ClinVar Miner

Variants from CeGaT Praxis fuer Humangenetik Tuebingen with conflicting interpretations

Location: Germany — Primary collection method: clinical testing
Minimum review status of the submission from CeGaT Praxis fuer Humangenetik Tuebingen: Collection method of the submission from CeGaT Praxis fuer Humangenetik Tuebingen:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
7336 2169 37 1054 3180 49 546 4265

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
CeGaT Praxis fuer Humangenetik Tuebingen pathogenic likely pathogenic uncertain significance likely benign benign association drug response protective risk factor other
likely pathogenic 234 2 143 22 14 0 1 0 5 1
uncertain significance 214 207 31 2357 1102 1 4 3 23 8
likely benign 29 15 551 4 820 1 0 0 7 2

Submitter to submitter summary #

Total submitters: 273
Download table as spreadsheet
Submitter Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
Invitae 0 1921 0 679 2147 6 112 2943
GeneDx 0 1246 0 389 1098 1 105 1592
EGL Genetic Diagnostics,Eurofins Clinical Diagnostics 0 907 0 189 569 7 57 822
Ambry Genetics 0 799 0 134 494 0 36 664
Illumina Clinical Services Laboratory,Illumina 0 863 0 17 509 0 44 567
Athena Diagnostics Inc 0 178 0 112 282 0 19 412
Laboratory for Molecular Medicine, Partners HealthCare Personalized Medicine 0 494 0 83 297 0 24 404
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories 0 244 0 117 176 0 23 316
PreventionGenetics,PreventionGenetics 0 222 0 92 213 0 9 314
Color 0 296 0 88 193 0 11 292
Integrated Genetics/Laboratory Corporation of America 0 161 5 110 127 0 28 269
OMIM 0 14 0 82 12 32 118 234
Mendelics 0 255 0 42 165 0 23 229
Genetic Services Laboratory, University of Chicago 0 269 0 35 149 1 25 210
Biesecker Lab/Clinical Genomics Section,National Institutes of Health 0 96 27 23 134 0 2 186
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 0 130 0 14 115 0 15 144
Quest Diagnostics Nichols Institute San Juan Capistrano 0 115 0 62 69 0 9 140
Counsyl 0 234 0 19 53 0 34 106
CHEO Genetics Diagnostic Laboratory,Children's Hospital of Eastern Ontario 0 94 0 24 56 0 3 83
Diagnostic Laboratory, Department of Genetics,University Medical Center Groningen 0 57 0 25 53 0 4 82
Center for Advanced Laboratory Medicine, UC San Diego Health,University of California San Diego 0 17 0 12 66 0 0 78
Mayo Clinic Genetic Testing Laboratories,Mayo Clinic 0 106 0 21 41 0 11 73
DNA and Cytogenetics Diagnostics Unit,Erasmus Medical Center 0 57 0 32 37 0 4 73
GeneReviews 0 9 1 33 3 0 34 71
Division of Genomic Diagnostics,The Children's Hospital of Philadelphia 0 54 0 25 34 0 8 67
Department of Pathology and Laboratory Medicine,Sinai Health System 0 21 0 36 17 0 1 54
Genome Diagnostics Laboratory,University Medical Center Utrecht 0 40 0 23 26 0 3 52
Baylor Genetics 0 9 0 28 2 0 18 48
True Health Diagnostics 0 77 0 8 34 1 3 46
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) 0 8 0 30 14 0 1 45
CSER _CC_NCGL, University of Washington 0 86 0 3 30 0 7 40
Sharing Clinical Reports Project (SCRP) 0 4 0 18 16 0 1 35
Fulgent Genetics,Fulgent Genetics 0 258 0 16 10 0 7 33
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute 0 37 0 0 20 2 6 28
Michigan Medical Genetics Laboratories,University of Michigan 0 2 0 18 7 0 1 26
Blueprint Genetics 0 54 0 2 11 2 11 26
Institute of Human Genetics,Klinikum rechts der Isar 0 1 0 12 0 0 13 25
NIHR Bioresource Rare Diseases, University of Cambridge 0 19 0 2 2 0 20 24
Genome Diagnostics Laboratory,VU University Medical Center Amsterdam 0 22 0 7 16 0 0 23
Breast Cancer Information Core (BIC) (BRCA2) 0 21 0 7 13 0 1 21
Genomic Research Center, Shahid Beheshti University of Medical Sciences 0 32 0 2 6 0 13 21
Wong Mito Lab, Molecular and Human Genetics, Baylor College of Medicine 0 8 0 9 8 0 4 21
Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago 0 29 0 1 14 0 5 20
Centre for Mendelian Genomics,University Medical Centre Ljubljana 0 27 0 5 2 2 10 19
Center for Human Genetics, Inc 0 32 0 1 15 0 0 16
RettBASE 0 3 0 7 8 0 1 16
Cancer Genetics and Genomics Laboratory,British Columbia Cancer Agency 0 2 0 14 2 0 0 16
University of Washington Department of Laboratory Medicine, University of Washington 0 11 0 3 8 1 4 16
Sharon lab,Hadassah-Hebrew University Medical Center 0 5 0 4 0 0 11 15
Institute of Human Genetics, Univ. Regensburg,Univ. Regensburg 0 6 0 3 1 0 10 14
Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde,Academisch Medisch Centrum 0 0 0 5 3 0 6 14
Medical Genetics Laboratory, Kennedy Center,Juliane Marie Center, Rigshospitalet 0 15 0 2 3 0 8 13
Vantari Genetics 0 3 0 6 7 0 0 13
International Society for Gastrointestinal Hereditary Tumours (InSiGHT) 0 12 0 7 5 0 0 12
Pathway Genomics 0 14 0 6 4 0 2 12
Robarts Research Institute,Western University 0 18 0 2 9 0 1 12
GeneKor MSA 0 35 0 3 5 1 2 11
Equipe Genetique des Anomalies du Developpement, Université de Bourgogne 0 15 0 1 3 0 7 11
Bioinformatics Core,Luxembourg Center for Systems Biomedicine 0 0 0 2 0 0 9 11
Clinical Molecular Genetics Laboratory,Johns Hopkins All Children's Hospital 0 15 0 1 5 0 4 10
Breast Cancer Information Core (BIC) (BRCA1) 0 11 0 1 8 0 1 10
Stanford Center for Inherited Cardiovascular Disease,Stanford University 0 38 0 0 6 0 3 9
Division of Human Genetics,Children's Hospital of Philadelphia 0 9 0 5 0 0 4 9
Laboratory of Genetics and Molecular Cardiology, University of São Paulo 0 9 0 1 6 0 2 9
Institute for Biomarker Research,Medical Diagnostic Laboratories, L.L.C. 0 22 0 0 9 0 0 9
Bioscientia Institut fuer Medizinische Diagnostik GmbH,Sonic Healthcare 0 11 0 4 0 0 5 9
LDLR-LOVD, British Heart Foundation 0 5 0 1 7 0 0 8
Knight Diagnostic Laboratories,Oregon Health and Sciences University 0 12 0 0 3 0 5 8
Lupski Lab, Baylor-Hopkins CMG, Baylor College of Medicine 0 10 0 0 2 0 6 8
Fundacion Hipercolesterolemia Familiar 0 4 0 2 5 0 1 8
Inherited Neuropathy Consortium 0 9 0 0 1 0 7 8
Reproductive Health Research and Development,BGI Genomics 0 4 0 4 0 0 4 8
Courtagen Diagnostics Laboratory,Courtagen Life Sciences 0 0 0 5 0 0 2 7
Agnes Ginges Centre for Molecular Cardiology,Centenary Institute 0 8 0 2 4 0 1 7
Biochemical Molecular Genetic Laboratory,King Abdulaziz Medical City 0 2 0 4 1 0 2 7
ClinGen Hearing Loss Variant Curation Expert Panel, 0 1 0 2 4 0 1 7
Johns Hopkins Genomics,Johns Hopkins University 0 1 0 1 2 0 4 7
Juha Muilu Group; Institute for Molecular Medicine Finland (FIMM) 0 0 2 0 0 0 4 6
Northcott Neuroscience Laboratory, ANZAC Research Institute 0 0 0 2 4 0 0 6
Cardiovascular Research Group,Instituto Nacional de Saude Doutor Ricardo Jorge 0 8 0 1 3 0 2 6
Undiagnosed Diseases Network,NIH 0 5 0 2 1 0 3 6
Centre de Génétique Moléculaire et Chromosomique, Unité de génétique de l'Obésité et des Dyslipidémies,APHP, GH Hôpitaux Universitaires Pitié-Salpêtrière / Charles-Foix 0 2 0 3 1 0 2 6
SIB Swiss Institute of Bioinformatics 0 8 0 4 1 0 1 6
Research Molecular Genetics Laboratory,Women's College Hospital, University of Toronto 0 1 0 4 2 0 0 6
Institute for Genomic Medicine (IGM) Clinical Laboratory,Nationwide Children's Hospital 0 8 0 2 4 0 0 6
CFTR-France 0 0 0 1 1 0 4 6
Molecular Genetics Laboratory,BC Children's and BC Women's Hospitals 0 1 0 4 0 0 1 5
Foulkes Cancer Genetics LDI, Lady Davis Institute for Medical Research 0 3 0 1 3 0 1 5
PXE International 0 0 0 1 0 0 4 5
Human Genome Sequencing Center Clinical Lab,Baylor College of Medicine 0 1 0 1 0 2 2 5
Willoughby Group, Queen's University Belfast 0 0 0 0 1 0 4 5
Institute for Integrative and Experimental Genomics,University of Luebeck 0 1 0 0 3 0 2 5
Center of Genomic medicine, Geneva,University Hospital of Geneva 0 2 0 3 0 0 2 5
Laboratory of Molecular Genetics (Pr. Bezieau's lab), CHU de Nantes 0 0 0 3 0 0 2 5
ClinGen Inherited Cardiomyopathy Variant Curation Expert Panel, 0 2 0 4 1 0 0 5
Gharavi Laboratory,Columbia University 0 2 0 0 2 0 3 5
PharmGKB 0 0 0 0 0 4 0 4
Wellcome Centre for Mitochondrial Research,Newcastle University 0 1 0 3 0 0 1 4
Centre for Genomic and Experimental Medicine,University of Edinburgh 0 0 0 0 1 0 3 4
Personalized Diabetes Medicine Program,University of Maryland School of Medicine 0 10 0 0 4 0 0 4
Database of Curated Mutations (DoCM) 0 1 0 1 0 0 3 4
Center of Medical Genetics and Primary Health Care 0 1 0 0 0 1 3 4
Department of Pathology and Molecular Medicine,Queen's University 0 3 0 4 0 0 0 4
Broad Institute Rare Disease Group,Broad Institute 0 2 0 1 0 0 3 4
German Consortium for Hereditary Breast and Ovarian Cancer Center Cologne,University Hospital Cologne 0 0 0 3 0 0 1 4
Developmental Genetics Unit,King Faisal Specialist Hospital & Research Centre 0 2 0 0 0 0 3 3
PALB2 database 0 1 0 2 1 0 0 3
Department of Ophthalmology and Visual Sciences Kyoto University 0 0 1 1 1 0 0 3
Center for Medical Genetics Ghent,University of Ghent 0 6 0 1 0 0 2 3
NeuroMeGen,Hospital Clinico Santiago de Compostela 0 1 0 1 0 0 2 3
Paul Sabatier University EA-4555, Paul Sabatier University 0 0 0 0 2 0 1 3
U4M - Lille University & CHRU Lille, Université de Lille - CHRU de Lille 0 1 0 2 0 0 1 3
Department of Immunology,Hospital Universitario Virgen del Rocio 0 0 0 0 0 0 3 3
Research and Development, ARUP Laboratories 0 3 0 2 1 0 0 3
Molecular Genetics Laboratory,Centre for Cardiovascular Surgery and Transplantation 0 2 0 1 0 0 2 3
Phosphorus, Inc. 0 9 0 0 1 0 2 3
ClinGen RASopathy Variant Curation Expert Panel 0 1 0 0 3 0 0 3
Department of Genetics,Sultan Qaboos University Hospital, Oman 0 3 0 0 1 0 2 3
Institute for Human Genetics,University Clinic Freiburg 0 0 0 0 0 0 2 2
Molecular Genetics Laboratory,Children's Mercy Hospital and Clinics 0 0 0 1 1 0 0 2
Institute of Human Genetics,Cologne University 0 1 0 0 0 0 2 2
FirmaLab 0 0 0 1 0 0 1 2
Endocrinology Clinic, Seth G.S. Medical College 0 0 0 0 0 0 2 2
ClinVar Staff, National Center for Biotechnology Information (NCBI) 0 0 0 0 0 0 2 2
Cardiovascular Biomedical Research Unit,Royal Brompton & Harefield NHS Foundation Trust 0 37 0 0 0 0 2 2
Academic Department of Medical Genetics, University of Cambridge 0 0 0 0 0 0 2 2
Institute of Human Genetics,Friedrich-Alexander-Universität Erlangen-Nürnberg 0 1 0 0 0 0 2 2
UCLA Clinical Genomics Center, UCLA 0 1 0 0 0 0 2 2
Tgen's Center For Rare Childhood Disorders,Translational Genomics Research Institute (TGEN) 0 0 0 1 0 0 1 2
