ClinVar Miner

Variants from Color with conflicting interpretations

Location: United States — Primary collection method: clinical testing
Minimum review status of the submission from Color: Collection method of the submission from Color:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
6482 10018 144 3055 3626 57 420 5822

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
Color pathogenic likely pathogenic uncertain significance likely benign benign association drug response risk factor other
pathogenic 5 334 50 2 0 0 1 21 1
likely pathogenic 195 1 80 5 0 0 0 7 0
uncertain significance 71 161 35 615 44 1 0 3 2
likely benign 34 21 2449 9 1293 0 0 2 1
benign 25 13 569 1258 94 2 1 5 10

Submitter to submitter summary #

Total submitters: 146
Download table as spreadsheet
Submitter Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
GeneDx 0 6571 0 1088 778 1 51 1918
Invitae 0 10025 0 779 998 2 51 1830
Ambry Genetics 0 9167 0 637 821 0 64 1522
Integrated Genetics/Laboratory Corporation of America 0 2160 1 428 1002 0 21 1452
Illumina Clinical Services Laboratory,Illumina 0 372 0 611 340 0 14 963
Counsyl 0 2334 0 352 545 0 17 914
Quest Diagnostics Nichols Institute San Juan Capistrano 0 1603 0 276 339 0 15 629
Breast Cancer Information Core (BIC) (BRCA2) 0 500 0 30 361 0 24 415
Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine 0 974 0 128 182 0 7 317
Breast Cancer Information Core (BIC) (BRCA1) 0 331 0 27 264 0 25 316
Department of Pathology and Laboratory Medicine,Sinai Health System 0 619 0 166 136 0 9 311
Sharing Clinical Reports Project (SCRP) 0 933 0 188 111 0 10 309
PreventionGenetics 0 1146 0 176 124 0 5 305
Mendelics 0 563 0 39 221 0 9 269
EGL Genetic Diagnostics,Eurofins Clinical Diagnostics 0 519 0 99 165 1 3 268
Biesecker Lab/Human Development Section,National Institutes of Health 0 121 96 30 118 0 2 246
International Society for Gastrointestinal Hereditary Tumours (InSiGHT) 0 285 53 63 98 0 6 220
True Health Diagnostics 0 228 0 161 31 1 0 193
Genetic Services Laboratory, University of Chicago 0 169 0 100 69 0 2 171
CSER_CC_NCGL; University of Washington Medical Center 0 144 0 37 112 0 15 164
ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories 0 546 0 104 49 0 5 158
Mayo Clinic Genetic Testing Laboratories,Mayo Clinic 0 320 0 88 52 0 7 147
CHEO Genetics Diagnostic Laboratory,Children's Hospital of Eastern Ontario 0 270 0 80 55 0 3 138
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) 0 1161 0 130 3 0 4 137
Fulgent Genetics 0 406 0 32 84 0 4 120
Robarts Research Institute,Western University 0 56 0 61 31 0 13 105
OMIM 0 101 0 16 13 40 39 103
DNA and Cytogenetics Diagnostics Unit,Erasmus Medical Center 0 259 0 83 20 0 0 103
Division of Genomic Diagnostics,The Children's Hospital of Philadelphia 0 84 0 38 53 0 2 93
GeneKor MSA 0 278 0 18 72 1 2 93
Institute for Biomarker Research,Medical Diagnostic Laboratories, L.L.C. 0 74 0 69 15 0 2 86
CeGaT Praxis fuer Humangenetik Tuebingen 0 62 0 26 51 0 7 84
Genome Diagnostics Laboratory,University Medical Center Utrecht 0 159 0 74 8 0 0 82
Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde,Academisch Medisch Centrum 0 61 0 40 2 0 35 77
University of Washington Department of Laboratory Medicine,University of Washington 0 130 0 26 37 1 10 74
Laboratory of Genetics and Molecular Cardiology,University of São Paulo 0 34 0 12 46 0 11 69
Diagnostic Laboratory, Department of Genetics,University Medical Center Groningen 0 232 0 56 9 0 1 66
Center for Human Genetics, Inc 0 46 0 28 31 0 3 62
Michigan Medical Genetics Laboratories,University of Michigan 0 177 0 50 11 0 1 62
Cardiovascular Research Group,Instituto Nacional de Saude Doutor Ricardo Jorge 0 54 0 12 37 0 6 55
Foulkes Cancer Genetics LDI,Lady Davis Institute for Medical Research 0 87 0 15 33 0 6 54
Research Molecular Genetics Laboratory,Women's College Hospital, University of Toronto 0 372 0 30 11 0 11 52
Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA), c/o University of Cambridge 0 563 0 41 0 0 9 50
LDLR-LOVD, British Heart Foundation 0 81 0 32 7 0 9 48
Pathway Genomics 0 112 0 34 13 0 1 48
Blueprint Genetics, 0 37 0 12 26 0 6 42
Cancer Genetics Laboratory,Peter MacCallum Cancer Centre 0 31 0 21 21 0 0 42
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 0 46 0 35 5 0 1 41
Centre de Génétique Moléculaire et Chromosomique, Unité de génétique de l'Obésité et des Dyslipidémies,APHP, GH Hôpitaux Universitaires Pitié-Salpêtrière / Charles-Foix 0 30 0 24 8 0 9 41
Cancer Genetics and Genomics Laboratory,British Columbia Cancer Agency 0 84 0 20 21 0 0 41
Stanford Center for Inherited Cardiovascular Disease,Stanford University 0 60 0 11 28 0 1 40
Color 22233 52 0 25 12 0 0 37
PALB2 database 0 73 0 8 20 0 4 32
Baylor Miraca Genetics Laboratories, 0 116 0 27 1 0 3 31
U4M - Lille University & CHRU Lille,Université Lille 2 - CHRU de Lille 0 24 0 15 0 0 15 30
Genome Diagnostics Laboratory,VU University Medical Center Amsterdam 0 60 0 27 1 0 0 28
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute 0 22 0 10 13 0 4 27
Vantari Genetics 0 45 0 16 8 0 0 24
Fundacion Hipercolesterolemia Familiar 0 25 0 9 9 0 6 24
Athena Diagnostics Inc 0 95 0 17 6 0 0 23
Department of Pathology and Molecular Medicine,Queen's University 0 59 0 8 15 0 0 23
Clinical Genomics Lab,St. Jude Children's Research Hospital 0 48 0 1 21 0 1 23
Laboratory of Molecular Diagnosis of Cancer,West China Hospital, Sichuan University 0 28 0 0 21 0 0 21
Iberoamerican FH Network 0 20 0 7 9 0 4 20
Soonchunhyang University Bucheon Hospital,Soonchunhyang University Medical Center 0 5 0 2 15 0 2 19
3DMed Clinical Laboratory Inc 0 42 0 2 16 0 1 19
GeneReviews 0 28 5 5 0 0 8 18
Knight Diagnostic Laboratories,Oregon Health and Sciences University 0 7 0 0 18 0 0 18
Database of Curated Mutations (DoCM) 0 6 0 8 0 0 10 18
A.C.Camargo Cancer Center / LGBM, A.C.Camargo Cancer Center 0 30 0 1 15 0 1 17
Cardiovascular Genetics Laboratory,PathWest Laboratory Medicine WA - Fiona Stanley Hospital 0 25 0 11 2 0 3 16
Genomic Research Center,Shahid Beheshti University of Medical Sciences 0 19 0 2 8 0 6 16
Molecular Genetics Laboratory,Centre for Cardiovascular Surgery and Transplantation 0 18 0 11 3 0 2 16
ClinGen CDH1 Variant Curation Expert Panel 0 11 0 13 3 0 0 16
Centre for Mendelian Genomics,University Medical Centre Ljubljana 0 11 0 1 9 0 4 14
Cardiovascular Biomarker Research Laboratory,Mayo Clinic 0 7 0 8 5 0 0 13
Equipe Genetique des Anomalies du Developpement,Université de Bourgogne 0 9 0 2 6 0 4 12
Systems Biology Platform Zhejiang California International NanoSystems Institute 0 0 0 0 0 11 0 11
Center for Medical Genetics Ghent,University of Ghent 0 10 0 1 8 0 2 11
Institute for Integrative and Experimental Genomics,University of Luebeck 0 2 0 7 3 0 1 11
Human Genome Sequencing Center Clinical Lab,Baylor College of Medicine 0 82 0 3 0 1 6 10
Department of Medical Genetics,University Hospital of North Norway 0 13 0 6 4 0 0 10
German Consortium for Hereditary Breast and Ovarian Cancer Center Cologne,University Hospital Cologne 0 64 0 5 0 0 5 10
Institute for Genomic Medicine (IGM) Clinical Laboratory,Nationwide Children's Hospital 0 7 0 8 0 0 0 8
Phosphorus, Inc. 0 3 0 1 5 0 0 6
Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago 0 4 0 0 6 0 0 6
Clinical Molecular Genetics Laboratory,Johns Hopkins All Children's Hospital 0 8 0 0 1 0 4 5
Department of Medical Genetics,Oslo University Hospital 0 88 0 3 0 0 2 5
Center for Human Genetics and Laboratory Diagnostics, Dr. Klein, Dr. Rost and Colleagues 0 4 0 0 5 0 0 5
ClinGen Inherited Cardiomyopathy Variant Curation Expert Panel, 0 35 0 2 3 0 0 5
Cancer Variant Interpretation Group UK,Institute of Cancer Research, London 0 0 0 1 0 0 4 5
Cancer Genomic Medicine Translational Research Lab,Cleveland Clinic Genomic Medicine Institute 0 0 0 0 3 0 1 4
Agnes Ginges Centre for Molecular Cardiology,Centenary Institute 0 7 0 4 0 0 0 4
Forensic Genetics Laboratory,Harris County Institute of Forensic Sciences 0 0 0 0 0 0 4 4
ClinGen PTEN Variant Curation Expert Panel 0 10 0 1 3 0 0 4
Evolutionary and Medical Genetics Laboratory, Centre for Cellular and Molecular Biology 0 0 0 0 1 0 2 3
HudsonAlpha Institute for Biotechnology 0 18 0 2 0 0 1 3
Center for Human Genetics,University of Leuven 0 4 0 0 1 0 2 3
Genetic Predisposition to Colorectal Cancer Group,Institut d’Investigacions Biomediques August Pi i Sunyer 0 0 0 2 0 0 1 3
Donald Williams Parsons Laboratory,Baylor College of Medicine 0 2 0 0 0 2 1 3
GeneID Lab - Advanced Molecular Diagnostics 0 1 0 0 2 0 1 3
Developmental Genetics Unit,King Faisal Specialist Hospital & Research Centre 0 0 0 0 0 0 2 2
Genologica Medica 0 34 0 2 0 0 0 2
Mayo Clinic Health System - Franciscan Health care,Mayo Clinic Health System 0 0 0 0 1 0 1 2
Lupski Lab, Baylor-Hopkins CMG,Baylor College of Medicine 0 2 0 0 0 0 2 2
Dr. Peter K. Rogan Lab,Western University 0 0 0 1 0 0 1 2
Next Generation Diagnostics,Novartis Institutes for BioMedical Research, Inc. 0 0 0 0 2 0 0 2
Erich and Hanna Klessmann Institute for Cardiovascular Research and Development,Heart and Diabetes Center North Rhine-Westphalia 0 2 0 0 0 0 2 2
MVZ Praenatalmedizin und Genetik Nuernberg 0 1 0 1 1 0 0 2
Laboratoire de Biologie et Génétique du Cancer,Centre François Baclesse 0 2 0 1 0 0 1 2
Snyder Lab, Genetics Department,Stanford University 0 2 0 1 0 1 0 2
Clinical Cancer Genetics and Family Consultants,Athens Medical Center 0 1 0 0 0 0 2 2
Lab. Molecular Oncology,VUB, Free University of Brussels 0 3 0 0 2 0 0 2
Gharavi Laboratory,Columbia University 0 12 0 1 1 0 0 2
Division Human Genetics,Medical University Innsbruck 0 27 0 1 0 0 0 1
Science for Life laboratory, Karolinska Institutet 0 0 1 0 0 0 0 1
SNPedia 0 9 0 1 0 0 0 1
PharmGKB 0 0 0 0 0 1 0 1
Shenzhen Institute of Pediatrics,Shenzhen Children's Hospital 0 0 0 0 0 0 1 1
UCLA Clinical Genomics Center, UCLA 0 0 0 1 0 0 0 1
Foundation Medicine, Inc. 0 0 0 0 1 0 0 1
Center for Individualized Medicine,Mayo Clinic 0 1 0 1 0 0 0 1
Molecular Oncology Laboratory,Centre Jean Perrin 0 0 0 0 0 1 0 1
Centre for Genomic and Experimental Medicine,University of Edinburgh 0 0 0 0 0 0 1 1
Baylor-Hopkins Center for Mendelian Genomics,Johns Hopkins University 0 0 0 0 0 0 1 1
Bioscientia Institut fuer Medizinische Diagnostik GmbH,Sonic Healthcare 0 7 0 1 0 0 0 1
Personalized Diabetes Medicine Program,University of Maryland School of Medicine 0 0 0 1 0 0 0 1
Clinical Molecular and Personalized Diagnostics,Institute of Biochemistry and Clinical Biochemistry, Teaching and Research Hospital Agostino Gemelli Foundation 0 0 0 1 0 0 0 1
ARUP Institute,ARUP Laboratories 0 0 0 1 0 0 0 1
Centre for Molecular Diagnostics & Cell Biology,Rajiv Gandhi Cancer Institute & Research Center 0 0 0 0 1 0 0 1
Oxford Haemato-Oncology Service,Oxford University Hospitals NHS Foundation Trust 0 0 0 0 0 1 0 1
Endocrine oncology group,Uppsala University 0 0 0 1 0 0 0 1
SIB Swiss Institute of Bioinformatics 0 3 0 1 0 0 0 1
Geisinger Autism and Developmental Medicine Institute,Geisinger Health System 0 1 0 1 0 0 0 1
CHLA Center for Personalized Medicine,Children's Hospital, Los Angeles 0 5 0 1 0 0 0 1
AlTemaimi Lab, Faculty of Medicine,Kuwait University 0 0 0 0 0 0 1 1
Yang An-Suei Laboratory,Academia Sinica 0 1 0 1 0 0 0 1
School of Basic Medicine,Fourth Military Medical University 0 0 0 0 0 0 1 1
Laboratory of Molecular Neuropathology,The University of Texas Health Science Center at Houston 0 0 0 0 0 0 1 1
Dept. of Medical Genetics, Telemark Hospital Trust 0 0 0 0 0 0 1 1
Cancer Diagnostics Division,Gene Solutions 0 0 0 1 0 0 0 1
Department of Molecular Diagnostics,Institute of Oncology 0 0 0 1 0 0 0 1
Department of Genetics,Sultan Qaboos University Hospital, Oman 0 2 0 0 0 0 1 1
Core Molecular Diagnostic Lab,McGill University Health Centre 0 0 0 1 0 0 0 1
Center for Reproductive Medicine,Shandong Provincial Hospital Affiliated to Shandong University 0 0 0 0 0 0 1 1
Cure Brain Cancer Foundation Neuro-Oncology Group, Adult Cancer Program,University of New South Wales 0 0 0 0 0 0 1 1

All variants with conflicting interpretations #

Total variants: 5822
Download table as spreadsheet
HGVS dbSNP
MYH11:c.503-14_503-12del rs141564071
NM_000038.5(APC):c.-16C>T rs371665872
NM_000038.5(APC):c.1005A>G (p.Leu335=) rs3797704
NM_000038.5(APC):c.1139G>A (p.Arg380Gln) rs587782886
NM_000038.5(APC):c.120G>A (p.Glu40=) rs142720069
NM_000038.5(APC):c.1240C>T (p.Arg414Cys) rs137854567
NM_000038.5(APC):c.1276G>T (p.Ala426Ser) rs200598389
NM_000038.5(APC):c.1313-9A>G rs368494354
NM_000038.5(APC):c.135+8G>C rs1554067166
NM_000038.5(APC):c.1392T>C (p.His464=) rs1057524073
NM_000038.5(APC):c.1405C>T (p.Leu469=) rs746293695
NM_000038.5(APC):c.1408+5G>A rs779919032
NM_000038.5(APC):c.1419G>A (p.Gln473=) rs141579422
NM_000038.5(APC):c.1443G>A (p.Val481=) rs146179851
NM_000038.5(APC):c.1458T>C (p.Tyr486=) rs2229992
NM_000038.5(APC):c.1488A>T (p.Thr496=) rs9282599
NM_000038.5(APC):c.1495C>G (p.Arg499Gly) rs137854580
NM_000038.5(APC):c.1548+17T>C rs367690523
NM_000038.5(APC):c.1554G>A (p.Thr518=) rs546568052
NM_000038.5(APC):c.1604C>T (p.Ser535Phe) rs75870842
NM_000038.5(APC):c.1631T>C (p.Ile544Thr) rs144056494
NM_000038.5(APC):c.1635G>A (p.Ala545=) rs351771
NM_000038.5(APC):c.1686G>A (p.Thr562=) rs770256026
NM_000038.5(APC):c.1695A>G (p.Glu565=) rs77921116
NM_000038.5(APC):c.1713A>G (p.Ala571=) rs529306174
NM_000038.5(APC):c.1722A>G (p.Glu574=) rs786201277
NM_000038.5(APC):c.1825G>A (p.Val609Ile) rs147863331
NM_000038.5(APC):c.1867C>T (p.Arg623Trp) rs730881238
NM_000038.5(APC):c.1958+10G>T rs375175370
NM_000038.5(APC):c.1958+1_1958+4dupGTAT rs1060503356
NM_000038.5(APC):c.1958+5A>G rs762899641
NM_000038.5(APC):c.1958+6T>C rs368421386
NM_000038.5(APC):c.1958+8T>C rs62626346
NM_000038.5(APC):c.1959G>A (p.Arg653=) rs72541809
NM_000038.5(APC):c.1962A>G (p.Gln654=) rs1057523515
NM_000038.5(APC):c.2031C>T (p.Val677=) rs769363082
NM_000038.5(APC):c.2105G>A (p.Gly702Glu) rs876658289
NM_000038.5(APC):c.2196T>C (p.Asn732=) rs781693283
NM_000038.5(APC):c.220+2T>A rs587781809
NM_000038.5(APC):c.2204C>T (p.Ala735Val) rs147655929
NM_000038.5(APC):c.2205G>A (p.Ala735=) rs141001261
NM_000038.5(APC):c.221-2A>G rs786201291
NM_000038.5(APC):c.221A>C (p.Glu74Ala) rs773347338
NM_000038.5(APC):c.2222A>G (p.Asn741Ser) rs150209825
NM_000038.5(APC):c.2232T>G (p.Ser744=) rs145751759
NM_000038.5(APC):c.2262T>G (p.Val754=) rs148987776
NM_000038.5(APC):c.2277C>T (p.Ala759=) rs762441650
NM_000038.5(APC):c.2297C>T (p.Ala766Val) rs200339830
NM_000038.5(APC):c.2322C>T (p.Asp774=) rs145792879
NM_000038.5(APC):c.2385C>T (p.Leu795=) rs80188155
NM_000038.5(APC):c.2438A>G (p.Asn813Ser) rs201522866
NM_000038.5(APC):c.2444A>C (p.Asn815Thr) rs762990578
NM_000038.5(APC):c.2476T>G (p.Leu826Val) rs145245264
NM_000038.5(APC):c.2527A>G (p.Ser843Gly) rs536223189
NM_000038.5(APC):c.2586C>G (p.Asn862Lys) rs147972247
NM_000038.5(APC):c.2593C>T (p.Pro865Ser) rs192620988
NM_000038.5(APC):c.259C>T (p.Leu87=) rs569640184
NM_000038.5(APC):c.2608C>T (p.Pro870Ser) rs33974176
NM_000038.5(APC):c.2627G>A (p.Arg876Gln) rs373428732
NM_000038.5(APC):c.2658G>T (p.Gln886His) rs587780593
NM_000038.5(APC):c.2677G>A (p.Glu893Lys) rs199740875
NM_000038.5(APC):c.277C>G (p.Leu93Val) rs201567345
NM_000038.5(APC):c.2805C>T (p.Tyr935=) rs137854575
NM_000038.5(APC):c.2847G>T (p.Met949Ile) rs147394539
NM_000038.5(APC):c.2860T>C (p.Leu954=) rs863224278
NM_000038.5(APC):c.2948T>C (p.Ile983Thr) rs113674464
NM_000038.5(APC):c.2952A>G (p.Glu984=) rs772562489
NM_000038.5(APC):c.2958T>C (p.Tyr986=) rs746581330
NM_000038.5(APC):c.295C>T (p.Arg99Trp) rs139196838
NM_000038.5(APC):c.3006C>T (p.Ala1002=) rs72541810
NM_000038.5(APC):c.3165A>T (p.Ile1055=) rs61734287
NM_000038.5(APC):c.3173A>G (p.Asp1058Gly) rs148725540
NM_000038.5(APC):c.317G>A (p.Arg106His) rs201764637
NM_000038.5(APC):c.323G>A (p.Gly108Glu) rs1114167456
NM_000038.5(APC):c.3245C>G (p.Thr1082Ser) rs730881244
NM_000038.5(APC):c.3249T>G (p.Asp1083Glu) rs201629780
NM_000038.5(APC):c.3264G>A (p.Lys1088=) rs114774495
NM_000038.5(APC):c.3323A>G (p.Asn1108Ser) rs151286353
NM_000038.5(APC):c.3352A>G (p.Asn1118Asp) rs140493115
NM_000038.5(APC):c.3374T>C (p.Val1125Ala) rs377278397
NM_000038.5(APC):c.3378C>G (p.Ser1126Arg) rs149353082
NM_000038.5(APC):c.3386T>C (p.Leu1129Ser) rs143638171
NM_000038.5(APC):c.3468_3470delAGA (p.Glu1157del) rs386833391
NM_000038.5(APC):c.3471G>A (p.Glu1157=) rs143927847
NM_000038.5(APC):c.3479C>A (p.Thr1160Lys) rs201004111
NM_000038.5(APC):c.3511C>T (p.Arg1171Cys) rs201830995
NM_000038.5(APC):c.3512G>A (p.Arg1171His) rs372481703
NM_000038.5(APC):c.3625G>A (p.Glu1209Lys) rs201185479
NM_000038.5(APC):c.3632T>G (p.Met1211Arg) rs575268622
NM_000038.5(APC):c.3650A>C (p.Asn1217Thr) rs138933660
NM_000038.5(APC):c.3691C>G (p.Leu1231Val) rs573020080
NM_000038.5(APC):c.3732A>G (p.Gln1244=) rs74380081
NM_000038.5(APC):c.3739G>A (p.Ala1247Thr) rs148223181
NM_000038.5(APC):c.3750A>G (p.Lys1250=) rs142728143
NM_000038.5(APC):c.3786T>C (p.Tyr1262=) rs147411334
NM_000038.5(APC):c.379A>G (p.Ser127Gly) rs200089324
NM_000038.5(APC):c.3815C>G (p.Ser1272Ter) rs863225348
NM_000038.5(APC):c.3837T>G (p.Ser1279=) rs1057522493
NM_000038.5(APC):c.385G>C (p.Glu129Gln) rs376628500
NM_000038.5(APC):c.388A>G (p.Ser130Gly) rs150973053
NM_000038.5(APC):c.3909A>G (p.Gln1303=) rs746289994
