NM_000527.4(LDLR):c.-120C>T rs875989886
NM_000527.4(LDLR):c.-121T>C rs777716188
NM_000527.4(LDLR):c.-142C>G rs879254370
NM_000527.4(LDLR):c.-153C>T rs879254366
NM_000527.4(LDLR):c.-217C>T rs17249141
NM_000527.4(LDLR):c.-286C>G rs989307060
NM_000527.4(LDLR):c.-97G>A rs944580031
NM_000527.4(LDLR):c.1002C>T (p.Ile334=) rs762853526
NM_000527.4(LDLR):c.1056C>T (p.Cys352=) rs13306515
NM_000527.4(LDLR):c.1060+9C>T rs540073140
NM_000527.4(LDLR):c.1067A>T (p.Asp356Val) rs879254777
NM_000527.4(LDLR):c.1078G>C (p.Asp360His) rs777926251
NM_000527.4(LDLR):c.108C>T (p.Asp36=) rs373144619
NM_000527.4(LDLR):c.1156G>T (p.Asp386Tyr) rs1402951356
NM_000527.4(LDLR):c.1167G>A (p.Thr389=) rs139066906
NM_000527.4(LDLR):c.1221C>T (p.His407=) rs778424518
NM_000527.4(LDLR):c.1323C>T (p.Ile441=) rs5933
NM_000527.4(LDLR):c.1336C>T (p.Leu446=) rs375651668
NM_000527.4(LDLR):c.1359-6C>T
NM_000527.4(LDLR):c.1367T>C (p.Leu456Pro) rs200143634
NM_000527.4(LDLR):c.1381G>A (p.Gly461Ser) rs193922568
NM_000527.4(LDLR):c.1431C>T (p.Asp477=) rs368610522
NM_000527.4(LDLR):c.1555C>A (p.Pro519Thr) rs875989923
NM_000527.4(LDLR):c.1586+15C>T rs371716068
NM_000527.4(LDLR):c.1586+16G>A
NM_000527.4(LDLR):c.1587-11C>T rs201957233
NM_000527.4(LDLR):c.165C>G (p.Gly55=) rs150644181
NM_000527.4(LDLR):c.1774G>A (p.Gly592Arg) rs763147599
NM_000527.4(LDLR):c.1835C>T (p.Ala612Val) rs377449975
NM_000527.4(LDLR):c.1836C>A (p.Ala612=) rs143872778
NM_000527.4(LDLR):c.1868T>C (p.Ile623Thr) rs141155833
NM_000527.4(LDLR):c.1911delC (p.Asp638Metfs) rs867272973
NM_000527.4(LDLR):c.1942T>G (p.Ser648Ala)
NM_000527.4(LDLR):c.1988-13T>G rs200201131
NM_000527.4(LDLR):c.2055G>A (p.Pro685=) rs149126953
NM_000527.4(LDLR):c.2089G>A (p.Ala697Thr) rs776217028
NM_000527.4(LDLR):c.2106G>A (p.Met702Ile) rs140731590
NM_000527.4(LDLR):c.211G>A (p.Gly71Arg) rs766903209
NM_000527.4(LDLR):c.2125A>G (p.Arg709Gly) rs1057519684
NM_000527.4(LDLR):c.2206G>A (p.Val736Ile) rs547268730
NM_000527.4(LDLR):c.2312C>T (p.Ala771Val)
NM_000527.4(LDLR):c.2320G>A (p.Asp774Asn) rs138190838
NM_000527.4(LDLR):c.2324T>C (p.Val775Ala) rs780300776
NM_000527.4(LDLR):c.2358C>T (p.Ser786=) rs183255090
NM_000527.4(LDLR):c.2388C>T (p.Ile796=) rs543852919
NM_000527.4(LDLR):c.2389+7G>A
NM_000527.4(LDLR):c.2389+8C>T rs747170426
NM_000527.4(LDLR):c.2427A>G (p.Leu809=) rs147191787
NM_000527.4(LDLR):c.2548-19G>A
NM_000527.4(LDLR):c.2579C>T (p.Ala860Val) rs13306505
NM_000527.4(LDLR):c.299A>T (p.Asp100Val) rs879254460
NM_000527.4(LDLR):c.313+1G>A
NM_000527.4(LDLR):c.324G>A (p.Thr108=) rs146517429
NM_000527.4(LDLR):c.345C>G (p.Arg115=) rs150144164
NM_000527.4(LDLR):c.351C>T (p.His117=) rs200258458
NM_000527.4(LDLR):c.408C>T (p.Asp136=) rs759738744
NM_000527.4(LDLR):c.450C>T (p.Pro150=) rs773365925
NM_000527.4(LDLR):c.498C>T (p.Ala166=) rs10417394
NM_000527.4(LDLR):c.508G>A (p.Asp170Asn) rs139089530
NM_000527.4(LDLR):c.510C>A (p.Asp170Glu) rs1060499931
NM_000527.4(LDLR):c.531G>A (p.Ser177=) rs555158224
NM_000527.4(LDLR):c.543G>T (p.Pro181=) rs766577671
NM_000527.4(LDLR):c.564C>T (p.Tyr188=) rs121908034
NM_000527.4(LDLR):c.567G>C (p.Val189=) rs753329861
NM_000527.4(LDLR):c.660C>T (p.Pro220=) rs143002616
NM_000527.4(LDLR):c.666C>T (p.Cys222=) rs756613387
NM_000527.4(LDLR):c.681C>T (p.Asp227=) rs121908028
NM_000527.4(LDLR):c.694+9G>A rs34093283
NM_000527.4(LDLR):c.710G>A (p.Arg237His) rs148171426
NM_000527.4(LDLR):c.731C>G (p.Ser244Cys) rs1208667598
NM_000527.4(LDLR):c.817+9T>C
NM_000527.4(LDLR):c.828C>T (p.Cys276=) rs146651743
NM_000527.4(LDLR):c.82G>A (p.Glu28Lys) rs551747280
NM_000527.4(LDLR):c.853C>T (p.His285Tyr)
NM_000527.4(LDLR):c.858C>T (p.Ser286=) rs140241383
NM_000527.4(LDLR):c.861C>T (p.Gly287=) rs770191650
NM_000527.4(LDLR):c.940+9C>T
NM_000527.4(LDLR):c.982G>A (p.Val328Ile) rs768925824
NM_000527.4(LDLR):c.993C>T (p.Asp331=) rs147905921
NM_000527.5(LDLR):c.-13A>G rs376011618
NM_000527.5(LDLR):c.1012T>G (p.Cys338Gly) rs879254753
NM_000527.5(LDLR):c.1019G>A (p.Cys340Tyr) rs755757866
NM_000527.5(LDLR):c.1024G>A (p.Asp342Asn)
NM_000527.5(LDLR):c.1024G>T (p.Asp342Tyr) rs139361635
NM_000527.5(LDLR):c.1027G>A (p.Gly343Ser)
NM_000527.5(LDLR):c.1049G>C (p.Arg350Pro) rs875989914
NM_000527.5(LDLR):c.1055G>A (p.Cys352Tyr) rs193922566
NM_000527.5(LDLR):c.1057G>A (p.Glu353Lys)
NM_000527.5(LDLR):c.1060+10G>C
NM_000527.5(LDLR):c.1060+7=
NM_000527.5(LDLR):c.1061-8T>C
NM_000527.5(LDLR):c.1061A>G (p.Asp354Gly) rs755449669
NM_000527.5(LDLR):c.1061A>T (p.Asp354Val) rs755449669
NM_000527.5(LDLR):c.1066G>A (p.Asp356Asn) rs767767730
NM_000527.5(LDLR):c.1069G>A (p.Glu357Lys) rs879254781
NM_000527.5(LDLR):c.1085A>C (p.Asp362Ala) rs138315511
NM_000527.5(LDLR):c.1090T>C (p.Cys364Arg)
NM_000527.5(LDLR):c.1133A>C (p.Gln378Pro) rs730882098
NM_000527.5(LDLR):c.1166C>T (p.Thr389Met) rs149227308
NM_000527.5(LDLR):c.1171G>A (p.Ala391Thr)
NM_000527.5(LDLR):c.1187-10G>A
NM_000527.5(LDLR):c.1194C>T (p.Ile398=) rs13306498
NM_000527.5(LDLR):c.1201C>G (p.Leu401Val)
NM_000527.5(LDLR):c.1216C>A (p.Arg406=) rs121908043
NM_000527.5(LDLR):c.1222G>A (p.Glu408Lys) rs137943601
NM_000527.5(LDLR):c.1238C>T (p.Thr413Met) rs368562025
NM_000527.5(LDLR):c.1241T>G (p.Leu414Arg) rs748554592
NM_000527.5(LDLR):c.1247G>A (p.Arg416Gln) rs773658037
NM_000527.5(LDLR):c.1252G>A (p.Glu418Lys)
NM_000527.5(LDLR):c.1279A>C (p.Arg427=) rs371355878
NM_000527.5(LDLR):c.1285G>A (p.Val429Met)
NM_000527.5(LDLR):c.1294C>G (p.Leu432Val) rs730882100
NM_000527.5(LDLR):c.1301C>T (p.Thr434Met) rs745343524