Foundation for Research in Genetics and Endocrinology, FRIGE's Institute of Human Genetics 0 1 0 1 0 0 1 2
Medical Genetics, University of Parma 0 0 0 1 1 0 0 2
Oxford Medical Genetics Laboratories,Oxford University Hospitals NHS Foundation Trust 0 0 0 1 0 0 1 2
Center for Human Genetics,University of Leuven 0 3 0 0 1 0 1 2
Forensic Genetics Laboratory,Harris County Institute of Forensic Sciences 0 0 0 0 0 0 2 2
Cardiovascular Biomarker Research Laboratory,Mayo Clinic 0 3 0 0 2 0 0 2
Baylor-Hopkins Center for Mendelian Genomics,Johns Hopkins University 0 0 0 0 0 0 2 2
Soonchunhyang University Bucheon Hospital,Soonchunhyang University Medical Center 0 5 0 0 2 0 0 2
Department of Medical Genetics,University Hospital of North Norway 0 3 0 1 1 0 0 2
Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA), c/o University of Cambridge 0 0 0 1 0 0 1 2
Unit for Genetic & Epidemiological Research on Neurological Disorders,Instituto de Investigação e Inovação em Saúde 0 9 0 2 0 0 0 2
Geisinger Autism and Developmental Medicine Institute,Geisinger Health System 0 2 0 1 1 0 1 2
CHLA Center for Personalized Medicine,Children's Hospital, Los Angeles 0 4 0 0 0 0 2 2
Rare Disease Group, Clinical Genetics,Karolinska Institutet 0 0 0 0 1 0 2 2
Human Genomics Unit,Institute for molecular medicine Finland (FIMM) 0 0 0 0 0 0 2 2
Schule lab,Hertie Institute for Clinical Brain Research 0 0 0 0 2 0 0 2
Dept. of Medical Genetics, Telemark Hospital Trust 0 2 0 0 0 0 2 2
Clinical Cancer Genetics and Family Consultants,Athens Medical Center 0 0 0 0 0 0 2 2
ClinGen PTEN Variant Curation Expert Panel 0 4 0 0 2 0 0 2
ClinGen CDH1 Variant Curation Expert Panel 0 0 0 1 1 0 0 2
Codex Genetics Limited 0 0 0 2 0 0 0 2
Wessex Regional Genetics Laboratory,Salisbury District Hospital 0 0 0 1 0 0 1 2
Collagen Diagnostic Laboratory,University of Washington 0 0 0 0 0 0 1 1
Molecular Diagnostics Lab,Nemours Alfred I. duPont Hospital for Children 0 0 0 1 0 0 0 1
Clinical Biochemistry Laboratory,Health Services Laboratory 0 1 0 1 0 0 0 1
Elsea Laboratory,Baylor College of Medicine 0 0 0 0 0 0 1 1
Genetics - Viapath,Viapath, Guy's Hospital 0 0 0 0 0 0 1 1
Molecular Vision Laboratory 0 0 0 0 0 1 0 1
Cardiovascular Genetics Laboratory,PathWest Laboratory Medicine WA - Fiona Stanley Hospital 0 1 0 1 0 0 0 1
MyeliNeuroGene Lab,McGill University Health Center Research Institute 0 0 0 0 0 0 1 1
Columbia University Laboratory of Personalized Genomic Medicine,Columbia University Medical Center 0 0 0 0 0 0 1 1
Martin Pollak Laboratory, Beth Israel Deaconess Medical Center 0 0 1 0 0 0 0 1
GenMed Metabolism Lab 0 0 0 0 0 0 1 1
Unidad de Diagnostico y Tratamiento de Errores Congenitos del Metabolismo. Hospital Clínico Universitário de Santiago de Compostela 0 0 0 0 0 0 1 1
Department of Psychiatry,Nagoya University 0 0 0 0 0 0 1 1
Demyelinating Disease Laboratories, VA Medical Center and University of Tennessee 0 0 0 0 0 0 1 1
Institute of Human Genetics,University Medical Center Hamburg-Eppendorf 0 0 0 0 0 0 1 1
Department of Medical Genetics,Oslo University Hospital 0 0 0 0 0 0 1 1
U955 Equipe 11,INSERM 0 0 0 0 0 0 1 1
GOLD service, Hunter New England Health 0 0 0 0 0 0 1 1
Shaikh Laboratory, University of Colorado 0 0 0 0 0 0 1 1
Evolutionary and Medical Genetics Laboratory, Centre for Cellular and Molecular Biology 0 0 0 0 0 0 1 1
University of British Columbia 0 0 0 0 0 0 1 1
Department of Molecular Endocrinology,National Research Institute for Child Health and Development 0 0 0 0 0 0 1 1
Department of Molecular and Human Genetics, Baylor College of Medicine 0 0 0 0 0 0 1 1
Institute of Pediatric Research,Xinhua Hospital affiliated to Shanghai Jiao Tong University School of Medicine 0 0 0 0 0 0 1 1
University Children's Hospital, University of Zurich 0 0 0 0 0 0 1 1
E. Rossignol Lab,CHU Ste-Justine, Universite de Montreal 0 0 0 0 0 0 1 1
Vavilov Institute of General Genetics RAS, Laboratory of Evolutional Genomics 0 0 0 0 0 1 0 1
Science and Research Branch, Islamic Azad University,Islamic Azad University 0 0 0 0 0 0 1 1
Translational Genetics in Neurodegenerative disease,Karolinska Institutet 0 0 0 1 0 0 0 1
Department of Neurology, University Hospital of Strasbourg 0 0 0 0 0 0 1 1
Centre of Medical Genetics, University of Antwerp 0 0 0 0 0 0 1 1
Child and Family Research Institute 0 0 0 1 0 0 0 1
University of Washington Center for Mendelian Genomics,University of Washington 0 1 0 0 0 0 1 1
HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology 0 5 0 1 0 0 0 1
Institute for Ophthalmic Research,University Tuebingen 0 0 0 0 0 0 1 1
DST/NWU Preclinical Drug Development Platform,North-West University 0 0 0 0 1 0 0 1
Dobyns Lab,Seattle Children's Research Institute 0 0 0 0 0 0 1 1
Department of Internal Medicine, University of Texas Health Science Center at Houston 0 0 0 0 1 0 0 1
Endocrine Unit 2,University Hospital of Pisa 0 0 0 1 0 0 0 1
Neurogenetics of motion laboratory,Montreal Neurological Institute 0 0 0 1 0 0 0 1
Department of Clinical Genetics,Tartu University Hospital 0 0 0 0 0 0 1 1
Undiagnosed Diseases Program Translational Research Laboratory,National Institutes of Health 0 0 0 0 0 0 1 1
Genome Sciences Centre,British Columbia Cancer Agency 0 0 0 0 0 0 1 1
Centre for Genomic Medicine, Manchester,Central Manchester University Hospitals 0 2 0 1 0 0 0 1
Prof. Thelma's Laboratory, Department of Genetics,University of Delhi South Campus 0 0 0 0 0 0 1 1
Ludwig Lab, Institute of Human Genetics, University Hospital Bonn 0 0 0 0 0 0 1 1
Laboratory of Genetics, AOUP,Azienda Ospedaliera Universitaria Pisana 0 0 0 0 0 0 1 1
Medical Research Institute,Tokyo Medical and Dental University 0 0 0 0 0 0 1 1
Human Genome and Stem Cell Research Center,Department of Genetics and Evolutionary Biology, Institute of Biosciences, University of São Paulo 0 0 0 0 0 0 1 1
Department of Pediatrics and Neonatology,Nagoya City University Graduate School of Medical Sciences 0 0 0 0 0 0 1 1
Neurogenetics group,VIB, Antwerp, Belgium 0 0 0 0 0 0 1 1
Leeds Amelogenesis Imperfecta Research Group, University of Leeds 0 0 0 0 0 0 1 1
Rui Chen Lab,Baylor College of Medicine 0 0 0 0 0 0 1 1
Bioinformatics dept.,Datar Cancer Genetics Limited, India 0 0 0 0 0 0 1 1
Geschwind lab,University of California Los Angeles 0 0 0 0 0 1 1 1
Neuromuscular disorders lab,University of Helsinki 0 0 0 1 0 0 0 1
Department of Medical Biochemistry and Genetics,University of Turku 0 0 0 0 0 0 1 1
Universitätsklinikum Salzburg,Universitätskinderklinik 0 0 0 0 0 0 1 1
Erich and Hanna Klessmann Institute for Cardiovascular Research and Development,Heart and Diabetes Center North Rhine-Westphalia 0 3 0 0 0 0 1 1
Department of Molecular and Medical Genetics,Osaka Medical Center for Cancer and Cardiovascular Diseases 0 0 0 0 0 0 1 1
Beijing Municipal Key Laboratory,Capital Institute of Pediatrics 0 0 0 0 0 1 0 1
Weber Lab,Hannover Medical School 0 0 0 0 0 0 1 1
Human Genetics - Radboudumc,Radboudumc 0 3 0 1 0 0 0 1
Center for Human Genetics and Laboratory Diagnostics, Dr. Klein, Dr. Rost and Colleagues 0 14 0 0 0 0 1 1
Metabolic Liver Diseases Lab,Fondazione IRCCS Ca Granda Policlinico, University of Milan 0 0 0 0 0 0 1 1
Zuffardi lab,University of Pavia 0 0 0 0 0 0 1 1
Pediatric Highly Intensive Care Unit,Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico 0 0 0 0 0 0 1 1
Daryl Scott Lab,Baylor College of Medicine 0 0 0 0 0 0 1 1
Neurogenetics Laboratory - MEYER,AOU Meyer 0 0 0 0 0 0 1 1
Tim Yu lab,Boston Children's Hospital 0 0 0 0 0 0 1 1
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego 0 1 0 1 0 0 0 1
Center for Medical Genetics and Molecular Medicine,Haukeland University Hospital 0 0 0 0 1 0 0 1
Laboratoire de Biologie et Génétique du Cancer,Centre François Baclesse 0 0 0 0 0 0 1 1
Medical Genetics Laboratory,Aldo Moro University of Bari 0 0 0 0 0 0 1 1
Herman Laboratory,Nationwide Children's Hospital 0 0 0 0 0 0 1 1
Iberoamerican FH Network 0 3 0 1 0 0 0 1
Section on Medical Neuroendocrinolgy,National Institutes of Health 0 0 0 0 0 0 1 1
Department of Medical Sciences,Uppsala University 0 1 0 0 0 0 1 1
Department of Obstetrics and Gynecology,Helsinki University Hospital 0 0 0 0 0 0 1 1
Yang An-Suei Laboratory,Academia Sinica 0 0 0 0 0 0 1 1
Snyder Lab, Genetics Department,Stanford University 0 0 0 0 0 1 0 1
Institute of Cellular and Molecular Medicine,Copenhagen University 0 0 0 0 0 0 1 1
Flegel Lab,National Institutes of Health 0 0 0 0 0 0 1 1
Biologia e Medicina Molecolare, Sapienza University of Rome 0 0 0 0 0 0 1 1
Division of Hearing and Balance Research,National Hospital Organization Tokyo Medical Center 0 0 0 0 0 0 1 1
Molecular Genetics Laboratory,State University of Campinas 0 0 0 0 0 0 1 1
Dan Cohn Lab,University Of California Los Angeles 0 0 0 0 0 0 1 1
Emory University School of Medicine, Department of Human Genetics,Emory University 0 0 0 0 0 0 1 1
Clinical genetics,CHU Grenoble-Alpes 0 0 0 0 0 0 1 1
Laboratory of Diagnosis and Therapy of Lysosomal Disorders,University of Padova 0 0 0 0 0 0 1 1
Reproductive Development, Murdoch Childrens Research Institute 0 0 0 0 0 0 1 1
Laboratory of Medical Genetics, INSERM 0 0 0 1 0 0 0 1
Laboratoire de Genetique Moleculaire,Centre Hospitalier Universitaire de Bordeaux 0 0 0 0 0 0 1 1
Medical Genetics Lab,Policlinico S. Orsola.Malpighi 0 0 0 0 0 0 1 1
CIViC knowledgebase,Washington University School of Medicine 0 0 0 0 0 0 1 1
Génétique des Maladies du Développement, Hospices Civils de Lyon 0 2 0 1 0 0 0 1
Medical Cytogenetics and Molecular Genetics Laboratory,IRCCS Istituto Auxologico Italiano 0 0 0 0 1 0 0 1
Center of Medical Genetics,Central South University 0 0 0 0 0 1 0 1
Molecular Diagnostics Laboratory, M Health: University of Minnesota 0 2 0 0 0 0 1 1
Raymond Lab,University of Cambridge 0 1 0 0 0 0 1 1
Laboratory of Medical Genetics, National & Kapodistrian University of Athens 0 0 0 0 1 0 0 1
Clinical Genomics Lab,St. Jude Children's Research Hospital 0 3 0 0 1 0 0 1
Lab. Molecular Oncology,VUB, Free University of Brussels 0 1 0 0 1 0 0 1
Dr. Alfred Bastarche Laboratory,Dr. Georges L. Dumont University Hospital Centre 0 0 0 0 0 0 1 1
Cole/Wambach Lab,Washington University in St. Louis 0 0 0 1 0 0 0 1
Mayo Clinic Genomics Laboratory,Mayo Clinic 0 0 0 0 0 0 1 1
Molecular Pathology Diagnostics Labratory,University of Iowa Hospitals & Clinics 0 0 0 0 0 0 1 1