NM_000038.5(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000038.5(APC):c.3927_3931delAAAGA (p.Glu1309Aspfs) rs121913224
NM_000038.5(APC):c.3949G>C (p.Glu1317Gln) rs1801166
NM_000038.5(APC):c.3963C>T (p.Ser1321=) rs150595875
NM_000038.5(APC):c.4134G>A (p.Gln1378=) rs780368623
NM_000038.5(APC):c.420G>C (p.Glu140Asp) rs202161017
NM_000038.5(APC):c.4212C>A (p.Ser1404=) rs144655979
NM_000038.5(APC):c.4212C>T (p.Ser1404=) rs144655979
NM_000038.5(APC):c.423-16A>T rs78919815
NM_000038.5(APC):c.423-3T>A rs587782293
NM_000038.5(APC):c.423-4delA rs730881230
NM_000038.5(APC):c.4237A>G (p.Met1413Val) rs141519952
NM_000038.5(APC):c.4311A>G (p.Lys1437=) rs371784771
NM_000038.5(APC):c.4326T>A (p.Pro1442=) rs67622085
NM_000038.5(APC):c.4333A>G (p.Thr1445Ala) rs587780597
NM_000038.5(APC):c.4336G>A (p.Ala1446Thr) rs146572883
NM_000038.5(APC):c.4349G>A (p.Arg1450Gln) rs587782678
NM_000038.5(APC):c.4360A>G (p.Lys1454Glu) rs111866410
NM_000038.5(APC):c.4372C>T (p.Pro1458Ser) rs143796828
NM_000038.5(APC):c.4375_4377delACT (p.Thr1459del) rs386833393
NM_000038.5(APC):c.4376C>G (p.Thr1459Ser) rs756048549
NM_000038.5(APC):c.4413A>G (p.Ala1471=) rs964029262
NM_000038.5(APC):c.4416A>T (p.Val1472=) rs773352404
NM_000038.5(APC):c.4420G>A (p.Ala1474Thr) rs139387758
NM_000038.5(APC):c.4479G>A (p.Thr1493=) rs41115
NM_000038.5(APC):c.450A>G (p.Lys150=) rs116020626
NM_000038.5(APC):c.4533C>T (p.Leu1511=) rs150089434
NM_000038.5(APC):c.4669A>G (p.Ile1557Val) rs763578917
NM_000038.5(APC):c.4711_4713delGAT (p.Asp1571del) rs587782888
NM_000038.5(APC):c.4765C>G (p.Arg1589Gly) rs72541813
NM_000038.5(APC):c.4765C>T (p.Arg1589Cys) rs72541813
NM_000038.5(APC):c.4833G>A (p.Gln1611=) rs762030106
NM_000038.5(APC):c.4893T>C (p.Ser1631=) rs35634377
NM_000038.5(APC):c.4905G>A (p.Gly1635=) rs137988845
NM_000038.5(APC):c.4913T>C (p.Met1638Thr) rs201797422
NM_000038.5(APC):c.4919G>A (p.Arg1640Gln) rs529480958
NM_000038.5(APC):c.5009C>T (p.Ala1670Val) rs202228932
NM_000038.5(APC):c.5025T>G (p.Val1675=) rs876658169
NM_000038.5(APC):c.5026A>G (p.Arg1676Gly) rs370560998
NM_000038.5(APC):c.5027G>C (p.Arg1676Thr) rs143674116
NM_000038.5(APC):c.5034G>A (p.Gly1678=) rs42427
NM_000038.5(APC):c.5140G>A (p.Asp1714Asn) rs148275069
NM_000038.5(APC):c.5147A>G (p.Asn1716Ser) rs141298709
NM_000038.5(APC):c.5181C>T (p.Cys1727=) rs1554086499
NM_000038.5(APC):c.5225G>A (p.Arg1742His) rs199775075
NM_000038.5(APC):c.5250C>G (p.Val1750=) rs2229997
NM_000038.5(APC):c.5264C>T (p.Ala1755Val) rs771967537
NM_000038.5(APC):c.5265G>A (p.Ala1755=) rs34506289
NM_000038.5(APC):c.5268T>A (p.Ser1756=) rs866006
NM_000038.5(APC):c.5268T>G (p.Ser1756=) rs866006
NM_000038.5(APC):c.5271T>C (p.Ser1757=) rs752875511
NM_000038.5(APC):c.5274T>A (p.Ser1758=) rs199600387
NM_000038.5(APC):c.5298T>C (p.Asp1766=) rs781533317
NM_000038.5(APC):c.5304G>A (p.Lys1768=) rs863224285
NM_000038.5(APC):c.532-14_532-12delATT rs765893314
NM_000038.5(APC):c.532-9delT rs777844116
NM_000038.5(APC):c.5363G>A (p.Arg1788His) rs201472075
NM_000038.5(APC):c.537C>A (p.Ser179=) rs149736402
NM_000038.5(APC):c.5392A>G (p.Asn1798Asp) rs200794097
NM_000038.5(APC):c.53T>A (p.Met18Lys) rs200960071
NM_000038.5(APC):c.5424_5426delCAA (p.Asn1808del) rs587782002
NM_000038.5(APC):c.5506G>A (p.Gly1836Arg) rs766739164
NM_000038.5(APC):c.5571A>C (p.Ser1857=) rs376624613
NM_000038.5(APC):c.5635G>T (p.Ala1879Ser) rs587779799
NM_000038.5(APC):c.564A>G (p.Gln188=) rs377493489
NM_000038.5(APC):c.565T>C (p.Leu189=) rs762146761
NM_000038.5(APC):c.5690A>C (p.His1897Pro) rs112610898
NM_000038.5(APC):c.5708A>G (p.Asn1903Ser) rs750404000
NM_000038.5(APC):c.5737A>G (p.Ile1913Val) rs1554086935
NM_000038.5(APC):c.573T>C (p.Tyr191=) rs185154886
NM_000038.5(APC):c.5752A>G (p.Ile1918Val) rs776966222
NM_000038.5(APC):c.5790A>G (p.Gln1930=) rs141152252
NM_000038.5(APC):c.5801C>T (p.Pro1934Leu) rs587780600
NM_000038.5(APC):c.5805G>A (p.Gln1935=) rs377040690
NM_000038.5(APC):c.5880G>A (p.Pro1960=) rs465899
NM_000038.5(APC):c.5912C>G (p.Ser1971Cys) rs754691867
NM_000038.5(APC):c.607C>G (p.Gln203Glu) rs141576417
NM_000038.5(APC):c.6135C>T (p.Ser2045=) rs187297940
NM_000038.5(APC):c.6219T>G (p.Gly2073=) rs766559927
NM_000038.5(APC):c.6363_6365dupTGC (p.Ala2122_Cys2123insAla) rs587780602
NM_000038.5(APC):c.6387G>A (p.Ser2129=) rs374310157
NM_000038.5(APC):c.646-8T>A rs879254149
NM_000038.5(APC):c.647G>A (p.Arg216Gln) rs76685252
NM_000038.5(APC):c.6492C>T (p.Gly2164=) rs765332758
NM_000038.5(APC):c.6510A>C (p.Pro2170=) rs138571760
NM_000038.5(APC):c.6525A>G (p.Thr2175=) rs200151646
NM_000038.5(APC):c.6526T>C (p.Leu2176=) rs183468041
NM_000038.5(APC):c.6554G>A (p.Ser2185Asn) rs764255983
NM_000038.5(APC):c.6609T>C (p.Val2203=) rs149328018
NM_000038.5(APC):c.6639G>A (p.Met2213Ile) rs35540155
NM_000038.5(APC):c.6669A>G (p.Ser2223=) rs372680843
NM_000038.5(APC):c.6679G>T (p.Gly2227Cys) rs367905430
NM_000038.5(APC):c.6724A>G (p.Ser2242Gly) rs201375478
NM_000038.5(APC):c.6750C>T (p.Gly2250=) rs555799753
NM_000038.5(APC):c.6821C>T (p.Ala2274Val) rs34919187
NM_000038.5(APC):c.6857C>T (p.Ala2286Val) rs200587641
NM_000038.5(APC):c.6873A>T (p.Gln2291His) rs148878262
NM_000038.5(APC):c.6907G>A (p.Gly2303Arg) rs544549596
NM_000038.5(APC):c.6921G>A (p.Ser2307=) rs2229993
NM_000038.5(APC):c.6948A>G (p.Pro2316=) rs202144406
NM_000038.5(APC):c.695G>A (p.Arg232Gln) rs201727026
NM_000038.5(APC):c.6965A>G (p.Gln2322Arg) rs1057517549
NM_000038.5(APC):c.6985A>G (p.Ile2329Val) rs146048493
NM_000038.5(APC):c.7020C>T (p.Asn2340=) rs773108684
NM_000038.5(APC):c.7032A>G (p.Gln2344=) rs753728632
NM_000038.5(APC):c.7036C>T (p.Pro2346Ser) rs200756935
NM_000038.5(APC):c.705A>G (p.Leu235=) rs147036141
NM_000038.5(APC):c.7095A>G (p.Ser2365=) rs747844776
NM_000038.5(APC):c.70C>T (p.Arg24Ter) rs145945630
NM_000038.5(APC):c.7109G>T (p.Gly2370Val) rs140079759
NM_000038.5(APC):c.7137C>G (p.Thr2379=) rs141454910
NM_000038.5(APC):c.7182T>C (p.Ser2394=) rs777420141
NM_000038.5(APC):c.7201C>T (p.Leu2401=) rs2229994
NM_000038.5(APC):c.7209G>A (p.Gln2403=) rs769603145
NM_000038.5(APC):c.721G>A (p.Glu241Lys) rs777603154
NM_000038.5(APC):c.7395T>C (p.Leu2465=) rs369906346
NM_000038.5(APC):c.7399C>A (p.Pro2467Thr) rs372305287
NM_000038.5(APC):c.7415C>T (p.Ala2472Val) rs200399245
NM_000038.5(APC):c.7490C>T (p.Ser2497Leu) rs141010008
NM_000038.5(APC):c.7504G>A (p.Gly2502Ser) rs2229995
NM_000038.5(APC):c.7513C>G (p.Arg2505Gly) rs79630786
NM_000038.5(APC):c.7514G>A (p.Arg2505Gln) rs147549623
NM_000038.5(APC):c.7543A>G (p.Ile2515Val) rs554356011
NM_000038.5(APC):c.756C>T (p.Thr252=) rs771535363
NM_000038.5(APC):c.7574G>A (p.Arg2525His) rs762034315
NM_000038.5(APC):c.757G>A (p.Gly253Ser) rs772806807
NM_000038.5(APC):c.7621A>G (p.Ile2541Val) rs587778033
NM_000038.5(APC):c.7625A>G (p.Asn2542Ser) rs151163793
NM_000038.5(APC):c.7632A>G (p.Ser2544=) rs749324187
NM_000038.5(APC):c.7645C>T (p.Arg2549Cys) rs199539353
NM_000038.5(APC):c.7696A>C (p.Arg2566=) rs1060504883
NM_000038.5(APC):c.7704A>G (p.Gly2568=) rs35043160
NM_000038.5(APC):c.7717A>G (p.Ile2573Val) rs145444830
NM_000038.5(APC):c.7731A>G (p.Ser2577=) rs537187449
NM_000038.5(APC):c.7766A>G (p.Glu2589Gly) rs200406572
NM_000038.5(APC):c.7778A>G (p.Asn2593Ser) rs367676584
NM_000038.5(APC):c.777G>T (p.Arg259=) rs147704593
NM_000038.5(APC):c.7781C>G (p.Ser2594Cys) rs543396310
NM_000038.5(APC):c.7786T>G (p.Ser2596Ala) rs138137162
NM_000038.5(APC):c.7821C>T (p.Ser2607=) rs532235331
NM_000038.5(APC):c.7833A>G (p.Thr2611=) rs1057520909
NM_000038.5(APC):c.7858T>A (p.Phe2620Ile) rs587781816
NM_000038.5(APC):c.7862C>G (p.Ser2621Cys) rs72541816
NM_000038.5(APC):c.7878T>G (p.Thr2626=) rs757020188
NM_000038.5(APC):c.7888G>A (p.Val2630Ile) rs199688874
NM_000038.5(APC):c.7903A>G (p.Thr2635Ala) rs886059799
NM_000038.5(APC):c.7929A>G (p.Leu2643=) rs138796072
NM_000038.5(APC):c.7977G>A (p.Val2659=) rs1392424178
NM_000038.5(APC):c.7986G>A (p.Glu2662=) rs571645304
NM_000038.5(APC):c.8008A>C (p.Arg2670=) rs756875223
NM_000038.5(APC):c.8010A>G (p.Arg2670=) rs786201524
NM_000038.5(APC):c.8042C>T (p.Pro2681Leu) rs182456139
NM_000038.5(APC):c.8043G>A (p.Pro2681=) rs149347068
NM_000038.5(APC):c.8043G>C (p.Pro2681=) rs149347068
NM_000038.5(APC):c.8061A>G (p.Ser2687=) rs746180965
NM_000038.5(APC):c.8068G>A (p.Ala2690Thr) rs140868933
NM_000038.5(APC):c.8100T>C (p.Asn2700=) rs761326128
NM_000038.5(APC):c.8141G>A (p.Arg2714His) rs747362422
NM_000038.5(APC):c.8146G>A (p.Val2716Met) rs587778044
NM_000038.5(APC):c.8199A>G (p.Gln2733=) rs372365378
NM_000038.5(APC):c.8213T>C (p.Ile2738Thr) rs863224552
NM_000038.5(APC):c.8261G>A (p.Ser2754Asn) rs369721828
NM_000038.5(APC):c.8266A>G (p.Ile2756Val) rs146115809
NM_000038.5(APC):c.8325G>A (p.Gly2775=) rs770719841
NM_000038.5(APC):c.8332G>T (p.Ala2778Ser) rs587778046
NM_000038.5(APC):c.835-3T>C rs372090940
NM_000038.5(APC):c.835-4T>G rs756807560
NM_000038.5(APC):c.8383G>A (p.Ala2795Thr) rs369264968
NM_000038.5(APC):c.8389A>G (p.Ser2797Gly) rs147287751
NM_000038.5(APC):c.8416C>G (p.Pro2806Ala) rs587780608
NM_000038.5(APC):c.841A>G (p.Thr281Ala) rs769727966
NM_000038.5(APC):c.8429A>G (p.Asn2810Ser) rs758044862
NM_000038.5(APC):c.848G>A (p.Arg283Gln) rs149154604
NM_000038.5(APC):c.933+5C>A rs573528468
NM_000038.5(APC):c.934-2A>G rs1554079938
NM_000038.5(APC):c.937_938delGA (p.Glu313Asnfs) rs387906239
NM_000038.5(APC):c.95A>G (p.Asn32Ser) rs539108537
NM_000038.6(APC):c.5465T>A (p.Val1822Asp) rs459552
NM_000051.3(ATM):c.-14T>C
NM_000051.3(ATM):c.1010G>A (p.Arg337His) rs202160435
NM_000051.3(ATM):c.1021G>A (p.Val341Ile) rs200601781
NM_000051.3(ATM):c.1027_1030delGAAA rs587780612
NM_000051.3(ATM):c.103C>A (p.Arg35=) rs55861249
NM_000051.3(ATM):c.103C>T (p.Arg35Ter) rs55861249
NM_000051.3(ATM):c.1065+1G>T rs201089102
NM_000051.3(ATM):c.1066-6T>G rs201686625
NM_000051.3(ATM):c.1073A>G (p.Asn358Ser) rs149636614
NM_000051.3(ATM):c.1082C>A (p.Thr361Asn)
NM_000051.3(ATM):c.1132A>G (p.Ser378Gly) rs587779811
NM_000051.3(ATM):c.1138T>A (p.Tyr380Asn) rs34083085
NM_000051.3(ATM):c.1176C>G (p.Gly392=) rs1800727
NM_000051.3(ATM):c.1215delT (p.Asn405Lysfs) rs1555069815
NM_000051.3(ATM):c.1229T>C (p.Val410Ala) rs56128736
NM_000051.3(ATM):c.1235+5A>T rs1064793679
NM_000051.3(ATM):c.1236-2A>G rs80159221
NM_000051.3(ATM):c.1236-3dupT rs34325032
NM_000051.3(ATM):c.1254A>G (p.Gln418=) rs4987943
NM_000051.3(ATM):c.125A>G (p.His42Arg) rs201773026
NM_000051.3(ATM):c.1272T>C (p.Pro424=) rs35578748
NM_000051.3(ATM):c.1332C>A (p.Pro444=) rs763361384
NM_000051.3(ATM):c.1335A>G (p.Gln445=) rs1385656085
NM_000051.3(ATM):c.1339C>T (p.Arg447Ter) rs587779815
NM_000051.3(ATM):c.1355delC (p.Thr452Asnfs) rs587781776
NM_000051.3(ATM):c.1368A>G (p.Leu456=) rs750579940
NM_000051.3(ATM):c.1380G>C (p.Thr460=) rs145333518
NM_000051.3(ATM):c.138T>C (p.His46=) rs770834907
NM_000051.3(ATM):c.1402_1403delAA (p.Lys468Glufs) rs587781347
NM_000051.3(ATM):c.1442T>G (p.Leu481Ter) rs1555070980
NM_000051.3(ATM):c.1464G>T (p.Trp488Cys) rs377597949
NM_000051.3(ATM):c.146C>G (p.Ser49Cys) rs1800054
NM_000051.3(ATM):c.1511A>G (p.Asn504Ser) rs56365018
NM_000051.3(ATM):c.1541G>A (p.Gly514Asp) rs2235000
NM_000051.3(ATM):c.1595G>A (p.Cys532Tyr) rs35963548
NM_000051.3(ATM):c.1608-19G>T rs773158102
NM_000051.3(ATM):c.1608-3T>C rs774196176
NM_000051.3(ATM):c.162T>C (p.Tyr54=) rs3218690
NM_000051.3(ATM):c.1636C>G (p.Leu546Val) rs2227924
NM_000051.3(ATM):c.1648A>G (p.Ile550Val) rs202144949
NM_000051.3(ATM):c.1695A>G (p.Glu565=) rs780932013
NM_000051.3(ATM):c.1703G>T (p.Arg568Ile) rs200381392
NM_000051.3(ATM):c.1744T>C (p.Phe582Leu) rs2235006
NM_000051.3(ATM):c.1773T>C (p.Asn591=) rs61734356
NM_000051.3(ATM):c.1800C>T (p.His600=) rs750715942
NM_000051.3(ATM):c.1810C>T (p.Pro604Ser) rs2227922
NM_000051.3(ATM):c.1855A>C (p.Asn619His) rs140882609
NM_000051.3(ATM):c.186A>G (p.Arg62=) rs876658224
NM_000051.3(ATM):c.1887C>T (p.Ser629=) rs143097772
NM_000051.3(ATM):c.1888G>A (p.Val630Met) rs148191382
NM_000051.3(ATM):c.1898+2T>G rs587782124
NM_000051.3(ATM):c.1902A>G (p.Glu634=) rs1060501633
NM_000051.3(ATM):c.1953A>G (p.Leu651=) rs730881283
NM_000051.3(ATM):c.1960C>A (p.Gln654Lys) rs528165789
NM_000051.3(ATM):c.1986T>C (p.Phe662=) rs1800055
NM_000051.3(ATM):c.198A>G (p.Lys66=) rs540920248
NM_000051.3(ATM):c.2019G>A (p.Lys673=) rs786203021
NM_000051.3(ATM):c.2021A>G (p.His674Arg) rs201762714
NM_000051.3(ATM):c.202A>G (p.Ile68Val) rs35389822
NM_000051.3(ATM):c.2040C>T (p.Phe680=) rs587780855
NM_000051.3(ATM):c.2043T>A (p.Ser681=) rs746422877
NM_000051.3(ATM):c.2074C>T (p.Arg692Cys) rs765965513
NM_000051.3(ATM):c.2085G>A (p.Leu695=) rs786202229
NM_000051.3(ATM):c.2096A>G (p.Glu699Gly) rs147934285
NM_000051.3(ATM):c.2119T>C (p.Ser707Pro) rs4986761
NM_000051.3(ATM):c.2127T>C (p.Ile709=) rs56252953
NM_000051.3(ATM):c.2127T>G (p.Ile709Met) rs56252953
NM_000051.3(ATM):c.2181C>T (p.Gly727=) rs876658836
NM_000051.3(ATM):c.2187C>T (p.Tyr729=) rs373430058
NM_000051.3(ATM):c.2193C>T (p.Tyr731=) rs2229019
NM_000051.3(ATM):c.2220A>G (p.Ala740=) rs56353517
NM_000051.3(ATM):c.2222A>G (p.Tyr741Cys) rs878853492
NM_000051.3(ATM):c.2238C>T (p.Phe746=) rs786203595
NM_000051.3(ATM):c.2250G>A (p.Lys750=) rs1137887
NM_000051.3(ATM):c.2251-10T>G rs730881346
NM_000051.3(ATM):c.2262A>G (p.Gln754=) rs778320952
NM_000051.3(ATM):c.2284_2285delCT (p.Leu762Valfs) rs587781658
NM_000051.3(ATM):c.2289T>A (p.Phe763Leu) rs34231402
NM_000051.3(ATM):c.2346A>G (p.Leu782=) rs730881285
NM_000051.3(ATM):c.2355T>C (p.Arg785=) rs1555075801
NM_000051.3(ATM):c.2362A>C (p.Ser788Arg) rs641252
NM_000051.3(ATM):c.2376+20G>C rs140364468
NM_000051.3(ATM):c.2377-15_2377-12delTTGT rs730881298
NM_000051.3(ATM):c.2377-6T>A rs876660963
NM_000051.3(ATM):c.237delA (p.Lys79Asnfs) rs730881303
NM_000051.3(ATM):c.2396C>T (p.Ala799Val) rs199954262
NM_000051.3(ATM):c.2442C>A (p.Asp814Glu) rs3218695
NM_000051.3(ATM):c.2446_2447delGCinsCT (p.Ala816Leu) rs587781956
NM_000051.3(ATM):c.2466+7A>G rs55812024
NM_000051.3(ATM):c.2466A>G (p.Leu822=) rs747108452
NM_000051.3(ATM):c.2467-7C>T rs768850329
NM_000051.3(ATM):c.2476A>C (p.Ile826Leu) rs587782397
NM_000051.3(ATM):c.2494C>T (p.Arg832Cys) rs2229022
NM_000051.3(ATM):c.2495G>T (p.Arg832Leu) rs199875915
NM_000051.3(ATM):c.2522A>C (p.Asp841Ala) rs587781812
NM_000051.3(ATM):c.2531G>A (p.Gly844Glu) rs587781808
NM_000051.3(ATM):c.2572T>C (p.Phe858Leu) rs1800056
NM_000051.3(ATM):c.2577C>T (p.Asn859=) rs730881286
NM_000051.3(ATM):c.2598T>G (p.Val866=) rs730881350
NM_000051.3(ATM):c.2606C>G (p.Ala869Gly) rs145513717
NM_000051.3(ATM):c.2606_2607delCA (p.Ala869Glufs) rs1057516944
NM_000051.3(ATM):c.2608A>G (p.Asn870Asp) rs61734354
NM_000051.3(ATM):c.2610C>T (p.Asn870=) rs587780618
NM_000051.3(ATM):c.2614C>T (p.Pro872Ser) rs3218673
NM_000051.3(ATM):c.2630G>C (p.Ser877Thr) rs370269552
NM_000051.3(ATM):c.2638+2T>C rs587779826
NM_000051.3(ATM):c.2638+6T>C rs768305533
NM_000051.3(ATM):c.2685A>G (p.Leu895=) rs3218687
NM_000051.3(ATM):c.2716T>A (p.Leu906Met) rs368047468
NM_000051.3(ATM):c.2735A>G (p.Gln912Arg) rs730881353
NM_000051.3(ATM):c.2778A>G (p.Lys926=) rs372569168
NM_000051.3(ATM):c.2804C>T (p.Thr935Met) rs3218708
NM_000051.3(ATM):c.2805G>C (p.Thr935=) rs55934812
NM_000051.3(ATM):c.2836A>G (p.Met946Val) rs587781992
NM_000051.3(ATM):c.2838+10G>A rs1555083482
NM_000051.3(ATM):c.2838+9C>G rs370160823
NM_000051.3(ATM):c.2839-3_2839delinsGATACTA rs786202148
NM_000051.3(ATM):c.2839-4T>C rs1057522619
NM_000051.3(ATM):c.2859G>A (p.Glu953=) rs569489729
NM_000051.3(ATM):c.2880delC (p.Leu961Cysfs) rs730881300
NM_000051.3(ATM):c.2887A>G (p.Met963Val) rs374353016
NM_000051.3(ATM):c.2913A>G (p.Lys971=) rs1057522291
NM_000051.3(ATM):c.2919A>G (p.Leu973=) rs587779829
NM_000051.3(ATM):c.2921+1G>A rs587781558
NM_000051.3(ATM):c.2921+1G>C rs587781558
NM_000051.3(ATM):c.2921+1G>T rs587781558
NM_000051.3(ATM):c.2927T>C (p.Val976Ala) rs146145357
NM_000051.3(ATM):c.2932T>C (p.Ser978Pro) rs139552233
NM_000051.3(ATM):c.295A>G (p.Ser99Gly) rs137882485
NM_000051.3(ATM):c.2967T>C (p.Thr989=) rs144145128
NM_000051.3(ATM):c.2T>C (p.Met1Thr) rs786203606
NM_000051.3(ATM):c.3012C>T (p.Ser1004=) rs751260996
NM_000051.3(ATM):c.3014A>G (p.Asn1005Ser) rs146531614
NM_000051.3(ATM):c.3016A>G (p.Met1006Val) rs139893395
NM_000051.3(ATM):c.3077+4G>A rs201222237
NM_000051.3(ATM):c.3078-1G>A rs750663117
NM_000051.3(ATM):c.3118A>G (p.Met1040Val) rs3092857
NM_000051.3(ATM):c.3150T>C (p.Leu1050=) rs3092859
NM_000051.3(ATM):c.3153+20T>C rs200786429
NM_000051.3(ATM):c.3154-4G>A rs199543313
NM_000051.3(ATM):c.3154-5C>T rs55719759
NM_000051.3(ATM):c.3190A>G (p.Met1064Val) rs79431304
NM_000051.3(ATM):c.320G>A (p.Cys107Tyr) rs142358238
NM_000051.3(ATM):c.3237T>C (p.Ala1079=) rs564238520
NM_000051.3(ATM):c.3242A>G (p.Asn1081Ser) rs368111672
NM_000051.3(ATM):c.3283A>C (p.Arg1095=) rs876660302
NM_000051.3(ATM):c.3285-15C>T rs770928986
NM_000051.3(ATM):c.3285-9delT rs1799757
NM_000051.3(ATM):c.3295G>A (p.Asp1099Asn) rs372966951
NM_000051.3(ATM):c.3299C>T (p.Thr1100Met) rs189445371
NM_000051.3(ATM):c.3300G>A (p.Thr1100=) rs587780621
NM_000051.3(ATM):c.3303G>A (p.Lys1101=) rs925487325
NM_000051.3(ATM):c.332-3T>C rs376116157
NM_000051.3(ATM):c.3336T>A (p.Pro1112=) rs758784434
NM_000051.3(ATM):c.3342G>A (p.Lys1114=) rs138393322
NM_000051.3(ATM):c.334G>A (p.Ala112Thr) rs146382972
NM_000051.3(ATM):c.3352A>G (p.Thr1118Ala) rs572564322
NM_000051.3(ATM):c.3372C>G (p.Tyr1124Ter) rs587779833
NM_000051.3(ATM):c.3381_3384delTCAG (p.Gln1128Lysfs) rs587781971
NM_000051.3(ATM):c.3383A>G (p.Gln1128Arg) rs2229020