NM_000527.5(LDLR):c.1302G>A (p.Thr434=) rs534782075
NM_000527.5(LDLR):c.131G>A (p.Trp44Ter) rs267607213
NM_000527.5(LDLR):c.1322T>C (p.Ile441Thr) rs879254862
NM_000527.5(LDLR):c.1323C>G (p.Ile441Met) rs5933
NM_000527.5(LDLR):c.1329G>C (p.Trp443Cys) rs879254867
NM_000527.5(LDLR):c.1358+2T>A rs193922567
NM_000527.5(LDLR):c.1359-1G>A rs139617694
NM_000527.5(LDLR):c.1359-5C>G rs531005522
NM_000527.5(LDLR):c.1384G>A (p.Val462Ile) rs750363970
NM_000527.5(LDLR):c.1393T>A (p.Tyr465Asn) rs730882101
NM_000527.5(LDLR):c.1414G>T (p.Asp472Tyr) rs730882102
NM_000527.5(LDLR):c.1429G>A (p.Asp477Asn) rs780316072
NM_000527.5(LDLR):c.1432G>A (p.Gly478Arg)
NM_000527.5(LDLR):c.1444G>A (p.Asp482Asn) rs139624145
NM_000527.5(LDLR):c.1457G>A (p.Ser486Asn) rs879254910
NM_000527.5(LDLR):c.1474G>A (p.Asp492Asn)
NM_000527.5(LDLR):c.1474G>C (p.Asp492His) rs373646964
NM_000527.5(LDLR):c.148G>A (p.Ala50Thr) rs137853960
NM_000527.5(LDLR):c.148G>T (p.Ala50Ser) rs137853960
NM_000527.5(LDLR):c.1503G>A (p.Ala501=) rs368889457
NM_000527.5(LDLR):c.1510A>G (p.Lys504Glu) rs730882103
NM_000527.5(LDLR):c.1516G>A (p.Val506Met) rs373848925
NM_000527.5(LDLR):c.1529C>T (p.Thr510Met) rs755154048
NM_000527.5(LDLR):c.1545C>T (p.Asn515=) rs147896205
NM_000527.5(LDLR):c.1546G>A (p.Gly516Ser)
NM_000527.5(LDLR):c.1553A>G (p.Lys518Arg) rs879254938
NM_000527.5(LDLR):c.1567G>A (p.Val523Met)
NM_000527.5(LDLR):c.1576C>T (p.Pro526Ser) rs730882106
NM_000527.5(LDLR):c.1640T>C (p.Leu547Pro) rs879254968
NM_000527.5(LDLR):c.1646G>A (p.Gly549Asp)
NM_000527.5(LDLR):c.1661C>T (p.Ser554Leu) rs879254976
NM_000527.5(LDLR):c.1690A>G (p.Asn564Asp) rs397509365
NM_000527.5(LDLR):c.1702C>G (p.Leu568Val) rs746959386
NM_000527.5(LDLR):c.1706-10G>A
NM_000527.5(LDLR):c.1706-1G>A rs879254996
NM_000527.5(LDLR):c.1720C>T (p.Arg574Cys) rs185098634
NM_000527.5(LDLR):c.1721G>A (p.Arg574His)
NM_000527.5(LDLR):c.1745T>C (p.Leu582Pro) rs875989930
NM_000527.5(LDLR):c.1747C>T (p.His583Tyr) rs730882109
NM_000527.5(LDLR):c.1761C>G (p.Ser587Arg) rs753430282
NM_000527.5(LDLR):c.1764C>T (p.Ile588=) rs778595540
NM_000527.5(LDLR):c.1765G>A (p.Asp589Asn) rs201971888
NM_000527.5(LDLR):c.1773C>T (p.Asn591=) rs688
NM_000527.5(LDLR):c.1775G>A (p.Gly592Glu)
NM_000527.5(LDLR):c.1783C>T (p.Arg595Trp)
NM_000527.5(LDLR):c.1784G>A (p.Arg595Gln) rs201102492
NM_000527.5(LDLR):c.1816G>A (p.Ala606Thr) rs72658865
NM_000527.5(LDLR):c.1816G>T (p.Ala606Ser) rs72658865
NM_000527.5(LDLR):c.1836C>T (p.Ala612=) rs143872778
NM_000527.5(LDLR):c.1837G>A (p.Val613Ile)
NM_000527.5(LDLR):c.1845G>A (p.Glu615=) rs879255047
NM_000527.5(LDLR):c.1846-10G>T rs368243304
NM_000527.5(LDLR):c.1855T>C (p.Phe619Leu) rs747134711
NM_000527.5(LDLR):c.185C>T (p.Thr62Met)
NM_000527.5(LDLR):c.1860G>T (p.Trp620Cys) rs875989933
NM_000527.5(LDLR):c.1863A>G (p.Thr621=)
NM_000527.5(LDLR):c.1867A>G (p.Ile623Val) rs555292896
NM_000527.5(LDLR):c.186G>A (p.Thr62=) rs55958434
NM_000527.5(LDLR):c.1874A>C (p.Asn625Thr) rs879255064
NM_000527.5(LDLR):c.1875C>T (p.Asn625=) rs137853962
NM_000527.5(LDLR):c.1876G>A (p.Glu626Lys)
NM_000527.5(LDLR):c.1879G>A (p.Ala627Thr) rs879255066
NM_000527.5(LDLR):c.1897C>T (p.Arg633Cys)
NM_000527.5(LDLR):c.1898G>A (p.Arg633His) rs754536745
NM_000527.5(LDLR):c.190+4A>T rs769446356
NM_000527.5(LDLR):c.1911C>T (p.Ser637=) rs373570349
NM_000527.5(LDLR):c.1920C>T (p.Asn640=) rs5926
NM_000527.5(LDLR):c.1928C>T (p.Ala643Val) rs879255075
NM_000527.5(LDLR):c.1951G>A (p.Asp651Asn) rs730882110
NM_000527.5(LDLR):c.1955T>C (p.Met652Thr) rs875989936
NM_000527.5(LDLR):c.1959T>C (p.Val653=) rs5925
NM_000527.5(LDLR):c.1977C>A (p.Thr659=) rs72658866
NM_000527.5(LDLR):c.1987+6G>C
NM_000527.5(LDLR):c.1988-5C>G rs375877599
NM_000527.5(LDLR):c.2000G>A (p.Cys667Tyr) rs28942083
NM_000527.5(LDLR):c.2001_2002del (p.Cys667_Glu668delinsTer) rs1600743301
NM_000527.5(LDLR):c.2023G>A (p.Gly675Ser) rs770744861
NM_000527.5(LDLR):c.2026G>A (p.Gly676Ser) rs745753810
NM_000527.5(LDLR):c.2043C>A (p.Cys681Ter)
NM_000527.5(LDLR):c.2050G>A (p.Ala684Thr) rs774730452
NM_000527.5(LDLR):c.2054C>T (p.Pro685Leu)
NM_000527.5(LDLR):c.2096C>T (p.Pro699Leu)
NM_000527.5(LDLR):c.2100C>T (p.Asp700=)
NM_000527.5(LDLR):c.2101G>A (p.Gly701Ser) rs368838866
NM_000527.5(LDLR):c.2140+1G>A rs145787161
NM_000527.5(LDLR):c.2140+5G>A
NM_000527.5(LDLR):c.2177C>T (p.Thr726Ile)
NM_000527.5(LDLR):c.2205C>T (p.Ala735=)
NM_000527.5(LDLR):c.2215C>T (p.Gln739Ter) rs370018159
NM_000527.5(LDLR):c.2225C>T (p.Thr742Ile) rs767546791
NM_000527.5(LDLR):c.223T>A (p.Cys75Ser) rs879254439
NM_000527.5(LDLR):c.2242G>A (p.Asp748Asn) rs150104358
NM_000527.5(LDLR):c.2252G>A (p.Arg751Gln) rs200142970
NM_000527.5(LDLR):c.226G>T (p.Gly76Trp) rs574337291
NM_000527.5(LDLR):c.2282C>T (p.Thr761Met) rs138477254
NM_000527.5(LDLR):c.2289G>T (p.Glu763Asp) rs774698247
NM_000527.5(LDLR):c.2291T>C (p.Ile764Thr) rs759440817
NM_000527.5(LDLR):c.232C>T (p.Arg78Cys) rs370860696
NM_000527.5(LDLR):c.233G>A (p.Arg78His) rs146675823
NM_000527.5(LDLR):c.2389G>A (p.Val797Met)
NM_000527.5(LDLR):c.2390-16G>A rs183496025
NM_000527.5(LDLR):c.2391G>C (p.Val797=)
NM_000527.5(LDLR):c.2411T>C (p.Leu804Pro) rs879255203
NM_000527.5(LDLR):c.2416dup (p.Val806fs)
NM_000527.5(LDLR):c.241C>T (p.Arg81Cys)
NM_000527.5(LDLR):c.2441G>A (p.Arg814Gln)
NM_000527.5(LDLR):c.2476C>A (p.Pro826Thr) rs879255217
NM_000527.5(LDLR):c.2479G>A (p.Val827Ile) rs137853964
NM_000527.5(LDLR):c.2546C>A (p.Ser849Ter) rs377437226
NM_000527.5(LDLR):c.2575G>A (p.Val859Met) rs202049029