Genetic Diseases Diagnostic Center,Koc University Hospital 0 0 0 0 0 0 1 1
AG Reprogenetics, University of Münster 0 0 0 0 0 0 1 1
Inherited Eye Disorders lab,UCL Institute of Ophthalmology 0 0 0 0 0 0 1 1
Department of Pediatrics,University of Ottawa 0 0 0 0 0 0 1 1
Klaassen Lab,Charite University Medicine Berlin 0 4 0 0 1 0 0 1
Department of Genetics, Rouen University Hospital, Normandy Center for Genomic and Personalized Medicine 0 0 0 1 0 0 0 1
Biochemistry Laboratory of CDMU,Chengde Medical University 0 1 0 0 0 0 1 1
Genetic Testing Center for Deafness, Department of Otolaryngology Head & Neck Surgery,Institute of Otolaryngology, Chinese PLA General Hospital 0 0 0 0 0 0 1 1
Institute for Genomic Statistics and Bioinformatics, University Hospital Bonn 0 0 0 1 0 0 0 1
Institute for Human Genetics,University Hospital Essen 0 0 0 0 0 0 1 1
Clinical Genetics Research Group,Karolinska Institutet 0 0 0 0 0 0 1 1
Genesis Genome Database 0 3 0 0 0 0 1 1
UT Southwestern Medical Center, UT Southwestern Medical Center 0 0 0 0 0 1 0 1
Department of Haematogenetics,ICMR National Institute of Immunohaematology 0 0 0 0 0 0 1 1
Center for Computational Genomics and Data Science,University of Alabama 0 0 0 0 0 1 0 1

All variants with conflicting interpretations #

Total variants: 4265
Download table as spreadsheet
HGVS dbSNP
NM_000016.5(ACADM):c.127G>A (p.Glu43Lys) rs147559466
NM_000016.5(ACADM):c.199T>C (p.Tyr67His) rs121434280
NM_000016.5(ACADM):c.994C>T (p.Leu332=) rs138098371
NM_000017.4(ACADS):c.1058C>T (p.Ser353Leu) rs28941773
NM_000018.4(ACADVL):c.1844G>A (p.Arg615Gln) rs148584617
NM_000020.2(ACVRL1):c.88C>T (p.Pro30Ser) rs149664056
NM_000032.5(ALAS2):c.1560C>A (p.Pro520=) rs150055592
NM_000033.4(ABCD1):c.1899C>T (p.Ser633=)
NM_000033.4(ABCD1):c.1900G>A (p.Ala634Thr) rs782041940
NM_000033.4(ABCD1):c.1902C>T (p.Ala634=) rs141110958
NM_000033.4(ABCD1):c.258C>T (p.Val86=) rs200660869
NM_000033.4(ABCD1):c.420C>A (p.Ile140=) rs74315279
NM_000033.4(ABCD1):c.54G>A (p.Thr18=) rs781855598
NM_000033.4(ABCD1):c.757C>G (p.Leu253Val) rs150151955
NM_000036.2(AMPD1):c.1029G>T (p.Met343Ile) rs61752478
NM_000036.2(AMPD1):c.242C>T (p.Pro81Leu) rs61752479
NM_000038.6(APC):c.1240C>T (p.Arg414Cys) rs137854567
NM_000038.6(APC):c.1631T>C (p.Ile544Thr) rs144056494
NM_000038.6(APC):c.1761C>T (p.Ser587=) rs370783137
NM_000038.6(APC):c.2627G>A (p.Arg876Gln) rs373428732
NM_000038.6(APC):c.2805C>T (p.Tyr935=) rs137854575
NM_000038.6(APC):c.2958T>C (p.Tyr986=) rs746581330
NM_000038.6(APC):c.295C>T (p.Arg99Trp) rs139196838
NM_000038.6(APC):c.3006C>T (p.Ala1002=) rs72541810
NM_000038.6(APC):c.3386T>C (p.Leu1129Ser) rs143638171
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000038.6(APC):c.3949G>C (p.Glu1317Gln) rs1801166
NM_000038.6(APC):c.4326T>A (p.Pro1442=) rs67622085
NM_000038.6(APC):c.4372C>T (p.Pro1458Ser) rs143796828
NM_000038.6(APC):c.450A>G (p.Lys150=) rs116020626
NM_000038.6(APC):c.5009C>T (p.Ala1670Val) rs202228932
NM_000038.6(APC):c.5140G>A (p.Asp1714Asn) rs148275069
NM_000038.6(APC):c.5265G>A (p.Ala1755=) rs34506289
NM_000038.6(APC):c.6526T>C (p.Leu2176=) rs183468041
NM_000038.6(APC):c.6669A>G (p.Ser2223=) rs372680843
NM_000038.6(APC):c.6821C>T (p.Ala2274Val) rs34919187
NM_000038.6(APC):c.6873A>T (p.Gln2291His) rs148878262
NM_000038.6(APC):c.6921G>A (p.Ser2307=) rs2229993
NM_000038.6(APC):c.7036C>T (p.Pro2346Ser) rs200756935
NM_000038.6(APC):c.7490C>T (p.Ser2497Leu) rs141010008
NM_000038.6(APC):c.7514G>A (p.Arg2505Gln) rs147549623
NM_000038.6(APC):c.7766A>G (p.Glu2589Gly) rs200406572
NM_000038.6(APC):c.7778A>G (p.Asn2593Ser) rs367676584
NM_000038.6(APC):c.7858T>A (p.Phe2620Ile) rs587781816
NM_000038.6(APC):c.7862C>G (p.Ser2621Cys) rs72541816
NM_000038.6(APC):c.7929A>G (p.Leu2643=) rs138796072
NM_000038.6(APC):c.8141G>A (p.Arg2714His) rs747362422
NM_000038.6(APC):c.8383G>A (p.Ala2795Thr) rs369264968
NM_000041.4(APOE):c.137T>C (p.Leu46Pro) rs769452
NM_000043.6(FAS):c.578A>G (p.Lys193Arg) rs150489856
NM_000044.6(AR):c.1370_1372GCG[20] (p.Gly471_Gly473dup)
NM_000044.6(AR):c.171_173GCA[24] (p.Gln80dup) rs3032358
NM_000044.6(AR):c.1937C>A (p.Ala646Asp) rs1800053
NM_000046.5(ARSB):c.1336+2T>G rs768012515
NM_000049.4(ASPA):c.637A>G (p.Lys213Glu)
NM_000051.3(ATM):c.1066-6T>G rs201686625
NM_000051.3(ATM):c.1229T>C (p.Val410Ala) rs56128736
NM_000051.3(ATM):c.1272T>C (p.Pro424=) rs35578748
NM_000051.3(ATM):c.146C>G (p.Ser49Cys) rs1800054
NM_000051.3(ATM):c.162T>C (p.Tyr54=) rs3218690
NM_000051.3(ATM):c.1703G>T (p.Arg568Ile) rs200381392
NM_000051.3(ATM):c.1744T>C (p.Phe582Leu) rs2235006
NM_000051.3(ATM):c.1773T>C (p.Asn591=) rs61734356
NM_000051.3(ATM):c.1898+2T>G rs587782124
NM_000051.3(ATM):c.1986T>C (p.Phe662=) rs1800055
NM_000051.3(ATM):c.2021A>G (p.His674Arg) rs201762714
NM_000051.3(ATM):c.2119T>C (p.Ser707Pro) rs4986761
NM_000051.3(ATM):c.2181C>T (p.Gly727=) rs876658836
NM_000051.3(ATM):c.2251-7A>G rs879254103
NM_000051.3(ATM):c.2572T>C (p.Phe858Leu) rs1800056
NM_000051.3(ATM):c.2577C>T (p.Asn859=) rs730881286
NM_000051.3(ATM):c.2932T>C (p.Ser978Pro) rs139552233
NM_000051.3(ATM):c.3016A>G (p.Met1006Val) rs139893395
NM_000051.3(ATM):c.3154-4G>A rs199543313
NM_000051.3(ATM):c.3218dup (p.Phe1074fs) rs876660741
NM_000051.3(ATM):c.3242A>G (p.Asn1081Ser) rs368111672
NM_000051.3(ATM):c.331+5G>A rs752135143
NM_000051.3(ATM):c.3378A>G (p.Lys1126=) rs149182949
NM_000051.3(ATM):c.370A>G (p.Ile124Val) rs148590073
NM_000051.3(ATM):c.3925G>A (p.Ala1309Thr) rs149711770
NM_000051.3(ATM):c.4066A>G (p.Asn1356Asp) rs147600485
NM_000051.3(ATM):c.4324T>C (p.Tyr1442His) rs201666889
NM_000051.3(ATM):c.4362A>C (p.Lys1454Asn) rs148993589
NM_000051.3(ATM):c.4424A>G (p.Tyr1475Cys) rs34640941
NM_000051.3(ATM):c.4473C>T (p.Phe1491=) rs4988008
NM_000051.3(ATM):c.4492T>C (p.Leu1498=) rs748949478
NM_000051.3(ATM):c.4709T>C (p.Val1570Ala) rs140856217
NM_000051.3(ATM):c.4735C>T (p.Gln1579Ter) rs869312755
NM_000051.3(ATM):c.4853G>A (p.Arg1618Gln) rs765759912
NM_000051.3(ATM):c.496+4T>C rs587781375
NM_000051.3(ATM):c.5071A>C (p.Ser1691Arg) rs1800059
NM_000051.3(ATM):c.5558A>T (p.Asp1853Val) rs1801673
NM_000051.3(ATM):c.5793T>C (p.Ala1931=) rs3092910
NM_000051.3(ATM):c.5821G>C (p.Val1941Leu) rs147187700
NM_000051.3(ATM):c.6067G>A (p.Gly2023Arg) rs11212587
NM_000051.3(ATM):c.609C>T (p.Asp203=) rs144709948
NM_000051.3(ATM):c.6447T>C (p.Tyr2149=) rs1057519167
NM_000051.3(ATM):c.6807+8del rs1555119385
NM_000051.3(ATM):c.6860G>C (p.Gly2287Ala) rs1800061
NM_000051.3(ATM):c.7187C>G (p.Thr2396Ser) rs370559102
NM_000051.3(ATM):c.7359T>G (p.Arg2453=) rs786201541
NM_000051.3(ATM):c.7390T>C (p.Cys2464Arg) rs55801750
NM_000051.3(ATM):c.7456C>T (p.Arg2486Ter) rs587779865
NM_000051.3(ATM):c.7463G>A (p.Cys2488Tyr) rs774281788
NM_000051.3(ATM):c.7475T>G (p.Leu2492Arg) rs56399857
NM_000051.3(ATM):c.7618G>A (p.Val2540Ile) rs35203200
NM_000051.3(ATM):c.7788+8G>T rs112775908
NM_000051.3(ATM):c.7816A>G (p.Ile2606Val) rs376824528
NM_000051.3(ATM):c.8560C>T (p.Arg2854Cys) rs201958469
NM_000051.3(ATM):c.8592C>T (p.Tyr2864=) rs56025670
NM_000051.3(ATM):c.8850+5A>C rs1057522186
NM_000051.3(ATM):c.998C>T (p.Ser333Phe) rs28904919
NM_000052.7(ATP7A):c.1009G>A (p.Ala337Thr) rs138039591
NM_000052.7(ATP7A):c.1893G>C (p.Leu631Phe) rs372898963
NM_000052.7(ATP7A):c.2499-7T>C rs782260332
NM_000052.7(ATP7A):c.2531G>A (p.Arg844His) rs367775730
NM_000052.7(ATP7A):c.2903A>G (p.Glu968Gly) rs138958687
NM_000052.7(ATP7A):c.3931A>G (p.Met1311Val) rs139781067
NM_000052.7(ATP7A):c.4389T>C (p.Ser1463=) rs371939448
NM_000052.7(ATP7A):c.880A>T (p.Asn294Tyr) rs150526992
NM_000053.4(ATP7B):c.*16G>A rs193922100
NM_000053.4(ATP7B):c.1122C>G (p.Val374=) rs201254466
NM_000053.4(ATP7B):c.1185C>T (p.Ala395=) rs764551529
NM_000053.4(ATP7B):c.1278C>T (p.Val426=) rs143556945
NM_000053.4(ATP7B):c.1285+5G>T rs370579582
NM_000053.4(ATP7B):c.1543+13C>T rs200171850
NM_000053.4(ATP7B):c.1607T>C (p.Val536Ala) rs138427376
NM_000053.4(ATP7B):c.1620C>T (p.Leu540=) rs145798966
NM_000053.4(ATP7B):c.1877G>C (p.Gly626Ala) rs587783299
NM_000053.4(ATP7B):c.1993A>G (p.Met665Val) rs146303208
NM_000053.4(ATP7B):c.1995G>A (p.Met665Ile) rs72552259
NM_000053.4(ATP7B):c.19_20del (p.Gln7fs) rs749363958
NM_000053.4(ATP7B):c.2175G>A (p.Arg725=) rs61733684
NM_000053.4(ATP7B):c.2355+13T>G rs139211339
NM_000053.4(ATP7B):c.2544C>T (p.Gly848=) rs200996053
NM_000053.4(ATP7B):c.2755C>T (p.Arg919Trp) rs121907993
NM_000053.4(ATP7B):c.2972C>T (p.Thr991Met) rs41292782
NM_000053.4(ATP7B):c.3403G>A (p.Ala1135Thr) rs187200982
NM_000053.4(ATP7B):c.3557-6C>T rs140708492
NM_000053.4(ATP7B):c.3620A>G (p.His1207Arg) rs7334118
NM_000053.4(ATP7B):c.3624G>T (p.Thr1208=)
NM_000053.4(ATP7B):c.3903+6C>T rs2282057
NM_000053.4(ATP7B):c.4058G>A (p.Trp1353Ter) rs193922110
NM_000053.4(ATP7B):c.4135C>T (p.Pro1379Ser) rs181250704
NM_000053.4(ATP7B):c.4213G>A (p.Gly1405Ser) rs189601972
NM_000053.4(ATP7B):c.4301C>T (p.Thr1434Met) rs60986317
NM_000053.4(ATP7B):c.4311G>A (p.Lys1437=) rs73202048
NM_000057.4(BLM):c.1928G>A (p.Arg643His) rs12720097
NM_000057.4(BLM):c.2119C>T (p.Pro707Ser) rs146077918
NM_000057.4(BLM):c.2293G>A (p.Val765Ile) rs191789336
NM_000057.4(BLM):c.3849G>A (p.Gln1283=) rs140524886
NM_000057.4(BLM):c.3892G>A (p.Gly1298Arg) rs587779889
NM_000057.4(BLM):c.4076+4T>G rs183176301
NM_000057.4(BLM):c.43C>T (p.Arg15Cys) rs148545569
NM_000059.3(BRCA2):c.10094_10095insGAATTATATC (p.Ser3366fs) rs1064792995
NM_000059.3(BRCA2):c.10176del (p.Glu3393fs) rs80359258
NM_000059.3(BRCA2):c.1151C>T (p.Ser384Phe) rs41293475
NM_000059.3(BRCA2):c.1385A>G (p.Glu462Gly) rs56403624
NM_000059.3(BRCA2):c.1395A>C (p.Val465=) rs11571641
NM_000059.3(BRCA2):c.1744A>G (p.Thr582Ala) rs80358457
NM_000059.3(BRCA2):c.1786G>C (p.Asp596His) rs56328701
NM_000059.3(BRCA2):c.1792A>G (p.Thr598Ala) rs28897710
NM_000059.3(BRCA2):c.1910-6G>A rs1555282344
NM_000059.3(BRCA2):c.1938C>T (p.Ser646=) rs28897711
NM_000059.3(BRCA2):c.223G>C (p.Ala75Pro) rs28897701
NM_000059.3(BRCA2):c.2459A>G (p.Asp820Gly) rs80358511
NM_000059.3(BRCA2):c.2484T>C (p.Tyr828=) rs45619134
NM_000059.3(BRCA2):c.2623G>A (p.Val875Ile) rs587782582
NM_000059.3(BRCA2):c.2803G>A (p.Asp935Asn) rs28897716
NM_000059.3(BRCA2):c.2883G>A (p.Gln961=) rs11571655
NM_000059.3(BRCA2):c.2919G>A (p.Ser973=) rs45525041
NM_000059.3(BRCA2):c.3032C>G (p.Thr1011Arg) rs80358548
NM_000059.3(BRCA2):c.3055C>G (p.Leu1019Val) rs55638633