NM_000051.3(ATM):c.3402+16A>G rs763382531
NM_000051.3(ATM):c.3402+17T>C rs3092825
NM_000051.3(ATM):c.3402+5T>C rs1057520229
NM_000051.3(ATM):c.3403-14dupA rs3218681
NM_000051.3(ATM):c.3403-15T>A rs79701258
NM_000051.3(ATM):c.3403-3A>C rs374866638
NM_000051.3(ATM):c.3467C>T (p.Thr1156Met) rs759951393
NM_000051.3(ATM):c.3468G>A (p.Thr1156=) rs148358896
NM_000051.3(ATM):c.3517T>C (p.Leu1173=) rs141460670
NM_000051.3(ATM):c.3541A>T (p.Lys1181Ter) rs1057516981
NM_000051.3(ATM):c.3543A>G (p.Lys1181=) rs1555091382
NM_000051.3(ATM):c.3577-12delT rs730881288
NM_000051.3(ATM):c.3577-13T>C rs587780856
NM_000051.3(ATM):c.3577-6G>A rs56006345
NM_000051.3(ATM):c.3577-7C>T rs558667657
NM_000051.3(ATM):c.3588A>G (p.Lys1196=) rs376524625
NM_000051.3(ATM):c.3613C>T (p.Arg1205Cys) rs760928285
NM_000051.3(ATM):c.3614G>A (p.Arg1205His) rs769106895
NM_000051.3(ATM):c.3689A>G (p.Asn1230Ser) rs587782195
NM_000051.3(ATM):c.370A>G (p.Ile124Val) rs148590073
NM_000051.3(ATM):c.3712_3716delTTATT (p.Leu1238Lysfs) rs786201675
NM_000051.3(ATM):c.3747-10C>G rs775274473
NM_000051.3(ATM):c.3756T>A (p.Tyr1252Ter) rs886039637
NM_000051.3(ATM):c.378T>A (p.Asp126Glu) rs2234997
NM_000051.3(ATM):c.378delT (p.Asp126Glufs) rs587781449
NM_000051.3(ATM):c.3806A>G (p.Lys1269Arg) rs146017595
NM_000051.3(ATM):c.3831G>C (p.Glu1277Asp) rs587781787
NM_000051.3(ATM):c.387delA (p.Asp130Ilefs) rs745642834
NM_000051.3(ATM):c.3919G>A (p.Gly1307Arg) rs568451087
NM_000051.3(ATM):c.3925G>A (p.Ala1309Thr) rs149711770
NM_000051.3(ATM):c.3963G>A (p.Met1321Ile) rs35184530
NM_000051.3(ATM):c.3964C>A (p.Leu1322Ile) rs144535256
NM_000051.3(ATM):c.3993+1G>A rs200196781
NM_000051.3(ATM):c.3993+5G>T rs3092842
NM_000051.3(ATM):c.3994-11_3994-4delTGCCCTTG rs1060501665
NM_000051.3(ATM):c.3994-2A>G rs587782276
NM_000051.3(ATM):c.3G>A (p.Met1Ile) rs781404312
NM_000051.3(ATM):c.4050G>A (p.Thr1350=) rs770697446
NM_000051.3(ATM):c.4060C>A (p.Pro1354Thr) rs145119475
NM_000051.3(ATM):c.4066A>G (p.Asn1356Asp) rs147600485
NM_000051.3(ATM):c.4084_4085delAG (p.Ser1362Hisfs) rs886039488
NM_000051.3(ATM):c.4098_4099delTG (p.Cys1366Terfs) rs876658248
NM_000051.3(ATM):c.4109+6T>C rs368606937
NM_000051.3(ATM):c.4111delG (p.Asp1371Ilefs) rs797045114
NM_000051.3(ATM):c.411C>T (p.Tyr137=) rs756160533
NM_000051.3(ATM):c.4138C>T (p.His1380Tyr) rs3092856
NM_000051.3(ATM):c.4167A>G (p.Thr1389=) rs183214437
NM_000051.3(ATM):c.4236+11A>G rs368684533
NM_000051.3(ATM):c.4258C>T (p.Leu1420Phe) rs1800058
NM_000051.3(ATM):c.4279G>A (p.Ala1427Thr) rs2229021
NM_000051.3(ATM):c.42A>G (p.Gln14=) rs771378101
NM_000051.3(ATM):c.4324T>C (p.Tyr1442His) rs201666889
NM_000051.3(ATM):c.4332G>A (p.Leu1444=) rs753570046
NM_000051.3(ATM):c.4362A>C (p.Lys1454Asn) rs148993589
NM_000051.3(ATM):c.4365T>A (p.Ser1455Arg) rs527471560
NM_000051.3(ATM):c.4388T>G (p.Phe1463Cys) rs138327406
NM_000051.3(ATM):c.4402G>A (p.Val1468Ile) rs369903995
NM_000051.3(ATM):c.4424A>G (p.Tyr1475Cys) rs34640941
NM_000051.3(ATM):c.4437-5A>G rs876658290
NM_000051.3(ATM):c.4437-7A>G rs370354306
NM_000051.3(ATM):c.4473C>T (p.Phe1491=) rs4988008
NM_000051.3(ATM):c.4492T>C (p.Leu1498=) rs748949478
NM_000051.3(ATM):c.4578C>T (p.Pro1526=) rs1800889
NM_000051.3(ATM):c.4606A>G (p.Lys1536Glu) rs587779841
NM_000051.3(ATM):c.4611+9C>G rs760704159
NM_000051.3(ATM):c.4612-4T>G rs569983068
NM_000051.3(ATM):c.4626G>A (p.Leu1542=) rs786202784
NM_000051.3(ATM):c.4629A>G (p.Lys1543=) rs745565564
NM_000051.3(ATM):c.4665C>T (p.Leu1555=) rs374431061
NM_000051.3(ATM):c.4674G>A (p.Thr1558=) rs876658474
NM_000051.3(ATM):c.4703A>G (p.His1568Arg) rs368830730
NM_000051.3(ATM):c.4709T>C (p.Val1570Ala) rs140856217
NM_000051.3(ATM):c.4735C>T (p.Gln1579Ter) rs869312755
NM_000051.3(ATM):c.4753A>G (p.Arg1585Gly) rs781275128
NM_000051.3(ATM):c.4776+1G>T rs771117943
NM_000051.3(ATM):c.4776+2_4776+13delTAATAAAAATTT rs762838462
NM_000051.3(ATM):c.478_482delTCTCA (p.Ser160Alafs) rs587780624
NM_000051.3(ATM):c.4802G>A (p.Ser1601Asn) rs587782506
NM_000051.3(ATM):c.4853G>A (p.Arg1618Gln) rs765759912
NM_000051.3(ATM):c.48A>G (p.Glu16=) rs774768437
NM_000051.3(ATM):c.4909+3G>A rs778685122
NM_000051.3(ATM):c.4910A>G (p.Asp1637Gly) rs763457172
NM_000051.3(ATM):c.4949A>G (p.Asn1650Ser) rs55870064
NM_000051.3(ATM):c.496+18T>A rs762171014
NM_000051.3(ATM):c.496+4T>C rs587781375
NM_000051.3(ATM):c.496+5G>A rs796051858
NM_000051.3(ATM):c.497-4T>A rs876659621
NM_000051.3(ATM):c.4980C>T (p.Asn1660=) rs144338238
NM_000051.3(ATM):c.5005+15T>A rs377355762
NM_000051.3(ATM):c.5005+7_5005+8delTA rs587780626
NM_000051.3(ATM):c.5005+9C>T rs730881291
NM_000051.3(ATM):c.5071A>C (p.Ser1691Arg) rs1800059
NM_000051.3(ATM):c.5089A>G (p.Thr1697Ala) rs142455912
NM_000051.3(ATM):c.5177+5G>A rs759373136
NM_000051.3(ATM):c.5178-4dup rs747750958
NM_000051.3(ATM):c.5185G>C (p.Val1729Leu) rs3092907
NM_000051.3(ATM):c.5188C>T (p.Arg1730Ter) rs764389018
NM_000051.3(ATM):c.5228C>T (p.Thr1743Ile) rs587779844
NM_000051.3(ATM):c.5290delC (p.Leu1764Tyrfs) rs587779846
NM_000051.3(ATM):c.5319+6_5319+7delTT rs777478613
NM_000051.3(ATM):c.5319+7T>A rs925428128
NM_000051.3(ATM):c.5320-10T>C rs864622731
NM_000051.3(ATM):c.5352C>T (p.Asn1784=) rs140641762
NM_000051.3(ATM):c.544G>C (p.Val182Leu) rs3218707
NM_000051.3(ATM):c.5475A>G (p.Gln1825=) rs1555106560
NM_000051.3(ATM):c.5488A>G (p.Met1830Val) rs587781622
NM_000051.3(ATM):c.5497-2A>C rs786203796
NM_000051.3(ATM):c.5497-8T>C rs3092829
NM_000051.3(ATM):c.5515C>T (p.Gln1839Ter) rs786204751
NM_000051.3(ATM):c.5550A>G (p.Leu1850=) rs35850088
NM_000051.3(ATM):c.5557G>A (p.Asp1853Asn) rs1801516
NM_000051.3(ATM):c.5558A>T (p.Asp1853Val) rs1801673
NM_000051.3(ATM):c.5595T>C (p.His1865=) rs772261410
NM_000051.3(ATM):c.5618G>A (p.Cys1873Tyr) rs587782239
NM_000051.3(ATM):c.5630T>C (p.Phe1877Ser) rs202028401
NM_000051.3(ATM):c.5644C>T (p.Arg1882Ter) rs786204433
NM_000051.3(ATM):c.5674+6C>G rs780204400
NM_000051.3(ATM):c.5675-4T>A rs56075338
NM_000051.3(ATM):c.5693G>A (p.Arg1898Gln) rs370680798
NM_000051.3(ATM):c.5712dupA (p.Ser1905Ilefs) rs587781730
NM_000051.3(ATM):c.5762+6G>A rs776532221
NM_000051.3(ATM):c.5762_5763insNG_009830.1:g.91138_91274 rs774925473
NM_000051.3(ATM):c.5793T>C (p.Ala1931=) rs3092910
NM_000051.3(ATM):c.5890A>G (p.Lys1964Glu) rs201963507
NM_000051.3(ATM):c.5890A>T (p.Lys1964Ter) rs201963507
NM_000051.3(ATM):c.5894_5900dupAAAGTAT (p.Met1967Ilefs) rs1555110517
NM_000051.3(ATM):c.5961T>G (p.Ser1987=) rs1060504265
NM_000051.3(ATM):c.5975A>C (p.Lys1992Thr) rs150757822
NM_000051.3(ATM):c.601C>T (p.Gln201Ter) rs886039666
NM_000051.3(ATM):c.6040G>T (p.Glu2014Ter) rs375783941
NM_000051.3(ATM):c.6056A>G (p.Tyr2019Cys) rs876658415
NM_000051.3(ATM):c.6067G>A (p.Gly2023Arg) rs11212587
NM_000051.3(ATM):c.6088A>G (p.Ile2030Val) rs145847315
NM_000051.3(ATM):c.6095+15T>C rs3212321
NM_000051.3(ATM):c.6095+8G>T rs547072690
NM_000051.3(ATM):c.6095G>A (p.Arg2032Lys) rs139770721
NM_000051.3(ATM):c.609C>T (p.Asp203=) rs144709948
NM_000051.3(ATM):c.6100C>A (p.Arg2034=) rs532480170
NM_000051.3(ATM):c.6100C>T (p.Arg2034Ter) rs532480170
NM_000051.3(ATM):c.6108T>C (p.Tyr2036=) rs3092826
NM_000051.3(ATM):c.6114C>T (p.His2038=) rs774993357
NM_000051.3(ATM):c.6115G>A (p.Glu2039Lys) rs864622251
NM_000051.3(ATM):c.6154G>A (p.Glu2052Lys) rs202206540
NM_000051.3(ATM):c.6176C>T (p.Thr2059Ile) rs144761622
NM_000051.3(ATM):c.6179G>A (p.Arg2060His) rs376521407
NM_000051.3(ATM):c.6198+5A>G rs771047560
NM_000051.3(ATM):c.6200C>A (p.Ala2067Asp) rs397514577
NM_000051.3(ATM):c.6234C>T (p.Ser2078=) rs569483748
NM_000051.3(ATM):c.6235G>A (p.Val2079Ile) rs1800060
NM_000051.3(ATM):c.6246A>G (p.Lys2082=) rs745977589
NM_000051.3(ATM):c.6330C>T (p.Asp2110=) rs759029705
NM_000051.3(ATM):c.6333T>C (p.His2111=) rs55756349
NM_000051.3(ATM):c.6338C>G (p.Thr2113Ser) rs573290117
NM_000051.3(ATM):c.6347+19delT rs58978479
NM_000051.3(ATM):c.6382T>C (p.Leu2128=) rs753646931
NM_000051.3(ATM):c.6396A>G (p.Leu2132=) rs370537345
NM_000051.3(ATM):c.6399A>G (p.Gln2133=) rs750614487
NM_000051.3(ATM):c.6404_6405insTT (p.Arg2136Terfs) rs587782554
NM_000051.3(ATM):c.6437G>C (p.Ser2146Thr) rs56815840
NM_000051.3(ATM):c.6443A>G (p.Lys2148Arg) rs730881382
NM_000051.3(ATM):c.6465G>A (p.Val2155=) rs140423883
NM_000051.3(ATM):c.6486C>T (p.Ser2162=) rs138166710
NM_000051.3(ATM):c.6543G>T (p.Glu2181Asp) rs138828590
NM_000051.3(ATM):c.6552C>T (p.Ser2184=) rs565124064
NM_000051.3(ATM):c.6572+12G>T rs3218677
NM_000051.3(ATM):c.6572+4T>C rs587780636
NM_000051.3(ATM):c.657T>C (p.Cys219=) rs2235003
NM_000051.3(ATM):c.660G>A (p.Ala220=) rs763669136
NM_000051.3(ATM):c.6700C>T (p.Leu2234=) rs760602228
NM_000051.3(ATM):c.6795C>T (p.Phe2265=) rs3218699
NM_000051.3(ATM):c.6820G>A (p.Ala2274Thr) rs567060474
NM_000051.3(ATM):c.6850delG (p.Val2284Leufs) rs876659569
NM_000051.3(ATM):c.6860G>C (p.Gly2287Ala) rs1800061
NM_000051.3(ATM):c.6888A>T (p.Ala2296=) rs200735689
NM_000051.3(ATM):c.6891A>G (p.Gln2297=) rs773545588
NM_000051.3(ATM):c.6919C>T (p.Leu2307Phe) rs56009889
NM_000051.3(ATM):c.6975+13delT rs763287238
NM_000051.3(ATM):c.6975+13dupT rs763287238
NM_000051.3(ATM):c.6975+2T>C rs879254199
NM_000051.3(ATM):c.6975G>A (p.Ala2325=) rs556778314
NM_000051.3(ATM):c.6988C>G (p.Leu2330Val) rs148432863
NM_000051.3(ATM):c.6995T>C (p.Leu2332Pro) rs4988111
NM_000051.3(ATM):c.6997dupA (p.Thr2333Asnfs) rs587781299
NM_000051.3(ATM):c.6998C>A (p.Thr2333Lys) rs150503164
NM_000051.3(ATM):c.6998C>T (p.Thr2333Ile) rs150503164
NM_000051.3(ATM):c.69A>G (p.Arg23=) rs876659304
NM_000051.3(ATM):c.7000_7003delTACA (p.Tyr2334Glnfs) rs786203421
NM_000051.3(ATM):c.702A>G (p.Ala234=) rs752751588
NM_000051.3(ATM):c.7038A>G (p.Ala2346=) rs146167034
NM_000051.3(ATM):c.7038A>T (p.Ala2346=) rs146167034
NM_000051.3(ATM):c.7044G>A (p.Thr2348=) rs140104789
NM_000051.3(ATM):c.7187C>G (p.Thr2396Ser) rs370559102
NM_000051.3(ATM):c.7224G>A (p.Ser2408=) rs145747513
NM_000051.3(ATM):c.7271T>G (p.Val2424Gly) rs28904921
NM_000051.3(ATM):c.7308-10T>C rs745319720
NM_000051.3(ATM):c.7313C>T (p.Thr2438Ile) rs147604227
NM_000051.3(ATM):c.7327C>T (p.Arg2443Ter) rs121434220
NM_000051.3(ATM):c.7328G>A (p.Arg2443Gln) rs587782310
NM_000051.3(ATM):c.7358G>A (p.Arg2453His) rs587781361
NM_000051.3(ATM):c.735C>T (p.Val245=) rs3218674
NM_000051.3(ATM):c.7390T>C (p.Cys2464Arg) rs55801750
NM_000051.3(ATM):c.742C>T (p.Arg248Ter) rs730881336
NM_000051.3(ATM):c.7475T>G (p.Leu2492Arg) rs56399857
NM_000051.3(ATM):c.7494T>C (p.Ser2498=) rs34393781
NM_000051.3(ATM):c.749G>A (p.Arg250Gln) rs56123940
NM_000051.3(ATM):c.7515+20A>G rs80124497
NM_000051.3(ATM):c.7516-9delT rs573494809
NM_000051.3(ATM):c.7618G>A (p.Val2540Ile) rs35203200
NM_000051.3(ATM):c.7629+12_7629+15delTGAA rs1555124156
NM_000051.3(ATM):c.7629+13G>A rs563651647
NM_000051.3(ATM):c.7630-17T>C rs116047570
NM_000051.3(ATM):c.7630-3C>T rs587782448
NM_000051.3(ATM):c.7638_7646delTAGAATTTC (p.Arg2547_Ser2549del) rs587776547
NM_000051.3(ATM):c.7705_7706delGA (p.Asp2569Terfs) rs759965045
NM_000051.3(ATM):c.7740A>C (p.Arg2580Ser) rs199915459
NM_000051.3(ATM):c.7757A>G (p.Asn2586Ser) rs587778079
NM_000051.3(ATM):c.7788+7G>A rs749610251
NM_000051.3(ATM):c.7788+8G>T rs112775908
NM_000051.3(ATM):c.7788G>A (p.Glu2596=) rs587780639
NM_000051.3(ATM):c.7789-3T>G rs864622185
NM_000051.3(ATM):c.7792C>T (p.Arg2598Ter) rs138941496
NM_000051.3(ATM):c.7816A>G (p.Ile2606Val) rs376824528
NM_000051.3(ATM):c.7875_7876delTGinsGC (p.Asp2625_Ala2626delinsGluPro) rs267606668
NM_000051.3(ATM):c.7913G>A (p.Trp2638Ter) rs377349459
NM_000051.3(ATM):c.7919C>T (p.Thr2640Ile) rs4988125
NM_000051.3(ATM):c.7927+10T>C rs730881277
NM_000051.3(ATM):c.7927+6dupT rs587781324
NM_000051.3(ATM):c.7928-10T>C rs188404773
NM_000051.3(ATM):c.7983T>C (p.Asp2661=) rs143972422
NM_000051.3(ATM):c.7988T>C (p.Val2663Ala) rs377648506
NM_000051.3(ATM):c.7998dupT (p.Met2667Tyrfs) rs587779869
NM_000051.3(ATM):c.8011-6T>G rs762092284
NM_000051.3(ATM):c.8046T>C (p.Thr2682=) rs876660435
NM_000051.3(ATM):c.8100A>G (p.Lys2700=) rs778601472
NM_000051.3(ATM):c.8122G>A (p.Asp2708Asn) rs587782719
NM_000051.3(ATM):c.8147T>C (p.Val2716Ala) rs587782652
NM_000051.3(ATM):c.8151+11C>T rs555381912
NM_000051.3(ATM):c.8152-6C>T rs200389039
NM_000051.3(ATM):c.8185C>T (p.Gln2729Ter) rs587781967
NM_000051.3(ATM):c.8217G>A (p.Leu2739=) rs759069006
NM_000051.3(ATM):c.8266A>T (p.Lys2756Ter) rs371638537
NM_000051.3(ATM):c.8268+6T>A rs747153940
NM_000051.3(ATM):c.8269-10_8269-9delGT rs587780641
NM_000051.3(ATM):c.829G>T (p.Glu277Ter) rs876660933
NM_000051.3(ATM):c.8307G>A (p.Trp2769Ter) rs778269655
NM_000051.3(ATM):c.8353G>A (p.Asp2785Asn) rs587782417
NM_000051.3(ATM):c.8355T>C (p.Asp2785=) rs372834825
NM_000051.3(ATM):c.8371_8374delTACA (p.Tyr2791Glyfs) rs1064793046
NM_000051.3(ATM):c.8391T>C (p.Ser2797=) rs566485657
NM_000051.3(ATM):c.8395_8404delTTTCAGTGCC (p.Phe2799Lysfs) rs786202800
NM_000051.3(ATM):c.8418+13C>T rs372552946
NM_000051.3(ATM):c.8419-16_8419-13delTATT rs774275044
NM_000051.3(ATM):c.8419-19A>G rs12279930
NM_000051.3(ATM):c.8480T>G (p.Phe2827Cys) rs121434216
NM_000051.3(ATM):c.8494C>T (p.Arg2832Cys) rs587779872
NM_000051.3(ATM):c.8518T>C (p.Leu2840=) rs794727769
NM_000051.3(ATM):c.8532T>C (p.Ile2844=) rs730881278
NM_000051.3(ATM):c.8549T>A (p.Leu2850Ter) rs876658716
NM_000051.3(ATM):c.8565T>G (p.Ser2855Arg) rs780905851
NM_000051.3(ATM):c.8578_8580delTCT (p.Ser2860del) rs786203976
NM_000051.3(ATM):c.8584+10T>C rs373321041
NM_000051.3(ATM):c.8584+6C>G rs863224300
NM_000051.3(ATM):c.858A>G (p.Gln286=) rs145301478
NM_000051.3(ATM):c.8592C>T (p.Tyr2864=) rs56025670
NM_000051.3(ATM):c.8629T>C (p.Leu2877=) rs730881279
NM_000051.3(ATM):c.8671+9T>G rs200190537
NM_000051.3(ATM):c.8711A>G (p.Glu2904Gly) rs786202826
NM_000051.3(ATM):c.8730C>G (p.Leu2910=) rs551041839
NM_000051.3(ATM):c.8732C>T (p.Thr2911Ile) rs794728018
NM_000051.3(ATM):c.8763G>A (p.Thr2921=) rs781528244
NM_000051.3(ATM):c.876G>A (p.Pro292=) rs755860432
NM_000051.3(ATM):c.8786+1G>A rs17174393
NM_000051.3(ATM):c.8786+20G>C rs56283878
NM_000051.3(ATM):c.8786+8A>C rs4986839
NM_000051.3(ATM):c.8814_8824delGAGAAACTCTC (p.Met2938Ilefs) rs758814126
NM_000051.3(ATM):c.8876_8879delACTG (p.Asp2959Glyfs) rs786204726
NM_000051.3(ATM):c.8921C>T (p.Pro2974Leu) rs139379666
NM_000051.3(ATM):c.8922G>A (p.Pro2974=) rs527248759
NM_000051.3(ATM):c.8977C>T (p.Arg2993Ter) rs770641163
NM_000051.3(ATM):c.8987+10A>G rs1060504308
NM_000051.3(ATM):c.8987+3G>A rs56360226
NM_000051.3(ATM):c.8993T>C (p.Ile2998Thr) rs778670498
NM_000051.3(ATM):c.8998C>T (p.Gln3000Ter) rs587781698
NM_000051.3(ATM):c.9006C>T (p.Phe3002=) rs540172506
NM_000051.3(ATM):c.9022C>T (p.Arg3008Cys) rs587782292
NM_000051.3(ATM):c.9049C>T (p.Leu3017=) rs876658991
NM_000051.3(ATM):c.9086G>A (p.Gly3029Asp) rs201199629
NM_000051.3(ATM):c.9139C>T (p.Arg3047Ter) rs121434219
NM_000051.3(ATM):c.9166G>T (p.Val3056Leu) rs371767164
NM_000051.3(ATM):c.94C>T (p.Arg32Cys) rs148061139
NM_000051.3(ATM):c.967A>G (p.Ile323Val) rs587781511
NM_000051.3(ATM):c.998C>T (p.Ser333Phe) rs28904919
NM_000059.3(BRCA2):c.*14C>T rs373436334
NM_000059.3(BRCA2):c.-11C>T rs76874770
NM_000059.3(BRCA2):c.-14T>C rs276174796
NM_000059.3(BRCA2):c.-15A>C rs138705202
NM_000059.3(BRCA2):c.-39-12_-39-10delTCT rs276174798
NM_000059.3(BRCA2):c.-39-16G>A rs276174799
NM_000059.3(BRCA2):c.-3A>G rs431825277
NM_000059.3(BRCA2):c.-9T>C rs276174802
NM_000059.3(BRCA2):c.10024G>A (p.Glu3342Lys) rs28897761
NM_000059.3(BRCA2):c.10045A>G (p.Thr3349Ala) rs80358387
NM_000059.3(BRCA2):c.10070C>T (p.Thr3357Ile) rs80358388
NM_000059.3(BRCA2):c.10076A>G (p.Glu3359Gly) rs80358389
NM_000059.3(BRCA2):c.10082A>C (p.Gln3361Pro) rs751250810
NM_000059.3(BRCA2):c.10087A>G (p.Ile3363Val) rs55881945
NM_000059.3(BRCA2):c.10089A>G (p.Ile3363Met) rs80358390
NM_000059.3(BRCA2):c.10094_10095insGAATTATATC (p.Ser3366Asnfs) rs1064792995
NM_000059.3(BRCA2):c.10095_10096insT (p.Ser3366Terfs) rs730881599
NM_000059.3(BRCA2):c.10110G>A (p.Arg3370=) rs28897762
NM_000059.3(BRCA2):c.10111A>G (p.Thr3371Ala) rs80358393
NM_000059.3(BRCA2):c.1011C>T (p.Asn337=) rs41293473
NM_000059.3(BRCA2):c.10120A>G (p.Thr3374Ala) rs80358395
NM_000059.3(BRCA2):c.10121C>T (p.Thr3374Ile) rs56309455
NM_000059.3(BRCA2):c.10127C>G (p.Ser3376Ter) rs1555290049
NM_000059.3(BRCA2):c.10150C>T (p.Arg3384Ter) rs397507568
NM_000059.3(BRCA2):c.10153C>T (p.Arg3385Cys) rs397507261
NM_000059.3(BRCA2):c.10154G>A (p.Arg3385His) rs80358398
NM_000059.3(BRCA2):c.10160C>G (p.Thr3387Ser) rs863224584
NM_000059.3(BRCA2):c.10171A>G (p.Ile3391Val) rs778147500
NM_000059.3(BRCA2):c.10176A>G (p.Lys3392=) rs876659206
NM_000059.3(BRCA2):c.10189T>A (p.Ser3397Thr) rs876660044
NM_000059.3(BRCA2):c.10202C>T (p.Thr3401Met) rs55853199
NM_000059.3(BRCA2):c.10203G>A (p.Thr3401=) rs147854265
NM_000059.3(BRCA2):c.10220A>G (p.Asn3407Ser) rs80358401
NM_000059.3(BRCA2):c.10222A>T (p.Lys3408Ter) rs80358402
NM_000059.3(BRCA2):c.10234A>G (p.Ile3412Val) rs1801426
NM_000059.3(BRCA2):c.10238C>A (p.Thr3413Lys) rs730881584
NM_000059.3(BRCA2):c.10240A>G (p.Thr3414Ala) rs80358405
NM_000059.3(BRCA2):c.10249T>C (p.Tyr3417His) rs535952730
NM_000059.3(BRCA2):c.10250A>G (p.Tyr3417Cys) rs730881600
NM_000059.3(BRCA2):c.10251T>C (p.Tyr3417=) rs80359779
NM_000059.3(BRCA2):c.10253_10256delTCTA (p.Ile3418Lysfs) rs80359259
NM_000059.3(BRCA2):c.1040A>G (p.Gln347Arg) rs55800493
NM_000059.3(BRCA2):c.1054T>C (p.Tyr352His) rs542343726
NM_000059.3(BRCA2):c.1054dupT (p.Tyr352Leufs) rs80359261
NM_000059.3(BRCA2):c.1059A>G (p.Ser353=) rs730881585