NM_000527.5(LDLR):c.259T>G (p.Trp87Gly) rs121908025
NM_000527.5(LDLR):c.268G>A (p.Asp90Asn) rs749038326
NM_000527.5(LDLR):c.284G>T (p.Cys95Phe) rs879254457
NM_000527.5(LDLR):c.291C>T (p.Asn97=) rs372845091
NM_000527.5(LDLR):c.292G>A (p.Gly98Ser) rs750474121
NM_000527.5(LDLR):c.301G>A (p.Glu101Lys) rs144172724
NM_000527.5(LDLR):c.313+2T>C rs793888517
NM_000527.5(LDLR):c.313+5G>T rs879254467
NM_000527.5(LDLR):c.313C>T (p.Pro105Ser) rs13306510
NM_000527.5(LDLR):c.314-2A>C rs879254470
NM_000527.5(LDLR):c.337G>A (p.Glu113Lys) rs769383881
NM_000527.5(LDLR):c.344G>A (p.Arg115His) rs201102461
NM_000527.5(LDLR):c.352G>T (p.Asp118Tyr) rs730882080
NM_000527.5(LDLR):c.367T>C (p.Ser123Pro) rs879254495
NM_000527.5(LDLR):c.400T>C (p.Cys134Arg) rs875989900
NM_000527.5(LDLR):c.401G>T (p.Cys134Phe) rs879254514
NM_000527.5(LDLR):c.418G>A (p.Glu140Lys)
NM_000527.5(LDLR):c.427T>C (p.Cys143Arg) rs875989901
NM_000527.5(LDLR):c.440C>T (p.Thr147Ile) rs879254524
NM_000527.5(LDLR):c.491T>C (p.Leu164Pro) rs879254544
NM_000527.5(LDLR):c.4G>C (p.Gly2Arg)
NM_000527.5(LDLR):c.502G>A (p.Asp168Asn) rs200727689
NM_000527.5(LDLR):c.507C>T (p.Asn169=) rs146354103
NM_000527.5(LDLR):c.523G>A (p.Asp175Asn) rs121908033
NM_000527.5(LDLR):c.530C>T (p.Ser177Leu)
NM_000527.5(LDLR):c.542C>G (p.Pro181Arg) rs557344672
NM_000527.5(LDLR):c.543G>A (p.Pro181=)
NM_000527.5(LDLR):c.551G>A (p.Cys184Tyr)
NM_000527.5(LDLR):c.564C>G (p.Tyr188Ter) rs121908034
NM_000527.5(LDLR):c.589T>G (p.Cys197Gly) rs730882085
NM_000527.5(LDLR):c.58G>A (p.Gly20Arg) rs147509697
NM_000527.5(LDLR):c.590G>A (p.Cys197Tyr) rs376459828
NM_000527.5(LDLR):c.622G>A (p.Glu208Lys) rs879254597
NM_000527.5(LDLR):c.631C>T (p.His211Tyr) rs771917370
NM_000527.5(LDLR):c.651TGG[1] (p.Gly219del) rs121908027
NM_000527.5(LDLR):c.661G>A (p.Asp221Asn) rs875989906
NM_000527.5(LDLR):c.662A>G (p.Asp221Gly)
NM_000527.5(LDLR):c.681C>G (p.Asp227Glu) rs121908028
NM_000527.5(LDLR):c.682G>A (p.Glu228Lys)
NM_000527.5(LDLR):c.682G>C (p.Glu228Gln)
NM_000527.5(LDLR):c.682G>T (p.Glu228Ter) rs121908029
NM_000527.5(LDLR):c.693C>A (p.Cys231Ter)
NM_000527.5(LDLR):c.694+1G>A rs879254646
NM_000527.5(LDLR):c.718G>A (p.Glu240Lys) rs768563000
NM_000527.5(LDLR):c.757C>T (p.Arg253Trp)
NM_000527.5(LDLR):c.761A>C (p.Gln254Pro) rs879254667
NM_000527.5(LDLR):c.769C>T (p.Arg257Trp)
NM_000527.5(LDLR):c.782G>T (p.Cys261Phe) rs121908040
NM_000527.5(LDLR):c.798T>A (p.Asp266Glu) rs139043155
NM_000527.5(LDLR):c.806G>A (p.Gly269Asp)
NM_000527.5(LDLR):c.811G>A (p.Val271Ile) rs749220643
NM_000527.5(LDLR):c.829G>A (p.Glu277Lys)
NM_000527.5(LDLR):c.858C>A (p.Ser286Arg) rs140241383
NM_000527.5(LDLR):c.859G>A (p.Gly287Ser) rs375495026
NM_000527.5(LDLR):c.862G>A (p.Glu288Lys) rs368657165
NM_000527.5(LDLR):c.907C>T (p.Arg303Trp) rs151207122
NM_000527.5(LDLR):c.90C>T (p.Asn30=) rs72658855
NM_000527.5(LDLR):c.917C>T (p.Ser306Leu) rs11547917
NM_000527.5(LDLR):c.91G>A (p.Glu31Lys) rs776421777
NM_000527.5(LDLR):c.932A>G (p.Lys311Arg) rs761765254
NM_000527.5(LDLR):c.940+3_940+6del
NM_000527.5(LDLR):c.941-4G>A
NM_000527.5(LDLR):c.949G>A (p.Glu317Lys) rs746834464
NM_000527.5(LDLR):c.953G>T (p.Cys318Phe)
NM_000527.5(LDLR):c.967G>A (p.Gly323Ser) rs373869746
NM_000527.5(LDLR):c.970G>A (p.Gly324Ser)
NM_000527.5(LDLR):c.980A>C (p.His327Pro)
NM_000527.5(LDLR):c.981C>T (p.His327=) rs1060499933
NM_000535.7(PMS2):c.-1C>A rs369681753
NM_000535.7(PMS2):c.-2C>T rs876658209
NM_000535.7(PMS2):c.-4A>G rs544503598
NM_000535.7(PMS2):c.-5C>A rs786202272
NM_000535.7(PMS2):c.-7T>C rs199660792
NM_000535.7(PMS2):c.1004A>G (p.Asn335Ser) rs200513014
NM_000535.7(PMS2):c.1080A>G (p.Ile360Met) rs567102013
NM_000535.7(PMS2):c.1096G>C (p.Asp366His) rs141769057
NM_000535.7(PMS2):c.1099G>A (p.Val367Ile) rs746889239
NM_000535.7(PMS2):c.1169C>T (p.Ala390Val) rs587780039
NM_000535.7(PMS2):c.11C>G (p.Ala4Gly) rs745361721
NM_000535.7(PMS2):c.123_131del (p.Leu42_Glu44del) rs863224676
NM_000535.7(PMS2):c.1266G>A (p.Glu422=) rs138049175
NM_000535.7(PMS2):c.1280G>A (p.Arg427His) rs112902065
NM_000535.7(PMS2):c.1288A>G (p.Thr430Ala) rs587781382
NM_000535.7(PMS2):c.1357A>G (p.Met453Val) rs587780722
NM_000535.7(PMS2):c.1361T>C (p.Leu454Pro) rs772659239
NM_000535.7(PMS2):c.1394A>G (p.Lys465Arg) rs141084758
NM_000535.7(PMS2):c.1399G>A (p.Val467Ile) rs373611083
NM_000535.7(PMS2):c.1420G>T (p.Ala474Ser) rs373114291
NM_000535.7(PMS2):c.1435C>G (p.His479Asp) rs376344586
NM_000535.7(PMS2):c.1438G>A (p.Gly480Arg) rs146848345
NM_000535.7(PMS2):c.1454C>T (p.Thr485Met) rs1805323
NM_000535.7(PMS2):c.1463C>T (p.Ala488Val) rs587779328
NM_000535.7(PMS2):c.1488C>T (p.His496=) rs1805320
NM_000535.7(PMS2):c.1490G>A (p.Gly497Asp) rs199739859
NM_000535.7(PMS2):c.1501G>A (p.Val501Met) rs540287433
NM_000535.7(PMS2):c.1510G>C (p.Glu504Gln) rs368516768
NM_000535.7(PMS2):c.1531A>G (p.Thr511Ala) rs2228007
NM_000535.7(PMS2):c.1532C>T (p.Thr511Met) rs74902811
NM_000535.7(PMS2):c.1552G>A (p.Glu518Lys) rs376142390
NM_000535.7(PMS2):c.1555T>C (p.Tyr519His) rs370236216
NM_000535.7(PMS2):c.1556A>G (p.Tyr519Cys) rs63750649
NM_000535.7(PMS2):c.1557T>C (p.Tyr519=) rs6972869
NM_000535.7(PMS2):c.1559C>T (p.Ala520Val) rs63751300
NM_000535.7(PMS2):c.1567T>A (p.Ser523Thr) rs63751132
NM_000535.7(PMS2):c.1569C>G (p.Ser523=) rs141458772
NM_000535.7(PMS2):c.1577A>G (p.Asp526Gly) rs143235330
NM_000535.7(PMS2):c.1679G>A (p.Cys560Tyr) rs757989905
NM_000535.7(PMS2):c.1688G>A (p.Arg563Gln) rs63750668
NM_000535.7(PMS2):c.1688G>T (p.Arg563Leu) rs63750668