NM_000059.3(BRCA2):c.3392G>A (p.Arg1131Lys) rs1555283214
NM_000059.3(BRCA2):c.3516G>A (p.Ser1172=) rs1799952
NM_000059.3(BRCA2):c.3568C>T (p.Arg1190Trp) rs80358604
NM_000059.3(BRCA2):c.4068G>A (p.Leu1356=) rs28897724
NM_000059.3(BRCA2):c.4187A>G (p.Gln1396Arg) rs55969723
NM_000059.3(BRCA2):c.4258G>T (p.Asp1420Tyr) rs28897727
NM_000059.3(BRCA2):c.4315G>A (p.Ala1439Thr) rs80358666
NM_000059.3(BRCA2):c.4462_4463CA[1] (p.His1488fs) rs397507720
NM_000059.3(BRCA2):c.4570T>G (p.Phe1524Val) rs56386506
NM_000059.3(BRCA2):c.4584C>T (p.Ser1528=) rs80359788
NM_000059.3(BRCA2):c.4686A>G (p.Gln1562=) rs28897730
NM_000059.3(BRCA2):c.4928T>C (p.Val1643Ala) rs28897731
NM_000059.3(BRCA2):c.5199C>T (p.Ser1733=) rs28897734
NM_000059.3(BRCA2):c.5552T>G (p.Ile1851Ser) rs80358776
NM_000059.3(BRCA2):c.5634C>G (p.Asn1878Lys) rs80358784
NM_000059.3(BRCA2):c.5869A>G (p.Ile1957Val) rs80358817
NM_000059.3(BRCA2):c.5897A>G (p.His1966Arg) rs80358823
NM_000059.3(BRCA2):c.6100C>T (p.Arg2034Cys) rs1799954
NM_000059.3(BRCA2):c.68-7T>A rs81002830
NM_000059.3(BRCA2):c.7008-62A>G rs76584943
NM_000059.3(BRCA2):c.7056T>A (p.Pro2352=) rs276174888
NM_000059.3(BRCA2):c.7413A>G (p.Thr2471=) rs138067005
NM_000059.3(BRCA2):c.7448G>A (p.Ser2483Asn) rs80358967
NM_000059.3(BRCA2):c.7601C>T (p.Ala2534Val) rs74047012
NM_000059.3(BRCA2):c.8010G>A (p.Ser2670=) rs146430937
NM_000059.3(BRCA2):c.8124T>G (p.Thr2708=) rs587780662
NM_000059.3(BRCA2):c.8166A>G (p.Thr2722=) rs786201640
NM_000059.3(BRCA2):c.8182G>A (p.Val2728Ile) rs28897749
NM_000059.3(BRCA2):c.831T>G (p.Asn277Lys) rs28897705
NM_000059.3(BRCA2):c.8567A>C (p.Glu2856Ala) rs11571747
NM_000059.3(BRCA2):c.8850G>T (p.Lys2950Asn) rs28897754
NM_000059.3(BRCA2):c.943T>A (p.Cys315Ser) rs79483201
NM_000059.3(BRCA2):c.9789_9790del (p.Asn3264fs) rs886040851
NM_000059.3(BRCA2):c.9976A>T (p.Lys3326Ter) rs11571833
NM_000069.3(CACNA1S):c.1547C>T (p.Ser516Leu) rs140662085
NM_000069.3(CACNA1S):c.2440G>A (p.Ala814Thr) rs139956524
NM_000069.3(CACNA1S):c.2454G>A (p.Ala818=) rs141619541
NM_000069.3(CACNA1S):c.3761G>A (p.Arg1254Gln) rs530655602
NM_000069.3(CACNA1S):c.3795+3G>A rs191758096
NM_000069.3(CACNA1S):c.398+3G>A rs764710968
NM_000069.3(CACNA1S):c.4060A>T (p.Thr1354Ser) rs145910245
NM_000069.3(CACNA1S):c.4114-8T>C rs373675720
NM_000069.3(CACNA1S):c.4437G>A (p.Thr1479=) rs200538716
NM_000069.3(CACNA1S):c.530C>T (p.Ser177Leu) rs141204958
NM_000069.3(CACNA1S):c.743C>T (p.Thr248Met) rs200665694
NM_000070.3(CAPN3):c.1001A>T (p.His334Leu) rs749863676
NM_000070.3(CAPN3):c.1302C>T (p.Asn434=) rs751429914
NM_000070.3(CAPN3):c.1668C>T (p.Ile556=) rs199884116
NM_000070.3(CAPN3):c.1746-20C>G rs201892814
NM_000070.3(CAPN3):c.2235C>T (p.Tyr745=) rs147774793
NM_000070.3(CAPN3):c.552G>A (p.Thr184=) rs147808529
NM_000075.4(CDK4):c.762C>T (p.Pro254=) rs753908111
NM_000077.4(CDKN2A):c.150+12G>A rs1057520264
NM_000077.4(CDKN2A):c.150+37G>C rs45456595
NM_000082.3(ERCC8):c.655G>C (p.Ala219Pro)
NM_000082.3(ERCC8):c.839C>A (p.Thr280Lys) rs61754098
NM_000083.3(CLCN1):c.1012C>T (p.Arg338Ter) rs759761559
NM_000083.3(CLCN1):c.1231G>T (p.Gly411Cys) rs756199349
NM_000083.3(CLCN1):c.1392C>T (p.Phe464=) rs201919331
NM_000083.3(CLCN1):c.2364+10G>A rs201855153
NM_000083.3(CLCN1):c.501C>G (p.Phe167Leu) rs149729531
NM_000083.3(CLCN1):c.899G>A (p.Arg300Gln) rs118066140
NM_000088.3(COL1A1):c.1882G>A (p.Ala628Thr) rs113950465
NM_000089.3(COL1A2):c.1866T>C (p.Gly622=) rs765470622
NM_000089.3(COL1A2):c.2425C>T (p.Pro809Ser) rs145355907
NM_000089.3(COL1A2):c.3313G>A (p.Gly1105Ser) rs139851311
NM_000089.3(COL1A2):c.3853A>C (p.Asn1285His) rs144797861
NM_000089.3(COL1A2):c.594+5A>T rs200744314
NM_000089.4(COL1A2):c.526T>C (p.Phe176Leu)
NM_000090.3(COL3A1):c.1024G>A (p.Gly342Arg) rs794728040
NM_000090.3(COL3A1):c.1188C>T (p.Gly396=) rs745743884
NM_000090.3(COL3A1):c.1461C>T (p.Ala487=) rs747522483
NM_000090.3(COL3A1):c.2002C>A (p.Pro668Thr) rs1801183
NM_000090.3(COL3A1):c.3576C>T (p.Ala1192=) rs574331101
NM_000090.3(COL3A1):c.3777T>C (p.Ala1259=) rs34781844
NM_000091.4(COL4A3):c.4421T>C (p.Leu1474Pro) rs200302125
NM_000092.5(COL4A4):c.8C>T (p.Ser3Phe)
NM_000093.5(COL5A1):c.4818C>T (p.Asp1606=)
NM_000094.3(COL7A1):c.3942dup (p.Asn1315fs) rs747912732
NM_000098.3(CPT2):c.1602G>A (p.Glu534=) rs148110518
NM_000104.3(CYP1B1):c.1103G>A (p.Arg368His) rs79204362
NM_000104.3(CYP1B1):c.1294= (p.Leu432=) rs1056836
NM_000104.3(CYP1B1):c.1358A>G (p.Asn453Ser) rs1800440
NM_000104.3(CYP1B1):c.241T>A (p.Tyr81Asn) rs9282671
NM_000109.4(DMD):c.*23_*35del rs752332058
NM_000110.3(DPYD):c.1601G>A (p.Ser534Asn) rs1801158
NM_000110.3(DPYD):c.2846A>T (p.Asp949Val) rs67376798
NM_000111.2(SLC26A3):c.571-2A>G rs386833486
NM_000116.5(TAZ):c.873G>A (p.Gly291=) rs35902788
NM_000118.3(ENG):c.-9G>A rs368423516
NM_000118.3(ENG):c.219+22C>T rs370257876
NM_000119.3(EPB42):c.642C>T (p.Phe214=) rs768899304
NM_000122.1(ERCC3):c.2111C>T (p.Ser704Leu) rs4150521
NM_000124.4(ERCC6):c.1274A>C (p.Asp425Ala) rs4253046
NM_000124.4(ERCC6):c.3391A>G (p.Asn1131Asp) rs147079519
NM_000124.4(ERCC6):c.3650T>G (p.Phe1217Cys) rs61760166
NM_000124.4(ERCC6):c.4223A>C (p.Glu1408Ala) rs61760167
NM_000127.2(EXT1):c.1782G>A (p.Ala594=) rs61753261
NM_000129.3(F13A1):c.103G>T (p.Val35Leu) rs5985
NM_000129.3(F13A1):c.1694C>T (p.Pro565Leu) rs5982
NM_000129.3(F13A1):c.1777G>A (p.Gly593Ser)
NM_000130.4(F5):c.1242A>G (p.Lys414=) rs6035
NM_000130.4(F5):c.2222A>G (p.Asn741Ser) rs144979314
NM_000130.4(F5):c.2573A>G (p.Lys858Arg) rs4524
NM_000130.4(F5):c.2868T>C (p.Tyr956=) rs149067268
NM_000130.4(F5):c.5054C>G (p.Thr1685Ser) rs6011
NM_000130.4(F5):c.5290A>G (p.Met1764Val) rs6030
NM_000130.4(F5):c.5490G>A (p.Leu1830=) rs149092241
NM_000130.4(F5):c.6309G>A (p.Leu2103=) rs35369423
NM_000130.5(F5):c.4589A>C (p.Glu1530Ala)
NM_000130.5(F5):c.5245C>G (p.Leu1749Val)
NM_000131.4(F7):c.806-10T>C rs3093266
NM_000132.3(F8):c.102C>T (p.Asp34=) rs1800283
NM_000133.3(F9):c.19A>T (p.Ile7Phe) rs150190385
NM_000133.3(F9):c.819T>C (p.Val273=) rs1800455
NM_000133.3(F9):c.907C>T (p.His303Tyr) rs1801202
NM_000133.4(F9):c.391+4A>G
NM_000133.4(F9):c.8G>A (p.Arg3His)
NM_000135.4(FANCA):c.1047G>A (p.Ala349=) rs144900606
NM_000135.4(FANCA):c.1830A>G (p.Ala610=) rs1800338
NM_000135.4(FANCA):c.2602-13CT[2] rs577636020
NM_000135.4(FANCA):c.3348+7G>T rs185527578
NM_000136.3(FANCC):c.178G>A (p.Val60Ile) rs138629441
NM_000136.3(FANCC):c.584A>T (p.Asp195Val) rs1800365
NM_000136.3(FANCC):c.77C>T (p.Ser26Phe) rs1800361
NM_000138.4(FBN1):c.1027G>A (p.Gly343Arg) rs146726731
NM_000138.4(FBN1):c.3216C>T (p.Asp1072=) rs757177349
NM_000138.4(FBN1):c.3508C>T (p.Arg1170Cys) rs1366894709
NM_000138.4(FBN1):c.3797A>T (p.Tyr1266Phe) rs200283837
NM_000138.4(FBN1):c.4095C>T (p.Asp1365=) rs375402043
NM_000138.4(FBN1):c.4998C>G (p.Thr1666=) rs141925790
NM_000138.4(FBN1):c.510C>T (p.Tyr170=) rs111671429
NM_000138.4(FBN1):c.5330G>A (p.Cys1777Tyr) rs1060501069
NM_000138.4(FBN1):c.59A>G (p.Tyr20Cys) rs201309310
NM_000138.4(FBN1):c.6288C>T (p.Cys2096=) rs144822241
NM_000138.4(FBN1):c.6700G>A (p.Val2234Met) rs112084407
NM_000138.4(FBN1):c.7056C>T (p.Ser2352=) rs149697299
NM_000138.4(FBN1):c.7204+7C>G rs371763964
NM_000138.4(FBN1):c.7241G>A (p.Arg2414Gln) rs143863014
NM_000138.4(FBN1):c.8005G>A (p.Gly2669Ser) rs794728281
NM_000138.4(FBN1):c.902G>T (p.Gly301Val) rs142888621
NM_000144.5(FXN):c.123C>T (p.Gly41=) rs1057519131
NM_000144.5(FXN):c.384+8T>C
NM_000152.5(GAA):c.1593C>T (p.Asp531=) rs138732016
NM_000152.5(GAA):c.2152G>A (p.Val718Ile) rs141017311
NM_000153.3(GALC):c.1158_1161+6delCATGGTAAAC rs759068540
NM_000153.4(GALC):c.329-10_329-8del rs770389075
NM_000153.4(GALC):c.334A>G (p.Thr112Ala) rs147313927
NM_000153.4(GALC):c.41C>G (p.Ala14Gly) rs373587692
NM_000153.4(GALC):c.956A>G (p.Tyr319Cys) rs183105855
NM_000156.6(GAMT):c.581T>C (p.Val194Ala) rs147739199
NM_000157.3(GBA):c.1448T>C rs421016
NM_000157.4(GBA):c.1093G>A (p.Glu365Lys) rs2230288
NM_000157.4(GBA):c.1192C>T (p.Arg398Ter) rs121908309
NM_000157.4(GBA):c.1223C>T (p.Thr408Met) rs75548401
NM_000157.4(GBA):c.1226A>G (p.Asn409Ser) rs76763715
NM_000157.4(GBA):c.1227C>A (p.Asn409Lys) rs749227753
NM_000157.4(GBA):c.535G>C (p.Asp179His) rs147138516
NM_000157.4(GBA):c.667T>C (p.Trp223Arg) rs61748906
NM_000157.4(GBA):c.882T>G (p.His294Gln) rs367968666
NM_000158.4(GBE1):c.1134T>G (p.Ser378Arg) rs36099971
NM_000158.4(GBE1):c.2017G>A (p.Ala673Thr) rs193074572
NM_000158.4(GBE1):c.405C>T (p.Leu135=) rs139882066
NM_000159.4(GCDH):c.764C>T (p.Ser255Leu) rs758503371
NM_000161.3(GCH1):c.195G>A (p.Glu65=) rs139350456
NM_000161.3(GCH1):c.206C>T (p.Pro69Leu) rs56127440
NM_000161.3(GCH1):c.400G>A (p.Asp134Asn) rs1353623780
NM_000161.3(GCH1):c.610G>A (p.Val204Ile) rs200891969
NM_000161.3(GCH1):c.68C>T (p.Pro23Leu) rs41298432
NM_000162.5(GCK):c.1364T>A (p.Val455Glu) rs753795627
NM_000163.5(GHR):c.535C>T (p.Arg179Cys) rs121909362
NM_000165.5(GJA1):c.140A>T (p.Asp47Val) rs1554200995
NM_000167.5(GK):c.730-5A>T rs186543786
NM_000169.2(GLA):c.376A>G (p.Ser126Gly) rs149391489
NM_000169.2(GLA):c.427G>A (p.Ala143Thr) rs104894845
NM_000169.2(GLA):c.937G>T (p.Asp313Tyr) rs28935490
NM_000169.2(GLA):c.945C>T (p.Asp315=) rs151208856
NM_000170.2(GLDC):c.1705G>A (p.Ala569Thr) rs151268759
NM_000170.2(GLDC):c.1707+8G>A rs144666843
NM_000170.2(GLDC):c.1931G>A (p.Cys644Tyr)
NM_000170.2(GLDC):c.2053-5C>G rs140877566
NM_000170.2(GLDC):c.2380G>A (p.Ala794Thr) rs141933811
NM_000170.2(GLDC):c.482A>G (p.Tyr161Cys) rs386833580
NM_000179.2(MSH6):c.-8C>T rs565211544
NM_000179.2(MSH6):c.1449G>T (p.Val483=) rs35590297
NM_000179.2(MSH6):c.1508C>G (p.Ser503Cys) rs63750897
NM_000179.2(MSH6):c.1827A>G (p.Leu609=) rs767064953
NM_000179.2(MSH6):c.241G>A (p.Ala81Thr) rs587779239
NM_000179.2(MSH6):c.2561A>T (p.Lys854Met) rs34374438
NM_000179.2(MSH6):c.2633T>C (p.Val878Ala) rs2020912
NM_000179.2(MSH6):c.3024C>T (p.Thr1008=) rs587780675
NM_000179.2(MSH6):c.3160A>T (p.Ile1054Phe) rs267608075
NM_000179.2(MSH6):c.3217C>T (p.Pro1073Ser) rs142254875
NM_000179.2(MSH6):c.3226C>T (p.Arg1076Cys) rs63750617
NM_000179.2(MSH6):c.3245C>T (p.Pro1082Leu) rs191109849
NM_000179.2(MSH6):c.3246G>T (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3283C>T (p.Arg1095Cys) rs376243329
NM_000179.2(MSH6):c.3300G>A (p.Thr1100=) rs540252208
NM_000179.2(MSH6):c.4002-10T>A rs545466048
NM_000179.2(MSH6):c.663A>C (p.Glu221Asp) rs41557217
NM_000179.2(MSH6):c.884A>G (p.Lys295Arg) rs267608051
NM_000179.2(MSH6):c.957G>A (p.Thr319=) rs375210430