NM_000059.3(BRCA2):c.1075G>A (p.Glu359Lys) rs1555281730
NM_000059.3(BRCA2):c.1096T>G (p.Leu366Val) rs587779357
NM_000059.3(BRCA2):c.1114A>C (p.Asn372His) rs144848
NM_000059.3(BRCA2):c.1123C>T (p.Pro375Ser) rs80358408
NM_000059.3(BRCA2):c.1124C>T (p.Pro375Leu) rs80358409
NM_000059.3(BRCA2):c.1127T>G (p.Phe376Cys) rs80358410
NM_000059.3(BRCA2):c.1141G>A (p.Asp381Asn) rs398122723
NM_000059.3(BRCA2):c.1144A>C (p.Lys382Gln) rs371454630
NM_000059.3(BRCA2):c.114A>G (p.Glu38=) rs1555280345
NM_000059.3(BRCA2):c.1151C>T (p.Ser384Phe) rs41293475
NM_000059.3(BRCA2):c.1160T>C (p.Val387Ala) rs373945846
NM_000059.3(BRCA2):c.1166C>A (p.Pro389Gln) rs397507263
NM_000059.3(BRCA2):c.1166C>T (p.Pro389Leu) rs397507263
NM_000059.3(BRCA2):c.1167G>A (p.Pro389=) rs148607710
NM_000059.3(BRCA2):c.1179T>C (p.Cys393=) rs786201237
NM_000059.3(BRCA2):c.1181A>C (p.Glu394Ala) rs56016241
NM_000059.3(BRCA2):c.1216G>A (p.Ala406Thr) rs751535164
NM_000059.3(BRCA2):c.1218C>G (p.Ala406=) rs276174807
NM_000059.3(BRCA2):c.1225G>A (p.Glu409Lys) rs80358416
NM_000059.3(BRCA2):c.122C>T (p.Pro41Leu) rs786201716
NM_000059.3(BRCA2):c.1232T>C (p.Ile411Thr) rs79597821
NM_000059.3(BRCA2):c.1244A>G (p.His415Arg) rs80358417
NM_000059.3(BRCA2):c.1247T>G (p.Ile416Ser) rs80358418
NM_000059.3(BRCA2):c.125A>G (p.Tyr42Cys) rs4987046
NM_000059.3(BRCA2):c.1272A>G (p.Ser424=) rs587780531
NM_000059.3(BRCA2):c.1275A>G (p.Glu425=) rs34355306
NM_000059.3(BRCA2):c.1342C>T (p.Arg448Cys) rs80358422
NM_000059.3(BRCA2):c.1343G>A (p.Arg448His) rs80358423
NM_000059.3(BRCA2):c.1354C>A (p.Leu452Ile) rs80358424
NM_000059.3(BRCA2):c.1362A>G (p.Lys454=) rs55919657
NM_000059.3(BRCA2):c.136C>T (p.Pro46Ser) rs80358425
NM_000059.3(BRCA2):c.1385A>G (p.Glu462Gly) rs56403624
NM_000059.3(BRCA2):c.1395A>C (p.Val465=) rs11571641
NM_000059.3(BRCA2):c.1409A>C (p.Glu470Ala) rs750341436
NM_000059.3(BRCA2):c.1427C>G (p.Ser476Cys) rs80358431
NM_000059.3(BRCA2):c.1441A>G (p.Ile481Val) rs760559435
NM_000059.3(BRCA2):c.145G>T (p.Glu49Ter) rs80358435
NM_000059.3(BRCA2):c.1460C>A (p.Ala487Glu) rs56390402
NM_000059.3(BRCA2):c.1462A>G (p.Ile488Val) rs864622352
NM_000059.3(BRCA2):c.1478C>T (p.Pro493Leu) rs786202916
NM_000059.3(BRCA2):c.1504A>C (p.Lys502Gln) rs276174809
NM_000059.3(BRCA2):c.1514T>C (p.Ile505Thr) rs28897708
NM_000059.3(BRCA2):c.1538A>G (p.Lys513Arg) rs28897709
NM_000059.3(BRCA2):c.1550A>G (p.Asn517Ser) rs80358439
NM_000059.3(BRCA2):c.1564G>C (p.Gly522Arg) rs80358442
NM_000059.3(BRCA2):c.1568A>G (p.His523Arg) rs80358443
NM_000059.3(BRCA2):c.1584C>T (p.Asn528=) rs730881587
NM_000059.3(BRCA2):c.1627C>A (p.His543Asn) rs80358446
NM_000059.3(BRCA2):c.1630A>G (p.Thr544Ala) rs80358447
NM_000059.3(BRCA2):c.1631C>T (p.Thr544Ile) rs80358448
NM_000059.3(BRCA2):c.1644G>A (p.Gln548=) rs55986646
NM_000059.3(BRCA2):c.1647G>A (p.Lys549=) rs276174812
NM_000059.3(BRCA2):c.165_167delCAA (p.Asn56del) rs11571587
NM_000059.3(BRCA2):c.1662T>G (p.Cys554Trp) rs80358451
NM_000059.3(BRCA2):c.1666A>G (p.Asn556Asp) rs587781794
NM_000059.3(BRCA2):c.167A>C (p.Asn56Thr) rs80358454
NM_000059.3(BRCA2):c.1689G>A (p.Trp563Ter) rs80358456
NM_000059.3(BRCA2):c.171C>T (p.Tyr57=) rs201523522
NM_000059.3(BRCA2):c.1744A>C (p.Thr582Pro) rs80358457
NM_000059.3(BRCA2):c.1749G>A (p.Leu583=) rs780324598
NM_000059.3(BRCA2):c.175C>G (p.Pro59Ala) rs56091799
NM_000059.3(BRCA2):c.1763A>G (p.Asn588Ser) rs373400041
NM_000059.3(BRCA2):c.1769T>G (p.Phe590Cys) rs80358459
NM_000059.3(BRCA2):c.1786G>C (p.Asp596His) rs56328701
NM_000059.3(BRCA2):c.1788T>C (p.Asp596=) rs11571642
NM_000059.3(BRCA2):c.1792A>G (p.Thr598Ala) rs28897710
NM_000059.3(BRCA2):c.1798T>C (p.Tyr600His) rs75419644
NM_000059.3(BRCA2):c.179A>G (p.Asn60Ser) rs80358463
NM_000059.3(BRCA2):c.1804G>A (p.Gly602Arg) rs80358466
NM_000059.3(BRCA2):c.1810A>G (p.Lys604Glu) rs80358467
NM_000059.3(BRCA2):c.1817C>T (p.Pro606Leu) rs80358469
NM_000059.3(BRCA2):c.1818G>A (p.Pro606=) rs76844014
NM_000059.3(BRCA2):c.1820A>C (p.Lys607Thr) rs55962656
NM_000059.3(BRCA2):c.182T>C (p.Leu61Pro) rs1555280374
NM_000059.3(BRCA2):c.1838T>G (p.Leu613Arg) rs587780646
NM_000059.3(BRCA2):c.183A>G (p.Leu61=) rs776638534
NM_000059.3(BRCA2):c.1865C>T (p.Ala622Val) rs80358477
NM_000059.3(BRCA2):c.1875T>A (p.Phe625Leu) rs80358478
NM_000059.3(BRCA2):c.1889C>T (p.Thr630Ile) rs80358479
NM_000059.3(BRCA2):c.1909+1G>A rs587781629
NM_000059.3(BRCA2):c.1909+22delT rs276174816
NM_000059.3(BRCA2):c.1909+22dupT rs276174816
NM_000059.3(BRCA2):c.1909+9_1909+10delGT rs527732001
NM_000059.3(BRCA2):c.1910-1G>T
NM_000059.3(BRCA2):c.1911T>C (p.Gly637=) rs11571652
NM_000059.3(BRCA2):c.1938C>T (p.Ser646=) rs28897711
NM_000059.3(BRCA2):c.1964C>G (p.Pro655Arg) rs28897712
NM_000059.3(BRCA2):c.198A>G (p.Gln66=) rs28897700
NM_000059.3(BRCA2):c.2004G>A (p.Arg668=) rs755049218
NM_000059.3(BRCA2):c.2014A>G (p.Arg672Gly) rs587781647
NM_000059.3(BRCA2):c.2025A>G (p.Thr675=) rs147381487
NM_000059.3(BRCA2):c.2094A>G (p.Leu698=) rs28897714
NM_000059.3(BRCA2):c.2109C>T (p.Thr703=) rs762499878
NM_000059.3(BRCA2):c.2125C>G (p.Leu709Val) rs80358489
NM_000059.3(BRCA2):c.2127G>C (p.Leu709=) rs554040246
NM_000059.3(BRCA2):c.2133C>T (p.Cys711=) rs535547513
NM_000059.3(BRCA2):c.2136G>T (p.Leu712=) rs886037813
NM_000059.3(BRCA2):c.2138A>T (p.Gln713Leu) rs55816687
NM_000059.3(BRCA2):c.2145A>G (p.Gly715=) rs112566179
NM_000059.3(BRCA2):c.2152G>A (p.Glu718Lys) rs397507281
NM_000059.3(BRCA2):c.215A>G (p.Asn72Ser) rs276174818
NM_000059.3(BRCA2):c.2208A>G (p.Ala736=) rs144984153
NM_000059.3(BRCA2):c.2233A>G (p.Lys745Glu) rs374691587
NM_000059.3(BRCA2):c.223G>C (p.Ala75Pro) rs28897701
NM_000059.3(BRCA2):c.2251dupA (p.Thr751Asnfs) rs886040416
NM_000059.3(BRCA2):c.2256C>T (p.Asp752=) rs766384913
NM_000059.3(BRCA2):c.2262A>G (p.Gln754=) rs1057520621
NM_000059.3(BRCA2):c.2274T>G (p.Ser758Arg) rs142243359
NM_000059.3(BRCA2):c.2287C>G (p.His763Asp) rs863224585
NM_000059.3(BRCA2):c.231T>G (p.Thr77=) rs114446594
NM_000059.3(BRCA2):c.2320A>G (p.Thr774Ala) rs55968715
NM_000059.3(BRCA2):c.232C>T (p.Pro78Ser) rs398122745
NM_000059.3(BRCA2):c.2330A>G (p.Asp777Gly) rs780489283
NM_000059.3(BRCA2):c.2348T>G (p.Val783Gly) rs768143929
NM_000059.3(BRCA2):c.2350A>G (p.Met784Val) rs11571653
NM_000059.3(BRCA2):c.235A>G (p.Ile79Val) rs80358502
NM_000059.3(BRCA2):c.2389A>G (p.Lys797Glu) rs587782737
NM_000059.3(BRCA2):c.2391G>A (p.Lys797=) rs587776462
NM_000059.3(BRCA2):c.2412A>G (p.Glu804=) rs587780866
NM_000059.3(BRCA2):c.2416G>C (p.Asp806His) rs56404215
NM_000059.3(BRCA2):c.241T>A (p.Phe81Ile) rs80358507
NM_000059.3(BRCA2):c.2429C>T (p.Thr810Ile) rs80358509
NM_000059.3(BRCA2):c.2459A>G (p.Asp820Gly) rs80358511
NM_000059.3(BRCA2):c.2461G>A (p.Val821Ile) rs756411508
NM_000059.3(BRCA2):c.2482T>C (p.Tyr828His) rs1060502466
NM_000059.3(BRCA2):c.2484T>C (p.Tyr828=) rs45619134
NM_000059.3(BRCA2):c.2488A>G (p.Asn830Asp) rs574039421
NM_000059.3(BRCA2):c.2490C>A (p.Asn830Lys) rs56331088
NM_000059.3(BRCA2):c.2524G>C (p.Val842Leu) rs587782454
NM_000059.3(BRCA2):c.2526A>G (p.Val842=) rs770778164
NM_000059.3(BRCA2):c.2538A>C (p.Ser846=) rs11571654
NM_000059.3(BRCA2):c.2550A>G (p.Gln850=) rs80359785
NM_000059.3(BRCA2):c.257T>C (p.Leu86Pro) rs572782576
NM_000059.3(BRCA2):c.2581C>T (p.Gln861Ter) rs773356478
NM_000059.3(BRCA2):c.2589T>A (p.Asn863Lys) rs80358521
NM_000059.3(BRCA2):c.2601T>G (p.Thr867=) rs730881589
NM_000059.3(BRCA2):c.2616A>G (p.Lys872=) rs202047206
NM_000059.3(BRCA2):c.2667T>C (p.Asn889=) rs587782469
NM_000059.3(BRCA2):c.2679A>G (p.Gln893=) rs786203640
NM_000059.3(BRCA2):c.267G>A (p.Pro89=) rs587780648
NM_000059.3(BRCA2):c.2680G>A (p.Val894Ile) rs28897715
NM_000059.3(BRCA2):c.2698A>G (p.Asn900Asp) rs55736268
NM_000059.3(BRCA2):c.2716A>G (p.Thr906Ala) rs80358528
NM_000059.3(BRCA2):c.2731delG (p.Glu911Lysfs) rs80359344
NM_000059.3(BRCA2):c.2739C>T (p.Asp913=) rs276174829
NM_000059.3(BRCA2):c.2751A>G (p.Val917=) rs765644162
NM_000059.3(BRCA2):c.2771A>T (p.Asn924Ile) rs80358530
NM_000059.3(BRCA2):c.2779A>G (p.Met927Val) rs786201837
NM_000059.3(BRCA2):c.2786T>C (p.Leu929Ser) rs2227943
NM_000059.3(BRCA2):c.2803G>A (p.Asp935Asn) rs28897716
NM_000059.3(BRCA2):c.2803G>C (p.Asp935His) rs28897716
NM_000059.3(BRCA2):c.280C>T (p.Pro94Ser) rs80358531
NM_000059.3(BRCA2):c.2813C>A (p.Ala938Glu) rs55773834
NM_000059.3(BRCA2):c.2817C>T (p.Thr939=) rs367921107
NM_000059.3(BRCA2):c.2837A>G (p.Asp946Gly) rs55972907
NM_000059.3(BRCA2):c.2860_2862delGAG (p.Glu954del) rs80359360
NM_000059.3(BRCA2):c.2875G>A (p.Val959Ile) rs1555282921
NM_000059.3(BRCA2):c.2883G>A (p.Gln961=) rs11571655
NM_000059.3(BRCA2):c.2886T>C (p.His962=) rs786202807
NM_000059.3(BRCA2):c.28A>G (p.Thr10Ala) rs786203080
NM_000059.3(BRCA2):c.2918C>T (p.Ser973Leu) rs397507296
NM_000059.3(BRCA2):c.2919G>A (p.Ser973=) rs45525041
NM_000059.3(BRCA2):c.2926T>A (p.Ser976Thr) rs144862123
NM_000059.3(BRCA2):c.2926_2927delTCinsAT (p.Ser976Ile) rs276174831
NM_000059.3(BRCA2):c.2927C>T (p.Ser976Phe) rs11571656
NM_000059.3(BRCA2):c.2944A>C (p.Ile982Leu) rs28897717
NM_000059.3(BRCA2):c.2946A>G (p.Ile982Met) rs80358541
NM_000059.3(BRCA2):c.2957A>G (p.Asn986Ser) rs28897718
NM_000059.3(BRCA2):c.2960A>T (p.Asn987Ile) rs2227944
NM_000059.3(BRCA2):c.2971A>G (p.Asn991Asp) rs1799944
NM_000059.3(BRCA2):c.2987T>G (p.Leu996Arg) rs80358545
NM_000059.3(BRCA2):c.2999T>C (p.Ile1000Thr) rs374769365
NM_000059.3(BRCA2):c.3032C>G (p.Thr1011Arg) rs80358548
NM_000059.3(BRCA2):c.3055C>G (p.Leu1019Val) rs55638633
NM_000059.3(BRCA2):c.3073A>G (p.Lys1025Glu) rs80358550
NM_000059.3(BRCA2):c.3111A>G (p.Gln1037=) rs786202967
NM_000059.3(BRCA2):c.316+12A>G rs186419778
NM_000059.3(BRCA2):c.316+13A>G rs773097109
NM_000059.3(BRCA2):c.316+1G>A rs397507303
NM_000059.3(BRCA2):c.316+5G>A rs81002840
NM_000059.3(BRCA2):c.317-12G>A rs81002841
NM_000059.3(BRCA2):c.317-15A>G rs1555280835
NM_000059.3(BRCA2):c.3173A>G (p.Lys1058Arg) rs431825302
NM_000059.3(BRCA2):c.3174dup (p.Leu1059Thrfs) rs1555283079
NM_000059.3(BRCA2):c.3211C>T (p.His1071Tyr) rs80358564
NM_000059.3(BRCA2):c.3213T>C (p.His1071=) rs863224304
NM_000059.3(BRCA2):c.3218A>G (p.Gln1073Arg) rs80358566
NM_000059.3(BRCA2):c.3225T>C (p.Ser1075=) rs779228375
NM_000059.3(BRCA2):c.322A>C (p.Asn108His) rs80358567
NM_000059.3(BRCA2):c.3254A>G (p.His1085Arg) rs80358570
NM_000059.3(BRCA2):c.3256A>G (p.Ile1086Val) rs80358571
NM_000059.3(BRCA2):c.3262C>T (p.Pro1088Ser) rs80358572
NM_000059.3(BRCA2):c.3264T>C (p.Pro1088=) rs36060526
NM_000059.3(BRCA2):c.3264dupT (p.Gln1089Serfs) rs80359380
NM_000059.3(BRCA2):c.3299A>T (p.Asn1100Ile) rs80358575
NM_000059.3(BRCA2):c.3302A>G (p.His1101Arg) rs398122761
NM_000059.3(BRCA2):c.3304A>T (p.Asn1102Tyr) rs28897719
NM_000059.3(BRCA2):c.3309A>G (p.Leu1103=) rs786203980
NM_000059.3(BRCA2):c.3326C>T (p.Ala1109Val) rs41293479
NM_000059.3(BRCA2):c.3392G>A (p.Arg1131Lys) rs1555283214
NM_000059.3(BRCA2):c.3401G>C (p.Ser1134Thr) rs398122764
NM_000059.3(BRCA2):c.3417G>A (p.Lys1139=) rs145625991
NM_000059.3(BRCA2):c.3420T>C (p.Ser1140=) rs118093942
NM_000059.3(BRCA2):c.3431T>G (p.Val1144Gly) rs80358587
NM_000059.3(BRCA2):c.3436G>T (p.Glu1146Ter) rs1237049560
NM_000059.3(BRCA2):c.343A>G (p.Lys115Glu) rs56242644
NM_000059.3(BRCA2):c.3445A>G (p.Met1149Val) rs80358589
NM_000059.3(BRCA2):c.3453C>G (p.Ile1151Met) rs80358592
NM_000059.3(BRCA2):c.3458A>G (p.Lys1153Arg) rs80358594
NM_000059.3(BRCA2):c.3479G>A (p.Arg1160Lys) rs183920365
NM_000059.3(BRCA2):c.3481_3482dupGA (p.Asp1161Glufs) rs878853569
NM_000059.3(BRCA2):c.3494A>G (p.His1165Arg) rs587782201
NM_000059.3(BRCA2):c.3495T>C (p.His1165=) rs776655838
NM_000059.3(BRCA2):c.3509C>T (p.Ala1170Val) rs80358599
NM_000059.3(BRCA2):c.3515C>T (p.Ser1172Leu) rs80358600
NM_000059.3(BRCA2):c.3516G>A (p.Ser1172=) rs1799952
NM_000059.3(BRCA2):c.352C>T (p.Arg118Cys) rs375125172
NM_000059.3(BRCA2):c.3539A>G (p.Lys1180Arg) rs28897720
NM_000059.3(BRCA2):c.353G>A (p.Arg118His) rs80358603
NM_000059.3(BRCA2):c.3545_3546delTT (p.Phe1182Terfs) rs80359388
NM_000059.3(BRCA2):c.3555A>G (p.Thr1185=) rs876659609
NM_000059.3(BRCA2):c.3562A>G (p.Ile1188Val) rs202230438
NM_000059.3(BRCA2):c.3568C>T (p.Arg1190Trp) rs80358604
NM_000059.3(BRCA2):c.3569G>A (p.Arg1190Gln) rs80358605
NM_000059.3(BRCA2):c.3575T>G (p.Phe1192Cys) rs80358606
NM_000059.3(BRCA2):c.3581G>A (p.Gly1194Asp) rs28897721
NM_000059.3(BRCA2):c.3661T>C (p.Ser1221Pro) rs80358611
NM_000059.3(BRCA2):c.3672C>T (p.Gly1224=) rs587780650
NM_000059.3(BRCA2):c.3675A>G (p.Thr1225=) rs276174835
NM_000059.3(BRCA2):c.3682A>G (p.Asn1228Asp) rs28897722
NM_000059.3(BRCA2):c.3711T>C (p.Ala1237=) rs745588537
NM_000059.3(BRCA2):c.3715A>G (p.Lys1239Glu) rs374191973
NM_000059.3(BRCA2):c.3717A>G (p.Lys1239=) rs141196976
NM_000059.3(BRCA2):c.3749A>G (p.Glu1250Gly) rs56400215
NM_000059.3(BRCA2):c.375T>A (p.Asp125Glu) rs80358616
NM_000059.3(BRCA2):c.3767A>G (p.His1256Arg) rs80358618
NM_000059.3(BRCA2):c.3786A>T (p.Ser1262=) rs1042077901
NM_000059.3(BRCA2):c.3789T>C (p.Ser1263=) rs876659185
NM_000059.3(BRCA2):c.379G>T (p.Ala127Ser) rs80358621
NM_000059.3(BRCA2):c.3814A>G (p.Met1272Val) rs80358624
NM_000059.3(BRCA2):c.3822G>A (p.Lys1274=) rs1555283410
NM_000059.3(BRCA2):c.3839A>T (p.Asp1280Val) rs56337919
NM_000059.3(BRCA2):c.3840T>C (p.Asp1280=) rs786201327
NM_000059.3(BRCA2):c.3858_3860delAAA (p.Lys1286del) rs80359406
NM_000059.3(BRCA2):c.3859_3860delAA (p.Asn1287Terfs) rs80359406
NM_000059.3(BRCA2):c.3864_3866delTAA (p.Asn1288del) rs276174837
NM_000059.3(BRCA2):c.3869G>A (p.Cys1290Tyr) rs41293485
NM_000059.3(BRCA2):c.3874C>T (p.Leu1292=) rs587780867
NM_000059.3(BRCA2):c.3880T>C (p.Leu1294=) rs786201236
NM_000059.3(BRCA2):c.3910A>G (p.Thr1304Ala) rs28897723
NM_000059.3(BRCA2):c.3916G>A (p.Val1306Ile) rs80358636
NM_000059.3(BRCA2):c.3989A>G (p.Asn1330Ser) rs1057520792
NM_000059.3(BRCA2):c.4003G>T (p.Glu1335Ter) rs747070579
NM_000059.3(BRCA2):c.4007_4008insCATC (p.Asp1337Ilefs) rs878853577
NM_000059.3(BRCA2):c.4023A>C (p.Ser1341=) rs276174840
NM_000059.3(BRCA2):c.4037_4043delCTGTTTGinsT (p.Thr1346_Cys1348delinsIle) rs276174841
NM_000059.3(BRCA2):c.4046T>C (p.Ile1349Thr) rs80358654
NM_000059.3(BRCA2):c.4054G>T (p.Asp1352Tyr) rs80358655
NM_000059.3(BRCA2):c.4058_4062delAAACG (p.Glu1353Glyfs) rs397507322
NM_000059.3(BRCA2):c.4061C>T (p.Thr1354Met) rs80358656
NM_000059.3(BRCA2):c.4062G>A (p.Thr1354=) rs768735660
NM_000059.3(BRCA2):c.4068G>A (p.Leu1356=) rs28897724
NM_000059.3(BRCA2):c.4071A>C (p.Leu1357=) rs140556653
NM_000059.3(BRCA2):c.4090A>C (p.Ile1364Leu) rs56248502
NM_000059.3(BRCA2):c.4094G>A (p.Cys1365Tyr) rs80358657
NM_000059.3(BRCA2):c.4146_4148delAGA (p.Glu1382del) rs80359432
NM_000059.3(BRCA2):c.4178C>T (p.Ala1393Val) rs398122776
NM_000059.3(BRCA2):c.4179G>A (p.Ala1393=) rs770531115
NM_000059.3(BRCA2):c.4187A>G (p.Gln1396Arg) rs55969723
NM_000059.3(BRCA2):c.4241C>T (p.Thr1414Met) rs70953664
NM_000059.3(BRCA2):c.4242G>A (p.Thr1414=) rs750495335
NM_000059.3(BRCA2):c.4242G>T (p.Thr1414=) rs750495335
NM_000059.3(BRCA2):c.4258G>T (p.Asp1420Tyr) rs28897727
NM_000059.3(BRCA2):c.4258delG (p.Asp1420Ilefs) rs80359436
NM_000059.3(BRCA2):c.426-12G>A rs81002880
NM_000059.3(BRCA2):c.426-20T>G rs1064795008
NM_000059.3(BRCA2):c.4269T>C (p.Thr1423=) rs786201377
NM_000059.3(BRCA2):c.4271C>G (p.Ser1424Cys) rs80358664
NM_000059.3(BRCA2):c.4284dupT (p.Gln1429Serfs) rs80359439
NM_000059.3(BRCA2):c.4299G>A (p.Gly1433=) rs1555283699
NM_000059.3(BRCA2):c.4301A>T (p.Lys1434Ile) rs397507714
NM_000059.3(BRCA2):c.4314C>T (p.Val1438=) rs730881590
NM_000059.3(BRCA2):c.4316C>A (p.Ala1439Asp) rs80358667
NM_000059.3(BRCA2):c.4320A>G (p.Lys1440=) rs769535925
NM_000059.3(BRCA2):c.433_435delGTT (p.Val145del) rs80359442
NM_000059.3(BRCA2):c.438A>G (p.Leu146=) rs200942633
NM_000059.3(BRCA2):c.4405_4409delGACAT (p.Asp1469Lysfs) rs397507331
NM_000059.3(BRCA2):c.440A>G (p.Gln147Arg) rs80358674
NM_000059.3(BRCA2):c.441A>G (p.Gln147=) rs80358676
NM_000059.3(BRCA2):c.442T>C (p.Cys148Arg) rs80358677
NM_000059.3(BRCA2):c.4436G>C (p.Ser1479Thr) rs80358678
NM_000059.3(BRCA2):c.4478_4481delAAAG (p.Glu1493Valfs) rs80359454
NM_000059.3(BRCA2):c.4483G>A (p.Val1495Ile) rs80358680
NM_000059.3(BRCA2):c.4494T>A (p.Gly1498=) rs373160367
NM_000059.3(BRCA2):c.4530C>T (p.Pro1510=) rs757731214
NM_000059.3(BRCA2):c.4531G>A (p.Glu1511Lys) rs376338226
NM_000059.3(BRCA2):c.4534C>T (p.Arg1512Cys) rs80358684
NM_000059.3(BRCA2):c.4535G>A (p.Arg1512His) rs80358685
NM_000059.3(BRCA2):c.4544dup (p.Ile1516Aspfs) rs397507725
NM_000059.3(BRCA2):c.4552delG (p.Glu1518Asnfs) rs398122783
NM_000059.3(BRCA2):c.4554delA (p.Glu1518Aspfs) rs80359458
NM_000059.3(BRCA2):c.455C>A (p.Thr152Lys) rs80358691
NM_000059.3(BRCA2):c.4563A>C (p.Leu1521=) rs206075
NM_000059.3(BRCA2):c.4570T>G (p.Phe1524Val) rs56386506
NM_000059.3(BRCA2):c.4578A>G (p.Thr1526=) rs202022822
NM_000059.3(BRCA2):c.4584C>T (p.Ser1528=) rs80359788
NM_000059.3(BRCA2):c.4585G>A (p.Gly1529Arg) rs28897728
NM_000059.3(BRCA2):c.4588A>T (p.Lys1530Ter) rs80358692
NM_000059.3(BRCA2):c.4599A>C (p.Lys1533Asn) rs80358694
NM_000059.3(BRCA2):c.4614T>C (p.Ser1538=) rs45520945
NM_000059.3(BRCA2):c.4656T>C (p.Gly1552=) rs41293491
NM_000059.3(BRCA2):c.4670C>G (p.Thr1557Ser) rs80358698
NM_000059.3(BRCA2):c.467A>G (p.Asp156Gly) rs68071147
NM_000059.3(BRCA2):c.4681C>A (p.His1561Asn) rs2219594
NM_000059.3(BRCA2):c.4686A>G (p.Gln1562=) rs28897730
NM_000059.3(BRCA2):c.4698C>T (p.Thr1566=) rs750813972
NM_000059.3(BRCA2):c.4699C>T (p.Leu1567=) rs146514381
NM_000059.3(BRCA2):c.469_470delAA (p.Lys157Valfs) rs397507739
NM_000059.3(BRCA2):c.4703A>G (p.Lys1568Arg) rs80358699