NM_000535.7(PMS2):c.1688_1689delinsAG (p.Arg563Gln) rs587780725
NM_000535.7(PMS2):c.1711C>A (p.Leu571Ile) rs63750055
NM_000535.7(PMS2):c.1717A>T (p.Thr573Ser) rs63751211
NM_000535.7(PMS2):c.1720C>T (p.Pro574Ser) rs758018736
NM_000535.7(PMS2):c.1723A>G (p.Asn575Asp) rs142506484
NM_000535.7(PMS2):c.1733G>A (p.Arg578His) rs63750770
NM_000535.7(PMS2):c.1753C>A (p.Leu585Ile) rs63750947
NM_000535.7(PMS2):c.1765G>C (p.Asp589His) rs749727182
NM_000535.7(PMS2):c.1768A>G (p.Ile590Val) rs63750476
NM_000535.7(PMS2):c.1798A>G (p.Met600Val) rs1304634005
NM_000535.7(PMS2):c.180C>G (p.Asp60Glu) rs200313585
NM_000535.7(PMS2):c.1828A>G (p.Lys610Glu) rs199700509
NM_000535.7(PMS2):c.1866G>A (p.Met622Ile) rs1805324
NM_000535.7(PMS2):c.187G>A (p.Val63Met) rs772216832
NM_000535.7(PMS2):c.1883G>A (p.Arg628Gln) rs587780044
NM_000535.7(PMS2):c.1906G>A (p.Ala636Thr) rs876658863
NM_000535.7(PMS2):c.1928A>G (p.Gln643Arg) rs760629688
NM_000535.7(PMS2):c.23+10G>C rs192027828
NM_000535.7(PMS2):c.24-3T>C rs749485884
NM_000535.7(PMS2):c.24-4C>G rs2345056
NM_000535.7(PMS2):c.251-20T>G rs149343081
NM_000535.7(PMS2):c.251-2A>C rs587779340
NM_000535.7(PMS2):c.319C>T (p.Arg107Trp) rs188006077
NM_000535.7(PMS2):c.354-3C>T rs587782632
NM_000535.7(PMS2):c.384G>A (p.Ser128=) rs371342884
NM_000535.7(PMS2):c.433C>A (p.Gln145Lys) rs786204133
NM_000535.7(PMS2):c.52A>G (p.Ile18Val) rs63750123
NM_000535.7(PMS2):c.538-2A>G rs758304323
NM_000535.7(PMS2):c.53T>C (p.Ile18Thr) rs201343342
NM_000535.7(PMS2):c.591C>T (p.Gly197=) rs748518694
NM_000535.7(PMS2):c.614A>C (p.Gln205Pro) rs587779342
NM_000535.7(PMS2):c.620G>A (p.Gly207Glu) rs374704824
NM_000535.7(PMS2):c.652G>A (p.Gly218Ser) rs878854055
NM_000535.7(PMS2):c.682G>A (p.Gly228Ser) rs376258383
NM_000535.7(PMS2):c.706-20dup rs60794673
NM_000535.7(PMS2):c.708G>T (p.Leu236Phe) rs201395630
NM_000535.7(PMS2):c.830C>A (p.Thr277Lys) rs1805322
NM_000535.7(PMS2):c.852A>G (p.Ser284=) rs766177007
NM_000535.7(PMS2):c.89A>G (p.Gln30Arg) rs56203955
NM_000535.7(PMS2):c.903+4T>C rs753803330
NM_000535.7(PMS2):c.904-2A>G rs587781339
NM_000535.7(PMS2):c.935T>C (p.Met312Thr) rs530021751
NM_000535.7(PMS2):c.961G>A (p.Val321Ile) rs377043696
NM_000535.7(PMS2):c.988+4A>G rs763959308
NM_000546.5(TP53):c.1000G>C (p.Gly334Arg) rs730882028
NM_000546.5(TP53):c.1009C>T (p.Arg337Cys) rs587782529
NM_000546.5(TP53):c.100C>A (p.Pro34Thr) rs786201968
NM_000546.5(TP53):c.105G>C (p.Leu35Phe) rs121912661
NM_000546.5(TP53):c.1073A>T (p.Glu358Val) rs773553186
NM_000546.5(TP53):c.1079G>C (p.Gly360Ala) rs35993958
NM_000546.5(TP53):c.107C>A (p.Pro36Gln) rs587781866
NM_000546.5(TP53):c.108G>A (p.Pro36=) rs1800370
NM_000546.5(TP53):c.1120G>A (p.Gly374Ser) rs587781858
NM_000546.5(TP53):c.1120G>C (p.Gly374Arg) rs587781858
NM_000546.5(TP53):c.144C>A (p.Asp48Glu) rs587781460
NM_000546.5(TP53):c.145G>A (p.Asp49Asn) rs587780728
NM_000546.5(TP53):c.217G>A (p.Val73Met) rs587782423
NM_000546.5(TP53):c.245C>T (p.Pro82Leu) rs534447939
NM_000546.5(TP53):c.248C>T (p.Ala83Val) rs201717599
NM_000546.5(TP53):c.256G>A (p.Ala86Thr) rs587782148
NM_000546.5(TP53):c.28G>C (p.Val10Leu) rs535274413
NM_000546.5(TP53):c.31G>A (p.Glu11Lys) rs201382018
NM_000546.5(TP53):c.385G>A (p.Ala129Thr) rs1438095083
NM_000546.5(TP53):c.404G>A (p.Cys135Tyr) rs587781991
NM_000546.5(TP53):c.434T>A (p.Leu145Gln) rs587782197
NM_000546.5(TP53):c.466C>T (p.Arg156Cys) rs563378859
NM_000546.5(TP53):c.472C>T (p.Arg158Cys) rs587780068
NM_000546.5(TP53):c.481G>A (p.Ala161Thr) rs193920817
NM_000546.5(TP53):c.536A>G (p.His179Arg) rs1057519991
NM_000546.5(TP53):c.541C>T (p.Arg181Cys) rs587782596
NM_000546.5(TP53):c.566C>T (p.Ala189Val) rs121912665
NM_000546.5(TP53):c.587G>C (p.Arg196Pro) rs483352697
NM_000546.5(TP53):c.604C>G (p.Arg202Gly) rs587780072
NM_000546.5(TP53):c.604C>T (p.Arg202Cys) rs587780072
NM_000546.5(TP53):c.605G>A (p.Arg202His) rs587778719
NM_000546.5(TP53):c.613T>C (p.Tyr205His) rs1057520008
NM_000546.5(TP53):c.643A>G (p.Ser215Gly) rs886039484
NM_000546.5(TP53):c.665C>T (p.Pro222Leu) rs146340390
NM_000546.5(TP53):c.666G>T (p.Pro222=) rs72661118
NM_000546.5(TP53):c.704A>G (p.Asn235Ser) rs144340710
NM_000546.5(TP53):c.713G>A (p.Cys238Tyr) rs730882005
NM_000546.5(TP53):c.824G>A (p.Cys275Tyr) rs863224451
NM_000546.5(TP53):c.824G>C (p.Cys275Ser) rs863224451
NM_000546.5(TP53):c.868C>T (p.Arg290Cys) rs770374782
NM_000546.5(TP53):c.884C>T (p.Pro295Leu) rs751713111
NM_000546.5(TP53):c.892G>A (p.Glu298Lys) rs201744589
NM_000546.5(TP53):c.907A>G (p.Ser303Gly) rs587782391
NM_000546.5(TP53):c.919+3A>G rs876659784
NM_000546.5(TP53):c.943T>A (p.Ser315Thr) rs762620193
NM_000546.5(TP53):c.949C>A (p.Gln317Lys) rs764735889
NM_000546.5(TP53):c.97-6C>T rs35117667
NM_000546.5(TP53):c.974G>A (p.Gly325Glu) rs121912659
NM_000546.5(TP53):c.993+12T>C rs1800899
NM_000546.6(TP53):c.1093C>T (p.His365Tyr) rs267605075
NM_000546.6(TP53):c.1163A>C (p.Glu388Ala) rs587781736
NM_000546.6(TP53):c.140C>G (p.Pro47Arg) rs1597375038
NM_000546.6(TP53):c.473G>A (p.Arg158His) rs587782144
NM_000546.6(TP53):c.523C>T (p.Arg175Cys) rs138729528
NM_000546.6(TP53):c.639A>G (p.Arg213=) rs1800372
NM_000546.6(TP53):c.66A>G (p.Leu22=) rs748527030
NM_000546.6(TP53):c.743G>A (p.Arg248Gln) rs11540652
NM_000546.6(TP53):c.844C>T (p.Arg282Trp) rs28934574
NM_000546.6(TP53):c.847C>T (p.Arg283Cys) rs149633775
NM_000546.6(TP53):c.869G>A (p.Arg290His) rs55819519
NM_000546.6(TP53):c.935C>G (p.Thr312Ser) rs145151284
NM_001005242.3(PKP2):c.1012A>G (p.Thr338Ala) rs139851304