NM_000180.3(GUCY2D):c.1093C>T (p.Arg365Trp) rs138836357
NM_000180.3(GUCY2D):c.129_134delTCTGCT (p.Leu44_Leu45del) rs552184470
NM_000180.3(GUCY2D):c.1315G>A (p.Gly439Arg) rs140638938
NM_000180.3(GUCY2D):c.1537C>T (p.Leu513Phe) rs61749682
NM_000180.3(GUCY2D):c.271G>C (p.Ala91Pro) rs573367793
NM_000180.3(GUCY2D):c.3098C>T (p.Ser1033Leu) rs146149224
NM_000180.3(GUCY2D):c.369C>T (p.Gly123=) rs529594203
NM_000180.3(GUCY2D):c.74C>T (p.Ser25Phe) rs557108466
NM_000182.5(HADHA):c.-1G>T rs72809666
NM_000182.5(HADHA):c.1212G>C (p.Val404=) rs116396996
NM_000182.5(HADHA):c.2107G>A (p.Gly703Arg) rs200438844
NM_000182.5(HADHA):c.2175C>T (p.Gly725=) rs375399631
NM_000182.5(HADHA):c.652G>C (p.Val218Leu) rs71441018
NM_000186.3(CFH):c.2850G>T (p.Gln950His) rs149474608
NM_000199.5(SGSH):c.1296C>T (p.Tyr432=) rs141153056
NM_000202.8(IDS):c.445T>G (p.Ser149Ala) rs146846763
NM_000202.8(IDS):c.754G>A (p.Asp252Asn) rs146458524
NM_000213.5(ITGB4):c.2929C>T (p.Arg977Cys) rs145976111
NM_000218.2(KCNQ1):c.328G>A (p.Val110Ile) rs199472677
NM_000219.6(KCNE1):c.107G>A (p.Arg36His) rs199473351
NM_000219.6(KCNE1):c.253G>A (p.Asp85Asn) rs1805128
NM_000219.6(KCNE1):c.30G>A (p.Thr10=) rs187686559
NM_000219.6(KCNE1):c.84G>A (p.Ser28=) rs17173510
NM_000222.2(KIT):c.1207A>G (p.Ile403Val) rs878853759
NM_000222.2(KIT):c.1290A>G (p.Ala430=) rs55966164
NM_000232.4(SGCB):c.943G>A (p.Gly315Arg) rs150395645
NM_000243.2(MEFV):c.1043G>A (p.Arg348His) rs104895198
NM_000243.2(MEFV):c.1105C>T (p.Pro369Ser) rs11466023
NM_000243.2(MEFV):c.1223G>A (p.Arg408Gln) rs11466024
NM_000243.2(MEFV):c.1370C>T (p.Ala457Val) rs104895151
NM_000243.2(MEFV):c.1467G>A (p.Gln489=) rs61732424
NM_000243.2(MEFV):c.1772T>C (p.Ile591Thr) rs11466045
NM_000243.2(MEFV):c.2084A>G rs104895094
NM_000243.2(MEFV):c.2177T>C (p.Val726Ala) rs28940579
NM_000243.2(MEFV):c.2230G>T rs61732874
NM_000243.2(MEFV):c.442G>C (p.Glu148Gln) rs3743930
NM_000243.2(MEFV):c.443A>T (p.Glu148Val) rs104895076
NM_000243.2(MEFV):c.564C>T (p.Pro188=) rs775755423
NM_000243.2(MEFV):c.688G>A (p.Glu230Lys) rs104895080
NM_000243.2(MEFV):c.800C>T (p.Thr267Ile) rs104895081
NM_000243.2(MEFV):c.986G>A (p.Arg329His) rs104895112
NM_000244.3(MEN1):c.-22C>A rs374749001
NM_000244.3(MEN1):c.1079G>A (p.Arg360Gln) rs1114167474
NM_000244.3(MEN1):c.1201-6G>A rs576193460
NM_000244.3(MEN1):c.1311G>A (p.Leu437=) rs138770431
NM_000244.3(MEN1):c.1366-4C>T rs764408631
NM_000244.3(MEN1):c.30G>T (p.Leu10=) rs371192390
NM_000248.3(MITF):c.560-7T>A rs200580325
NM_000248.3(MITF):c.861A>G (p.Glu287=) rs137904015
NM_000249.3(MLH1):c.-28A>G rs56198082
NM_000249.3(MLH1):c.1217G>A (p.Ser406Asn) rs41294980
NM_000249.3(MLH1):c.1321G>A (p.Ala441Thr) rs63750365
NM_000249.3(MLH1):c.1744C>T (p.Leu582Phe) rs63751713
NM_000249.3(MLH1):c.1852A>G (p.Lys618Glu) rs35001569
NM_000249.3(MLH1):c.1853A>G (p.Lys618Arg) rs63750449
NM_000249.3(MLH1):c.191A>G (p.Asn64Ser) rs63750952
NM_000249.3(MLH1):c.2066A>G (p.Gln689Arg) rs63750702
NM_000249.3(MLH1):c.2146G>A (p.Val716Met) rs35831931
NM_000249.3(MLH1):c.277A>G (p.Ser93Gly) rs41295282
NM_000249.3(MLH1):c.375A>G (p.Ala125=) rs1800144
NM_000249.3(MLH1):c.65G>C (p.Gly22Ala) rs41295280
NM_000249.3(MLH1):c.702G>A (p.Glu234=) rs35908749
NM_000249.3(MLH1):c.778C>T (p.Leu260Phe) rs63750642
NM_000249.3(MLH1):c.977T>C (p.Val326Ala) rs63751049
NM_000250.2(MPO):c.1555_1568del (p.Met519fs) rs536522394
NM_000251.2(MSH2):c.1275A>G (p.Glu425=) rs63751650
NM_000251.2(MSH2):c.1387-8G>T rs187525243
NM_000251.2(MSH2):c.1680T>C (p.Asn560=) rs200056411
NM_000251.2(MSH2):c.1730T>C (p.Ile577Thr) rs63749910
NM_000251.2(MSH2):c.1737A>G (p.Lys579=) rs61756467
NM_000251.2(MSH2):c.1748A>G (p.Asn583Ser) rs201118107
NM_000251.2(MSH2):c.1787A>G (p.Asn596Ser) rs41295288
NM_000251.2(MSH2):c.211+8C>T rs267607916
NM_000251.2(MSH2):c.339G>A (p.Lys113=) rs35898375
NM_000251.2(MSH2):c.557A>G (p.Asn186Ser) rs151129360
NM_000253.3(MTTP):c.2673C>T (p.Ser891=) rs115222767
NM_000255.4(MMUT):c.1629C>T (p.Ser543=) rs150642856
NM_000256.3(MYBPC3):c.12G>A (p.Pro4=) rs377292092
NM_000256.3(MYBPC3):c.1321G>A (p.Glu441Lys) rs193922377
NM_000256.3(MYBPC3):c.1468G>A (p.Gly490Arg) rs200625851
NM_000256.3(MYBPC3):c.1591G>C (p.Gly531Arg) rs397515912
NM_000256.3(MYBPC3):c.1608T>A (p.Ala536=) rs200224422
NM_000256.3(MYBPC3):c.1720C>A (p.Arg574=) rs61897383
NM_000256.3(MYBPC3):c.246T>C (p.Ile82=) rs372502369
NM_000256.3(MYBPC3):c.2497G>A (p.Ala833Thr) rs199865688
NM_000256.3(MYBPC3):c.2870C>G (p.Thr957Ser) rs193922380
NM_000256.3(MYBPC3):c.3326C>T (p.Thr1109Ile) rs397516016
NM_000256.3(MYBPC3):c.3332_3335dup (p.Trp1112Ter) rs730880337
NM_000256.3(MYBPC3):c.3627G>A (p.Lys1209=) rs1555120261
NM_000256.3(MYBPC3):c.3657G>T (p.Leu1219=) rs770157084
NM_000256.3(MYBPC3):c.3763G>A (p.Ala1255Thr) rs727503167
NM_000256.3(MYBPC3):c.442G>A (p.Gly148Arg) rs397516050
NM_000256.3(MYBPC3):c.471C>T (p.Phe157=) rs150291001
NM_000256.3(MYBPC3):c.501C>T (p.Thr167=) rs397516054
NM_000256.3(MYBPC3):c.565G>A (p.Val189Ile) rs11570052
NM_000256.3(MYBPC3):c.709T>C (p.Tyr237His) rs730880624
NM_000256.3(MYBPC3):c.906-7G>T rs397516079
NM_000256.3(MYBPC3):c.926+8C>T rs377595584
NM_000256.3(MYBPC3):c.961G>A (p.Val321Met) rs200119454
NM_000256.3(MYBPC3):c.977G>A (p.Arg326Gln) rs34580776
NM_000257.4(MYH7):c.1749C>T (p.Ala583=) rs758665829
NM_000257.4(MYH7):c.2890G>C (p.Val964Leu) rs45496496
NM_000257.4(MYH7):c.2945T>C (p.Met982Thr) rs145532615
NM_000257.4(MYH7):c.3036C>T (p.Ala1012=) rs145379951
NM_000257.4(MYH7):c.3133C>T (p.Arg1045Cys) rs45611033
NM_000257.4(MYH7):c.3153G>A (p.Ala1051=) rs45540831
NM_000257.4(MYH7):c.3286G>T (p.Asp1096Tyr) rs45478699
NM_000257.4(MYH7):c.3853+7C>T rs45467397
NM_000257.4(MYH7):c.3981C>A (p.Asn1327Lys) rs141764279
NM_000257.4(MYH7):c.4145G>A (p.Arg1382Gln) rs727504325
NM_000257.4(MYH7):c.4293C>T (p.Asp1431=) rs45560242
NM_000257.4(MYH7):c.4353+6C>T rs765398896
NM_000257.4(MYH7):c.4659C>T (p.His1553=) rs570079347
NM_000257.4(MYH7):c.5243G>A (p.Cys1748Tyr) rs200303340
NM_000257.4(MYH7):c.5328C>T (p.Ser1776=) rs765263589
NM_000257.4(MYH7):c.5561C>T (p.Thr1854Met) rs372381770
NM_000257.4(MYH7):c.5661G>A (p.Glu1887=) rs730880727
NM_000257.4(MYH7):c.5690G>A (p.Arg1897His) rs727503240
NM_000257.4(MYH7):c.610C>T (p.Arg204Cys) rs397516259
NM_000258.2(MYL3):c.170C>A (p.Ala57Asp) rs139794067
NM_000259.3(MYO5A):c.4357C>T (p.Pro1453Ser)
NM_000260.4(MYO7A):c.2476G>A (p.Ala826Thr) rs368341987
NM_000260.4(MYO7A):c.2886G>C (p.Gln962His) rs200641606
NM_000260.4(MYO7A):c.3719G>A (p.Arg1240Gln) rs111033178
NM_000260.4(MYO7A):c.3978C>T (p.Cys1326=) rs111033376
NM_000260.4(MYO7A):c.448C>A (p.Arg150=) rs121965079
NM_000260.4(MYO7A):c.486C>T (p.Ala162=) rs367687624
NM_000260.4(MYO7A):c.5494C>A (p.Arg1832=) rs748080151
NM_000260.4(MYO7A):c.5598C>A (p.Leu1866=) rs111033504
NM_000260.4(MYO7A):c.5866G>A (p.Val1956Ile) rs142293185
NM_000260.4(MYO7A):c.803A>G (p.Lys268Arg) rs184866544
NM_000261.2(MYOC):c.1193A>G (p.Lys398Arg) rs56314834
NM_000261.2(MYOC):c.227G>A (p.Arg76Lys) rs2234926
NM_000261.2(MYOC):c.855G>T (p.Thr285=) rs146606638
NM_000263.4(NAGLU):c.889C>T (p.Arg297Ter) rs104894592
NM_000267.3(NF1):c.1296G>A (p.Val432=) rs371599283
NM_000267.3(NF1):c.1308G>A (p.Ser436=) rs765425127
NM_000267.3(NF1):c.2990+7A>G rs1555614465
NM_000267.3(NF1):c.4111-8_4111-6del rs751729752
NM_000267.3(NF1):c.6084+8C>G rs182709912
NM_000267.3(NF1):c.6297T>C (p.Ala2099=) rs371578074
NM_000267.3(NF1):c.647T>G (p.Leu216Arg)
NM_000267.3(NF1):c.7521A>G (p.Gln2507=) rs55865524
NM_000267.3(NF1):c.7935C>T (p.Asn2645=) rs747307832
NM_000267.3(NF1):c.79C>T (p.Gln27Ter) rs1060500363
NM_000271.5(NPC1):c.2972_2973del (p.Gln991fs) rs756815030
NM_000271.5(NPC1):c.3217G>A (p.Gly1073Ser) rs141440861
NM_000271.5(NPC1):c.3331C>T (p.Leu1111=) rs151125564
NM_000271.5(NPC1):c.57+4A>G rs1057519229
NM_000271.5(NPC1):c.665A>G (p.Asn222Ser) rs55680026
NM_000274.3(OAT):c.1311G>T (p.Leu437Phe) rs1800456
NM_000274.3(OAT):c.772-1G>A rs770390524
NM_000275.3(OCA2):c.1441G>A (p.Ala481Thr) rs74653330
NM_000277.3(PAH):c.506G>A (p.Arg169His) rs199475679
NM_000278.5(PAX2):c.357G>T (p.Leu119=)
NM_000280.4(PAX6):c.1088C>A (p.Ser363Ter) rs1411880763
NM_000282.4(PCCA):c.2017G>C (p.Val673Leu) rs142646074
NM_000283.3(PDE6B):c.655T>C (p.Tyr219His) rs62295357
NM_000283.3(PDE6B):c.928-9_940dup rs1553809300
NM_000284.4(PDHA1):c.396A>C (p.Arg132=) rs757654963
NM_000286.3(PEX12):c.959C>T (p.Ser320Phe) rs28936697
NM_000287.4(PEX6):c.1802G>A (p.Arg601Gln) rs34324426
NM_000288.4(PEX7):c.377A>C (p.Gln126Pro) rs113268723
NM_000288.4(PEX7):c.875T>A (p.Leu292Ter) rs1805137
NM_000291.4(PGK1):c.1188T>A (p.Gly396=)
NM_000291.4(PGK1):c.1234G>A (p.Asp412Asn) rs782165735
NM_000292.3(PHKA2):c.1398G>A (p.Ala466=) rs146631734
NM_000294.3(PHKG2):c.324C>T (p.Asp108=) rs138416154
NM_000295.5(SERPINA1):c.514G>T (p.Gly172Trp) rs112030253
NM_000302.4(PLOD1):c.1203-3C>T rs376288573
NM_000302.4(PLOD1):c.1534C>T (p.Arg512Cys) rs138490756
NM_000302.4(PLOD1):c.555G>T (p.Lys185Asn) rs142978362
NM_000303.3(PMM2):c.91T>C (p.Phe31Leu) rs749720760
NM_000304.4(PMP22):c.152A>G (p.His51Arg) rs368908933
NM_000304.4(PMP22):c.320-4C>T rs377467465
NM_000304.4(PMP22):c.353C>T (p.Thr118Met) rs104894619
NM_000304.4(PMP22):c.79-6C>T rs201682989
NM_000308.3(CTSA):c.159C>T (p.Ile53=) rs150140984
NM_000308.3(CTSA):c.934G>A (p.Asp312Asn) rs142892564
NM_000314.7(PTEN):c.-975G>C rs587780001
NM_000314.7(PTEN):c.132C>T (p.Gly44=) rs150651961
NM_000314.7(PTEN):c.855A>G (p.Glu285=) rs751888926
NM_000318.3(PEX2):c.748T>C (p.Trp250Arg) rs142645936
NM_000321.2(RB1):c.1707A>G (p.Leu569=) rs3092895
NM_000321.2(RB1):c.1770T>C (p.Cys590=) rs145310579
NM_000321.2(RB1):c.1862G>A (p.Arg621His) rs373601944
NM_000321.2(RB1):c.2360G>A (p.Arg787Gln) rs748094394
NM_000321.2(RB1):c.42C>T (p.Ala14=) rs148980395
NM_000326.5(RLBP1):c.141+6G>A rs181321141
NM_000328.3(RPGR):c.732G>A (p.Lys244=) rs62638654
NM_000329.3(RPE65):c.102C>A (p.Ile34=)
NM_000329.3(RPE65):c.130C>T (p.Arg44Ter) rs368088025
NM_000329.3(RPE65):c.304G>T (p.Glu102Ter) rs62642584
NM_000334.4(SCN4A):c.1100+7G>A rs200770684
NM_000334.4(SCN4A):c.1796A>G (p.His599Arg) rs187401185
NM_000334.4(SCN4A):c.1902C>T (p.Pro634=) rs368811155
NM_000334.4(SCN4A):c.2623C>T (p.Pro875Ser) rs201148948
NM_000334.4(SCN4A):c.2697G>A (p.Leu899=) rs199827271
NM_000334.4(SCN4A):c.355G>A (p.Val119Ile) rs41280110
NM_000334.4(SCN4A):c.403A>C (p.Met135Leu) rs148028364
NM_000334.4(SCN4A):c.5468C>G (p.Pro1823Arg) rs376833596