NM_000059.3(BRCA2):c.4718G>A (p.Cys1573Tyr) rs56249050
NM_000059.3(BRCA2):c.475+14C>T rs55698822
NM_000059.3(BRCA2):c.475+1G>T rs81002797
NM_000059.3(BRCA2):c.475+3A>G rs81002795
NM_000059.3(BRCA2):c.475+4delT rs276174848
NM_000059.3(BRCA2):c.4759G>A (p.Ala1587Thr) rs56137239
NM_000059.3(BRCA2):c.476-1G>A rs397507340
NM_000059.3(BRCA2):c.476-3C>T rs371431745
NM_000059.3(BRCA2):c.476-9_476-8insT rs276174849
NM_000059.3(BRCA2):c.4767A>G (p.Pro1589=) rs755818549
NM_000059.3(BRCA2):c.4779A>C (p.Glu1593Asp) rs80358703
NM_000059.3(BRCA2):c.4791T>C (p.Ser1597=) rs786201728
NM_000059.3(BRCA2):c.4798_4800delAAT (p.Asn1600del) rs276174851
NM_000059.3(BRCA2):c.4828G>A (p.Val1610Met) rs80358705
NM_000059.3(BRCA2):c.4830G>T (p.Val1610=) rs80359789
NM_000059.3(BRCA2):c.4850G>A (p.Ser1617Asn) rs397507341
NM_000059.3(BRCA2):c.4858T>C (p.Leu1620=) rs528771743
NM_000059.3(BRCA2):c.4901T>C (p.Phe1634Ser) rs80358715
NM_000059.3(BRCA2):c.4915G>A (p.Val1639Ile) rs80358716
NM_000059.3(BRCA2):c.4928T>C (p.Val1643Ala) rs28897731
NM_000059.3(BRCA2):c.4963delT (p.Tyr1655Thrfs) rs886040557
NM_000059.3(BRCA2):c.4977C>T (p.Ser1659=) rs45484897
NM_000059.3(BRCA2):c.497A>T (p.His166Leu) rs876658364
NM_000059.3(BRCA2):c.5020A>G (p.Ser1674Gly) rs80358725
NM_000059.3(BRCA2):c.5028T>C (p.Ser1676=) rs762458631
NM_000059.3(BRCA2):c.502C>A (p.Pro168Thr) rs80358726
NM_000059.3(BRCA2):c.5035delA (p.Thr1679Leufs) rs80359477
NM_000059.3(BRCA2):c.506A>G (p.Lys169Arg) rs80358730
NM_000059.3(BRCA2):c.5070A>C (p.Lys1690Asn) rs56087561
NM_000059.3(BRCA2):c.5095G>A (p.Asp1699Asn) rs80358731
NM_000059.3(BRCA2):c.5110_5113delAGAA (p.Arg1704Terfs) rs879254123
NM_000059.3(BRCA2):c.5144T>C (p.Leu1715Ser) rs1064793634
NM_000059.3(BRCA2):c.5159C>A (p.Ser1720Ter) rs80358740
NM_000059.3(BRCA2):c.516+14C>T rs182828913
NM_000059.3(BRCA2):c.516+17G>T rs765435155
NM_000059.3(BRCA2):c.516+18T>C rs81002834
NM_000059.3(BRCA2):c.5165G>A (p.Ser1722Asn) rs773707172
NM_000059.3(BRCA2):c.517-11T>C rs81002828
NM_000059.3(BRCA2):c.517-19C>T rs11571623
NM_000059.3(BRCA2):c.517-2A>G rs81002858
NM_000059.3(BRCA2):c.517-4C>G rs81002804
NM_000059.3(BRCA2):c.5170A>G (p.Ile1724Val) rs35335654
NM_000059.3(BRCA2):c.5171T>C (p.Ile1724Thr) rs80358743
NM_000059.3(BRCA2):c.5191C>A (p.His1731Asn) rs80358745
NM_000059.3(BRCA2):c.5195delT (p.Leu1732Profs) rs587779363
NM_000059.3(BRCA2):c.5198C>T (p.Ser1733Phe) rs55639415
NM_000059.3(BRCA2):c.5199C>T (p.Ser1733=) rs28897734
NM_000059.3(BRCA2):c.5200G>A (p.Glu1734Lys) rs786202543
NM_000059.3(BRCA2):c.5217T>C (p.Tyr1739=) rs80358746
NM_000059.3(BRCA2):c.521G>A (p.Arg174His) rs80358747
NM_000059.3(BRCA2):c.5229_5231delTAG (p.Ser1744del) rs397507349
NM_000059.3(BRCA2):c.5247T>G (p.Tyr1749Ter)
NM_000059.3(BRCA2):c.5268A>G (p.Val1756=) rs199879914
NM_000059.3(BRCA2):c.5278T>G (p.Ser1760Ala) rs28897735
NM_000059.3(BRCA2):c.5312G>A (p.Gly1771Asp) rs80358755
NM_000059.3(BRCA2):c.5319G>A (p.Glu1773=) rs376257217
NM_000059.3(BRCA2):c.5331_5333delGAA (p.Lys1777del) rs398122529
NM_000059.3(BRCA2):c.5344C>A (p.Gln1782Lys) rs80358757
NM_000059.3(BRCA2):c.534A>G (p.Lys178=) rs28897703
NM_000059.3(BRCA2):c.5378A>G (p.Asn1793Ser) rs80358759
NM_000059.3(BRCA2):c.53G>A (p.Arg18His) rs80358762
NM_000059.3(BRCA2):c.5411T>C (p.Val1804Ala) rs370252983
NM_000059.3(BRCA2):c.5414A>G (p.Asn1805Ser) rs80358765
NM_000059.3(BRCA2):c.5418A>G (p.Glu1806=) rs34351119
NM_000059.3(BRCA2):c.5423T>C (p.Ile1808Thr) rs397507350
NM_000059.3(BRCA2):c.5427C>T (p.Cys1809=) rs80359791
NM_000059.3(BRCA2):c.5428G>A (p.Val1810Ile) rs80358766
NM_000059.3(BRCA2):c.5455C>T (p.Pro1819Ser) rs80358768
NM_000059.3(BRCA2):c.5474C>T (p.Ala1825Val) rs397507352
NM_000059.3(BRCA2):c.5479A>G (p.Ile1827Val) rs80358770
NM_000059.3(BRCA2):c.5495C>A (p.Ser1832Tyr) rs138489917
NM_000059.3(BRCA2):c.5498A>G (p.Asn1833Ser) rs587782601
NM_000059.3(BRCA2):c.5503A>G (p.Asn1835Asp) rs80358771
NM_000059.3(BRCA2):c.5508T>G (p.Asn1836Lys) rs80358774
NM_000059.3(BRCA2):c.5529A>C (p.Ala1843=) rs372951842
NM_000059.3(BRCA2):c.5529A>T (p.Ala1843=) rs372951842
NM_000059.3(BRCA2):c.5542delA (p.Ser1848Valfs) rs80359519
NM_000059.3(BRCA2):c.5552T>G (p.Ile1851Ser) rs80358776
NM_000059.3(BRCA2):c.5554G>A (p.Val1852Ile) rs80358777
NM_000059.3(BRCA2):c.5612G>A (p.Ser1871Asn) rs80358782
NM_000059.3(BRCA2):c.5616_5620delAGTAA (p.Lys1872Asnfs) rs80359525
NM_000059.3(BRCA2):c.5631C>T (p.Asn1877=) rs374326934
NM_000059.3(BRCA2):c.5631delC (p.Asn1877Lysfs) rs397507357
NM_000059.3(BRCA2):c.5634C>G (p.Asn1878Lys) rs80358784
NM_000059.3(BRCA2):c.5634C>T (p.Asn1878=) rs80358784
NM_000059.3(BRCA2):c.5635G>A (p.Glu1879Lys) rs55996097
NM_000059.3(BRCA2):c.5640T>G (p.Asn1880Lys) rs11571657
NM_000059.3(BRCA2):c.5649A>C (p.Lys1883Asn) rs80358787
NM_000059.3(BRCA2):c.5652T>C (p.Ile1884=) rs766067138
NM_000059.3(BRCA2):c.5659A>G (p.Thr1887Ala) rs786202618
NM_000059.3(BRCA2):c.5663A>G (p.Lys1888Arg) rs80358791
NM_000059.3(BRCA2):c.5683G>A (p.Glu1895Lys) rs146351301
NM_000059.3(BRCA2):c.5688A>G (p.Ala1896=) rs768907899
NM_000059.3(BRCA2):c.5700A>G (p.Ser1900=) rs730881591
NM_000059.3(BRCA2):c.5704G>A (p.Asp1902Asn) rs4987048
NM_000059.3(BRCA2):c.5710C>G (p.Leu1904Val) rs55875643
NM_000059.3(BRCA2):c.5714A>G (p.His1905Arg) rs80358796
NM_000059.3(BRCA2):c.5723T>C (p.Leu1908Pro) rs80358797
NM_000059.3(BRCA2):c.5733T>G (p.Asp1911Glu) rs367823201
NM_000059.3(BRCA2):c.5737T>C (p.Cys1913Arg) rs80358799
NM_000059.3(BRCA2):c.5737T>G (p.Cys1913Gly) rs80358799
NM_000059.3(BRCA2):c.5741G>C (p.Ser1914Thr) rs80358801
NM_000059.3(BRCA2):c.5744C>T (p.Thr1915Met) rs4987117
NM_000059.3(BRCA2):c.5745G>A (p.Thr1915=) rs1799953
NM_000059.3(BRCA2):c.5752C>T (p.His1918Tyr) rs80358803
NM_000059.3(BRCA2):c.5753A>G (p.His1918Arg) rs80358804
NM_000059.3(BRCA2):c.575T>C (p.Met192Thr) rs80358805
NM_000059.3(BRCA2):c.5763T>G (p.Phe1921Leu) rs730881540
NM_000059.3(BRCA2):c.5768A>C (p.Asp1923Ala) rs45491005
NM_000059.3(BRCA2):c.5777G>A (p.Ser1926Asn) rs869320795
NM_000059.3(BRCA2):c.5785A>G (p.Ile1929Val) rs79538375
NM_000059.3(BRCA2):c.5793A>G (p.Gln1931=) rs371682489
NM_000059.3(BRCA2):c.5808G>A (p.Met1936Ile) rs759138390
NM_000059.3(BRCA2):c.5813G>C (p.Gly1938Ala) rs41293499
NM_000059.3(BRCA2):c.5836T>C (p.Ser1946Pro) rs80358811
NM_000059.3(BRCA2):c.5851_5854delAGTT (p.Ser1951Trpfs) rs80359543
NM_000059.3(BRCA2):c.5864C>A (p.Ser1955Ter) rs80358815
NM_000059.3(BRCA2):c.5869A>G (p.Ile1957Val) rs80358817
NM_000059.3(BRCA2):c.5879G>A (p.Cys1960Tyr) rs56157628
NM_000059.3(BRCA2):c.5880T>C (p.Cys1960=) rs368055906
NM_000059.3(BRCA2):c.5882G>A (p.Ser1961Asn) rs80358820
NM_000059.3(BRCA2):c.5885T>C (p.Ile1962Thr) rs1060502377
NM_000059.3(BRCA2):c.5896C>T (p.His1966Tyr) rs80358822
NM_000059.3(BRCA2):c.5897A>G (p.His1966Arg) rs80358823
NM_000059.3(BRCA2):c.5928G>T (p.Gly1976=) rs752858082
NM_000059.3(BRCA2):c.5946delT (p.Ser1982Argfs) rs80359550
NM_000059.3(BRCA2):c.5975C>T (p.Ser1992Leu) rs80358830
NM_000059.3(BRCA2):c.5976A>G (p.Ser1992=) rs748854546
NM_000059.3(BRCA2):c.5979A>G (p.Leu1993=) rs773999877
NM_000059.3(BRCA2):c.5985C>T (p.Asn1995=) rs374620036
NM_000059.3(BRCA2):c.5986G>A (p.Ala1996Thr) rs80358833
NM_000059.3(BRCA2):c.5988A>G (p.Ala1996=) rs773045221
NM_000059.3(BRCA2):c.6012A>G (p.Glu2004=) rs572976024
NM_000059.3(BRCA2):c.6017G>C (p.Ser2006Thr) rs144784912
NM_000059.3(BRCA2):c.6037A>T (p.Lys2013Ter) rs80358840
NM_000059.3(BRCA2):c.6054T>C (p.Ser2018=) rs540799830
NM_000059.3(BRCA2):c.6057C>T (p.Asn2019=) rs147961615
NM_000059.3(BRCA2):c.6078A>G (p.Thr2026=) rs375649375
NM_000059.3(BRCA2):c.6100C>T (p.Arg2034Cys) rs1799954
NM_000059.3(BRCA2):c.6101G>A (p.Arg2034His) rs80358849
NM_000059.3(BRCA2):c.6125A>G (p.Gln2042Arg) rs80358852
NM_000059.3(BRCA2):c.6131G>C (p.Gly2044Ala) rs56191579
NM_000059.3(BRCA2):c.6131G>T (p.Gly2044Val) rs56191579
NM_000059.3(BRCA2):c.6143A>T (p.Asn2048Ile) rs80358853
NM_000059.3(BRCA2):c.6172T>A (p.Phe2058Ile) rs80358857
NM_000059.3(BRCA2):c.6220C>A (p.His2074Asn) rs34309943
NM_000059.3(BRCA2):c.6225A>C (p.Lys2075Asn) rs80358863
NM_000059.3(BRCA2):c.6231G>C (p.Lys2077Asn) rs541826447
NM_000059.3(BRCA2):c.6269A>G (p.His2090Arg) rs397507366
NM_000059.3(BRCA2):c.6271A>C (p.Ser2091Arg) rs398122550
NM_000059.3(BRCA2):c.627C>A (p.Leu209=) rs28897704
NM_000059.3(BRCA2):c.627C>T (p.Leu209=) rs28897704
NM_000059.3(BRCA2):c.6288T>G (p.Pro2096=) rs372527810
NM_000059.3(BRCA2):c.6290C>T (p.Thr2097Met) rs80358866
NM_000059.3(BRCA2):c.6293C>T (p.Ser2098Phe) rs80358867
NM_000059.3(BRCA2):c.6304G>A (p.Val2102Ile) rs80358869
NM_000059.3(BRCA2):c.631+18G>A rs759965817
NM_000059.3(BRCA2):c.6317T>C (p.Leu2106Pro) rs56172926
NM_000059.3(BRCA2):c.632-10delT rs431825340
NM_000059.3(BRCA2):c.632-9A>G rs81002855
NM_000059.3(BRCA2):c.6322C>T (p.Arg2108Cys) rs55794205
NM_000059.3(BRCA2):c.6323G>A (p.Arg2108His) rs35029074
NM_000059.3(BRCA2):c.6325G>A (p.Val2109Ile) rs79456940
NM_000059.3(BRCA2):c.6338A>G (p.Asn2113Ser) rs80358874
NM_000059.3(BRCA2):c.6347A>G (p.His2116Arg) rs55953736
NM_000059.3(BRCA2):c.6362A>G (p.Glu2121Gly) rs397507846
NM_000059.3(BRCA2):c.6399_6401delAAA (p.Asn2135del) rs80359581
NM_000059.3(BRCA2):c.6412G>T (p.Val2138Phe) rs11571659
NM_000059.3(BRCA2):c.6443C>A (p.Ser2148Tyr) rs80358880
NM_000059.3(BRCA2):c.6455C>A (p.Ser2152Tyr) rs80358881
NM_000059.3(BRCA2):c.6458C>T (p.Pro2153Leu) rs276174873
NM_000059.3(BRCA2):c.6461A>C (p.Tyr2154Ser) rs80358882
NM_000059.3(BRCA2):c.6465C>T (p.Leu2155=) rs746099644
NM_000059.3(BRCA2):c.6475C>G (p.Gln2159Glu) rs398122558
NM_000059.3(BRCA2):c.6513G>T (p.Val2171=) rs206076
NM_000059.3(BRCA2):c.6531T>A (p.Ile2177=) rs587780658
NM_000059.3(BRCA2):c.6540G>C (p.Leu2180Phe) rs398122560
NM_000059.3(BRCA2):c.6541G>C (p.Gly2181Arg) rs371067421
NM_000059.3(BRCA2):c.6550C>G (p.Gln2184Glu) rs80358887
NM_000059.3(BRCA2):c.6560C>T (p.Pro2187Leu) rs56019712
NM_000059.3(BRCA2):c.6568G>A (p.Val2190Ile) rs80358888
NM_000059.3(BRCA2):c.658_659delGT (p.Val220Ilefs) rs80359604
NM_000059.3(BRCA2):c.6613G>A (p.Val2205Met) rs80358889
NM_000059.3(BRCA2):c.6640A>G (p.Thr2214Ala) rs377200598
NM_000059.3(BRCA2):c.6665A>G (p.Tyr2222Cys) rs397507875
NM_000059.3(BRCA2):c.6675A>G (p.Thr2225=) rs28897741
NM_000059.3(BRCA2):c.6691G>A (p.Ala2231Thr) rs758379999
NM_000059.3(BRCA2):c.67+16A>G rs529148674
NM_000059.3(BRCA2):c.67+17T>C rs767648965
NM_000059.3(BRCA2):c.67+18A>G rs1057524048
NM_000059.3(BRCA2):c.67+19T>C rs587780865
NM_000059.3(BRCA2):c.67+4T>C rs373546450
NM_000059.3(BRCA2):c.67+62T>G rs11571574
NM_000059.3(BRCA2):c.6706G>A (p.Glu2236Lys) rs41293503
NM_000059.3(BRCA2):c.6713A>G (p.Asp2238Gly) rs80358895
NM_000059.3(BRCA2):c.6714T>G (p.Asp2238Glu) rs28897742
NM_000059.3(BRCA2):c.6738A>G (p.Pro2246=) rs760272304
NM_000059.3(BRCA2):c.6739A>G (p.Ser2247Gly) rs80358896
NM_000059.3(BRCA2):c.6748A>G (p.Thr2250Ala) rs80358899
NM_000059.3(BRCA2):c.6761T>A (p.Phe2254Tyr) rs786202915
NM_000059.3(BRCA2):c.6771C>T (p.Pro2257=) rs373696964
NM_000059.3(BRCA2):c.6785T>G (p.Met2262Arg) rs80358904
NM_000059.3(BRCA2):c.68-1G>T rs1060502376
NM_000059.3(BRCA2):c.68-6A>T rs1555280325
NM_000059.3(BRCA2):c.68-7T>A rs81002830
NM_000059.3(BRCA2):c.68-7delT rs276174878
NM_000059.3(BRCA2):c.68-7dupT rs276174878
NM_000059.3(BRCA2):c.6803G>A (p.Arg2268Lys) rs80358906
NM_000059.3(BRCA2):c.6806T>C (p.Ile2269Thr) rs398122564
NM_000059.3(BRCA2):c.681+2dupT rs587781486
NM_000059.3(BRCA2):c.681+56C>T rs2126042
NM_000059.3(BRCA2):c.682-12_682-11delTA rs276174879
NM_000059.3(BRCA2):c.6821G>T (p.Gly2274Val) rs55712212
NM_000059.3(BRCA2):c.6840G>A (p.Val2280=)
NM_000059.3(BRCA2):c.6841+11A>G rs730881592
NM_000059.3(BRCA2):c.6841+80_6841+83delTTAA rs11571661
NM_000059.3(BRCA2):c.6842-11T>A rs81002877
NM_000059.3(BRCA2):c.6842-19A>G rs81002865
NM_000059.3(BRCA2):c.6842-20T>A rs81002811
NM_000059.3(BRCA2):c.6842-20T>C rs81002811
NM_000059.3(BRCA2):c.6842-2A>G rs1555285132
NM_000059.3(BRCA2):c.6853A>G (p.Ile2285Val) rs56272235
NM_000059.3(BRCA2):c.6871A>G (p.Asn2291Asp) rs80358911
NM_000059.3(BRCA2):c.6877T>C (p.Phe2293Leu) rs80358912
NM_000059.3(BRCA2):c.6886A>C (p.Ile2296Leu) rs576279166
NM_000059.3(BRCA2):c.6892G>A (p.Glu2298Lys) rs80358914
NM_000059.3(BRCA2):c.6921A>G (p.Ser2307=) rs181183366
NM_000059.3(BRCA2):c.6935A>T (p.Asp2312Val) rs80358916
NM_000059.3(BRCA2):c.6937+13T>G rs587780868
NM_000059.3(BRCA2):c.6937+1G>A rs886040935
NM_000059.3(BRCA2):c.6937+594T>G rs191253965
NM_000059.3(BRCA2):c.6943A>C (p.Ile2315Leu) rs80358918
NM_000059.3(BRCA2):c.6944_6947delTAAA (p.Ile2315Lysfs) rs80359629
NM_000059.3(BRCA2):c.6953G>A (p.Arg2318Gln) rs80358921
NM_000059.3(BRCA2):c.695A>G (p.Tyr232Cys) rs372188754
NM_000059.3(BRCA2):c.6960G>A (p.Leu2320=) rs373134168
NM_000059.3(BRCA2):c.6986C>T (p.Pro2329Leu) rs80358925
NM_000059.3(BRCA2):c.6987G>A (p.Pro2329=) rs756619373
NM_000059.3(BRCA2):c.7007+18T>A rs377471435
NM_000059.3(BRCA2):c.7007+4A>G rs876661201
NM_000059.3(BRCA2):c.7007G>T (p.Arg2336Leu) rs28897743
NM_000059.3(BRCA2):c.7008-1G>A rs786204280
NM_000059.3(BRCA2):c.7008-20_7008-17del4 rs276174887
NM_000059.3(BRCA2):c.7008-21T>C rs761989332
NM_000059.3(BRCA2):c.7008-24_7008-23delTT rs753029909
NM_000059.3(BRCA2):c.7008-25C>T rs751803680
NM_000059.3(BRCA2):c.7008-2A>T rs81002823
NM_000059.3(BRCA2):c.7008-62A>G rs76584943
NM_000059.3(BRCA2):c.7010C>T (p.Thr2337Ile) rs80358927
NM_000059.3(BRCA2):c.7017G>C (p.Lys2339Asn) rs45574331
NM_000059.3(BRCA2):c.7020A>G (p.Glu2340=) rs886042269
NM_000059.3(BRCA2):c.7021C>T (p.Arg2341Cys) rs41293505
NM_000059.3(BRCA2):c.7024C>T (p.Gln2342Ter) rs80358928
NM_000059.3(BRCA2):c.7050C>T (p.Thr2350=) rs587780870
NM_000059.3(BRCA2):c.7051G>A (p.Ala2351Thr) rs80358930
NM_000059.3(BRCA2):c.7052C>G (p.Ala2351Gly) rs80358932
NM_000059.3(BRCA2):c.7057G>C (p.Gly2353Arg) rs80358935
NM_000059.3(BRCA2):c.708T>C (p.His236=) rs185506536
NM_000059.3(BRCA2):c.7096C>G (p.Leu2366Val) rs80358941
NM_000059.3(BRCA2):c.7102T>G (p.Leu2368Val) rs397507382
NM_000059.3(BRCA2):c.7110dupA (p.Ser2371Ilefs) rs80359638
NM_000059.3(BRCA2):c.7121A>G (p.Asn2374Ser) rs1379054137
NM_000059.3(BRCA2):c.7140T>C (p.His2380=)
NM_000059.3(BRCA2):c.7150C>A (p.Gln2384Lys) rs55977008
NM_000059.3(BRCA2):c.7162A>G (p.Thr2388Ala) rs1060502390
NM_000059.3(BRCA2):c.7178T>C (p.Met2393Thr) rs431825351
NM_000059.3(BRCA2):c.7182A>G (p.Arg2394=) rs80359797
NM_000059.3(BRCA2):c.7185C>T (p.His2395=) rs730881580
NM_000059.3(BRCA2):c.7188G>A (p.Leu2396=) rs587780871
NM_000059.3(BRCA2):c.7188G>T (p.Leu2396Phe) rs587780871
NM_000059.3(BRCA2):c.7222C>T (p.Pro2408Ser) rs398122577
NM_000059.3(BRCA2):c.7224A>G (p.Pro2408=) rs276174891
NM_000059.3(BRCA2):c.7232A>C (p.Lys2411Thr) rs80358950
NM_000059.3(BRCA2):c.7235C>T (p.Thr2412Ile) rs397507384
NM_000059.3(BRCA2):c.7239A>G (p.Lys2413=) rs763727386
NM_000059.3(BRCA2):c.7241C>T (p.Ser2414Leu) rs80358951
NM_000059.3(BRCA2):c.7241_7242invCA (p.Ser2414Leu)
NM_000059.3(BRCA2):c.7278T>A (p.Ile2426=) rs372377916
NM_000059.3(BRCA2):c.7307A>T (p.Asn2436Ile) rs80358955
NM_000059.3(BRCA2):c.7313A>G (p.Asp2438Gly) rs80358957
NM_000059.3(BRCA2):c.7317A>G (p.Gly2439=) rs587780660
NM_000059.3(BRCA2):c.7319A>G (p.His2440Arg) rs4986860
NM_000059.3(BRCA2):c.7341T>C (p.Asn2447=) rs4986858
NM_000059.3(BRCA2):c.7354A>G (p.Asn2452Asp) rs398122580
NM_000059.3(BRCA2):c.7413A>G (p.Thr2471=) rs138067005
NM_000059.3(BRCA2):c.7418G>A (p.Cys2473Tyr) rs55924966
NM_000059.3(BRCA2):c.741C>T (p.Ile247=) rs276174892
NM_000059.3(BRCA2):c.742G>A (p.Ala248Thr) rs55854959
NM_000059.3(BRCA2):c.7435+10G>A rs81002793
NM_000059.3(BRCA2):c.7435+17delT rs1472572621
NM_000059.3(BRCA2):c.7435+6G>A rs81002852
NM_000059.3(BRCA2):c.7436-14T>G rs81002814
NM_000059.3(BRCA2):c.7436-4A>G rs81002904
NM_000059.3(BRCA2):c.7448G>A (p.Ser2483Asn) rs80358967
NM_000059.3(BRCA2):c.7463G>A (p.Arg2488Lys) rs80358968
NM_000059.3(BRCA2):c.7469T>C (p.Ile2490Thr) rs11571707
NM_000059.3(BRCA2):c.7481G>A (p.Arg2494Gln) rs80358973
NM_000059.3(BRCA2):c.7484T>C (p.Ile2495Thr) rs80358974
NM_000059.3(BRCA2):c.7491G>A (p.Lys2497=) rs786203092
NM_000059.3(BRCA2):c.7504C>T (p.Arg2502Cys) rs55716624
NM_000059.3(BRCA2):c.7505G>A (p.Arg2502His) rs56070345
NM_000059.3(BRCA2):c.7507G>A (p.Val2503Ile) rs587782191
NM_000059.3(BRCA2):c.750G>A (p.Val250=) rs143214959
NM_000059.3(BRCA2):c.7521A>G (p.Pro2507=) rs759383358
NM_000059.3(BRCA2):c.7522G>A (p.Gly2508Ser) rs80358978
NM_000059.3(BRCA2):c.7525dup (p.Ser2509Lysfs) rs80359656
NM_000059.3(BRCA2):c.7534C>T (p.Leu2512Phe) rs80358980
NM_000059.3(BRCA2):c.7544C>T (p.Thr2515Ile) rs28897744
NM_000059.3(BRCA2):c.7559G>A (p.Arg2520Gln) rs80358982
NM_000059.3(BRCA2):c.7565C>T (p.Ser2522Phe) rs80358985
NM_000059.3(BRCA2):c.7596C>T (p.Pro2532=) rs748631472
NM_000059.3(BRCA2):c.7601C>T (p.Ala2534Val) rs74047012
NM_000059.3(BRCA2):c.7602G>A (p.Ala2534=) rs81002826
NM_000059.3(BRCA2):c.7618-16T>G rs397507924
NM_000059.3(BRCA2):c.7625C>T (p.Thr2542Met) rs80358989
NM_000059.3(BRCA2):c.7626G>A (p.Thr2542=) rs61754138
NM_000059.3(BRCA2):c.7684T>C (p.Phe2562Leu) rs80358995
NM_000059.3(BRCA2):c.7712A>G (p.Glu2571Gly) rs55689095
NM_000059.3(BRCA2):c.771_775delTCAAA (p.Asn257Lysfs) rs80359671
NM_000059.3(BRCA2):c.7753G>A (p.Gly2585Arg) rs80359002
NM_000059.3(BRCA2):c.7759C>T (p.Leu2587Phe) rs56335340
NM_000059.3(BRCA2):c.7805+11C>A rs1060504610
NM_000059.3(BRCA2):c.7805+13A>G rs149769332
NM_000059.3(BRCA2):c.7805+1G>A rs81002809
NM_000059.3(BRCA2):c.7805+6C>G rs81002819
NM_000059.3(BRCA2):c.7805+8A>G rs81002847
NM_000059.3(BRCA2):c.7806-2A>G rs81002836