NM_001005242.3(PKP2):c.1379-2019C>T rs149930872
NM_001005242.3(PKP2):c.1379-2067G>A rs138538072
NM_001005242.3(PKP2):c.1445C>T (p.Thr482Met) rs146882581
NM_001005242.3(PKP2):c.1460T>G (p.Ile487Ser) rs147240502
NM_001005242.3(PKP2):c.1627G>A (p.Val543Ile) rs146102241
NM_001005242.3(PKP2):c.1955A>G (p.Asn652Ser) rs140852019
NM_001005242.3(PKP2):c.2260A>G (p.Thr754Ala) rs112592855
NM_001005242.3(PKP2):c.505A>G (p.Ser169Gly) rs139139859
NM_001018005.2(TPM1):c.27G>A (p.Gln9=) rs397516365
NM_001018005.2(TPM1):c.522C>T (p.Ser174=) rs200173919
NM_001018005.2(TPM1):c.774C>T (p.Asp258=) rs762282433
NM_001035.3(RYR2):c.10254C>T (p.Asn3418=) rs138073811
NM_001035.3(RYR2):c.10324-4A>G rs72751287
NM_001035.3(RYR2):c.10641G>A (p.Thr3547=) rs144256966
NM_001035.3(RYR2):c.10725+4A>T rs116444428
NM_001035.3(RYR2):c.10941T>G (p.Pro3647=) rs370332882
NM_001035.3(RYR2):c.11811C>T (p.His3937=)
NM_001035.3(RYR2):c.12159G>A (p.Glu4053=) rs41267517
NM_001035.3(RYR2):c.12705C>T (p.Phe4235=) rs373606009
NM_001035.3(RYR2):c.13326C>T (p.Ala4442=) rs768161152
NM_001035.3(RYR2):c.13656T>C (p.His4552=) rs397516512
NM_001035.3(RYR2):c.13983C>T (p.Tyr4661=) rs138498780
NM_001035.3(RYR2):c.2204-7C>G rs147479514
NM_001035.3(RYR2):c.2574G>A (p.Thr858=) rs367992907
NM_001035.3(RYR2):c.3024G>A (p.Ala1008=) rs566157997
NM_001035.3(RYR2):c.3038G>A (p.Arg1013Gln) rs149514924
NM_001035.3(RYR2):c.3153C>T (p.Arg1051=) rs397516524
NM_001035.3(RYR2):c.3380A>G (p.Glu1127Gly) rs200525962
NM_001035.3(RYR2):c.3407C>T (p.Ala1136Val) rs72549415
NM_001035.3(RYR2):c.3720C>T (p.Ala1240=) rs750335699
NM_001035.3(RYR2):c.3888C>T (p.Asn1296=) rs373721253
NM_001035.3(RYR2):c.4069G>C (p.Asp1357His) rs193922626
NM_001035.3(RYR2):c.4101A>G (p.Lys1367=) rs376792533
NM_001035.3(RYR2):c.4465T>C (p.Cys1489Arg) rs200450676
NM_001035.3(RYR2):c.463+6C>T rs397516533
NM_001035.3(RYR2):c.4747C>T (p.Pro1583Ser) rs200070226
NM_001035.3(RYR2):c.4875G>A (p.Leu1625=) rs369323506
NM_001035.3(RYR2):c.5241C>G (p.Gly1747=) rs533362755
NM_001035.3(RYR2):c.5294C>G (p.Ser1765Cys) rs564806219
NM_001035.3(RYR2):c.5586C>T (p.Asp1862=) rs193922628
NM_001035.3(RYR2):c.5923A>G (p.Met1975Val) rs200318013
NM_001035.3(RYR2):c.615C>T (p.Ala205=) rs112680790
NM_001035.3(RYR2):c.6337G>A (p.Val2113Met) rs186906598
NM_001035.3(RYR2):c.649A>G (p.Ile217Val) rs200642525
NM_001035.3(RYR2):c.7443A>G (p.Gln2481=) rs759314800
NM_001035.3(RYR2):c.7488C>T (p.Leu2496=) rs143906555
NM_001035.3(RYR2):c.7619A>G (p.His2540Arg) rs200105499
NM_001035.3(RYR2):c.828A>G (p.Arg276=) rs180711819
NM_001035.3(RYR2):c.8736G>A (p.Leu2912=) rs762521873
NM_001035.3(RYR2):c.8896-9T>C rs773401697
NM_001035.3(RYR2):c.892C>T (p.Arg298Cys) rs551099887
NM_001035.3(RYR2):c.9519T>C (p.Thr3173=) rs371931287
NM_001035.3(RYR2):c.9820A>G (p.Asn3274Asp) rs751551400
NM_001048171.1(MUTYH):c.1076C>T (p.Ala359Val) rs35352891
NM_001048171.1(MUTYH):c.1434+2C>T rs140288388
NM_001048171.1(MUTYH):c.1435G>T (p.Val479Phe) rs587782228
NM_001048171.1(MUTYH):c.1514G>A (p.Arg505Gln) rs369410616
NM_001048171.1(MUTYH):c.530G>A (p.Arg177Gln) rs369677603
NM_001048171.1(MUTYH):c.929C>T (p.Ser310Leu) rs558173961
NM_001048174.2(MUTYH):c.1103G>A (p.Gly368Asp) rs36053993
NM_001048174.2(MUTYH):c.1174C>A (p.Leu392Met) rs144079536
NM_001048174.2(MUTYH):c.1192C>T (p.Arg398Cys) rs150792276
NM_001048174.2(MUTYH):c.1347G>C (p.Thr449=) rs74318065
NM_001048174.2(MUTYH):c.1463C>T (p.Pro488Leu) rs587778542
NM_001048174.2(MUTYH):c.228C>T (p.Tyr76=) rs121908380
NM_001048174.2(MUTYH):c.305-1G>C rs372267274
NM_001048174.2(MUTYH):c.397G>C (p.Asp133His) rs564930066
NM_001048174.2(MUTYH):c.493-5A>G rs758377868
NM_001048174.2(MUTYH):c.616G>A (p.Val206Met) rs200165598
NM_001048174.2(MUTYH):c.637C>T (p.Arg213Trp) rs34126013
NM_001048174.2(MUTYH):c.652G>T (p.Val218Phe) rs587780749
NM_001048174.2(MUTYH):c.699G>C (p.Gln233His) rs765339120
NM_001048174.2(MUTYH):c.737G>A (p.Arg246Gln) rs149866955
NM_001048174.2(MUTYH):c.841C>T (p.Arg281Cys) rs138089183
NM_001048174.2(MUTYH):c.850-2A>G rs77542170
NM_001048174.2(MUTYH):c.901G>A (p.Val301Met) rs147718169
NM_001048174.2(MUTYH):c.954G>A (p.Ser318=) rs372673338
NM_001126112.2(TP53):c.214_215delinsTG (p.Pro72Cys) rs730882014
NM_001126112.2(TP53):c.376-2dup rs751253294
NM_001126112.2(TP53):c.993+326_993+341del rs730882013
NM_001128425.1(MUTYH):c.1013A>G (p.Gln338Arg) rs199742231
NM_001128425.1(MUTYH):c.1163T>C (p.Leu388Pro) rs1060501335
NM_001128425.1(MUTYH):c.1323G>A (p.Glu441=) rs587782564
NM_001128425.1(MUTYH):c.1433A>G (p.Gln478Arg) rs774607582
NM_001128425.1(MUTYH):c.1501C>T (p.Gln501Ter) rs932830392
NM_001128425.1(MUTYH):c.1600C>A (p.Arg534=) rs144616312
NM_001128425.1(MUTYH):c.1640del (p.Ala547fs) rs587780086
NM_001128425.1(MUTYH):c.188G>A (p.Gly63Glu) rs763693540
NM_001128425.1(MUTYH):c.268G>A (p.Val90Ile) rs375526246
NM_001128425.1(MUTYH):c.326G>C (p.Arg109Pro) rs761763725
NM_001128425.1(MUTYH):c.361A>G (p.Met121Val) rs1553129862
NM_001128425.1(MUTYH):c.389-1G>A rs372267274
NM_001128425.1(MUTYH):c.391T>A (p.Trp131Arg) rs730881832
NM_001128425.1(MUTYH):c.44T>C (p.Met15Thr) rs201163858
NM_001128425.1(MUTYH):c.453_458dup (p.Met153_Gln154insIleTrp) rs876660190
NM_001128425.1(MUTYH):c.470C>T (p.Pro157Leu) rs777184451
NM_001128425.1(MUTYH):c.505-5C>T rs878854191
NM_001128425.1(MUTYH):c.548G>A (p.Gly183Asp) rs587781864
NM_001128425.1(MUTYH):c.576+3A>G rs765792042
NM_001128425.1(MUTYH):c.643G>A (p.Val215Met) rs776487884
NM_001128425.1(MUTYH):c.690G>A (p.Gln230=) rs199989617