NM_000334.4(SCN4A):c.952T>C (p.Trp318Arg) rs199676994
NM_000337.5(SGCD):c.213G>A (p.Arg71=) rs74846539
NM_000340.2(SLC2A2):c.1432C>G (p.Leu478Val) rs5397
NM_000342.3(SLC4A1):c.118G>A (p.Glu40Lys) rs45562031
NM_000342.4(SLC4A1):c.2701C>T (p.Arg901Trp) rs201265160
NM_000345.4(SNCA):c.216G>A (p.Thr72=)
NM_000346.4(SOX9):c.685+7C>T rs370951695
NM_000349.3(STAR):c.361C>T (p.Arg121Trp) rs34908868
NM_000350.3(ABCA4):c.1018T>C (p.Tyr340His) rs61748548
NM_000350.3(ABCA4):c.1025_1038del (p.Asp342fs) rs63749083
NM_000350.3(ABCA4):c.1268A>G (p.His423Arg) rs3112831
NM_000350.3(ABCA4):c.1411G>A (p.Glu471Lys) rs1800548
NM_000350.3(ABCA4):c.1532G>A (p.Arg511His) rs140482171
NM_000350.3(ABCA4):c.1622T>C (p.Leu541Pro) rs61751392
NM_000350.3(ABCA4):c.1654G>A (p.Val552Ile) rs145525174
NM_000350.3(ABCA4):c.1715G>A (p.Arg572Gln) rs61748559
NM_000350.3(ABCA4):c.1928T>G (p.Val643Gly) rs61754024
NM_000350.3(ABCA4):c.2023G>A (p.Val675Ile) rs575453437
NM_000350.3(ABCA4):c.2588-12C>G rs61751396
NM_000350.3(ABCA4):c.2690C>T (p.Thr897Ile) rs61749440
NM_000350.3(ABCA4):c.2948C>T (p.Thr983Ile) rs61752411
NM_000350.3(ABCA4):c.3113C>T (p.Ala1038Val) rs61751374
NM_000350.3(ABCA4):c.4539+2064C>T rs1553189179
NM_000350.3(ABCA4):c.455G>A (p.Arg152Gln) rs62646862
NM_000350.3(ABCA4):c.466A>G (p.Ile156Val) rs62646863
NM_000350.3(ABCA4):c.4685T>C (p.Ile1562Thr) rs1762111
NM_000350.3(ABCA4):c.4771G>A (p.Gly1591Arg) rs113106943
NM_000350.3(ABCA4):c.5018+2T>C rs61750562
NM_000350.3(ABCA4):c.5338C>G (p.Pro1780Ala) rs121909207
NM_000350.3(ABCA4):c.5603A>T (p.Asn1868Ile) rs1801466
NM_000350.3(ABCA4):c.5693G>A (p.Arg1898His) rs1800552
NM_000350.3(ABCA4):c.5908C>T (p.Leu1970Phe) rs28938473
NM_000350.3(ABCA4):c.6148G>C (p.Val2050Leu) rs41292677
NM_000350.3(ABCA4):c.6529G>A (p.Asp2177Asn) rs1800555
NM_000350.3(ABCA4):c.656G>C (p.Arg219Thr) rs61748537
NM_000351.7(STS):c.288T>C (p.Val96=)
NM_000355.4(TCN2):c.280G>A (p.Gly94Ser) rs11557600
NM_000359.3(TGM1):c.125C>A (p.Ser42Tyr) rs41295338
NM_000360.4(TH):c.1255G>A (p.Val419Met) rs184106392
NM_000360.4(TH):c.12C>T (p.Pro4=) rs147131010
NM_000360.4(TH):c.16G>A (p.Ala6Thr) rs74555599
NM_000360.4(TH):c.288G>C (p.Leu96=) rs151082354
NM_000360.4(TH):c.679G>A (p.Glu227Lys) rs536382000
NM_000361.2(THBD):c.127G>A (p.Ala43Thr) rs1800576
NM_000361.2(THBD):c.1502C>T (p.Pro501Leu) rs1800579
NM_000363.5(TNNI3):c.151-6C>G rs377258542
NM_000363.5(TNNI3):c.384G>A (p.Leu128=) rs373130533
NM_000363.5(TNNI3):c.493G>T (p.Glu165Ter) rs1057521530
NM_000364.3(TNNT2):c.113C>T (p.Ala38Val) rs200754249
NM_000368.4(TSC1):c.1178C>T (p.Thr393Ile) rs201452238
NM_000368.4(TSC1):c.1208C>T (p.Ser403Leu) rs118203504
NM_000368.4(TSC1):c.1438+6G>A rs118203530
NM_000368.4(TSC1):c.1977G>A (p.Ala659=) rs35958226
NM_000368.4(TSC1):c.2162G>A (p.Arg721His) rs769566267
NM_000368.4(TSC1):c.2285A>G (p.Asn762Ser) rs118203670
NM_000368.4(TSC1):c.2425G>C (p.Glu809Gln) rs118203692
NM_000368.4(TSC1):c.2653C>T (p.Arg885Trp) rs118203723
NM_000368.4(TSC1):c.3373T>C (p.Leu1125=) rs1157060310
NM_000368.4(TSC1):c.346T>G (p.Leu116Val) rs199620268
NM_000368.4(TSC1):c.378C>T (p.Val126=) rs373173550
NM_000368.4(TSC1):c.479G>A (p.Arg160His) rs749979841
NM_000368.4(TSC1):c.532G>A (p.Val178Ile) rs118203395
NM_000368.4(TSC1):c.782A>G (p.Lys261Arg) rs371225009
NM_000368.4(TSC1):c.87T>C (p.Phe29=) rs745384145
NM_000371.3(TTR):c.14G>A (p.Arg5His) rs138657343
NM_000371.3(TTR):c.328C>A (p.His110Asn) rs121918074
NM_000371.3(TTR):c.354C>T (p.Asn118=) rs11541797
NM_000371.3(TTR):c.416C>T (p.Thr139Met) rs28933981
NM_000382.3(ALDH3A2):c.1270C>T (p.Pro424Ser) rs61737992
NM_000382.3(ALDH3A2):c.28C>G (p.Gln10Glu) rs72547554
NM_000384.3(APOB):c.10131G>A (p.Leu3377=) rs1799812
NM_000384.3(APOB):c.10575C>T (p.Ser3525=) rs142573551
NM_000384.3(APOB):c.10708C>T (p.His3570Tyr) rs201736972
NM_000384.3(APOB):c.10740C>T (p.Asn3580=) rs150312765
NM_000384.3(APOB):c.11319G>A (p.Lys3773=) rs780811733
NM_000384.3(APOB):c.11401T>A (p.Ser3801Thr) rs12713540
NM_000384.3(APOB):c.11477C>T (p.Thr3826Met) rs61744153
NM_000384.3(APOB):c.11833A>G (p.Thr3945Ala) rs1801698
NM_000384.3(APOB):c.11911G>A (p.Glu3971Lys) rs373477107
NM_000384.3(APOB):c.12382G>A (p.Val4128Met) rs1801703
NM_000384.3(APOB):c.12794T>C (p.Val4265Ala) rs61743502
NM_000384.3(APOB):c.12940A>G (p.Ile4314Val) rs72654423
NM_000384.3(APOB):c.13680T>C (p.Thr4560=) rs72654427
NM_000384.3(APOB):c.2068-4T>A rs41291161
NM_000384.3(APOB):c.2188G>A (p.Val730Ile) rs12691202
NM_000384.3(APOB):c.2630C>T (p.Pro877Leu) rs12714097
NM_000384.3(APOB):c.2853G>A (p.Glu951=) rs151193347
NM_000384.3(APOB):c.3178T>C (p.Leu1060=) rs72653073
NM_000384.3(APOB):c.3383G>A (p.Arg1128His) rs12713843
NM_000384.3(APOB):c.3426G>A (p.Ser1142=) rs142448733
NM_000384.3(APOB):c.3471T>C (p.Tyr1157=) rs201128198
NM_000384.3(APOB):c.3740A>G (p.Tyr1247Cys) rs61741164
NM_000384.3(APOB):c.4299G>A (p.Ser1433=) rs376103623
NM_000384.3(APOB):c.4825T>C (p.Leu1609=) rs72653083
NM_000384.3(APOB):c.4838G>C (p.Ser1613Thr) rs61742247
NM_000384.3(APOB):c.5066G>A (p.Arg1689His) rs151009667
NM_000384.3(APOB):c.6636_6638TGA[1] (p.Asp2213del) rs541497967
NM_000384.3(APOB):c.6875T>C (p.Ile2292Thr) rs145977507
NM_000384.3(APOB):c.7285T>A (p.Ser2429Thr) rs72653092
NM_000384.3(APOB):c.7615G>A (p.Val2539Ile) rs148170480
NM_000384.3(APOB):c.7696G>A (p.Glu2566Lys) rs1801696
NM_000384.3(APOB):c.8462C>T (p.Pro2821Leu) rs72653095
NM_000384.3(APOB):c.8912A>C (p.Asn2971Thr) rs72653098
NM_000384.3(APOB):c.9105T>C (p.Asn3035=) rs147510760
NM_000384.3(APOB):c.9294C>T (p.Tyr3098=) rs145777339
NM_000384.3(APOB):c.9811G>A (p.Gly3271Ser) rs142422341
NM_000384.3(APOB):c.9883T>C (p.Tyr3295His) rs186299244
NM_000388.4(CASR):c.2767C>G (p.Pro923Ala) rs201517907
NM_000388.4(CASR):c.748G>A (p.Glu250Lys) rs62269092
NM_000391.4(TPP1):c.1497T>C (p.Pro499=) rs142672910
NM_000391.4(TPP1):c.14C>A (p.Ala5Asp) rs138976576
NM_000391.4(TPP1):c.542C>T (p.Ser181Phe) rs139059149
NM_000392.5(ABCC2):c.2073C>A (p.Val691=) rs17222624
NM_000392.5(ABCC2):c.2743C>T (p.Arg915Cys) rs112758556
NM_000392.5(ABCC2):c.842G>A (p.Ser281Asn) rs56131651
NM_000393.5(COL5A2):c.1738G>A (p.Val580Ile) rs771004951
NM_000393.5(COL5A2):c.403-3T>C rs369733690
NM_000393.5(COL5A2):c.4450G>A (p.Gly1484Ser) rs147420365
NM_000393.5(COL5A2):c.75A>G (p.Lys25=) rs549894501
NM_000398.7(CYB5R3):c.352C>T (p.His118Tyr)
NM_000399.5(EGR2):c.644C>T (p.Thr215Met) rs139147487
NM_000399.5(EGR2):c.832G>A (p.Ala278Thr) rs565355765
NM_000400.3(ERCC2):c.1381C>G (p.Leu461Val) rs121913016
NM_000400.3(ERCC2):c.601C>T (p.His201Tyr) rs1799792
NM_000400.4(ERCC2):c.1426G>A (p.Val476Ile)
NM_000400.4(ERCC2):c.1789C>T (p.Leu597=)
NM_000402.4(G6PD):c.653C>T (p.Ser218Phe) rs5030868
NM_000404.4(GLB1):c.31C>G (p.Leu11Val) rs77988381
NM_000406.2(GNRHR):c.317A>G (p.Gln106Arg) rs104893836
NM_000410.3(HFE):c.187C>G (p.His63Asp) rs1799945
NM_000410.3(HFE):c.193A>T (p.Ser65Cys) rs1800730
NM_000410.3(HFE):c.340+4T>C rs2071303
NM_000410.3(HFE):c.884T>C (p.Val295Ala) rs143175221
NM_000411.8(HLCS):c.890G>A (p.Arg297Gln) rs146030669
NM_000414.4(HSD17B4):c.1471G>A (p.Ala491Thr) rs28943591
NM_000414.4(HSD17B4):c.46G>A (p.Gly16Ser) rs137853096
NM_000426.3(LAMA2):c.1308T>G (p.Gly436=) rs41285286
NM_000426.3(LAMA2):c.3004G>A (p.Gly1002Ser)
NM_000426.3(LAMA2):c.3582T>C (p.Ile1194=) rs137962409
NM_000426.3(LAMA2):c.411G>A (p.Ala137=) rs149347601
NM_000426.3(LAMA2):c.4301C>T (p.Ser1434Leu)
NM_000426.3(LAMA2):c.4487C>T (p.Ala1496Val) rs147077184
NM_000426.3(LAMA2):c.4717+1G>T rs1131691660
NM_000426.3(LAMA2):c.5530C>T (p.Arg1844Cys) rs56173620
NM_000426.3(LAMA2):c.5562+5G>C rs771046502
NM_000426.3(LAMA2):c.5688C>T (p.His1896=) rs573779258
NM_000426.3(LAMA2):c.6506A>G (p.Asn2169Ser)
NM_000426.3(LAMA2):c.6788C>T (p.Thr2263Met) rs56209257
NM_000426.3(LAMA2):c.7344T>C (p.Asn2448=) rs199931560
NM_000426.3(LAMA2):c.9211+6T>C rs201375881
NM_000426.3(LAMA2):c.922G>A (p.Glu308Lys) rs146462599
NM_000426.3(LAMA2):c.9340G>A (p.Val3114Ile) rs200796753
NM_000432.3(MYL2):c.37G>A (p.Ala13Thr) rs104894363
NM_000432.3(MYL2):c.401A>C (p.Glu134Ala) rs143139258
NM_000435.3(NOTCH3):c.1819C>T (p.Arg607Cys) rs777751303
NM_000435.3(NOTCH3):c.203C>T (p.Pro68Leu) rs146810942
NM_000435.3(NOTCH3):c.2182C>T (p.Arg728Cys) rs1057519101
NM_000435.3(NOTCH3):c.4044C>T (p.Gly1348=) rs78926093
NM_000435.3(NOTCH3):c.451C>G (p.Gln151Glu) rs371491165
NM_000435.3(NOTCH3):c.831G>A (p.Glu277=)
NM_000436.4(OXCT1):c.112C>T (p.Arg38Cys) rs76956231
NM_000436.4(OXCT1):c.1491C>T (p.Asp497=) rs144283422
NM_000440.3(PDE6A):c.1086G>A (p.Ala362=) rs142259966
NM_000440.3(PDE6A):c.1476A>C (p.Gln492His) rs17711594
NM_000441.2(SLC26A4):c.2145G>T (p.Lys715Asn) rs397516427
NM_000441.2(SLC26A4):c.365dup (p.Ile124fs) rs786204730
NM_000441.2(SLC26A4):c.441G>A (p.Met147Ile) rs201905280
NM_000443.4(ABCB4):c.1529A>G (p.Asn510Ser) rs375315619
NM_000445.5(PLEC):c.10006C>T (p.Arg3336Cys) rs77303974
NM_000445.5(PLEC):c.10010C>T (p.Ala3337Val) rs183230983
NM_000445.5(PLEC):c.10042G>A (p.Gly3348Arg) rs34132016
NM_000445.5(PLEC):c.10186G>T (p.Val3396Leu) rs201373953
NM_000445.5(PLEC):c.10211G>A (p.Arg3404Gln) rs375724891
NM_000445.5(PLEC):c.10840C>T (p.Leu3614=) rs200006106
NM_000445.5(PLEC):c.12075C>T (p.Pro4025=) rs113137721
NM_000445.5(PLEC):c.12324C>T (p.Thr4108=) rs185022156
NM_000445.5(PLEC):c.12862G>A (p.Ala4288Thr) rs200924154
NM_000445.5(PLEC):c.13066C>T (p.Arg4356Cys) rs375593618
NM_000445.5(PLEC):c.13230C>T (p.Ala4410=)
NM_000445.5(PLEC):c.1326C>G (p.Ala442=) rs782527499
NM_000445.5(PLEC):c.13290G>A (p.Pro4430=) rs200338374
NM_000445.5(PLEC):c.13560G>A (p.Ser4520=) rs781929758
NM_000445.5(PLEC):c.2175G>A (p.Ala725=) rs373347166
NM_000445.5(PLEC):c.2318G>A (p.Arg773His) rs200887085
NM_000445.5(PLEC):c.2856C>T (p.Ala952=) rs201202488
NM_000445.5(PLEC):c.3126G>A (p.Pro1042=) rs368477108
NM_000445.5(PLEC):c.3252G>A (p.Ser1084=) rs371271326
NM_000445.5(PLEC):c.3267G>A (p.Thr1089=) rs782437578
NM_000445.5(PLEC):c.3669C>T (p.Asp1223=) rs377059744
NM_000445.5(PLEC):c.3966G>A (p.Pro1322=) rs148465219
NM_000445.5(PLEC):c.4036C>T (p.Leu1346=) rs201416081
NM_000445.5(PLEC):c.4053C>T (p.Ser1351=) rs375565604
NM_000445.5(PLEC):c.4157G>A (p.Arg1386His) rs574482100
NM_000445.5(PLEC):c.4301C>T (p.Ala1434Val) rs548430154
NM_000445.5(PLEC):c.4447G>A (p.Val1483Met) rs186848953
NM_000445.5(PLEC):c.4637C>T (p.Ser1546Leu) rs182120395
NM_000445.5(PLEC):c.4679G>A (p.Arg1560Gln) rs201430180