NM_000059.3(BRCA2):c.7806-6delG rs764374133
NM_000059.3(BRCA2):c.7857G>C (p.Trp2619Cys) rs80359011
NM_000059.3(BRCA2):c.7865A>G (p.Asn2622Ser) rs142899125
NM_000059.3(BRCA2):c.7868A>G (p.His2623Arg) rs80359012
NM_000059.3(BRCA2):c.7878G>A (p.Trp2626Ter) rs80359013
NM_000059.3(BRCA2):c.7878G>C (p.Trp2626Cys) rs80359013
NM_000059.3(BRCA2):c.7879A>T (p.Ile2627Phe) rs80359014
NM_000059.3(BRCA2):c.7916C>T (p.Pro2639Leu) rs774723315
NM_000059.3(BRCA2):c.7928C>G (p.Ala2643Gly) rs80359018
NM_000059.3(BRCA2):c.793+1G>A rs81002846
NM_000059.3(BRCA2):c.793+6T>C rs1222477192
NM_000059.3(BRCA2):c.794-11T>C rs81002822
NM_000059.3(BRCA2):c.7940T>C (p.Leu2647Pro) rs80359021
NM_000059.3(BRCA2):c.7958T>C (p.Leu2653Pro) rs80359022
NM_000059.3(BRCA2):c.7964A>G (p.Gln2655Arg) rs80359024
NM_000059.3(BRCA2):c.796T>C (p.Phe266Leu) rs587782433
NM_000059.3(BRCA2):c.7976+12G>A rs81002827
NM_000059.3(BRCA2):c.7976+2C>G rs886040943
NM_000059.3(BRCA2):c.7976+5G>A rs786201180
NM_000059.3(BRCA2):c.7976+5G>T rs786201180
NM_000059.3(BRCA2):c.7976G>A (p.Arg2659Lys) rs80359027
NM_000059.3(BRCA2):c.7976G>C (p.Arg2659Thr) rs80359027
NM_000059.3(BRCA2):c.7977-14G>A rs879255467
NM_000059.3(BRCA2):c.7977-15T>G rs431825361
NM_000059.3(BRCA2):c.7977-1G>T rs81002874
NM_000059.3(BRCA2):c.7978T>G (p.Tyr2660Asp) rs80359029
NM_000059.3(BRCA2):c.7985C>A (p.Thr2662Lys) rs431825362
NM_000059.3(BRCA2):c.7985C>T (p.Thr2662Met) rs431825362
NM_000059.3(BRCA2):c.7988A>T (p.Glu2663Val) rs80359031
NM_000059.3(BRCA2):c.7992T>A (p.Ile2664=) rs80359800
NM_000059.3(BRCA2):c.7994A>G (p.Asp2665Gly) rs28897745
NM_000059.3(BRCA2):c.7995T>C (p.Asp2665=) rs200757418
NM_000059.3(BRCA2):c.79A>G (p.Ile27Val) rs80359034
NM_000059.3(BRCA2):c.8007A>G (p.Arg2669=) rs143999963
NM_000059.3(BRCA2):c.8009C>T (p.Ser2670Leu) rs80359035
NM_000059.3(BRCA2):c.800G>A (p.Gly267Glu) rs80359036
NM_000059.3(BRCA2):c.8010G>A (p.Ser2670=) rs146430937
NM_000059.3(BRCA2):c.8014A>G (p.Ile2672Val) rs80359037
NM_000059.3(BRCA2):c.8027T>C (p.Met2676Thr) rs80359038
NM_000059.3(BRCA2):c.8036A>G (p.Asp2679Gly) rs80359041
NM_000059.3(BRCA2):c.8061T>C (p.Val2687=) rs776992904
NM_000059.3(BRCA2):c.8063T>C (p.Leu2688Pro) rs80359045
NM_000059.3(BRCA2):c.8084C>T (p.Ser2695Leu) rs80359048
NM_000059.3(BRCA2):c.8090G>A (p.Ser2697Asn) rs80359051
NM_000059.3(BRCA2):c.8091C>T (p.Ser2697=) rs140782158
NM_000059.3(BRCA2):c.8092G>A (p.Ala2698Thr) rs80359052
NM_000059.3(BRCA2):c.8111C>T (p.Ser2704Phe) rs80359054
NM_000059.3(BRCA2):c.8113A>G (p.Ser2705Gly) rs756105620
NM_000059.3(BRCA2):c.8117A>G (p.Asn2706Ser) rs80359055
NM_000059.3(BRCA2):c.811G>A (p.Gly271Arg) rs786204274
NM_000059.3(BRCA2):c.8124T>G (p.Thr2708=) rs587780662
NM_000059.3(BRCA2):c.8149G>T (p.Ala2717Ser) rs28897747
NM_000059.3(BRCA2):c.8151C>T (p.Ala2717=) rs774808067
NM_000059.3(BRCA2):c.8154T>C (p.Ile2718=) rs148880015
NM_000059.3(BRCA2):c.8165C>G (p.Thr2722Arg) rs80359062
NM_000059.3(BRCA2):c.8167G>C (p.Asp2723His) rs41293511
NM_000059.3(BRCA2):c.8168A>G (p.Asp2723Gly) rs41293513
NM_000059.3(BRCA2):c.8169T>A (p.Asp2723Glu) rs1060502432
NM_000059.3(BRCA2):c.8182G>A (p.Val2728Ile) rs28897749
NM_000059.3(BRCA2):c.8182G>C (p.Val2728Leu) rs28897749
NM_000059.3(BRCA2):c.8187G>T (p.Lys2729Asn) rs80359065
NM_000059.3(BRCA2):c.8188G>C (p.Ala2730Pro) rs80359066
NM_000059.3(BRCA2):c.8192A>G (p.Gln2731Arg) rs753837544
NM_000059.3(BRCA2):c.8193G>A (p.Gln2731=) rs1555287034
NM_000059.3(BRCA2):c.8215G>A (p.Val2739Ile) rs80359069
NM_000059.3(BRCA2):c.8215G>C (p.Val2739Leu) rs80359069
NM_000059.3(BRCA2):c.8243G>A (p.Gly2748Asp) rs80359071
NM_000059.3(BRCA2):c.825A>T (p.Lys275Asn) rs397507399
NM_000059.3(BRCA2):c.831T>G (p.Asn277Lys) rs28897705
NM_000059.3(BRCA2):c.8324T>G (p.Met2775Arg) rs80359073
NM_000059.3(BRCA2):c.8331+16C>G rs730881595
NM_000059.3(BRCA2):c.8331+2T>C rs398122602
NM_000059.3(BRCA2):c.8331+5A>G rs1555287099
NM_000059.3(BRCA2):c.8332-6G>T rs587780872
NM_000059.3(BRCA2):c.8350C>T (p.Arg2784Trp) rs80359075
NM_000059.3(BRCA2):c.8351G>A (p.Arg2784Gln) rs80359076
NM_000059.3(BRCA2):c.8355T>C (p.Pro2785=) rs1057524419
NM_000059.3(BRCA2):c.8356G>A (p.Ala2786Thr) rs80359077
NM_000059.3(BRCA2):c.8359C>T (p.Arg2787Cys) rs41293517
NM_000059.3(BRCA2):c.8360G>A (p.Arg2787His) rs80359078
NM_000059.3(BRCA2):c.8377G>A (p.Gly2793Arg) rs80359082
NM_000059.3(BRCA2):c.8378G>A (p.Gly2793Glu) rs80359083
NM_000059.3(BRCA2):c.8386C>T (p.Pro2796Ser) rs146120136
NM_000059.3(BRCA2):c.8395delA (p.Arg2799Aspfs) rs80359709
NM_000059.3(BRCA2):c.8417C>T (p.Ser2806Leu) rs587782785
NM_000059.3(BRCA2):c.841G>A (p.Asp281Asn) rs80359088
NM_000059.3(BRCA2):c.8421G>A (p.Ser2807=) rs371278843
NM_000059.3(BRCA2):c.8428A>G (p.Ser2810Gly) rs80359089
NM_000059.3(BRCA2):c.8432A>G (p.Asp2811Gly) rs80359090
NM_000059.3(BRCA2):c.8435G>A (p.Gly2812Glu) rs80359091
NM_000059.3(BRCA2):c.8460A>C (p.Val2820=) rs9590940
NM_000059.3(BRCA2):c.8487+14T>A rs767591414
NM_000059.3(BRCA2):c.8487+19A>G rs11571743
NM_000059.3(BRCA2):c.8487+3A>G rs81002806
NM_000059.3(BRCA2):c.8487+8G>A rs81002838
NM_000059.3(BRCA2):c.8488-19G>A rs398122607
NM_000059.3(BRCA2):c.8488-1G>A rs397507404
NM_000059.3(BRCA2):c.8488-5T>C rs533806629
NM_000059.3(BRCA2):c.8499G>A (p.Lys2833=) rs558819788
NM_000059.3(BRCA2):c.8503T>C (p.Ser2835Pro) rs11571746
NM_000059.3(BRCA2):c.8505A>G (p.Ser2835=) rs765655952
NM_000059.3(BRCA2):c.8524C>T (p.Arg2842Cys) rs80359104
NM_000059.3(BRCA2):c.8525G>A (p.Arg2842His) rs80359105
NM_000059.3(BRCA2):c.8567A>C (p.Glu2856Ala) rs11571747
NM_000059.3(BRCA2):c.856T>C (p.Ser286Pro) rs80359111
NM_000059.3(BRCA2):c.8573A>G (p.Gln2858Arg) rs80359114
NM_000059.3(BRCA2):c.8632+13A>G
NM_000059.3(BRCA2):c.8632+1G>A rs397507997
NM_000059.3(BRCA2):c.8632+6A>G rs81002894
NM_000059.3(BRCA2):c.8633-16C>G rs81002818
NM_000059.3(BRCA2):c.8633-24_8634del rs886040945
NM_000059.3(BRCA2):c.8633-4T>A rs397507407
NM_000059.3(BRCA2):c.8647C>T (p.Pro2883Ser) rs80359122
NM_000059.3(BRCA2):c.8649A>G (p.Pro2883=) rs786202069
NM_000059.3(BRCA2):c.865A>C (p.Asn289His) rs766173
NM_000059.3(BRCA2):c.865A>G (p.Asn289Asp) rs766173
NM_000059.3(BRCA2):c.8662C>T (p.Arg2888Cys) rs80359123
NM_000059.3(BRCA2):c.8667A>G (p.Ala2889=) rs786203480
NM_000059.3(BRCA2):c.8668C>A (p.Leu2890Ile) rs80359127
NM_000059.3(BRCA2):c.8687G>A (p.Arg2896His) rs80359128
NM_000059.3(BRCA2):c.8694G>A (p.Leu2898=) rs556762256
NM_000059.3(BRCA2):c.8697A>G (p.Gln2899=) rs786203707
NM_000059.3(BRCA2):c.8702G>A (p.Gly2901Asp) rs80359129
NM_000059.3(BRCA2):c.8723T>G (p.Val2908Gly) rs28897753
NM_000059.3(BRCA2):c.8724delG (p.Lys2909Argfs) rs1555288172
NM_000059.3(BRCA2):c.8754+4A>G rs81002893
NM_000059.3(BRCA2):c.8755-17A>G rs431825370
NM_000059.3(BRCA2):c.8755-19A>G rs398122713
NM_000059.3(BRCA2):c.8755-1G>A rs81002812
NM_000059.3(BRCA2):c.8755-9T>C rs397507413
NM_000059.3(BRCA2):c.8756G>T (p.Gly2919Val) rs80359131
NM_000059.3(BRCA2):c.8764A>G (p.Ser2922Gly) rs80359132
NM_000059.3(BRCA2):c.8807T>C (p.Leu2936Ser) rs398122714
NM_000059.3(BRCA2):c.8830A>T (p.Ile2944Phe) rs4987047
NM_000059.3(BRCA2):c.8850G>A (p.Lys2950=) rs28897754
NM_000059.3(BRCA2):c.8850G>T (p.Lys2950Asn) rs28897754
NM_000059.3(BRCA2):c.8851G>A (p.Ala2951Thr) rs11571769
NM_000059.3(BRCA2):c.8854A>G (p.Met2952Val) rs397508016
NM_000059.3(BRCA2):c.8866G>C (p.Glu2956Gln) rs142040996
NM_000059.3(BRCA2):c.887A>G (p.Tyr296Cys) rs45457795
NM_000059.3(BRCA2):c.8893G>C (p.Asp2965His) rs80359141
NM_000059.3(BRCA2):c.8905G>A (p.Val2969Met) rs59004709
NM_000059.3(BRCA2):c.8917C>T (p.Arg2973Cys) rs45469092
NM_000059.3(BRCA2):c.8918G>A (p.Arg2973His) rs80359143
NM_000059.3(BRCA2):c.8941G>A (p.Glu2981Lys) rs139052578
NM_000059.3(BRCA2):c.8952A>G (p.Ser2984=) rs876660709
NM_000059.3(BRCA2):c.8953+16C>T rs81002892
NM_000059.3(BRCA2):c.8953+1G>A rs81002882
NM_000059.3(BRCA2):c.8954-5_8954-2delAACA rs587782878
NM_000059.3(BRCA2):c.8963G>A (p.Ser2988Asn) rs778052683
NM_000059.3(BRCA2):c.8972G>A (p.Arg2991His) rs80359150
NM_000059.3(BRCA2):c.8979A>C (p.Ser2993=) rs781452016
NM_000059.3(BRCA2):c.898G>A (p.Val300Ile) rs878853616
NM_000059.3(BRCA2):c.8997G>A (p.Leu2999=) rs80359804
NM_000059.3(BRCA2):c.9004G>A (p.Glu3002Lys) rs80359152
NM_000059.3(BRCA2):c.9006A>T (p.Glu3002Asp) rs80359153
NM_000059.3(BRCA2):c.9032T>C (p.Leu3011Pro) rs80359155
NM_000059.3(BRCA2):c.9038C>T (p.Thr3013Ile) rs28897755
NM_000059.3(BRCA2):c.905C>T (p.Thr302Ile) rs80359158
NM_000059.3(BRCA2):c.9085G>A (p.Ala3029Thr) rs56179254
NM_000059.3(BRCA2):c.9087G>A (p.Ala3029=) rs368576266
NM_000059.3(BRCA2):c.909T>G (p.Ser303=) rs757430441
NM_000059.3(BRCA2):c.9104A>C (p.Tyr3035Ser) rs80359165
NM_000059.3(BRCA2):c.9106C>G (p.Gln3036Glu) rs202155613
NM_000059.3(BRCA2):c.9116C>T (p.Pro3039Leu) rs80359167
NM_000059.3(BRCA2):c.9117+9C>T rs81002869
NM_000059.3(BRCA2):c.9118-14T>C rs81002815
NM_000059.3(BRCA2):c.9148C>T (p.Gln3050Ter) rs80359170
NM_000059.3(BRCA2):c.9154C>T (p.Arg3052Trp) rs45580035
NM_000059.3(BRCA2):c.9155G>A (p.Arg3052Gln) rs80359171
NM_000059.3(BRCA2):c.9175A>G (p.Lys3059Glu) rs80359174
NM_000059.3(BRCA2):c.9187C>T (p.Pro3063Ser) rs80359176
NM_000059.3(BRCA2):c.9190G>A (p.Asp3064Asn) rs80359177
NM_000059.3(BRCA2):c.9222A>G (p.Leu3074=) rs200635661
NM_000059.3(BRCA2):c.9234C>T (p.Val3078=) rs587782428
NM_000059.3(BRCA2):c.9235G>A (p.Val3079Ile) rs55933907
NM_000059.3(BRCA2):c.9235delG (p.Val3079Phefs) rs397507422
NM_000059.3(BRCA2):c.9237T>C (p.Val3079=) rs80359805
NM_000059.3(BRCA2):c.9242T>C (p.Val3081Ala) rs80359189
NM_000059.3(BRCA2):c.9253A>C (p.Thr3085Pro) rs397507423
NM_000059.3(BRCA2):c.9253dupA (p.Thr3085Asnfs) rs80359752
NM_000059.3(BRCA2):c.9256+2T>C rs1555288591
NM_000059.3(BRCA2):c.9257-10delT rs276174919
NM_000059.3(BRCA2):c.9257-15T>C rs1135401940
NM_000059.3(BRCA2):c.9257-16T>C rs11571818
NM_000059.3(BRCA2):c.9257-17dupT rs276174919
NM_000059.3(BRCA2):c.9257-18C>A rs81002807
NM_000059.3(BRCA2):c.9257-8C>T rs11571819
NM_000059.3(BRCA2):c.9257G>C (p.Gly3086Ala) rs574271678
NM_000059.3(BRCA2):c.9270C>T (p.Phe3090=) rs587780873
NM_000059.3(BRCA2):c.9271G>A (p.Val3091Ile) rs80359194
NM_000059.3(BRCA2):c.9275A>G (p.Tyr3092Cys) rs80359195
NM_000059.3(BRCA2):c.927A>G (p.Ser309=) rs80359806
NM_000059.3(BRCA2):c.9285C>G (p.Asp3095Glu) rs80359198
NM_000059.3(BRCA2):c.9285C>T (p.Asp3095=) rs80359198
NM_000059.3(BRCA2):c.9292T>C (p.Tyr3098His) rs41293521
NM_000059.3(BRCA2):c.9302T>G (p.Leu3101Arg) rs28897758
NM_000059.3(BRCA2):c.9321A>C (p.Ile3107=) rs876658703
NM_000059.3(BRCA2):c.9353T>C (p.Met3118Thr) rs56204128
NM_000059.3(BRCA2):c.9364G>A (p.Ala3122Thr) rs587782313
NM_000059.3(BRCA2):c.9371A>T (p.Asn3124Ile) rs28897759
NM_000059.3(BRCA2):c.9375C>G (p.Leu3125=) rs276174924
NM_000059.3(BRCA2):c.9396A>G (p.Lys3132=) rs201172050
NM_000059.3(BRCA2):c.9411T>G (p.Thr3137=) rs1799968
NM_000059.3(BRCA2):c.9433G>C (p.Val3145Leu) rs587776476
NM_000059.3(BRCA2):c.9433G>T (p.Val3145Leu) rs587776476
NM_000059.3(BRCA2):c.943T>A (p.Cys315Ser) rs79483201
NM_000059.3(BRCA2):c.9442G>T (p.Ala3148Ser) rs949790323
NM_000059.3(BRCA2):c.9454G>A (p.Glu3152Lys) rs80359218
NM_000059.3(BRCA2):c.9458G>C (p.Gly3153Ala) rs80359220
NM_000059.3(BRCA2):c.9472A>G (p.Thr3158Ala) rs786204284
NM_000059.3(BRCA2):c.9477C>A (p.Phe3159Leu) rs80359221
NM_000059.3(BRCA2):c.9493A>G (p.Thr3165Ala) rs587782568
NM_000059.3(BRCA2):c.9501+3A>T rs61757642
NM_000059.3(BRCA2):c.9501+4A>G rs81002848
NM_000059.3(BRCA2):c.9501+6G>T rs863224600
NM_000059.3(BRCA2):c.9501+9A>C rs81002867
NM_000059.3(BRCA2):c.9502-12T>G rs81002803
NM_000059.3(BRCA2):c.9509A>G (p.Asp3170Gly) rs80359224
NM_000059.3(BRCA2):c.9513_9516delACTT (p.Leu3172Alafs) rs80359769
NM_000059.3(BRCA2):c.9547A>G (p.Ile3183Val) rs377123889
NM_000059.3(BRCA2):c.956A>C (p.Asn319Thr) rs55939572
NM_000059.3(BRCA2):c.956A>G (p.Asn319Ser) rs55939572
NM_000059.3(BRCA2):c.9581C>A (p.Pro3194Gln) rs28897760
NM_000059.3(BRCA2):c.9583A>G (p.Thr3195Ala) rs80359227
NM_000059.3(BRCA2):c.9586A>G (p.Lys3196Glu) rs80359228
NM_000059.3(BRCA2):c.9588delA (p.Asp3197Thrfs) rs876661285
NM_000059.3(BRCA2):c.9592T>C (p.Cys3198Arg) rs80359229
NM_000059.3(BRCA2):c.9605C>T (p.Pro3202Leu) rs397507432
NM_000059.3(BRCA2):c.9606G>A (p.Pro3202=) rs755890067
NM_000059.3(BRCA2):c.9606G>C (p.Pro3202=) rs755890067
NM_000059.3(BRCA2):c.9616C>G (p.Gln3206Glu) rs80359233
NM_000059.3(BRCA2):c.9632C>A (p.Thr3211Lys) rs730881583
NM_000059.3(BRCA2):c.9634G>C (p.Gly3212Arg) rs55775473
NM_000059.3(BRCA2):c.963A>G (p.Gln321=) rs276174927
NM_000059.3(BRCA2):c.9645T>A (p.Leu3215=) rs755111487
NM_000059.3(BRCA2):c.9647T>C (p.Leu3216Pro) rs431825377
NM_000059.3(BRCA2):c.9649-19G>A rs11571830
NM_000059.3(BRCA2):c.9649-20C>T rs56177715
NM_000059.3(BRCA2):c.9649-6_9649-5insT rs276174929
NM_000059.3(BRCA2):c.9649-8T>C rs81002857
NM_000059.3(BRCA2):c.9649-9T>G rs765352313
NM_000059.3(BRCA2):c.964A>C (p.Lys322Gln) rs11571640
NM_000059.3(BRCA2):c.9677A>G (p.Tyr3226Cys) rs80359237
NM_000059.3(BRCA2):c.9699_9702delTATG (p.Cys3233Trpfs) rs80359775
NM_000059.3(BRCA2):c.971G>A (p.Arg324Lys) rs397507435
NM_000059.3(BRCA2):c.9720T>C (p.Val3240=) rs80359810
NM_000059.3(BRCA2):c.9728C>T (p.Pro3243Leu) rs80359241
NM_000059.3(BRCA2):c.9730G>A (p.Val3244Ile) rs11571831
NM_000059.3(BRCA2):c.9738C>A (p.Ala3246=) rs80359811
NM_000059.3(BRCA2):c.9738C>T (p.Ala3246=) rs80359811
NM_000059.3(BRCA2):c.9748dup (p.Ser3250Phefs) rs886040850
NM_000059.3(BRCA2):c.9770A>G (p.Lys3257Arg) rs55847618
NM_000059.3(BRCA2):c.978C>A (p.Ser326Arg) rs28897706
NM_000059.3(BRCA2):c.9837A>G (p.Leu3279=) rs730881598
NM_000059.3(BRCA2):c.9838C>T (p.Pro3280Ser) rs55835607
NM_000059.3(BRCA2):c.9839C>A (p.Pro3280His) rs80359246
NM_000059.3(BRCA2):c.9843A>G (p.Pro3281=) rs11571832
NM_000059.3(BRCA2):c.9864A>G (p.Thr3288=) rs778401681
NM_000059.3(BRCA2):c.9875C>T (p.Pro3292Leu) rs56121817
NM_000059.3(BRCA2):c.987G>A (p.Arg329=) rs561002197
NM_000059.3(BRCA2):c.9905G>A (p.Arg3302Lys) rs80359249
NM_000059.3(BRCA2):c.9918C>A (p.Thr3306=) rs562881210
NM_000059.3(BRCA2):c.9924C>T (p.Tyr3308=) rs4987049
NM_000059.3(BRCA2):c.9925G>A (p.Glu3309Lys) rs80359251
NM_000059.3(BRCA2):c.9934A>G (p.Ile3312Val) rs80359254
NM_000059.3(BRCA2):c.9945delA (p.Glu3316Asnfs) rs431825381
NM_000059.3(BRCA2):c.9949C>T (p.Leu3317=) rs777488349
NM_000059.3(BRCA2):c.9952A>C (p.Asn3318His) rs80359256
NM_000059.3(BRCA2):c.9976A>T (p.Lys3326Ter) rs11571833
NM_000059.3(BRCA2):c.9981A>T (p.Lys3327Asn) rs587782098
NM_000059.3(BRCA2):c.9986A>G (p.Asn3329Ser) rs76635144
NM_000059.3:c.6884_6888del
NM_000075.3(CDK4):c.70C>T (p.Arg24Cys) rs11547328
NM_000077.4(CDKN2A):c.*6C>G rs375628411
NM_000077.4(CDKN2A):c.-14C>T rs764244718
NM_000077.4(CDKN2A):c.-19436C>T rs374360796
NM_000077.4(CDKN2A):c.-2G>A rs191394143
NM_000077.4(CDKN2A):c.146T>C (p.Ile49Thr) rs199907548
NM_000077.4(CDKN2A):c.149A>G (p.Gln50Arg) rs587778189
NM_000077.4(CDKN2A):c.150+8G>A rs1419306566
NM_000077.4(CDKN2A):c.151-14G>A rs767030551
NM_000077.4(CDKN2A):c.170C>T (p.Ala57Val) rs372266620
NM_000077.4(CDKN2A):c.174A>C (p.Arg58=) rs201208890
NM_000077.4(CDKN2A):c.174A>G (p.Arg58=) rs201208890
NM_000077.4(CDKN2A):c.176T>G (p.Val59Gly) rs104894099
NM_000077.4(CDKN2A):c.197A>G (p.His66Arg) rs756750256
NM_000077.4(CDKN2A):c.198C>T (p.His66=) rs374984975
NM_000077.4(CDKN2A):c.206A>G (p.Glu69Gly) rs372670098
NM_000077.4(CDKN2A):c.212A>G (p.Asn71Ser) rs559848002
NM_000077.4(CDKN2A):c.250G>T (p.Asp84Tyr) rs11552822
NM_000077.4(CDKN2A):c.261G>A (p.Arg87=) rs546300971
NM_000077.4(CDKN2A):c.266G>A (p.Gly89Asp) rs137854599
NM_000077.4(CDKN2A):c.273G>A (p.Leu91=) rs4987127
NM_000077.4(CDKN2A):c.298G>T (p.Ala100Ser) rs200863613
NM_000077.4(CDKN2A):c.301G>T (p.Gly101Trp) rs104894094
NM_000077.4(CDKN2A):c.318G>A (p.Val106=) rs199888003
NM_000077.4(CDKN2A):c.320G>A (p.Arg107His) rs370823171
NM_000077.4(CDKN2A):c.342C>G (p.Pro114=) rs878853648
NM_000077.4(CDKN2A):c.369T>A (p.His123Gln) rs6413463
NM_000077.4(CDKN2A):c.370C>T (p.Arg124Cys) rs34170727
NM_000077.4(CDKN2A):c.373G>C (p.Asp125His) rs146179135
NM_000077.4(CDKN2A):c.377T>A (p.Val126Asp) rs104894098
NM_000077.4(CDKN2A):c.379G>T (p.Ala127Ser) rs6413464
NM_000077.4(CDKN2A):c.384G>A (p.Arg128=) rs199901898
NM_000077.4(CDKN2A):c.402G>T (p.Ala134=) rs878853649
NM_000077.4(CDKN2A):c.405G>A (p.Gly135=) rs751586391
NM_000077.4(CDKN2A):c.430C>T (p.Arg144Cys) rs116150891
NM_000077.4(CDKN2A):c.442G>A (p.Ala148Thr) rs3731249
NM_000077.4(CDKN2A):c.457G>T (p.Asp153Tyr) rs45476696
NM_000077.4(CDKN2A):c.458-4G>C rs876660514
NM_000077.4(CDKN2A):c.51C>A (p.Ala17=) rs764362225
NM_000077.4(CDKN2A):c.67G>T (p.Gly23Cys) rs1131691186
NM_000077.4(CDKN2A):c.71G>C (p.Arg24Pro) rs104894097
NM_000077.4(CDKN2A):c.83T>G (p.Val28Gly) rs775176191
NM_000090.3(COL3A1):c.114C>G (p.Ser38=) rs141241764
NM_000090.3(COL3A1):c.1150-13T>C rs201839712
NM_000090.3(COL3A1):c.1188C>T (p.Gly396=) rs745743884
NM_000090.3(COL3A1):c.1550C>T (p.Pro517Leu) rs142085247
NM_000090.3(COL3A1):c.1617C>T (p.Pro539=) rs141091206
NM_000090.3(COL3A1):c.1762-11T>G rs761637298
NM_000090.3(COL3A1):c.1804C>A (p.Pro602Thr) rs35795890
NM_000090.3(COL3A1):c.1815+5G>A rs146652498
NM_000090.3(COL3A1):c.1927T>C (p.Leu643=) rs41263757
NM_000090.3(COL3A1):c.198A>G (p.Ile66Met) rs372269408
NM_000090.3(COL3A1):c.2002C>A (p.Pro668Thr) rs1801183
NM_000090.3(COL3A1):c.2002C>T (p.Pro668Ser) rs1801183
NM_000090.3(COL3A1):c.2035G>A (p.Ala679Thr) rs41263773
NM_000090.3(COL3A1):c.217G>C (p.Asp73His) rs200246388
NM_000090.3(COL3A1):c.2355C>G (p.Pro785=) rs148901664
NM_000090.3(COL3A1):c.2805T>C (p.Pro935=) rs111567071