NM_001128425.1(MUTYH):c.691-4C>T rs1557474961
NM_001128425.1(MUTYH):c.719C>T (p.Ala240Val) rs369120013
NM_001128425.1(MUTYH):c.783G>T (p.Gln261His) rs765339120
NM_001128425.1(MUTYH):c.857G>A (p.Gly286Glu) rs730881833
NM_001128425.1(MUTYH):c.920G>A (p.Arg307Gln) rs140156029
NM_001128425.1(MUTYH):c.961G>A (p.Gly321Arg) rs765686051
NM_001128425.1(MUTYH):c.997+3G>A rs864622394
NM_001142571.2(RAD51D):c.726A>G (p.Glu242=) rs114012742
NM_001142571.2(RAD51D):c.755G>A (p.Arg252Gln) rs28363283
NM_001167617.2(MLH1):c.-426_-425delinsTG rs63749994
NM_001195798.2(LDLR):c.2231_2232delinsAG (p.Arg744Gln) rs1555808091
NM_001195798.2(LDLR):c.820del (p.Thr274fs) rs751122998
NM_001195800.2(LDLR):c.314-2146_314-2142del rs1057516132
NM_001276345.2(TNNT2):c.200-4C>G rs397516448
NM_001276345.2(TNNT2):c.460C>T (p.Arg154Trp) rs483352832
NM_001276345.2(TNNT2):c.610-10C>T rs375547142
NM_001276345.2(TNNT2):c.63T>G (p.Val21=) rs397516477
NM_001276345.2(TNNT2):c.862C>T (p.Arg288Cys) rs121964857
NM_001281492.1(MSH6):c.3693_*3GACT[3] (p.Ter1231=) rs765313977
NM_001330368.2(C11orf65):c.641-22376CT[2] rs587781905
NM_001351834.2(ATM):c.4397_4398delinsCG (p.Arg1466Pro) rs886038217
NM_001351834.2(ATM):c.5763-1050A>G rs774925473
NM_001354604.2(MITF):c.1273G>A (p.Glu425Lys) rs149617956
NM_001354630.1(MLH1):c.1732-878_1732-877delinsGC rs35502531
NM_001613.4(ACTA2):c.417G>A (p.Gln139=) rs111265233
NM_001943.5(DSG2):c.1051A>G (p.Ser351Gly) rs139326669
NM_001943.5(DSG2):c.1303G>A (p.Asp435Asn) rs370509593
NM_001943.5(DSG2):c.1851C>T (p.Leu617=) rs202057770
NM_001943.5(DSG2):c.1920C>T (p.Gly640=) rs775642244
NM_001943.5(DSG2):c.221A>G (p.His74Arg) rs201855245
NM_001943.5(DSG2):c.2643C>T (p.Thr881=) rs180695545
NM_001943.5(DSG2):c.3059_3062del (p.Glu1020fs) rs397516706
NM_001943.5(DSG2):c.3082G>A (p.Gly1028Ser) rs150864240
NM_001943.5(DSG2):c.3175T>A (p.Ser1059Thr) rs201786158
NM_001943.5(DSG2):c.3243C>T (p.Val1081=) rs11542379
NM_001943.5(DSG2):c.437G>T (p.Arg146Leu) rs113451409
NM_001943.5(DSG2):c.473T>G (p.Val158Gly) rs191143292
NM_002474.3(MYH11):c.*5C>G rs1875184
NM_002474.3(MYH11):c.1249-15G>T rs886051765
NM_002474.3(MYH11):c.12G>A (p.Lys4=) rs112650390
NM_002474.3(MYH11):c.1848C>T (p.Ala616=) rs112834652
NM_002474.3(MYH11):c.1871G>A (p.Arg624His) rs201991156
NM_002474.3(MYH11):c.2005C>T (p.Arg669Cys) rs111404182
NM_002474.3(MYH11):c.217A>C (p.Lys73Gln) rs147447269
NM_002474.3(MYH11):c.2665A>C (p.Lys889Gln) rs762308378
NM_002474.3(MYH11):c.2802G>A (p.Glu934=) rs138977949
NM_002474.3(MYH11):c.2961C>T (p.Ile987=) rs137988790
NM_002474.3(MYH11):c.3531G>A (p.Thr1177=) rs149980738
NM_002474.3(MYH11):c.3651+5_3651+11delinsG rs371843272
NM_002474.3(MYH11):c.3651+6_3651+11del rs371843272
NM_002474.3(MYH11):c.3652-6C>T rs193922630
NM_002474.3(MYH11):c.3757AAG[3] (p.Lys1256del) rs730880147
NM_002474.3(MYH11):c.3910A>C (p.Ile1304Leu) rs200737737
NM_002474.3(MYH11):c.3928G>A (p.Val1310Met) rs7196804
NM_002474.3(MYH11):c.3949C>A (p.Leu1317Ile) rs141159831
NM_002474.3(MYH11):c.3973C>G (p.Gln1325Glu) rs150033906
NM_002474.3(MYH11):c.4074C>T (p.Ala1358=) rs370519992
NM_002474.3(MYH11):c.4293C>T (p.Asp1431=) rs143588920
NM_002474.3(MYH11):c.4401C>T (p.Tyr1467=) rs8046180
NM_002474.3(MYH11):c.4506C>T (p.Leu1502=) rs76890940
NM_002474.3(MYH11):c.4522A>G (p.Met1508Val) rs35176378
NM_002474.3(MYH11):c.453G>A (p.Pro151=) rs61734199
NM_002474.3(MYH11):c.4604G>A (p.Arg1535Gln) rs137934837
NM_002474.3(MYH11):c.4673C>T (p.Thr1558Met) rs111854563
NM_002474.3(MYH11):c.4681G>A (p.Ala1561Thr) rs138863103
NM_002474.3(MYH11):c.4770G>A (p.Lys1590=) rs11648119
NM_002474.3(MYH11):c.4821C>T (p.Asp1607=) rs749424185
NM_002474.3(MYH11):c.4861A>C (p.Lys1621Gln) rs34321232
NM_002474.3(MYH11):c.5094C>T (p.Ala1698=) rs771742318
NM_002474.3(MYH11):c.5226G>C (p.Glu1742Asp) rs144421849
NM_002474.3(MYH11):c.5247G>A (p.Gln1749=) rs757501817
NM_002474.3(MYH11):c.5273G>A (p.Arg1758Gln) rs142546324
NM_002474.3(MYH11):c.5275G>A (p.Val1759Ile) rs138059405
NM_002474.3(MYH11):c.5277C>T (p.Val1759=) rs112564682
NM_002474.3(MYH11):c.5370C>T (p.Leu1790=) rs35295469
NM_002474.3(MYH11):c.5406C>G (p.His1802Gln) rs746211825
NM_002474.3(MYH11):c.5439G>A (p.Lys1813=) rs1050162
NM_002474.3(MYH11):c.5470G>A (p.Ala1824Thr) rs147710374
NM_002474.3(MYH11):c.5478G>A (p.Leu1826=) rs1050163
NM_002474.3(MYH11):c.5517G>A (p.Ala1839=) rs28505375
NM_002474.3(MYH11):c.5529G>A (p.Ser1843=) rs146024732
NM_002474.3(MYH11):c.5566C>T (p.Leu1856=) rs142639688
NM_002474.3(MYH11):c.5691C>T (p.Asn1897=) rs149566621
NM_002474.3(MYH11):c.5772C>G (p.Leu1924=) rs774511118
NM_002474.3(MYH11):c.5787-4707C>G rs111588143
NM_002474.3(MYH11):c.5787-4708C>G rs200884440
NM_002474.3(MYH11):c.5787-4714dup rs747392139
NM_002474.3(MYH11):c.5787-4727C>T rs745371874
NM_002474.3(MYH11):c.5787-4733CT[2] rs747642850
NM_002474.3(MYH11):c.914A>G (p.Asn305Ser) rs185661462
NM_002485.4(NBN):c.-2C>A rs202104448
NM_002485.4(NBN):c.1125-3C>T rs587781326
NM_002485.4(NBN):c.1160C>G (p.Ser387Cys) rs747632184
NM_002485.4(NBN):c.1177T>C (p.Phe393Leu) rs941732827
NM_002485.4(NBN):c.1232C>G (p.Ser411Cys) rs551032019
NM_002485.4(NBN):c.1248G>T (p.Met416Ile) rs756572268
NM_002485.4(NBN):c.1268A>G (p.Lys423Arg) rs1444306607
NM_002485.4(NBN):c.127C>T (p.Arg43Ter) rs200287925
NM_002485.4(NBN):c.1312A>G (p.Ser438Gly) rs1456827107
NM_002485.4(NBN):c.1317A>G (p.Ile439Met) rs28538230
NM_002485.4(NBN):c.1398-10dup rs587780555
NM_002485.4(NBN):c.1465C>G (p.Leu489Val) rs143948240