NM_000445.5(PLEC):c.4732C>T (p.Arg1578Cys) rs2857824
NM_000445.5(PLEC):c.4757G>A (p.Arg1586Gln)
NM_000445.5(PLEC):c.5004G>A (p.Ala1668=)
NM_000445.5(PLEC):c.5061C>T (p.Ala1687=) rs199612329
NM_000445.5(PLEC):c.5110G>A (p.Gly1704Ser) rs373952777
NM_000445.5(PLEC):c.5308G>A (p.Ala1770Thr) rs781946435
NM_000445.5(PLEC):c.5385G>A (p.Leu1795=) rs186670912
NM_000445.5(PLEC):c.5568C>T (p.Ala1856=) rs781998103
NM_000445.5(PLEC):c.5842C>T (p.Arg1948Trp) rs201278290
NM_000445.5(PLEC):c.6285G>A (p.Thr2095=)
NM_000445.5(PLEC):c.6381G>A (p.Ala2127=) rs188154081
NM_000445.5(PLEC):c.6507C>T (p.Ala2169=) rs200062782
NM_000445.5(PLEC):c.6519G>A (p.Ala2173=) rs374211586
NM_000445.5(PLEC):c.6675C>T (p.Thr2225=) rs144242254
NM_000445.5(PLEC):c.7310C>T (p.Ala2437Val) rs543422533
NM_000445.5(PLEC):c.7348G>A (p.Ala2450Thr) rs193257576
NM_000445.5(PLEC):c.8587G>A (p.Asp2863Asn) rs200814155
NM_000445.5(PLEC):c.8590G>A (p.Glu2864Lys) rs199661077
NM_000445.5(PLEC):c.9162G>A (p.Ala3054=) rs199758196
NM_000445.5(PLEC):c.9414G>A (p.Gly3138=) rs188739870
NM_000445.5(PLEC):c.9799G>A (p.Glu3267Lys) rs75857070
NM_000445.5(PLEC):c.9977G>A (p.Arg3326Gln) rs368318946
NM_000447.3(PSEN2):c.336C>T (p.Tyr112=) rs200610057
NM_000447.3(PSEN2):c.415G>A (p.Val139Met) rs202178897
NM_000447.3(PSEN2):c.690C>G (p.Ala230=) rs145010538
NM_000452.3(SLC10A2):c.868C>T (p.Pro290Ser) rs56398830
NM_000452.3(SLC10A2):c.910T>C (p.Phe304Leu) rs61966074
NM_000454.4(SOD1):c.115C>G (p.Leu39Val) rs121912432
NM_000454.4(SOD1):c.272A>C (p.Asp91Ala) rs80265967
NM_000454.4(SOD1):c.335dup (p.Cys112fs) rs1568810771
NM_000455.4(STK11):c.1185A>G (p.Thr395=) rs370207155
NM_000455.4(STK11):c.1211C>T (p.Ser404Phe) rs200078204
NM_000455.4(STK11):c.1251C>T (p.Ala417=) rs1060503786
NM_000455.4(STK11):c.375-7G>A rs587781176
NM_000455.4(STK11):c.615G>A (p.Ala205=) rs532889728
NM_000455.4(STK11):c.795G>A (p.Glu265=) rs730881963
NM_000458.4(HNF1B):c.1006C>G (p.His336Asp) rs138986885
NM_000458.4(HNF1B):c.517G>A (p.Val173Ile)
NM_000462.5(UBE3A):c.2428A>G (p.Thr810Ala) rs374519603
NM_000465.4(BARD1):c.1194A>G (p.Thr398=) rs781482219
NM_000465.4(BARD1):c.1216C>T (p.Arg406Ter) rs377153250
NM_000465.4(BARD1):c.1317C>T (p.Gly439=) rs369986649
NM_000465.4(BARD1):c.1347A>G (p.Gln449=) rs373257776
NM_000465.4(BARD1):c.1409A>G (p.Asn470Ser) rs587781976
NM_000465.4(BARD1):c.1586G>A (p.Arg529Gln) rs753479021
NM_000465.4(BARD1):c.1972C>T (p.Arg658Cys) rs3738888
NM_000465.4(BARD1):c.1977A>G (p.Arg659=) rs147215925
NM_000465.4(BARD1):c.659T>C (p.Leu220Ser) rs138593305
NM_000465.4(BARD1):c.684A>G (p.Glu228=) rs780627045
NM_000466.3(PEX1):c.1579A>G (p.Thr527Ala) rs144942544
NM_000466.3(PEX1):c.2442C>T (p.Phe814=) rs145430946
NM_000466.3(PEX1):c.3373A>T (p.Met1125Leu) rs142994610
NM_000478.6(ALPL):c.571G>A (p.Glu191Lys) rs121918007
NM_000481.3(AMT):c.354G>A (p.Leu118=) rs145194293
NM_000481.3(AMT):c.631G>A (p.Glu211Lys) rs116192290
NM_000487.6(ARSA):c.466-7G>C rs6151414
NM_000488.3(SERPINC1):c.1246G>T (p.Ala416Ser) rs121909548
NM_000488.3(SERPINC1):c.89T>A (p.Val30Glu) rs2227624
NM_000489.5(ATRX):c.1303A>G (p.Ile435Val)
NM_000489.5(ATRX):c.4249C>T (p.Arg1417Trp) rs1557118764
NM_000492.3(CFTR):c.1210-12T[5] rs1805177
NM_000492.3(CFTR):c.1727G>C (p.Gly576Ala) rs1800098
NM_000492.3(CFTR):c.2002C>T (p.Arg668Cys) rs1800100
NM_000492.3(CFTR):c.224G>A (p.Arg75Gln) rs1800076
NM_000492.3(CFTR):c.2620-6T>C rs371315682
NM_000492.3(CFTR):c.2991G>C (p.Leu997Phe) rs1800111
NM_000492.3(CFTR):c.3080T>C (p.Ile1027Thr) rs1800112
NM_000492.3(CFTR):c.3285A>T (p.Thr1095=) rs1800118
NM_000492.3(CFTR):c.3415A>G (p.Ile1139Val) rs397508556
NM_000492.3(CFTR):c.3485G>T (p.Arg1162Leu) rs1800120
NM_000492.3(CFTR):c.360G>A (p.Ala120=) rs1800077
NM_000492.3(CFTR):c.4333G>A (p.Asp1445Asn) rs148783445
NM_000495.5(COL4A5):c.920G>A (p.Gly307Asp) rs104886082
NM_000501.4(ELN):c.930C>T (p.Ala310=) rs147367888
NM_000503.6(EYA1):c.1460C>T (p.Ser487Leu) rs139717960
NM_000503.6(EYA1):c.630T>C (p.Ser210=) rs373102227
NM_000506.3(F2):c.598G>A (p.Glu200Lys) rs62623459
NM_000506.4(F2):c.1824C>T (p.Arg608=) rs3136532
NM_000520.5(HEXA):c.739C>T (p.Arg247Trp) rs121907970
NM_000520.6(HEXA):c.1231G>A (p.Gly411Ser) rs575121167
NM_000520.6(HEXA):c.1435G>A (p.Ala479Thr) rs145012038
NM_000520.6(HEXA):c.459+5G>A rs762060470
NM_000521.4(HEXB):c.214C>T (p.Leu72Phe) rs147155126
NM_000527.4(LDLR):c.1414G>A (p.Asp472Asn) rs730882102
NM_000527.4(LDLR):c.1435C>G (p.Leu479Val) rs1254928151
NM_000527.4(LDLR):c.1546G>A (p.Gly516Ser) rs141673997
NM_000527.4(LDLR):c.1553A>G (p.Lys518Arg) rs879254938
NM_000527.4(LDLR):c.1618G>A (p.Ala540Thr) rs769370816
NM_000527.4(LDLR):c.1720C>T (p.Arg574Cys) rs185098634
NM_000527.4(LDLR):c.1730G>A (p.Trp577Ter) rs138947766
NM_000527.4(LDLR):c.1951G>A (p.Asp651Asn) rs730882110
NM_000527.4(LDLR):c.2101G>A (p.Gly701Ser) rs368838866
NM_000527.4(LDLR):c.2177C>T (p.Thr726Ile) rs45508991
NM_000527.4(LDLR):c.2231G>A (p.Arg744Gln) rs137853963
NM_000527.4(LDLR):c.2252G>A (p.Arg751Gln) rs200142970
NM_000527.4(LDLR):c.757C>T (p.Arg253Trp) rs150673992
NM_000527.4(LDLR):c.941-39C>T rs55792959
NM_000528.4(MAN2B1):c.2260G>A (p.Glu754Lys) rs141212446
NM_000530.8(MPZ):c.24C>T (p.Ser8=) rs144841836
NM_000530.8(MPZ):c.347A>G (p.Asn116Ser) rs281865130
NM_000531.6(OTC):c.374C>T (p.Thr125Met) rs72554356
NM_000532.5(PCCB):c.1421A>G (p.Lys474Arg) rs145628302
NM_000532.5(PCCB):c.303+8T>A rs199769617
NM_000532.5(PCCB):c.815G>A (p.Arg272Gln) rs150555106
NM_000535.7(PMS2):c.1344A>T (p.Gly448=) rs759192470
NM_000535.7(PMS2):c.1437C>G (p.His479Gln) rs63750685
NM_000535.7(PMS2):c.1560G>A (p.Ala520=) rs201167814
NM_000535.7(PMS2):c.1569C>G (p.Ser523=) rs141458772
NM_000535.7(PMS2):c.1688G>T (p.Arg563Leu) rs63750668
NM_000535.7(PMS2):c.1714G>A (p.Ala572Thr) rs63751023
NM_000535.7(PMS2):c.1717A>T (p.Thr573Ser) rs63751211
NM_000535.7(PMS2):c.180C>G (p.Asp60Glu) rs200313585
NM_000535.7(PMS2):c.1828A>G (p.Lys610Glu) rs199700509
NM_000535.7(PMS2):c.2012C>T (p.Thr671Met) rs587780046
NM_000535.7(PMS2):c.2113G>A (p.Glu705Lys) rs267608161
NM_000535.7(PMS2):c.2187C>G (p.Leu729=) rs373630535
NM_000535.7(PMS2):c.2249G>A (p.Gly750Asp) rs587779337
NM_000535.7(PMS2):c.2356C>A (p.Leu786Met) rs576055272
NM_000535.7(PMS2):c.255G>A (p.Leu85=) rs200491279
NM_000535.7(PMS2):c.595C>T (p.Arg199Cys) rs372297364
NM_000535.7(PMS2):c.687T>C (p.Ser229=) rs786201508
NM_000535.7(PMS2):c.795T>C (p.Asn265=) rs766667186
NM_000535.7(PMS2):c.803+5G>A rs939641251
NM_000535.7(PMS2):c.86G>C (p.Gly29Ala) rs146176004
NM_000540.2(RYR1):c.10048C>A (p.Arg3350=) rs200355885
NM_000540.2(RYR1):c.10097G>A (p.Arg3366His) rs137932199
NM_000540.2(RYR1):c.10119G>A (p.Val3373=) rs140689610
NM_000540.2(RYR1):c.10616G>A (p.Arg3539His) rs143987857
NM_000540.2(RYR1):c.10917G>A (p.Thr3639=) rs371952058
NM_000540.2(RYR1):c.11798A>G (p.Tyr3933Cys) rs147136339
NM_000540.2(RYR1):c.12283-7C>T rs143861818
NM_000540.2(RYR1):c.12869C>T (p.Ala4290Val) rs755065800
NM_000540.2(RYR1):c.12879G>C (p.Ala4293=) rs193922854
NM_000540.2(RYR1):c.12880A>G (p.Thr4294Ala) rs1003914966
NM_000540.2(RYR1):c.12956G>A (p.Arg4319Gln) rs539194350
NM_000540.2(RYR1):c.131G>A (p.Arg44His) rs139161723
NM_000540.2(RYR1):c.13505A>G (p.Glu4502Gly) rs139647387
NM_000540.2(RYR1):c.13513G>C (p.Asp4505His) rs150396398
NM_000540.2(RYR1):c.13863G>A (p.Glu4621=) rs140750876
NM_000540.2(RYR1):c.14130-8C>G rs140808099
NM_000540.2(RYR1):c.14505G>A (p.Gly4835=) rs118126378
NM_000540.2(RYR1):c.1453A>G (p.Met485Val) rs147723844
NM_000540.2(RYR1):c.14589C>T (p.Phe4863=) rs146072491
NM_000540.2(RYR1):c.14642T>C (p.Met4881Thr) rs1568605367
NM_000540.2(RYR1):c.1598G>A (p.Arg533His) rs144336148
NM_000540.2(RYR1):c.2091C>T (p.Ala697=) rs138704724
NM_000540.2(RYR1):c.2121C>A (p.Gly707=) rs146104858
NM_000540.2(RYR1):c.2160C>G (p.Leu720=) rs200914778
NM_000540.2(RYR1):c.2319C>T (p.Asp773=) rs374924686
NM_000540.2(RYR1):c.2356G>A (p.Val786Ile) rs369281291
NM_000540.2(RYR1):c.2871-5C>T rs45585535
NM_000540.2(RYR1):c.2919C>T (p.His973=) rs139363830
NM_000540.2(RYR1):c.3111C>T (p.Ser1037=) rs145434723
NM_000540.2(RYR1):c.3252C>T (p.Ser1084=) rs144164620
NM_000540.2(RYR1):c.3420C>T (p.Arg1140=) rs201599911
NM_000540.2(RYR1):c.3924G>C (p.Pro1308=) rs144350050
NM_000540.2(RYR1):c.4178A>G (p.Lys1393Arg) rs137933390
NM_000540.2(RYR1):c.4294-4C>T rs368108496
NM_000540.2(RYR1):c.46-5C>T rs774388278
NM_000540.2(RYR1):c.4710C>T (p.Asn1570=) rs763113534
NM_000540.2(RYR1):c.4711A>G (p.Ile1571Val) rs146429605
NM_000540.2(RYR1):c.4911G>A (p.Ala1637=) rs370350821
NM_000540.2(RYR1):c.4999C>T (p.Arg1667Cys) rs144157950
NM_000540.2(RYR1):c.5036G>A (p.Arg1679His) rs146504767
NM_000540.2(RYR1):c.5340_5341del (p.Cys1781fs) rs779723153
NM_000540.2(RYR1):c.5637C>T (p.Asp1879=) rs143418190
NM_000540.2(RYR1):c.6645C>T (p.Leu2215=) rs146617004
NM_000540.2(RYR1):c.6961A>G (p.Ile2321Val) rs34390345
NM_000540.2(RYR1):c.7007G>A (p.Arg2336His) rs112563513
NM_000540.2(RYR1):c.7025A>G (p.Asn2342Ser) rs147213895
NM_000540.2(RYR1):c.7536C>T (p.Ile2512=) rs368560744
NM_000540.2(RYR1):c.7830C>T (p.Leu2610=) rs140063541
NM_000540.2(RYR1):c.7923C>G (p.Leu2641=) rs142558977
NM_000540.2(RYR1):c.8026C>T (p.Arg2676Trp) rs193922826
NM_000540.2(RYR1):c.8112C>T (p.Cys2704=) rs763722972
NM_000540.2(RYR1):c.8142T>C (p.Tyr2714=) rs567352621
NM_000540.2(RYR1):c.8327C>T (p.Ser2776Phe) rs147707463
NM_000540.2(RYR1):c.9348G>A (p.Ser3116=) rs763655831
NM_000540.2(RYR1):c.9635A>G (p.Glu3212Gly) rs199738299
NM_000543.5(SMPD1):c.1550A>T (p.Glu517Val) rs142787001
NM_000543.5(SMPD1):c.441G>A (p.Val147=) rs148944108
NM_000545.6(HNF1A):c.1748G>A (p.Arg583Gln) rs137853242
NM_000548.5(TSC2):c.1040A>G (p.Lys347Arg) rs367963898
NM_000548.5(TSC2):c.1070C>T (p.Ala357Val) rs150195368
NM_000548.5(TSC2):c.1119+6G>C rs397515305
NM_000548.5(TSC2):c.1143G>A (p.Arg381=) rs45517155
NM_000548.5(TSC2):c.1281C>A (p.Ile427=) rs45478892
NM_000548.5(TSC2):c.1340C>T (p.Ala447Val) rs45486591
NM_000548.5(TSC2):c.1378G>A (p.Ala460Thr) rs137854154
NM_000548.5(TSC2):c.1387A>G (p.Ile463Val) rs45517171
NM_000548.5(TSC2):c.1398G>A (p.Leu466=) rs200702857
NM_000548.5(TSC2):c.1514G>A (p.Arg505Gln) rs376285784
NM_000548.5(TSC2):c.1656A>G (p.Ala552=) rs373515515
NM_000548.5(TSC2):c.1818C>T (p.Ile606=) rs547389841
NM_000548.5(TSC2):c.1820C>T (p.Ala607Val) rs397515296
NM_000548.5(TSC2):c.1981G>A (p.Gly661Ser) rs137854168
NM_000548.5(TSC2):c.223G>A (p.Glu75Lys) rs145470784