NM_000090.3(COL3A1):c.3061C>A (p.Leu1021Ile) rs139619440
NM_000090.3(COL3A1):c.3133G>A (p.Ala1045Thr) rs149722210
NM_000090.3(COL3A1):c.3202-14delT rs767971610
NM_000090.3(COL3A1):c.3228C>T (p.Pro1076=) rs200917999
NM_000090.3(COL3A1):c.3537C>A (p.Gly1179=) rs146837092
NM_000090.3(COL3A1):c.3626G>C (p.Gly1209Ala) rs374452484
NM_000090.3(COL3A1):c.3642C>A (p.Gly1214=) rs184402915
NM_000090.3(COL3A1):c.3818A>G (p.Lys1273Arg) rs144614075
NM_000090.3(COL3A1):c.3938A>G (p.Lys1313Arg) rs111840783
NM_000090.3(COL3A1):c.4020C>T (p.Tyr1340=) rs766750333
NM_000090.3(COL3A1):c.4021G>A (p.Gly1341Ser) rs140646380
NM_000090.3(COL3A1):c.505C>T (p.Leu169Phe) rs111391222
NM_000090.3(COL3A1):c.583-8C>T rs10166835
NM_000090.3(COL3A1):c.799-6delT rs767927599
NM_000090.3(COL3A1):c.80-13A>C rs566189676
NM_000090.3(COL3A1):c.812G>A (p.Arg271Gln) rs112185887
NM_000090.3(COL3A1):c.898-5T>C rs535434618
NM_000138.4(FBN1):c.1027G>A (p.Gly343Arg) rs146726731
NM_000138.4(FBN1):c.1323A>G (p.Pro441=) rs202030761
NM_000138.4(FBN1):c.1345G>A (p.Val449Ile) rs139058991
NM_000138.4(FBN1):c.1371C>G (p.Arg457=) rs25436
NM_000138.4(FBN1):c.1746C>T (p.Cys582=) rs112366266
NM_000138.4(FBN1):c.185G>A (p.Arg62His) rs145942328
NM_000138.4(FBN1):c.2094G>T (p.Pro698=) rs144775475
NM_000138.4(FBN1):c.2678-12T>C rs200368037
NM_000138.4(FBN1):c.2748G>A (p.Val916=) rs1339922695
NM_000138.4(FBN1):c.2855-9C>T rs140590
NM_000138.4(FBN1):c.2895G>A (p.Glu965=) rs140591
NM_000138.4(FBN1):c.2927G>A (p.Arg976His) rs140954477
NM_000138.4(FBN1):c.2956G>A (p.Ala986Thr) rs112287730
NM_000138.4(FBN1):c.3058A>G (p.Thr1020Ala) rs111801777
NM_000138.4(FBN1):c.306C>T (p.Cys102=) rs25388
NM_000138.4(FBN1):c.3089A>G (p.Asn1030Ser) rs375996640
NM_000138.4(FBN1):c.3294C>T (p.Asp1098=) rs140587
NM_000138.4(FBN1):c.3422C>T (p.Pro1141Leu) rs2228241
NM_000138.4(FBN1):c.3463+3A>G rs80344206
NM_000138.4(FBN1):c.3508C>T (p.Arg1170Cys) rs1366894709
NM_000138.4(FBN1):c.3509G>A (p.Arg1170His) rs137854475
NM_000138.4(FBN1):c.3590-8T>C rs140600
NM_000138.4(FBN1):c.3675G>A (p.Pro1225=) rs148147223
NM_000138.4(FBN1):c.3965-8T>C rs140637
NM_000138.4(FBN1):c.4095C>T (p.Asp1365=) rs375402043
NM_000138.4(FBN1):c.4306G>A (p.Val1436Met) rs377338217
NM_000138.4(FBN1):c.4750G>A (p.Glu1584Lys) rs148888513
NM_000138.4(FBN1):c.4905C>G (p.Thr1635=) rs113115949
NM_000138.4(FBN1):c.4998C>T (p.Thr1666=) rs141925790
NM_000138.4(FBN1):c.510C>T (p.Tyr170=) rs111671429
NM_000138.4(FBN1):c.5340A>C (p.Gly1780=) rs766501385
NM_000138.4(FBN1):c.5343G>A (p.Val1781=) rs140649
NM_000138.4(FBN1):c.5369G>A (p.Arg1790Gln) rs1555396428
NM_000138.4(FBN1):c.538+4A>G rs375721252
NM_000138.4(FBN1):c.539-15delA rs193922211
NM_000138.4(FBN1):c.5442C>T (p.Asn1814=) rs397515822
NM_000138.4(FBN1):c.5672-3T>C rs193922217
NM_000138.4(FBN1):c.6038-15_6038-14delAT rs752198920
NM_000138.4(FBN1):c.6038-8T>A rs569460847
NM_000138.4(FBN1):c.6164-3C>T rs571365493
NM_000138.4(FBN1):c.6302C>T (p.Thr2101Met) rs200816828
NM_000138.4(FBN1):c.6314-15G>A rs200841830
NM_000138.4(FBN1):c.6594C>T (p.Pro2198=) rs111844882
NM_000138.4(FBN1):c.6681A>C (p.Ser2227=) rs363824
NM_000138.4(FBN1):c.6700G>A (p.Val2234Met) rs112084407
NM_000138.4(FBN1):c.6705A>C (p.Gly2235=) rs2229326
NM_000138.4(FBN1):c.6801C>T (p.Asn2267=) rs886051245
NM_000138.4(FBN1):c.6832C>T (p.Pro2278Ser) rs363835
NM_000138.4(FBN1):c.6837G>A (p.Gly2279=) rs140584234
NM_000138.4(FBN1):c.6917G>A (p.Arg2306His) rs770443276
NM_000138.4(FBN1):c.6987C>G (p.Asp2329Glu) rs363831
NM_000138.4(FBN1):c.7098C>T (p.Asp2366=) rs1005074
NM_000138.4(FBN1):c.7497A>G (p.Leu2499=) rs148516442
NM_000138.4(FBN1):c.75G>A (p.Ala25=) rs543230518
NM_000138.4(FBN1):c.783T>C (p.Asn261=) rs113721547
NM_000138.4(FBN1):c.7902C>T (p.Pro2634=) rs138621371
NM_000138.4(FBN1):c.79G>A (p.Ala27Thr) rs25397
NM_000138.4(FBN1):c.8149G>A (p.Glu2717Lys) rs187553035
NM_000138.4(FBN1):c.8176C>T (p.Arg2726Trp) rs61746008
NM_000138.4(FBN1):c.8283A>T (p.Thr2761=) rs146120912
NM_000138.4(FBN1):c.8311G>A (p.Val2771Ile) rs193922244
NM_000138.4(FBN1):c.8363C>T (p.Thr2788Met) rs143007898
NM_000138.4(FBN1):c.8502T>C (p.Thr2834=) rs363847
NM_000138.4(FBN1):c.902G>T (p.Gly301Val) rs142888621
NM_000138.4(FBN1):c.986T>C (p.Ile329Thr) rs12324002
NM_000169.2(GLA):c.-12G>A rs3027585
NM_000169.2(GLA):c.-8C>G rs371291716
NM_000169.2(GLA):c.1153A>G (p.Thr385Ala) rs397515869
NM_000169.2(GLA):c.123C>T (p.Thr41=) rs137902198
NM_000169.2(GLA):c.129C>T (p.Gly43=) rs146177035
NM_000169.2(GLA):c.335G>A (p.Arg112His) rs372966991
NM_000169.2(GLA):c.352C>T (p.Arg118Cys) rs148158093
NM_000169.2(GLA):c.376A>G (p.Ser126Gly) rs149391489
NM_000169.2(GLA):c.416A>G (p.Asn139Ser) rs138886989
NM_000169.2(GLA):c.48T>G (p.Leu16=) rs201449986
NM_000169.2(GLA):c.937G>T (p.Asp313Tyr) rs28935490
NM_000179.2(MSH6):c.*10A>G rs757778351
NM_000179.2(MSH6):c.*4_*7dupGACT rs765313977
NM_000179.2(MSH6):c.-16C>A rs1064794403
NM_000179.2(MSH6):c.-18G>T rs199913053
NM_000179.2(MSH6):c.-2G>T rs374748889
NM_000179.2(MSH6):c.-6G>C rs730881822
NM_000179.2(MSH6):c.-6G>T rs730881822
NM_000179.2(MSH6):c.-7T>A rs1057523142
NM_000179.2(MSH6):c.-8C>T rs565211544
NM_000179.2(MSH6):c.1019T>C (p.Phe340Ser) rs61753793
NM_000179.2(MSH6):c.102C>A (p.Ala34=) rs201132087
NM_000179.2(MSH6):c.1037C>T (p.Ser346Phe) rs567785169
NM_000179.2(MSH6):c.1049C>T (p.Ala350Val) rs587782331
NM_000179.2(MSH6):c.1050C>T (p.Ala350=) rs730881802
NM_000179.2(MSH6):c.1054G>A (p.Val352Ile) rs730881787
NM_000179.2(MSH6):c.105C>T (p.Ala35=) rs998365223
NM_000179.2(MSH6):c.1063G>A (p.Gly355Ser) rs587778531
NM_000179.2(MSH6):c.1068T>C (p.Gly356=) rs749752524
NM_000179.2(MSH6):c.107C>T (p.Ala36Val) rs61756469
NM_000179.2(MSH6):c.1081C>T (p.Arg361Cys) rs587782651
NM_000179.2(MSH6):c.10C>T (p.Gln4Ter) rs786201042
NM_000179.2(MSH6):c.1109T>C (p.Leu370Ser) rs587779204
NM_000179.2(MSH6):c.1132A>C (p.Arg378=) rs781572949
NM_000179.2(MSH6):c.1135_1139delAGAGA (p.Arg379Terfs) rs267608077
NM_000179.2(MSH6):c.1144C>T (p.His382Tyr) rs587779207
NM_000179.2(MSH6):c.115G>C (p.Gly39Arg) rs751838296
NM_000179.2(MSH6):c.1164C>T (p.His388=) rs55708305
NM_000179.2(MSH6):c.1167C>T (p.Pro389=) rs1042819
NM_000179.2(MSH6):c.1168G>A (p.Asp390Asn) rs147737737
NM_000179.2(MSH6):c.116G>A (p.Gly39Glu) rs1042821
NM_000179.2(MSH6):c.1170T>C (p.Asp390=) rs55882234
NM_000179.2(MSH6):c.117G>A (p.Gly39=) rs756673077
NM_000179.2(MSH6):c.1186C>G (p.Leu396Val) rs2020908
NM_000179.2(MSH6):c.124C>T (p.Pro42Ser) rs34014629
NM_000179.2(MSH6):c.1295T>C (p.Phe432Ser) rs750528093
NM_000179.2(MSH6):c.131C>T (p.Pro44Leu) rs863224615
NM_000179.2(MSH6):c.1346T>C (p.Leu449Pro) rs63750741
NM_000179.2(MSH6):c.1364A>C (p.Asn455Thr) rs200938360
NM_000179.2(MSH6):c.1403G>A (p.Arg468His) rs41295268
NM_000179.2(MSH6):c.1449G>T (p.Val483=) rs35590297
NM_000179.2(MSH6):c.1474A>G (p.Met492Val) rs61754783
NM_000179.2(MSH6):c.1508C>G (p.Ser503Cys) rs63750897
NM_000179.2(MSH6):c.1509C>T (p.Ser503=) rs545020313
NM_000179.2(MSH6):c.1526T>C (p.Val509Ala) rs63751005
NM_000179.2(MSH6):c.1565A>G (p.Gln522Arg) rs63751009
NM_000179.2(MSH6):c.1569T>G (p.Thr523=) rs587779214
NM_000179.2(MSH6):c.1618C>A (p.Leu540Ile) rs201996928
NM_000179.2(MSH6):c.161G>C (p.Gly54Ala) rs63751098
NM_000179.2(MSH6):c.1634_1635delAA (p.Lys545Argfs) rs267608064
NM_000179.2(MSH6):c.1665A>G (p.Ala555=) rs146785465
NM_000179.2(MSH6):c.1668T>C (p.Tyr556=) rs730882130
NM_000179.2(MSH6):c.1677C>T (p.Cys559=) rs63749893
NM_000179.2(MSH6):c.1691C>A (p.Ser564Ter) rs864622153
NM_000179.2(MSH6):c.1696G>A (p.Gly566Arg) rs63749973
NM_000179.2(MSH6):c.1740G>A (p.Ser580=) rs762089407
NM_000179.2(MSH6):c.1746T>G (p.Phe582Leu) rs201518545
NM_000179.2(MSH6):c.1776A>T (p.Val592=) rs56132616
NM_000179.2(MSH6):c.178T>C (p.Leu60=) rs35819209
NM_000179.2(MSH6):c.1794A>G (p.Lys598=) rs786201210
NM_000179.2(MSH6):c.1822A>G (p.Ile608Val) rs201613780
NM_000179.2(MSH6):c.1844G>C (p.Cys615Ser) rs730881793
NM_000179.2(MSH6):c.1847C>G (p.Ser616Cys) rs772363120
NM_000179.2(MSH6):c.184C>A (p.Arg62Ser) rs876659508
NM_000179.2(MSH6):c.1867C>G (p.Pro623Ala) rs3136334
NM_000179.2(MSH6):c.1869C>T (p.Pro623=) rs141242295
NM_000179.2(MSH6):c.186C>A (p.Arg62=) rs1042820
NM_000179.2(MSH6):c.1870G>A (p.Gly624Ser) rs868760377
NM_000179.2(MSH6):c.1875C>T (p.Ser625=) rs63749886
NM_000179.2(MSH6):c.187T>C (p.Ser63Pro) rs763702846
NM_000179.2(MSH6):c.1917G>A (p.Glu639=) rs368059229
NM_000179.2(MSH6):c.1932G>C (p.Arg644Ser) rs34938432
NM_000179.2(MSH6):c.1937A>G (p.Lys646Arg) rs201096652
NM_000179.2(MSH6):c.194C>T (p.Ser65Leu) rs41294984
NM_000179.2(MSH6):c.1974G>A (p.Val658=) rs372916347
NM_000179.2(MSH6):c.2006T>C (p.Ile669Thr) rs555209664
NM_000179.2(MSH6):c.2027A>G (p.Lys676Arg) rs143643688
NM_000179.2(MSH6):c.2030G>C (p.Ser677Thr) rs587779224
NM_000179.2(MSH6):c.2061T>A (p.Cys687Ter) rs267608068
NM_000179.2(MSH6):c.2141C>G (p.Ser714Cys) rs730881796
NM_000179.2(MSH6):c.2147C>T (p.Thr716Ile) rs587782805
NM_000179.2(MSH6):c.2161A>C (p.Arg721=) rs537604099
NM_000179.2(MSH6):c.2173A>G (p.Ile725Val) rs148898662
NM_000179.2(MSH6):c.2175C>G (p.Ile725Met) rs63750304
NM_000179.2(MSH6):c.2187C>A (p.Ala729=) rs375610656
NM_000179.2(MSH6):c.2230dupG (p.Glu744Glyfs) rs786201050
NM_000179.2(MSH6):c.2239C>T (p.Leu747=) rs63751305
NM_000179.2(MSH6):c.2249C>A (p.Thr750Lys) rs730881817
NM_000179.2(MSH6):c.2253T>C (p.Asn751=) rs2020913
NM_000179.2(MSH6):c.2271C>T (p.Thr757=) rs142172006
NM_000179.2(MSH6):c.2272C>T (p.Leu758=) rs56371757
NM_000179.2(MSH6):c.2314C>A (p.Arg772=) rs63750138
NM_000179.2(MSH6):c.2314C>T (p.Arg772Trp) rs63750138
NM_000179.2(MSH6):c.2319C>T (p.Leu773=) rs63749895
NM_000179.2(MSH6):c.2384T>C (p.Ile795Thr) rs202127474
NM_000179.2(MSH6):c.2398G>C (p.Val800Leu) rs61748083
NM_000179.2(MSH6):c.2400T>C (p.Val800=) rs267608071
NM_000179.2(MSH6):c.2413A>G (p.Ile805Val) rs928923556
NM_000179.2(MSH6):c.2418C>T (p.Ser806=) rs770992427
NM_000179.2(MSH6):c.241G>A (p.Ala81Thr) rs587779239
NM_000179.2(MSH6):c.242C>T (p.Ala81Val) rs587779924
NM_000179.2(MSH6):c.2479A>G (p.Asn827Asp) rs878853716
NM_000179.2(MSH6):c.249T>G (p.Ala83=) rs876658308
NM_000179.2(MSH6):c.251C>T (p.Ala84Val) rs878853717
NM_000179.2(MSH6):c.255C>A (p.Pro85=) rs587779242
NM_000179.2(MSH6):c.2561A>T (p.Lys854Met) rs34374438
NM_000179.2(MSH6):c.2561_2562delAGinsTT (p.Lys854Ile) rs587780673
NM_000179.2(MSH6):c.257C>T (p.Thr86Ile) rs768444916
NM_000179.2(MSH6):c.260+10T>G rs193922342
NM_000179.2(MSH6):c.260+22C>G rs55927047
NM_000179.2(MSH6):c.2604G>A (p.Met868Ile) rs749508276
NM_000179.2(MSH6):c.261-14C>A rs369366445
NM_000179.2(MSH6):c.2633T>C (p.Val878Ala) rs2020912
NM_000179.2(MSH6):c.2646T>C (p.Phe882=) rs1190330045
NM_000179.2(MSH6):c.2667G>T (p.Gln889His) rs149945495
NM_000179.2(MSH6):c.2724A>G (p.Glu908=) rs35389622
NM_000179.2(MSH6):c.2725T>C (p.Leu909=) rs876659785
NM_000179.2(MSH6):c.276A>G (p.Pro92=) rs1800932
NM_000179.2(MSH6):c.2780T>C (p.Ile927Thr) rs587779926
NM_000179.2(MSH6):c.2904C>G (p.Val968=) rs150683226
NM_000179.2(MSH6):c.2925C>T (p.Asn975=) rs139026662
NM_000179.2(MSH6):c.2934G>A (p.Gln978=) rs751780309
NM_000179.2(MSH6):c.2940A>G (p.Glu980=) rs730881818
NM_000179.2(MSH6):c.2958C>T (p.Thr986=) rs757866392
NM_000179.2(MSH6):c.2964C>A (p.Arg988=) rs144288981
NM_000179.2(MSH6):c.2979A>G (p.Glu993=) rs370462886
NM_000179.2(MSH6):c.3015A>G (p.Arg1005=) rs990650403
NM_000179.2(MSH6):c.3024C>T (p.Thr1008=) rs587780675
NM_000179.2(MSH6):c.3029C>T (p.Thr1010Ile) rs768925694
NM_000179.2(MSH6):c.303G>A (p.Glu101=) rs1057521533
NM_000179.2(MSH6):c.3151G>A (p.Val1051Ile) rs576269342
NM_000179.2(MSH6):c.3160A>T (p.Ile1054Phe) rs267608075
NM_000179.2(MSH6):c.3162C>T (p.Ile1054=) rs149605979
NM_000179.2(MSH6):c.3163G>C (p.Ala1055Pro) rs587779254
NM_000179.2(MSH6):c.3172+1G>T rs587779255
NM_000179.2(MSH6):c.3173-10C>A rs587780559
NM_000179.2(MSH6):c.3173-10C>T rs587780559
NM_000179.2(MSH6):c.3173-10_3173-6delCTTTT rs781520783
NM_000179.2(MSH6):c.3173-18T>A rs189672273
NM_000179.2(MSH6):c.3173-18T>C rs189672273
NM_000179.2(MSH6):c.3198T>C (p.Tyr1066=) rs199643502
NM_000179.2(MSH6):c.3203G>A (p.Arg1068Gln) rs398123230
NM_000179.2(MSH6):c.3217C>T (p.Pro1073Ser) rs142254875
NM_000179.2(MSH6):c.321T>C (p.Pro107=) rs730881823
NM_000179.2(MSH6):c.3226C>T (p.Arg1076Cys) rs63750617
NM_000179.2(MSH6):c.3238_3239delCT (p.Leu1080Valfs) rs863225406
NM_000179.2(MSH6):c.3245C>T (p.Pro1082Leu) rs191109849
NM_000179.2(MSH6):c.3246G>A (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3246G>C (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3246G>T (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3259C>A (p.Pro1087Thr) rs63750998
NM_000179.2(MSH6):c.3259C>G (p.Pro1087Ala) rs63750998
NM_000179.2(MSH6):c.3259C>T (p.Pro1087Ser) rs63750998
NM_000179.2(MSH6):c.3260C>G (p.Pro1087Arg) rs63750753
NM_000179.2(MSH6):c.3261dupC (p.Phe1088Leufs) rs267608078
NM_000179.2(MSH6):c.3264C>T (p.Phe1088=) rs35621414
NM_000179.2(MSH6):c.3265T>C (p.Leu1089=) rs34490141
NM_000179.2(MSH6):c.3283C>T (p.Arg1095Cys) rs376243329
NM_000179.2(MSH6):c.3284G>A (p.Arg1095His) rs63750253
NM_000179.2(MSH6):c.3299C>G (p.Thr1100Arg) rs63750442
NM_000179.2(MSH6):c.3300G>A (p.Thr1100=) rs540252208
NM_000179.2(MSH6):c.3306T>A (p.Thr1102=) rs2020910
NM_000179.2(MSH6):c.3334G>A (p.Asp1112Asn) rs773955368
NM_000179.2(MSH6):c.333C>T (p.Tyr111=) rs786202772
NM_000179.2(MSH6):c.3354G>A (p.Glu1118=) rs35642130
NM_000179.2(MSH6):c.3384T>C (p.Tyr1128=) rs544518097
NM_000179.2(MSH6):c.3399T>C (p.Thr1133=) rs61748084
NM_000179.2(MSH6):c.339C>T (p.His113=) rs886056141
NM_000179.2(MSH6):c.33C>G (p.Phe11Leu) rs747802641
NM_000179.2(MSH6):c.3426G>A (p.Thr1142=) rs747771350
NM_000179.2(MSH6):c.3438+11_3438+14delCTTA rs377746844
NM_000179.2(MSH6):c.3438+13dupT rs267608097
NM_000179.2(MSH6):c.3438+14A>T rs2020911
NM_000179.2(MSH6):c.3438+17G>C rs759737239
NM_000179.2(MSH6):c.3438+6T>C rs370170322
NM_000179.2(MSH6):c.3439-10T>A rs730881819
NM_000179.2(MSH6):c.3439-16C>T rs192614006
NM_000179.2(MSH6):c.3439-1G>T rs587779263
NM_000179.2(MSH6):c.3439-2A>G rs267608098
NM_000179.2(MSH6):c.3477C>T (p.Tyr1159=) rs398123231
NM_000179.2(MSH6):c.3478G>A (p.Val1160Ile) rs376799914
NM_000179.2(MSH6):c.3485_3487delCTG (p.Ala1162del) rs63751427
NM_000179.2(MSH6):c.3488A>T (p.Glu1163Val) rs63750252
NM_000179.2(MSH6):c.3513T>C (p.Asp1171=) rs63749834
NM_000179.2(MSH6):c.3557-17delA rs778393939
NM_000179.2(MSH6):c.3557-3A>T rs41295274
NM_000179.2(MSH6):c.3557-4T>A rs1553332598
NM_000179.2(MSH6):c.3557-4delT rs267608102
NM_000179.2(MSH6):c.3557-4dupT rs267608102
NM_000179.2(MSH6):c.3574delG (p.Val1192Leufs) rs1553332671
NM_000179.2(MSH6):c.359T>C (p.Ile120Thr) rs775971872
NM_000179.2(MSH6):c.3605T>C (p.Met1202Thr) rs587779273
NM_000179.2(MSH6):c.363C>T (p.Arg121=) rs587779276
NM_000179.2(MSH6):c.3647-6T>A rs182871847
NM_000179.2(MSH6):c.3647-6T>C rs182871847
NM_000179.2(MSH6):c.364G>A (p.Glu122Lys) rs143036974
NM_000179.2(MSH6):c.3675G>A (p.Thr1225=) rs730881820
NM_000179.2(MSH6):c.3705T>C (p.Leu1235=) rs545552712
NM_000179.2(MSH6):c.3724_3726delCGT (p.Arg1242del) rs63749942
NM_000179.2(MSH6):c.3725G>A (p.Arg1242His) rs63750119
NM_000179.2(MSH6):c.3727A>T (p.Thr1243Ser) rs147453999
NM_000179.2(MSH6):c.3729A>G (p.Thr1243=) rs773807182
NM_000179.2(MSH6):c.3762A>T (p.Glu1254Asp) rs375459388
NM_000179.2(MSH6):c.3786G>A (p.Val1262=) rs760771483
NM_000179.2(MSH6):c.3787C>T (p.Arg1263Cys) rs367912290
NM_000179.2(MSH6):c.3798_3801+9delTATGGTATGTGCA rs1553333168
NM_000179.2(MSH6):c.3801+14G>T rs755626529
NM_000179.2(MSH6):c.3801+17T>C rs3136365
NM_000179.2(MSH6):c.3801+4T>C rs758830540
NM_000179.2(MSH6):c.3801+5G>A rs201080919
NM_000179.2(MSH6):c.3802-7_3802-4delTCTT rs876661171
NM_000179.2(MSH6):c.3807C>T (p.Cys1269=) rs747924946
NM_000179.2(MSH6):c.3832C>A (p.Pro1278Thr) rs587782109
NM_000179.2(MSH6):c.3833C>G (p.Pro1278Arg) rs201191389
NM_000179.2(MSH6):c.3840_3846delGGAGACT (p.Glu1281Leufs) rs63751319
NM_000179.2(MSH6):c.3850dup (p.Thr1284Asnfs) rs1553333421
NM_000179.2(MSH6):c.3851C>T (p.Thr1284Met) rs63750836
NM_000179.2(MSH6):c.3852G>A (p.Thr1284=) rs2229018
NM_000179.2(MSH6):c.3879T>C (p.Ala1293=) rs752369374
NM_000179.2(MSH6):c.38A>G (p.Lys13Arg) rs41294988
NM_000179.2(MSH6):c.3911G>A (p.Arg1304Lys) rs34625968
NM_000179.2(MSH6):c.3930G>A (p.Glu1310=)
NM_000179.2(MSH6):c.3936T>C (p.Val1312=) rs61753796
NM_000179.2(MSH6):c.393A>C (p.Val131=) rs752488540
NM_000179.2(MSH6):c.3960A>G (p.Ala1320=) rs373425206
NM_000179.2(MSH6):c.3961A>G (p.Arg1321Gly) rs41295278
NM_000179.2(MSH6):c.3980_3983dupATCA (p.Leu1330Valfs) rs1553333738
NM_000179.2(MSH6):c.3986C>T (p.Ser1329Leu) rs199594809
NM_000179.2(MSH6):c.3988C>T (p.Leu1330=) rs768944975
NM_000179.2(MSH6):c.3999dupT (p.Arg1334Serfs) rs863225418
NM_000179.2(MSH6):c.4001+11_4001+15dupAACTA rs587779302
NM_000179.2(MSH6):c.4001+11_4001+35delAACTATAATGGAATTATAACTAACT rs878853743
NM_000179.2(MSH6):c.4001+12_4001+15dupACTA rs267608132
NM_000179.2(MSH6):c.4001+2_4001+5delTAAC rs267608132
NM_000179.2(MSH6):c.4001+4_4001+8dupACTAA rs587782853
NM_000179.2(MSH6):c.4001G>A (p.Arg1334Gln) rs267608122
NM_000179.2(MSH6):c.4002-10T>A rs545466048
NM_000179.2(MSH6):c.4002-14T>C rs587781041
NM_000179.2(MSH6):c.4002-19T>C rs730881821
NM_000179.2(MSH6):c.4002-4T>C rs370428032
NM_000179.2(MSH6):c.4002-8dupA rs267608139
NM_000179.2(MSH6):c.4004_4007dupAAGT (p.Cys1337Serfs) rs876658497
NM_000179.2(MSH6):c.4068_4071dupGATT (p.Lys1358Aspfs) rs55740729
NM_000179.2(MSH6):c.431G>T (p.Ser144Ile) rs3211299