NM_002485.4(NBN):c.1480C>A (p.Gln494Lys) rs587781557
NM_002485.4(NBN):c.1489A>G (p.Thr497Ala) rs3026268
NM_002485.4(NBN):c.163_171+3del rs1057516772
NM_002485.4(NBN):c.1659G>A (p.Met553Ile) rs876659960
NM_002485.4(NBN):c.1684G>A (p.Val562Ile) rs754651655
NM_002485.4(NBN):c.16C>T (p.Pro6Ser) rs730881859
NM_002485.4(NBN):c.171+3A>G rs1487002693
NM_002485.4(NBN):c.172-3C>T rs587781620
NM_002485.4(NBN):c.1720T>A (p.Leu574Ile) rs142334798
NM_002485.4(NBN):c.1777C>G (p.Pro593Ala) rs146989944
NM_002485.4(NBN):c.1809C>A (p.Phe603Leu) rs192236678
NM_002485.4(NBN):c.1870C>T (p.Arg624Cys) rs962092255
NM_002485.4(NBN):c.1911_1914+1del rs1554556880
NM_002485.4(NBN):c.1993A>G (p.Lys665Glu) rs1554556544
NM_002485.4(NBN):c.1999T>C (p.Ser667Pro) rs587780091
NM_002485.4(NBN):c.2070+1G>A rs1554556454
NM_002485.4(NBN):c.2082T>G (p.Pro694=) rs7823648
NM_002485.4(NBN):c.2146A>G (p.Asn716Asp) rs72563785
NM_002485.4(NBN):c.2235-3C>T rs1554553897
NM_002485.4(NBN):c.2238C>A (p.Tyr746Ter) rs751570713
NM_002485.4(NBN):c.254A>G (p.Asn85Ser) rs587780095
NM_002485.4(NBN):c.278C>T (p.Ser93Leu) rs12721593
NM_002485.4(NBN):c.279G>A (p.Ser93=) rs587780781
NM_002485.4(NBN):c.34G>A (p.Gly12Arg) rs878854511
NM_002485.4(NBN):c.37+5G>A rs116735828
NM_002485.4(NBN):c.38-2A>G rs771475965
NM_002485.4(NBN):c.38-5C>T rs775244752
NM_002485.4(NBN):c.394A>G (p.Ile132Val) rs756946899
NM_002485.4(NBN):c.456G>A (p.Met152Ile) rs201816949
NM_002485.4(NBN):c.468A>C (p.Lys156Asn) rs730881858
NM_002485.4(NBN):c.481-4G>A rs754864893
NM_002485.4(NBN):c.505C>T (p.Arg169Cys) rs182756889
NM_002485.4(NBN):c.64G>A (p.Val22Ile) rs369910645
NM_002485.4(NBN):c.692A>G (p.Asn231Ser) rs1309274168
NM_002485.4(NBN):c.758C>T (p.Thr253Ile) rs61754967
NM_002485.4(NBN):c.797C>T (p.Pro266Leu) rs769420
NM_002485.4(NBN):c.798G>A (p.Pro266=) rs368786672
NM_002485.4(NBN):c.958A>G (p.Lys320Glu) rs1563548624
NM_002485.5(NBN):c.1262T>C (p.Leu421Ser) rs104895032
NM_002485.5(NBN):c.1405G>T (p.Asp469Tyr) rs148205441
NM_002485.5(NBN):c.283G>A (p.Asp95Asn) rs61753720
NM_002485.5(NBN):c.381T>C (p.Ala127=) rs61754795
NM_002485.5(NBN):c.425A>G (p.Asn142Ser) rs769414
NM_002485.5(NBN):c.511A>G (p.Ile171Val) rs61754966
NM_002485.5(NBN):c.643C>T (p.Arg215Trp) rs34767364
NM_002485.5(NBN):c.657_661del (p.Lys219fs) rs587776650
NM_002485.5(NBN):c.788T>C (p.Phe263Ser) rs147626427
NM_002878.3(RAD51D):c.137C>G (p.Ser46Cys) rs587780102
NM_002878.3(RAD51D):c.146C>T (p.Ala49Val) rs140317560
NM_002878.3(RAD51D):c.1A>G (p.Met1Val) rs561425038
NM_002878.3(RAD51D):c.263+1G>A rs1555570242
NM_002878.3(RAD51D):c.26G>C (p.Cys9Ser) rs140825795
NM_002878.3(RAD51D):c.355T>C (p.Cys119Arg) rs201313861
NM_002878.3(RAD51D):c.394G>A (p.Val132Ile) rs201141245
NM_002878.3(RAD51D):c.413A>G (p.Asn138Ser) rs201676898
NM_002878.3(RAD51D):c.481-5T>G rs374382703
NM_002878.3(RAD51D):c.568G>A (p.Ala190Thr) rs80116829
NM_002878.3(RAD51D):c.620C>T (p.Ser207Leu) rs370228071
NM_002878.3(RAD51D):c.623dup (p.Thr209fs) rs1555567610
NM_002878.3(RAD51D):c.668-4G>A rs1001440122
NM_002878.3(RAD51D):c.668-4G>T rs1001440122
NM_002878.3(RAD51D):c.715C>T (p.Arg239Trp) rs770250516
NM_002878.3(RAD51D):c.751A>G (p.Ile251Val) rs540273429
NM_002878.3(RAD51D):c.771C>T (p.Ser257=) rs146212490
NM_002878.3(RAD51D):c.865G>A (p.Gly289Ser) rs587782129
NM_002878.3(RAD51D):c.873C>T (p.Arg291=) rs140848654
NM_002878.3(RAD51D):c.915C>G (p.Phe305Leu) rs1316114457
NM_002878.3(RAD51D):c.919G>A (p.Glu307Lys) rs115031549
NM_002878.3(RAD51D):c.932T>A (p.Ile311Asn) rs145309168
NM_003242.6(TGFBR2):c.1062C>T (p.Leu354=) rs113194608
NM_003242.6(TGFBR2):c.1119G>A (p.Met373Ile) rs35719192
NM_003242.6(TGFBR2):c.1159G>A (p.Val387Met) rs35766612
NM_003242.6(TGFBR2):c.1159G>T (p.Val387Leu) rs35766612
NM_003242.6(TGFBR2):c.1525-6C>G rs748388518
NM_003242.6(TGFBR2):c.1525-8C>T rs11466530
NM_003242.6(TGFBR2):c.1602G>A (p.Val534=) rs140818646
NM_003242.6(TGFBR2):c.1657T>A (p.Ser553Thr) rs112215250
NM_003242.6(TGFBR2):c.367A>T (p.Met123Leu) rs768385200
NM_003242.6(TGFBR2):c.550A>G (p.Ile184Val)
NM_003242.6(TGFBR2):c.571G>A (p.Val191Ile) rs56105708
NM_003242.6(TGFBR2):c.649G>C (p.Ala217Pro) rs149141477
NM_003242.6(TGFBR2):c.690G>A (p.Thr230=) rs201560560
NM_003242.6(TGFBR2):c.696C>T (p.Ala232=) rs768508812
NM_003242.6(TGFBR2):c.94+16245G>A rs61732532
NM_003242.6(TGFBR2):c.944C>T (p.Thr315Met) rs34833812
NM_004329.2(BMPR1A):c.1140C>T (p.Asp380=) rs35572415
NM_004329.2(BMPR1A):c.1299C>T (p.Phe433=) rs150946485
NM_004329.2(BMPR1A):c.1327C>T (p.Arg443Cys) rs35619497
NM_004329.2(BMPR1A):c.1343-3T>C rs771504880
NM_004329.2(BMPR1A):c.1348G>A (p.Val450Met) rs55932635
NM_004329.2(BMPR1A):c.1419T>G (p.Val473=) rs145756629
NM_004329.2(BMPR1A):c.1560G>A (p.Thr520=) rs142775086
NM_004329.2(BMPR1A):c.170C>G (p.Pro57Arg) rs1057517610
NM_004329.2(BMPR1A):c.1A>C (p.Met1Leu) rs786203157
NM_004329.2(BMPR1A):c.22A>G (p.Ile8Val) rs863224719
NM_004329.2(BMPR1A):c.230+3A>G rs1060503393
NM_004329.2(BMPR1A):c.415C>T (p.Pro139Ser) rs772163112
NM_004329.2(BMPR1A):c.435G>A (p.Pro145=) rs11818239
NM_004329.2(BMPR1A):c.499A>G (p.Met167Val) rs200951235
NM_004329.2(BMPR1A):c.560G>A (p.Arg187His) rs189059377
NM_004329.2(BMPR1A):c.562C>T (p.Arg188Cys) rs879254272
NM_004329.2(BMPR1A):c.618A>G (p.Leu206=) rs55992440
NM_004329.2(BMPR1A):c.676-3A>C rs587782760
NM_004329.2(BMPR1A):c.676-4A>G rs929042482
NM_004329.2(BMPR1A):c.676-5T>C rs200537780
NM_004329.2(BMPR1A):c.760C>T (p.Arg254Cys) rs587782578