NM_000179.2(MSH6):c.457+13A>G rs1800933
NM_000179.2(MSH6):c.457+7G>C rs781280171
NM_000179.2(MSH6):c.458-17A>G rs554847828
NM_000179.2(MSH6):c.476C>T (p.Ala159Val) rs587778528
NM_000179.2(MSH6):c.483G>A (p.Lys161=) rs63751030
NM_000179.2(MSH6):c.491A>C (p.His164Pro) rs146469162
NM_000179.2(MSH6):c.503C>G (p.Ala168Gly) rs774162322
NM_000179.2(MSH6):c.513A>G (p.Glu171=) rs786201116
NM_000179.2(MSH6):c.532C>T (p.Arg178Cys) rs730881813
NM_000179.2(MSH6):c.540T>C (p.Asp180=) rs1800935
NM_000179.2(MSH6):c.59C>T (p.Ala20Val) rs63750664
NM_000179.2(MSH6):c.628-17C>A rs369971640
NM_000179.2(MSH6):c.628-7C>A rs373129248
NM_000179.2(MSH6):c.628-8C>G rs767991179
NM_000179.2(MSH6):c.642C>T (p.Tyr214=) rs1800937
NM_000179.2(MSH6):c.643G>A (p.Val215Ile) rs145959653
NM_000179.2(MSH6):c.660A>C (p.Glu220Asp) rs1800938
NM_000179.2(MSH6):c.663A>C (p.Glu221Asp) rs41557217
NM_000179.2(MSH6):c.668A>G (p.Asn223Ser) rs587779316
NM_000179.2(MSH6):c.73G>T (p.Ala25Ser) rs267608026
NM_000179.2(MSH6):c.866_867delGCinsAA (p.Gly289Glu) rs267608079
NM_000179.2(MSH6):c.869T>C (p.Leu290Pro) rs751309721
NM_000179.2(MSH6):c.884A>G (p.Lys295Arg) rs267608051
NM_000179.2(MSH6):c.892C>T (p.Arg298Ter) rs146816935
NM_000179.2(MSH6):c.926C>G (p.Ser309Cys) rs544222338
NM_000179.2(MSH6):c.942C>G (p.Ser314Arg) rs150440246
NM_000179.2(MSH6):c.945T>G (p.Ser315=) rs761581941
NM_000179.2(MSH6):c.956C>T (p.Thr319Met) rs188252826
NM_000179.2(MSH6):c.957G>A (p.Thr319=) rs375210430
NM_000179.2(MSH6):c.957G>C (p.Thr319=) rs375210430
NM_000179.2(MSH6):c.984C>T (p.Ser328=) rs138143769
NM_000179.2(MSH6):c.998C>T (p.Thr333Ile) rs587781983
NM_000218.2(KCNQ1):c.1179G>T (p.Lys393Asn) rs12720457
NM_000218.2(KCNQ1):c.1189C>T (p.Arg397Trp) rs199472776
NM_000218.2(KCNQ1):c.1222C>G (p.Pro408Ala) rs28730756
NM_000218.2(KCNQ1):c.1343C>G (p.Pro448Arg) rs12720449
NM_000218.2(KCNQ1):c.1394-14C>T rs28730758
NM_000218.2(KCNQ1):c.1394-8C>T rs371488379
NM_000218.2(KCNQ1):c.1455C>T (p.Phe485=) rs17215465
NM_000218.2(KCNQ1):c.1514+3G>A rs374767819
NM_000218.2(KCNQ1):c.1749C>T (p.Arg583=) rs200670744
NM_000218.2(KCNQ1):c.1800G>A (p.Thr600=) rs147091980
NM_000218.2(KCNQ1):c.1860C>T (p.His620=) rs139893266
NM_000218.2(KCNQ1):c.1926C>T (p.Cys642=) rs12720454
NM_000218.2(KCNQ1):c.1927G>A (p.Gly643Ser) rs1800172
NM_000218.2(KCNQ1):c.1942G>A (p.Val648Ile) rs34150427
NM_000218.2(KCNQ1):c.435C>T (p.Ile145=) rs1800170
NM_000218.2(KCNQ1):c.447C>T (p.Ala149=) rs146436765
NM_000218.2(KCNQ1):c.459G>A (p.Thr153=) rs148121889
NM_000218.2(KCNQ1):c.478-8C>T rs150711844
NM_000218.2(KCNQ1):c.513C>T (p.Tyr171=) rs139042529
NM_000218.2(KCNQ1):c.584G>A (p.Arg195Gln) rs138362632
NM_000218.2(KCNQ1):c.720C>T (p.His240=) rs28730754
NM_000218.2(KCNQ1):c.776G>A (p.Arg259His) rs199472720
NM_000218.2(KCNQ1):c.811C>T (p.Leu271=) rs189991547
NM_000218.2(KCNQ1):c.820A>G (p.Ile274Val) rs199472728
NM_000218.2(KCNQ1):c.972C>T (p.Val324=) rs554518844
NM_000238.3(KCNH2):c.1039C>T (p.Pro347Ser) rs138776684
NM_000238.3(KCNH2):c.1320G>T (p.Pro440=) rs144926928
NM_000238.3(KCNH2):c.1332G>A (p.Glu444=) rs9770044
NM_000238.3(KCNH2):c.1467C>T (p.Ile489=) rs740952
NM_000238.3(KCNH2):c.1471G>A (p.Val491Ile) rs374376640
NM_000238.3(KCNH2):c.1528C>T (p.Leu510=) rs75648145
NM_000238.3(KCNH2):c.1539C>T (p.Phe513=) rs1805120
NM_000238.3(KCNH2):c.1558-5C>T rs114186001
NM_000238.3(KCNH2):c.1563C>T (p.Ile521=) rs143011005
NM_000238.3(KCNH2):c.1641G>A (p.Ala547=) rs149902084
NM_000238.3(KCNH2):c.1692A>G (p.Leu564=) rs1805121
NM_000238.3(KCNH2):c.1800C>T (p.Ser600=) rs143518632
NM_000238.3(KCNH2):c.1809C>T (p.Gly603=) rs41314375
NM_000238.3(KCNH2):c.1956T>C (p.Tyr652=) rs1137617
NM_000238.3(KCNH2):c.2127C>T (p.Asn709=) rs768572372
NM_000238.3(KCNH2):c.2131A>G (p.Ile711Val) rs199473532
NM_000238.3(KCNH2):c.2398+105delC rs546898924
NM_000238.3(KCNH2):c.2398+156G>A rs139247073
NM_000238.3(KCNH2):c.2398+178C>T rs41314366
NM_000238.3(KCNH2):c.2454G>A (p.Ser818=) rs72549418
NM_000238.3(KCNH2):c.2665T>G (p.Leu889Val) rs765427343
NM_000238.3(KCNH2):c.2690A>C (p.Lys897Thr) rs1805123
NM_000238.3(KCNH2):c.2738C>T (p.Ala913Val) rs77331749
NM_000238.3(KCNH2):c.2941A>G (p.Ser981Gly) rs76649554
NM_000238.3(KCNH2):c.2948C>T (p.Thr983Ile) rs149955375
NM_000238.3(KCNH2):c.3140G>T (p.Arg1047Leu) rs36210421
NM_000238.3(KCNH2):c.3321G>A (p.Ser1107=) rs189457419
NM_000238.3(KCNH2):c.342C>T (p.Pro114=) rs532959204
NM_000238.3(KCNH2):c.3436A>T (p.Thr1146Ser) rs778879572
NM_000238.3(KCNH2):c.442C>T (p.Arg148Trp) rs139544114
NM_000238.3(KCNH2):c.51C>G (p.Thr17=) rs144338227
NM_000238.3(KCNH2):c.77-5C>G rs72549419
NM_000248.3(MITF):c.952G>A (p.Glu318Lys) rs149617956
NM_000249.3(MLH1):c.-14C>T rs730881744
NM_000249.3(MLH1):c.-7C>T rs104894994
NM_000249.3(MLH1):c.-8G>T rs761672073
NM_000249.3(MLH1):c.1013A>G (p.Asn338Ser) rs63751467
NM_000249.3(MLH1):c.1020C>G (p.Ser340=) rs374770981
NM_000249.3(MLH1):c.1038+51C>T rs55986674
NM_000249.3(MLH1):c.1040C>A (p.Thr347Asn) rs201541505
NM_000249.3(MLH1):c.1050A>G (p.Pro350=) rs137937003
NM_000249.3(MLH1):c.1103C>T (p.Ser368Leu) rs201673334
NM_000249.3(MLH1):c.1104G>A (p.Ser368=) rs769364808
NM_000249.3(MLH1):c.1128T>C (p.Asp376=) rs267607824
NM_000249.3(MLH1):c.1136A>C (p.Tyr379Ser) rs143009528
NM_000249.3(MLH1):c.1136A>G (p.Tyr379Cys) rs143009528
NM_000249.3(MLH1):c.1151T>A (p.Val384Asp) rs63750447
NM_000249.3(MLH1):c.116+14C>G rs773103242
NM_000249.3(MLH1):c.116+5G>A rs267607710
NM_000249.3(MLH1):c.116+5G>C rs267607710
NM_000249.3(MLH1):c.1164C>T (p.Ser388=) rs1060504014
NM_000249.3(MLH1):c.1166G>A (p.Arg389Gln) rs63750361
NM_000249.3(MLH1):c.117-10G>A rs576724240
NM_000249.3(MLH1):c.1207C>T (p.Pro403Ser) rs587778897
NM_000249.3(MLH1):c.1217G>A (p.Ser406Asn) rs41294980
NM_000249.3(MLH1):c.1266C>T (p.Gly422=) rs63750791
NM_000249.3(MLH1):c.1268G>A (p.Arg423Lys) rs370687064
NM_000249.3(MLH1):c.1269G>A (p.Arg423=) rs373076967
NM_000249.3(MLH1):c.1270G>A (p.Ala424Thr) rs377433038
NM_000249.3(MLH1):c.1321G>A (p.Ala441Thr) rs63750365
NM_000249.3(MLH1):c.1327A>C (p.Lys443Gln) rs34213726
NM_000249.3(MLH1):c.1359G>C (p.Lys453Asn) rs756099600
NM_000249.3(MLH1):c.1360G>C (p.Gly454Arg) rs63750527
NM_000249.3(MLH1):c.1379A>C (p.Glu460Ala) rs202038499
NM_000249.3(MLH1):c.1392T>C (p.Pro464=) rs63750201
NM_000249.3(MLH1):c.1410-10T>G rs372053184
NM_000249.3(MLH1):c.1410-4G>T rs1057520517
NM_000249.3(MLH1):c.1420C>G (p.Arg474Gly) rs147939838
NM_000249.3(MLH1):c.1421G>A (p.Arg474Gln) rs63751083
NM_000249.3(MLH1):c.1452T>C (p.Asp484=) rs587778916
NM_000249.3(MLH1):c.1460G>A (p.Arg487Gln) rs587778917
NM_000249.3(MLH1):c.1474G>A (p.Ala492Thr) rs63751145
NM_000249.3(MLH1):c.1517T>C (p.Val506Ala) rs63749909
NM_000249.3(MLH1):c.1558+11G>A rs267607833
NM_000249.3(MLH1):c.1558+14G>A rs41562513
NM_000249.3(MLH1):c.1558+4C>T rs531873434
NM_000249.3(MLH1):c.1558+5G>A rs199935667
NM_000249.3(MLH1):c.1559-11T>C rs730881750
NM_000249.3(MLH1):c.1565G>A (p.Arg522Gln) rs63751630
NM_000249.3(MLH1):c.1569G>T (p.Glu523Asp) rs63751680
NM_000249.3(MLH1):c.1590C>T (p.Phe530=) rs752241564
NM_000249.3(MLH1):c.1637A>G (p.Lys546Arg) rs587779954
NM_000249.3(MLH1):c.1665T>C (p.Leu555=) rs749204990
NM_000249.3(MLH1):c.1668-19A>G rs9876116
NM_000249.3(MLH1):c.1668-1G>A rs267607845
NM_000249.3(MLH1):c.1698T>C (p.Tyr566=) rs876658915
NM_000249.3(MLH1):c.1731+11A>T rs886058384
NM_000249.3(MLH1):c.1731+8T>C rs370108219
NM_000249.3(MLH1):c.1732-19T>A rs77120160
NM_000249.3(MLH1):c.1733A>G (p.Glu578Gly) rs63751612
NM_000249.3(MLH1):c.1742C>T (p.Pro581Leu) rs63751684
NM_000249.3(MLH1):c.1808C>G (p.Pro603Arg) rs63750876
NM_000249.3(MLH1):c.1820T>A (p.Leu607His) rs41295284
NM_000249.3(MLH1):c.1852A>G (p.Lys618Glu) rs35001569
NM_000249.3(MLH1):c.1852_1853delAAinsGC (p.Lys618Ala) rs35502531
NM_000249.3(MLH1):c.1853A>C (p.Lys618Thr) rs63750449
NM_000249.3(MLH1):c.1853A>G (p.Lys618Arg) rs63750449
NM_000249.3(MLH1):c.1878C>T (p.Phe626=) rs63751214
NM_000249.3(MLH1):c.1896+17T>C rs193922368
NM_000249.3(MLH1):c.1897-17C>G rs2308316
NM_000249.3(MLH1):c.1897-2A>G rs267607871
NM_000249.3(MLH1):c.1908G>A (p.Leu636=) rs1800145
NM_000249.3(MLH1):c.191A>G (p.Asn64Ser) rs63750952
NM_000249.3(MLH1):c.1937A>G (p.Tyr646Cys) rs35045067
NM_000249.3(MLH1):c.1959G>T (p.Leu653=) rs1800146
NM_000249.3(MLH1):c.1963A>G (p.Ile655Val) rs55907433
NM_000249.3(MLH1):c.1964T>C (p.Ile655Thr) rs63751225
NM_000249.3(MLH1):c.1976G>A (p.Arg659Gln) rs63749900
NM_000249.3(MLH1):c.198C>T (p.Thr66=) rs61751642
NM_000249.3(MLH1):c.1990-6G>A rs117221851
NM_000249.3(MLH1):c.199G>A (p.Gly67Arg) rs63750206
NM_000249.3(MLH1):c.2001C>T (p.Asp667=) rs63750014
NM_000249.3(MLH1):c.2040C>T (p.Cys680=) rs63749867
NM_000249.3(MLH1):c.2041G>A (p.Ala681Thr) rs63750217
NM_000249.3(MLH1):c.2066A>G (p.Gln689Arg) rs63750702
NM_000249.3(MLH1):c.207+12C>T rs121909450
NM_000249.3(MLH1):c.2070C>T (p.Tyr690=) rs550890395
NM_000249.3(MLH1):c.2071A>G (p.Ile691Val) rs201748079
NM_000249.3(MLH1):c.2101C>A (p.Gln701Lys) rs63750114
NM_000249.3(MLH1):c.2103+1G>T rs267607888
NM_000249.3(MLH1):c.2103+6G>T rs1057521607
NM_000249.3(MLH1):c.2104-11G>A rs147984696
NM_000249.3(MLH1):c.2104-19C>T rs74598902
NM_000249.3(MLH1):c.2104-22T>G rs267607890
NM_000249.3(MLH1):c.2146G>A (p.Val716Met) rs35831931
NM_000249.3(MLH1):c.2152C>T (p.His718Tyr) rs2020873
NM_000249.3(MLH1):c.2174G>A (p.Arg725His) rs566928243
NM_000249.3(MLH1):c.2210A>T (p.Asp737Val) rs267607885
NM_000249.3(MLH1):c.2246T>C (p.Leu749Pro) rs267607894
NM_000249.3(MLH1):c.2252A>G (p.Lys751Arg) rs140195825
NM_000249.3(MLH1):c.230G>A (p.Cys77Tyr) rs63750437
NM_000249.3(MLH1):c.244A>G (p.Thr82Ala) rs587778998
NM_000249.3(MLH1):c.24T>A (p.Ile8=) rs748406142
NM_000249.3(MLH1):c.277A>G (p.Ser93Gly) rs41295282
NM_000249.3(MLH1):c.290A>G (p.Tyr97Cys) rs773647920
NM_000249.3(MLH1):c.303T>G (p.Gly101=) rs4647220
NM_000249.3(MLH1):c.306+3A>G rs267607731
NM_000249.3(MLH1):c.306+8A>G rs587779002
NM_000249.3(MLH1):c.306G>T (p.Glu102Asp) rs63751665
NM_000249.3(MLH1):c.307-19A>G rs121909451
NM_000249.3(MLH1):c.30G>T (p.Arg10=) rs876660759
NM_000249.3(MLH1):c.375A>G (p.Ala125=) rs1800144
NM_000249.3(MLH1):c.394G>C (p.Asp132His) rs28930073
NM_000249.3(MLH1):c.42A>C (p.Thr14=) rs369737664
NM_000249.3(MLH1):c.438A>G (p.Gln146=) rs377279035
NM_000249.3(MLH1):c.454-6G>A rs781238673
NM_000249.3(MLH1):c.469dup (p.Tyr157Leufs) rs63751101
NM_000249.3(MLH1):c.474C>T (p.Asn158=) rs4647256
NM_000249.3(MLH1):c.479C>T (p.Ala160Val) rs63749924
NM_000249.3(MLH1):c.492A>C (p.Lys164Asn) rs765014361
NM_000249.3(MLH1):c.52C>T (p.Arg18Cys) rs367654552
NM_000249.3(MLH1):c.545+19G>T rs41285099
NM_000249.3(MLH1):c.552A>T (p.Ser184=) rs35225190
NM_000249.3(MLH1):c.579A>G (p.Ser193=) rs587781038
NM_000249.3(MLH1):c.583A>T (p.Lys195Ter) rs863225383
NM_000249.3(MLH1):c.588+11G>C rs4647258
NM_000249.3(MLH1):c.589-15C>T rs55658850
NM_000249.3(MLH1):c.589-8T>C rs1017112753
NM_000249.3(MLH1):c.589-9_589-6delGTTT rs587779026
NM_000249.3(MLH1):c.595G>C (p.Glu199Gln) rs63749887
NM_000249.3(MLH1):c.621A>G (p.Leu207=) rs770554901
NM_000249.3(MLH1):c.626A>G (p.Asn209Ser) rs150478207
NM_000249.3(MLH1):c.637G>A (p.Val213Met) rs2308317
NM_000249.3(MLH1):c.63G>A (p.Ala21=) rs1553637274
NM_000249.3(MLH1):c.649C>T (p.Arg217Cys) rs4986984
NM_000249.3(MLH1):c.655A>G (p.Ile219Val) rs1799977
NM_000249.3(MLH1):c.65G>C (p.Gly22Ala) rs41295280
NM_000249.3(MLH1):c.677+9A>G rs1060500696
NM_000249.3(MLH1):c.678-2A>G rs587779035
NM_000249.3(MLH1):c.678-9_678-8delTT
NM_000249.3(MLH1):c.69A>G (p.Glu23=) rs63750555
NM_000249.3(MLH1):c.702G>A (p.Glu234=) rs35908749
NM_000249.3(MLH1):c.778C>T (p.Leu260Phe) rs63750642
NM_000249.3(MLH1):c.790+10A>G rs182733777
NM_000249.3(MLH1):c.790C>G (p.His264Asp) rs63751597
NM_000249.3(MLH1):c.791-2A>G rs267607794
NM_000249.3(MLH1):c.791-5T>G rs267607788
NM_000249.3(MLH1):c.793C>T (p.Arg265Cys) rs63751194
NM_000249.3(MLH1):c.794G>A (p.Arg265His) rs63751448
NM_000249.3(MLH1):c.803A>G (p.Glu268Gly) rs63750650
NM_000249.3(MLH1):c.808A>G (p.Thr270Ala) rs371302926
NM_000249.3(MLH1):c.843A>C (p.Ala281=) rs146796765
NM_000249.3(MLH1):c.882C>T (p.Leu294=) rs63751707
NM_000249.3(MLH1):c.884+15A>G rs372817491
NM_000249.3(MLH1):c.884+16A>G rs377598055
NM_000249.3(MLH1):c.885-16_885-15delCT rs267607804
NM_000249.3(MLH1):c.885-2A>G rs267607805
NM_000249.3(MLH1):c.885-5G>T rs267607802
NM_000249.3(MLH1):c.91_92delGCinsTG (p.Ala31Cys) rs63749994
NM_000249.3(MLH1):c.925C>T (p.Pro309Ser) rs267607808
NM_000249.3(MLH1):c.927C>T (p.Pro309=) rs63749896
NM_000249.3(MLH1):c.94A>G (p.Ile32Val) rs2020872
NM_000249.3(MLH1):c.954C>T (p.His318=) rs146777069
NM_000249.3(MLH1):c.955G>A (p.Glu319Lys) rs63750796
NM_000249.3(MLH1):c.969G>C (p.Leu323=) rs1553648063
NM_000249.3(MLH1):c.974G>A (p.Arg325Gln) rs63750268
NM_000249.3(MLH1):c.977T>C (p.Val326Ala) rs63751049
NM_000249.3(MLH1):c.9C>G (p.Phe3Leu) rs779759678
NM_000251.2(MSH2):c.-9G>A rs547444746
NM_000251.2(MSH2):c.1045C>G (p.Pro349Ala) rs267607939
NM_000251.2(MSH2):c.1077-10T>C rs17224360
NM_000251.2(MSH2):c.1077-18C>G rs746526239
NM_000251.2(MSH2):c.1077-1G>C rs267607944
NM_000251.2(MSH2):c.1077-3C>T rs758182607
NM_000251.2(MSH2):c.1099G>A (p.Val367Ile) rs80285180
NM_000251.2(MSH2):c.1131A>G (p.Gln377=) rs181852377
NM_000251.2(MSH2):c.115C>A (p.Arg39=) rs786202334
NM_000251.2(MSH2):c.1168C>T (p.Leu390Phe) rs17224367
NM_000251.2(MSH2):c.118G>A (p.Gly40Ser) rs63751260
NM_000251.2(MSH2):c.1191A>T (p.Gln397His) rs768694189
NM_000251.2(MSH2):c.1194A>G (p.Ala398=) rs1060504412
NM_000251.2(MSH2):c.1217G>A (p.Arg406Gln) rs146567853
NM_000251.2(MSH2):c.1221C>G (p.Leu407=) rs63750813
NM_000251.2(MSH2):c.1255C>A (p.Gln419Lys) rs63750006
NM_000251.2(MSH2):c.1270C>T (p.His424Tyr) rs587782278
NM_000251.2(MSH2):c.1271A>G (p.His424Arg) rs200429136
NM_000251.2(MSH2):c.1275A>G (p.Glu425=) rs63751650
NM_000251.2(MSH2):c.1276+11A>G rs189015988
NM_000251.2(MSH2):c.1276+16G>A rs368120695
NM_000251.2(MSH2):c.1276+1G>A rs267607950
NM_000251.2(MSH2):c.1276+23dup rs587779081
NM_000251.2(MSH2):c.1276+7A>G rs748554540
NM_000251.2(MSH2):c.1277-16T>C rs368653974
NM_000251.2(MSH2):c.1277-8T>C rs145400590
NM_000251.2(MSH2):c.128A>G (p.Tyr43Cys) rs17217723
NM_000251.2(MSH2):c.1311G>T (p.Val437=) rs730881781
NM_000251.2(MSH2):c.1316_1318delCTC (p.Pro439del) rs587779082
NM_000251.2(MSH2):c.1319T>C (p.Leu440Pro) rs587779084
NM_000251.2(MSH2):c.132G>A (p.Thr44=) rs766856128
NM_000251.2(MSH2):c.1356A>G (p.Glu452=) rs63751212
NM_000251.2(MSH2):c.1360A>G (p.Ile454Val) rs587781627
NM_000251.2(MSH2):c.1387-14_1387-11delTGTT rs370436680
NM_000251.2(MSH2):c.1387-4G>C rs376796243
NM_000251.2(MSH2):c.1387-8G>T rs187525243
NM_000251.2(MSH2):c.138C>G (p.His46Gln) rs33946261
NM_000251.2(MSH2):c.1418C>T (p.Ser473Leu) rs63751403
NM_000251.2(MSH2):c.1461C>G (p.Asp487Glu) rs35107951
NM_000251.2(MSH2):c.1462T>G (p.Leu488Val) rs587781314
NM_000251.2(MSH2):c.1488A>G (p.Leu496=) rs267607960
NM_000251.2(MSH2):c.1489A>G (p.Ile497Val) rs755501968
NM_000251.2(MSH2):c.1511-9A>T rs12998837
NM_000251.2(MSH2):c.1560A>G (p.Gly520=) rs63750820
NM_000251.2(MSH2):c.1563T>C (p.Tyr521=) rs63750330
NM_000251.2(MSH2):c.1571G>C (p.Arg524Pro) rs63751207
NM_000251.2(MSH2):c.157G>A (p.Ala53Thr) rs755931648
NM_000251.2(MSH2):c.159C>T (p.Ala53=) rs780178752
NM_000251.2(MSH2):c.1605C>T (p.Asn535=) rs587779098
NM_000251.2(MSH2):c.1638G>A (p.Lys546=) rs372350768
NM_000251.2(MSH2):c.164G>A (p.Arg55Gln) rs748196422
NM_000251.2(MSH2):c.1659C>T (p.Asn553=) rs869312796
NM_000251.2(MSH2):c.1661+12G>A rs3732183
NM_000251.2(MSH2):c.1661+17T>G rs377461923
NM_000251.2(MSH2):c.1662-10C>T rs752606387
NM_000251.2(MSH2):c.1662-18T>C rs376235435
NM_000251.2(MSH2):c.1662-9G>A rs17218356
NM_000251.2(MSH2):c.1662C>T (p.Ser554=) rs587778525
NM_000251.2(MSH2):c.1666T>C (p.Leu556=) rs61756466
NM_000251.2(MSH2):c.1680T>C (p.Asn560=) rs200056411
NM_000251.2(MSH2):c.1690A>G (p.Thr564Ala) rs55778204
NM_000251.2(MSH2):c.1717G>A (p.Ala573Thr) rs200766962
NM_000251.2(MSH2):c.1730T>C (p.Ile577Thr) rs63749910
NM_000251.2(MSH2):c.1737A>G (p.Lys579=) rs61756467
NM_000251.2(MSH2):c.1748A>G (p.Asn583Ser) rs201118107
NM_000251.2(MSH2):c.1759+1G>A rs587779108
NM_000251.2(MSH2):c.1760-16T>G rs768370188
NM_000251.2(MSH2):c.1760-1G>A rs587779110
NM_000251.2(MSH2):c.1760-4A>G rs1060504409
NM_000251.2(MSH2):c.1774A>G (p.Met592Val) rs371614039
NM_000251.2(MSH2):c.1787A>G (p.Asn596Ser) rs41295288
NM_000251.2(MSH2):c.1807G>A (p.Asp603Asn) rs63750657
NM_000251.2(MSH2):c.182A>C (p.Gln61Pro) rs587779113
NM_000251.2(MSH2):c.1837A>C (p.Asn613His) rs200147804
NM_000251.2(MSH2):c.1854A>G (p.Pro618=) rs786203744
NM_000251.2(MSH2):c.1862G>T (p.Arg621Leu) rs759263820
NM_000251.2(MSH2):c.1886A>G (p.Gln629Arg) rs61756468
NM_000251.2(MSH2):c.1898T>C (p.Ile633Thr) rs864622093
NM_000251.2(MSH2):c.1938T>C (p.Asp646=) rs775484022
NM_000251.2(MSH2):c.1945G>A (p.Ala649Thr) rs786201822
NM_000251.2(MSH2):c.1963G>A (p.Val655Ile) rs549467183
NM_000251.2(MSH2):c.1979A>G (p.Asp660Gly) rs1085308057
NM_000251.2(MSH2):c.198C>T (p.Tyr66=) rs730881784
NM_000251.2(MSH2):c.1A>C (p.Met1Leu) rs267607911
NM_000251.2(MSH2):c.2005+8dupA rs267607992
NM_000251.2(MSH2):c.2005G>T (p.Gly669Cys) rs63751668
NM_000251.2(MSH2):c.2006-2A>G rs267607991
NM_000251.2(MSH2):c.2006-4G>A rs369853630
NM_000251.2(MSH2):c.2006-6T>C rs2303428
NM_000251.2(MSH2):c.2010C>T (p.Pro670=) rs766618212
NM_000251.2(MSH2):c.2043A>G (p.Gln681=) rs730881763
NM_000251.2(MSH2):c.2074G>A (p.Gly692Arg) rs63750232
NM_000251.2(MSH2):c.2074G>C (p.Gly692Arg) rs63750232
NM_000251.2