NM_004329.2(BMPR1A):c.777G>A (p.Ala259=) rs56108371
NM_004329.2(BMPR1A):c.953A>G (p.Tyr318Cys) rs587778111
NM_004329.2(BMPR1A):c.98C>G (p.Thr33Ser) rs142454490
NM_004329.3(BMPR1A):c.1433G>A (p.Arg478His) rs113849804
NM_004360.5(CDH1):c.1004G>A (p.Arg335Gln) rs373364873
NM_004360.5(CDH1):c.1018A>G (p.Thr340Ala) rs116093741
NM_004360.5(CDH1):c.1019C>T (p.Thr340Met) rs61747631
NM_004360.5(CDH1):c.1174G>A (p.Val392Ile) rs141864044
NM_004360.5(CDH1):c.1223C>T (p.Ala408Val) rs138135866
NM_004360.5(CDH1):c.1225T>C (p.Trp409Arg) rs587778176
NM_004360.5(CDH1):c.1243A>G (p.Ile415Val) rs1060501239
NM_004360.5(CDH1):c.1272C>T (p.Val424=) rs61756284
NM_004360.5(CDH1):c.1273G>A (p.Val425Ile) rs570930882
NM_004360.5(CDH1):c.1298A>G (p.Asp433Gly) rs376097289
NM_004360.5(CDH1):c.1308G>A (p.Leu436=) rs557551011
NM_004360.5(CDH1):c.1314A>G (p.Thr438=) rs547316616
NM_004360.5(CDH1):c.1334A>C (p.Glu445Ala) rs374398608
NM_004360.5(CDH1):c.1360G>A (p.Val454Ile) rs587780112
NM_004360.5(CDH1):c.1409C>T (p.Thr470Ile) rs370864592
NM_004360.5(CDH1):c.1565+1G>T rs587780113
NM_004360.5(CDH1):c.1565+2_1565+3insTT rs1555516200
NM_004360.5(CDH1):c.1568A>G (p.Tyr523Cys) rs553907248
NM_004360.5(CDH1):c.1585A>G (p.Thr529Ala) rs776890776
NM_004360.5(CDH1):c.164T>G (p.Val55Gly) rs587778174
NM_004360.5(CDH1):c.1680G>C (p.Thr560=) rs35741240
NM_004360.5(CDH1):c.1685C>G (p.Thr562Arg) rs587782381
NM_004360.5(CDH1):c.1697T>C (p.Ile566Thr) rs763292288
NM_004360.5(CDH1):c.1711+5G>A rs1131690818
NM_004360.5(CDH1):c.1774G>A (p.Ala592Thr) rs35187787
NM_004360.5(CDH1):c.1849G>A (p.Ala617Thr) rs33935154
NM_004360.5(CDH1):c.1888C>G (p.Leu630Val) rs2276331
NM_004360.5(CDH1):c.188G>A (p.Arg63Gln) rs587780117
NM_004360.5(CDH1):c.1896C>T (p.His632=) rs33969373
NM_004360.5(CDH1):c.1988A>G (p.Tyr663Cys) rs372182377
NM_004360.5(CDH1):c.2020A>T (p.Asn674Tyr) rs201637081
NM_004360.5(CDH1):c.2080G>A (p.Val694Ile) rs587780118
NM_004360.5(CDH1):c.2104G>A (p.Glu702Lys) rs149127230
NM_004360.5(CDH1):c.214G>A (p.Asp72Asn) rs35606263
NM_004360.5(CDH1):c.2195G>A (p.Arg732Gln) rs1060501244
NM_004360.5(CDH1):c.2296-1G>A rs1057517542
NM_004360.5(CDH1):c.2336G>A (p.Arg779Gln) rs587781311
NM_004360.5(CDH1):c.2343A>T (p.Glu781Asp) rs587780119
NM_004360.5(CDH1):c.2369C>T (p.Thr790Ile) rs587780120
NM_004360.5(CDH1):c.2374A>C (p.Met792Leu) rs759380419
NM_004360.5(CDH1):c.2387G>A (p.Arg796Gln) rs587782549
NM_004360.5(CDH1):c.2413G>A (p.Asp805Asn) rs200894246
NM_004360.5(CDH1):c.2440-6C>G rs139757930
NM_004360.5(CDH1):c.2450C>T (p.Ala817Val) rs587782024
NM_004360.5(CDH1):c.2494G>A (p.Val832Met) rs35572355
NM_004360.5(CDH1):c.2512A>G (p.Ser838Gly) rs121964872
NM_004360.5(CDH1):c.2520C>T (p.Ser840=) rs140328601
NM_004360.5(CDH1):c.2634C>T (p.Gly878=) rs2229044
NM_004360.5(CDH1):c.269G>A (p.Arg90Gln) rs587782647
NM_004360.5(CDH1):c.286A>G (p.Ile96Val) rs749306433
NM_004360.5(CDH1):c.304G>A (p.Ala102Thr) rs368492235
NM_004360.5(CDH1):c.324A>G (p.Arg108=) rs116542018
NM_004360.5(CDH1):c.344C>T (p.Thr115Met) rs370973869
NM_004360.5(CDH1):c.345G>A (p.Thr115=) rs1801023
NM_004360.5(CDH1):c.387+5G>A rs113055163
NM_004360.5(CDH1):c.408A>G (p.Gln136=) rs1060501229
NM_004360.5(CDH1):c.48+15_48+16del rs730881655
NM_004360.5(CDH1):c.48+5C>G rs77312180
NM_004360.5(CDH1):c.532-18C>T rs200673941
NM_004360.5(CDH1):c.546A>C (p.Lys182Asn) rs201141645
NM_004360.5(CDH1):c.715G>A (p.Gly239Arg) rs587780537
NM_004360.5(CDH1):c.724G>A (p.Val242Ile) rs111662525
NM_004360.5(CDH1):c.832+1G>A rs878854697
NM_004360.5(CDH1):c.833-3C>T rs587782839
NM_004360.5(CDH1):c.858C>A (p.Ala286=) rs876660354
NM_004360.5(CDH1):c.88C>A (p.Pro30Thr) rs139866691
NM_004360.5(CDH1):c.892G>A (p.Ala298Thr) rs142822590
NM_004360.5(CDH1):c.933C>G (p.Leu311=) rs35539711
NM_004415.4(DSP):c.12C>G (p.Asn4Lys) rs368802003
NM_004415.4(DSP):c.1743C>T (p.Ala581=) rs139095230
NM_004415.4(DSP):c.2422C>T (p.Arg808Cys) rs150339369
NM_004415.4(DSP):c.2596C>T (p.Arg866Cys) rs142429411
NM_004415.4(DSP):c.269A>G (p.Gln90Arg) rs188516326
NM_004415.4(DSP):c.2723G>A (p.Arg908His) rs142494121
NM_004415.4(DSP):c.2815G>A (p.Gly939Ser) rs80325569
NM_004415.4(DSP):c.3282G>A (p.Lys1094=) rs2491080
NM_004415.4(DSP):c.3510G>A (p.Glu1170=) rs28763964
NM_004415.4(DSP):c.4372C>G (p.Arg1458Gly) rs28763965
NM_004415.4(DSP):c.4455G>T (p.Arg1485Ser) rs113902911
NM_004415.4(DSP):c.4489C>T (p.Arg1497Trp) rs148041814
NM_004415.4(DSP):c.4526G>A (p.Arg1509Lys) rs577061462
NM_004415.4(DSP):c.4775A>G (p.Lys1592Arg) rs200421954
NM_004415.4(DSP):c.5167G>C (p.Glu1723Gln) rs142803672
NM_004415.4(DSP):c.5178C>A (p.Asn1726Lys) rs147415451
NM_004415.4(DSP):c.6038G>A (p.Arg2013Gln) rs557263443
NM_004415.4(DSP):c.6208G>A (p.Asp2070Asn) rs41302885
NM_004415.4(DSP):c.6881C>G (p.Ala2294Gly) rs147000526
NM_004415.4(DSP):c.7278T>C (p.Tyr2426=) rs78843072
NM_004415.4(DSP):c.7848G>A (p.Ser2616=) rs148798300
NM_004415.4(DSP):c.7964C>G (p.Ala2655Gly) rs193922671
NM_004415.4(DSP):c.8300C>A (p.Thr2767Asn) rs34884895
NM_004415.4(DSP):c.8301C>G (p.Thr2767=) rs145362059
NM_004415.4(DSP):c.8508_8517delinsGTCCCGCAGT (p.Gly2836_Ser2839=) rs1561706189
NM_004415.4(DSP):c.88G>A (p.Val30Met) rs121912998
NM_004572.3(PKP2):c.1558A>G (p.Ile520Val) rs763749576
NM_004572.3(PKP2):c.184C>A (p.Gln62Lys) rs199601548
NM_004572.3(PKP2):c.1974A>G (p.Gln658=) rs138901574
NM_004572.3(PKP2):c.406G>A (p.Val136Met) rs567795321
NM_004612.4(TGFBR1):c.1032T>C (p.Asn344=) rs192662552
NM_004612.4(TGFBR1):c.1125A>C (p.Thr375=) rs7861780
NM_004612.4(TGFBR1)