NM_000548.5(TSC2):c.2297T>C (p.Val766Ala) rs780682938
NM_000548.5(TSC2):c.2356C>T (p.Arg786Cys) rs767252128
NM_000548.5(TSC2):c.2427C>T (p.Ser809=) rs182849638
NM_000548.5(TSC2):c.251C>T (p.Ala84Val) rs35660529
NM_000548.5(TSC2):c.2546-5C>T rs45517247
NM_000548.5(TSC2):c.2584G>A (p.Ala862Thr) rs759837836
NM_000548.5(TSC2):c.2585C>T (p.Ala862Val) rs45517249
NM_000548.5(TSC2):c.299C>T (p.Ala100Val) rs375824753
NM_000548.5(TSC2):c.300G>A (p.Ala100=) rs45517100
NM_000548.5(TSC2):c.3140T>C (p.Val1047Ala) rs45517284
NM_000548.5(TSC2):c.3420C>T (p.Gly1140=) rs373968155
NM_000548.5(TSC2):c.3489C>T (p.Ala1163=) rs200346578
NM_000548.5(TSC2):c.3744C>T (p.Ala1248=) rs45517307
NM_000548.5(TSC2):c.3955G>A (p.Asp1319Asn) rs375883030
NM_000548.5(TSC2):c.4094C>T (p.Ser1365Leu) rs377123510
NM_000548.5(TSC2):c.4105C>T (p.Arg1369Trp) rs45517328
NM_000548.5(TSC2):c.4216G>T (p.Asp1406Tyr) rs147719291
NM_000548.5(TSC2):c.4260A>G (p.Ser1420=) rs1285012780
NM_000548.5(TSC2):c.4432G>C (p.Asp1478His) rs45517343
NM_000548.5(TSC2):c.4493+7C>A rs199943270
NM_000548.5(TSC2):c.4795G>A (p.Val1599Met) rs772687631
NM_000548.5(TSC2):c.4905C>T (p.Cys1635=) rs397514999
NM_000548.5(TSC2):c.5035G>A (p.Glu1679Lys) rs370404391
NM_000548.5(TSC2):c.5116C>T (p.Arg1706Cys) rs45517391
NM_000548.5(TSC2):c.5117G>A (p.Arg1706His) rs45517392
NM_000548.5(TSC2):c.5161-4C>G rs45517406
NM_000548.5(TSC2):c.5307C>T (p.His1769=) rs562220073
NM_000548.5(TSC2):c.5312C>T (p.Pro1771Leu) rs137854214
NM_000548.5(TSC2):c.5364T>C (p.Tyr1788=) rs367703283
NM_000548.5(TSC2):c.5383C>T (p.Arg1795Cys) rs45517423
NM_000548.5(TSC2):c.538C>G (p.Leu180Val) rs45485591
NM_000548.5(TSC2):c.552C>T (p.Val184=) rs199991910
NM_000548.5(TSC2):c.618C>T (p.Cys206=) rs45498496
NM_000548.5(TSC2):c.708C>T (p.Leu236=) rs756121647
NM_000548.5(TSC2):c.759C>T (p.Cys253=) rs45517125
NM_000548.5(TSC2):c.775-5C>T rs181827303
NM_000548.5(TSC2):c.814G>A (p.Ala272Thr) rs373818076
NM_000548.5(TSC2):c.975+8G>A rs137853984
NM_000551.3(VHL):c.150C>G (p.Ala50=) rs61751580
NM_000551.3(VHL):c.183C>G (p.Pro61=) rs63650860
NM_000551.3(VHL):c.241C>T (p.Pro81Ser) rs104893829
NM_000551.3(VHL):c.463+8C>T rs5030834
NM_000551.3(VHL):c.500G>A (p.Arg167Gln) rs5030821
NM_000551.3(VHL):c.74C>T (p.Pro25Leu) rs35460768
NM_000552.4(VWF):c.114C>T (p.Phe38=) rs2229443
NM_000552.4(VWF):c.1922C>T (p.Ala641Val) rs61754019
NM_000552.4(VWF):c.2365A>G (p.Thr789Ala) rs1063856
NM_000552.4(VWF):c.3692A>C (p.Asn1231Thr) rs61749368
NM_000552.4(VWF):c.3789G>A (p.Ser1263=) rs199831474
NM_000552.4(VWF):c.3797C>A (p.Pro1266Gln) rs61749370
NM_000552.4(VWF):c.4751A>G (p.Tyr1584Cys) rs1800386
NM_000552.4(VWF):c.5170+10C>T rs61750601
NM_000552.4(VWF):c.5277C>T (p.Asp1759=) rs41276736
NM_000552.4(VWF):c.5278G>A (p.Val1760Ile) rs61750604
NM_000552.4(VWF):c.546G>A (p.Ser182=) rs143054357
NM_000552.4(VWF):c.5851A>G (p.Thr1951Ala) rs144072210
NM_000552.4(VWF):c.6756G>A (p.Glu2252=) rs71581020
NM_000552.4(VWF):c.7082-13G>C rs71581025
NM_000552.4(VWF):c.7682T>A (p.Phe2561Tyr) rs35335161
NM_000552.4(VWF):c.7988G>C (p.Arg2663Pro) rs149834874
NM_000552.4(VWF):c.858C>T (p.Thr286=) rs776206258
NM_000553.4(WRN):c.1717A>G (p.Thr573Ala) rs150148567
NM_000553.4(WRN):c.3785C>G (p.Thr1262Arg) rs78488552
NM_000553.4:c.1578delC rs780555196
NM_000553.5(WRN):c.1149G>T (p.Leu383Phe) rs4987238
NM_000553.5(WRN):c.1165del (p.Arg389Glufs) rs878854131
NM_000553.5(WRN):c.2983G>A (p.Ala995Thr) rs140768346
NM_000553.5(WRN):c.903G>A (p.Gly301=) rs747226837
NM_000553.5(WRN):c.95A>G (p.Lys32Arg) rs34477820
NM_000554.6(CRX):c.122G>A (p.Arg41Gln) rs61748436
NM_000554.6(CRX):c.196G>A (p.Val66Ile) rs61748438
NM_000554.6(CRX):c.253-15G>A rs145805694
NM_000554.6(CRX):c.28C>G (p.His10Asp) rs139340178
NM_000554.6(CRX):c.425A>G (p.Tyr142Cys) rs61748442
NM_000593.5(TAP1):c.1231-3C>T rs56366814
NM_000601.6(HGF):c.1008G>A (p.Glu336=) rs148714837
NM_000602.5(SERPINE1):c.357G>A (p.Ala119=)
NM_000628.5(IL10RB):c.442G>A (p.Val148Met) rs45545138
NM_000631.5(NCF4):c.478G>A (p.Val160Met) rs150103256
NM_000637.5(GSR):c.694G>A (p.Gly232Ser)
NM_000642.3(AGL):c.1481G>A (p.Arg494His) rs141043166
NM_000642.3(AGL):c.2390A>G (p.Asn797Ser) rs149210307
NM_000642.3(AGL):c.2522C>T (p.Ser841Phe) rs150441555
NM_000642.3(AGL):c.4331A>G (p.Asn1444Ser) rs143815159
NM_000642.3(AGL):c.82+4A>C rs765098686
NM_000666.3(ACY1):c.1178G>A (p.Arg393His) rs121912701
NM_000702.4(ATP1A2):c.1261C>T (p.Arg421Ter) rs1165052640
NM_000702.4(ATP1A2):c.1474G>A (p.Glu492Lys) rs142348542
NM_000702.4(ATP1A2):c.2066G>A (p.Arg689Gln) rs28933401
NM_000702.4(ATP1A2):c.2130C>T (p.Ala710=) rs374749325
NM_000718.4(CACNA1B):c.30C>T (p.Gly10=) rs767457983
NM_000719.7(CACNA1C):c.202G>A (p.Ala68Thr) rs752000790
NM_000719.7(CACNA1C):c.2067C>T (p.Phe689=) rs112170830
NM_000719.7(CACNA1C):c.2391G>A (p.Gly797=) rs374857905
NM_000719.7(CACNA1C):c.2437G>A (p.Gly813Arg) rs545511851
NM_000719.7(CACNA1C):c.4380C>T (p.Tyr1460=) rs747654175
NM_000719.7(CACNA1C):c.5593G>A (p.Glu1865Lys) rs200231105
NM_000719.7(CACNA1C):c.5644T>C (p.Ser1882Pro) rs369438564
NM_000719.7(CACNA1C):c.6272A>G (p.Asn2091Ser) rs201090446
NM_000719.7(CACNA1C):c.792C>A (p.Ala264=) rs750459136
NM_000726.4(CACNB4):c.311G>T (p.Cys104Phe) rs1805031
NM_000742.4(CHRNA2):c.140C>T (p.Thr47Met) rs74772771
NM_000744.6(CHRNA4):c.1360G>A (p.Gly454Ser) rs78306886
NM_000744.6(CHRNA4):c.1634C>T (p.Thr545Met) rs121912282
NM_000744.6(CHRNA4):c.296G>A (p.Arg99His) rs143103435
NM_000748.3(CHRNB2):c.1235G>A (p.Gly412Asp) rs112585933
NM_000748.3(CHRNB2):c.297T>C (p.Phe99=) rs777276160
NM_000751.3(CHRND):c.862C>G (p.Gln288Glu) rs41265127
NM_000760.4(CSF3R):c.447G>C (p.Glu149Asp) rs139332126
NM_000784.4(CYP27A1):c.1419C>T (p.Val473=) rs138596741
NM_000784.4(CYP27A1):c.1471G>T (p.Ala491Ser) rs72551323
NM_000814.6(GABRB3):c.1293G>A (p.Arg431=) rs75914945
NM_000814.6(GABRB3):c.380A>G (p.Lys127Arg) rs1057519201
NM_000815.5(GABRD):c.1060-7C>T rs368961588
NM_000815.5(GABRD):c.147C>T (p.Ala49=) rs147463074
NM_000834.4(GRIN2B):c.189C>T (p.Ser63=) rs199707487
NM_000834.4(GRIN2B):c.190G>A (p.Val64Met) rs150070901
NM_000834.4(GRIN2B):c.2065G>A (p.Gly689Ser) rs869312868
NM_000834.4(GRIN2B):c.3047G>A (p.Arg1016Lys) rs141109968
NM_000834.4(GRIN2B):c.3076G>A (p.Gly1026Ser) rs201963596
NM_000834.4(GRIN2B):c.3981G>A (p.Lys1327=) rs201670483
NM_000834.4(GRIN2B):c.3993G>A (p.Met1331Ile) rs200035225
NM_000836.2(GRIN2D):c.2910G>A (p.Pro970=)
NM_000843.4(GRM6):c.19G>A (p.Ala7Thr) rs62642053
NM_000843.4(GRM6):c.2257G>A (p.Gly753Ser) rs79602188
NM_000875.5(IGF1R):c.1532G>A (p.Arg511Gln) rs33958176
NM_000883.4(IMPDH1):c.377T>C (p.Phe126Ser) rs367549284
NM_000890.5(KCNJ5):c.438C>T (p.Thr146=)
NM_000902.4(MME):c.1033G>A (p.Val345Ile) rs61758194
NM_000930.5(PLAT):c.860C>T (p.Thr287Met)
NM_000934.3(SERPINF2):c.1107C>T (p.Ser369=) rs148395057
NM_000941.3(POR):c.1891G>A (p.Val631Ile) rs145782750
NM_001001344.2(ATP2B3):c.1099C>T (p.Leu367=) rs150989590
NM_001003800.2(BICD2):c.1893C>T (p.Ile631=) rs141414055
NM_001003800.2(BICD2):c.2331G>A (p.Thr777=) rs779170531
NM_001005360.2(DNM2):c.2201A>G (p.Asn734Ser) rs577767034
NM_001005360.2(DNM2):c.238C>T (p.His80Tyr) rs148790687
NM_001005360.2(DNM2):c.2543+7C>G rs201979143
NM_001005360.2(DNM2):c.2592C>T (p.Ala864=) rs373161548
NM_001005360.2(DNM2):c.633C>T (p.Asp211=) rs200191870
NM_001005361.3(DNM2):c.1965C>T (p.Thr655=)
NM_001006658.2(CR2):c.1676G>A (p.Gly559Glu) rs143614333
NM_001006658.2(CR2):c.2298G>A (p.Trp766Ter) rs151093663
NM_001006658.2(CR2):c.524C>T (p.Pro175Leu) rs75282758
NM_001006658.2(CR2):c.970C>T (p.Arg324Cys) rs147393483
NM_001008212.2(OPTN):c.403G>T (p.Glu135Ter) rs140599944
NM_001008212.2(OPTN):c.489A>G (p.Glu163=) rs113811959
NM_001008537.3(NEXMIF):c.3823A>G (p.Ser1275Gly) rs201434271
NM_001008781.2(FAT3):c.5391G>A (p.Val1797=) rs143705185
NM_001009894.3(C12orf29):c.*807_*808CT[1] rs569673313
NM_001009944.3(PKD1):c.6749C>T (p.Thr2250Met) rs139971481
NM_001009944.3(PKD1):c.8161+5C>T rs534696523
NM_001009944.3(PKD1):c.971G>T (p.Arg324Leu) rs199476099
NM_001017420.3(ESCO2):c.1175G>A (p.Cys392Tyr) rs146312522
NM_001018005.2(TPM1):c.842T>C (p.Met281Thr) rs199476321
NM_001018111.3(PODXL):c.376A>C (p.Thr126Pro) rs55698400
NM_001018113.3(FANCB):c.1371C>T (p.Val457=) rs149695930
NM_001018113.3(FANCB):c.69T>C (p.Leu23=) rs151173533
NM_001022.4(RPS19):c.356+18G>C rs61762294
NM_001024688.2(NBN):c.896del (p.Pro299fs) rs587781969
NM_001025295.3(IFITM5):c.186+5G>A
NM_001029883.3(PCARE):c.2600C>T (p.Pro867Leu) rs182248363
NM_001029896.2(WDR45):c.257G>A (p.Arg86Gln) rs147437546
NM_001033855.3(DCLRE1C):c.1284A>C (p.Lys428Asn) rs113870881
NM_001034116.2(EIF2B4):c.51G>C (p.Lys17Asn)
NM_001034850.2(RETREG1):c.607G>A (p.Val203Met) rs143878016
NM_001035.3(RYR2):c.10017C>T (p.His3339=) rs376439588
NM_001035.3(RYR2):c.10941T>G (p.Pro3647=) rs370332882
NM_001035.3(RYR2):c.13449A>G (p.Lys4483=) rs1008224442
NM_001035.3(RYR2):c.13665C>T (p.Ile4555=) rs375213838
NM_001035.3(RYR2):c.3038G>A (p.Arg1013Gln) rs149514924
NM_001035.3(RYR2):c.4734C>T (p.Pro1578=) rs201880756
NM_001035.3(RYR2):c.8162T>C (p.Ile2721Thr) rs201500134
NM_001035.3(RYR2):c.8367T>C (p.Ile2789=) rs563219502
NM_001035.3(RYR2):c.8913T>C (p.Ile2971=) rs755520825
NM_001035511.2(SDHC):c.424G>A (p.Ala142Thr) rs182629842
NM_001035511.2(SDHC):c.430G>C (p.Glu144Gln) rs201210474
NM_001037.5(SCN1B):c.448+193G>A rs66876876
NM_001037.5(SCN1B):c.448+321G>A rs72558028
NM_001037.5(SCN1B):c.63C>T (p.Cys21=) rs200339565
NM_001039141.3(TRIOBP):c.3309C>T (p.His1103=) rs199594270
NM_001039141.3(TRIOBP):c.4031G>A (p.Arg1344Gln) rs34066624
NM_001039141.3(TRIOBP):c.584C>T (p.Thr195Ile) rs143157673
NM_001039523.3(CHRNA1):c.798C>T (p.Pro266=) rs189442556
NM_001039891.3(ZNF674):c.601C>T (p.Arg201Ter) rs182004761
NM_001040142.2(SCN2A):c.1923T>C (p.Asn641=) rs780183614
NM_001040142.2(SCN2A):c.2562+5A>G rs374738441
NM_001040142.2(SCN2A):c.2706C>G (p.Leu902=) rs192461273
NM_001040142.2(SCN2A):c.3579C>A (p.Leu1193=) rs367546924
NM_001040142.2(SCN2A):c.5155T>C (p.Leu1719=) rs199698414
NM_001040142.2(SCN2A):c.5319G>A (p.Ala1773=) rs373913233
NM_001040142.2(SCN2A):c.5397T>C (p.Tyr1799=) rs200603552
NM_001040142.2(SCN2A):c.5427G>A (p.Ala1809=) rs1177406324
NM_001040142.2(SCN2A):c.5517C>T (p.Leu1839=) rs148424455
NM_001040142.2(SCN2A):c.5580T>G (p.Ala1860=) rs752845880
NM_001040142.2(SCN2A):c.5752C>T (p.Arg1918Cys) rs139899756
NM_001040436.3(YARS2):c.626A>G (p.Lys209Arg) rs541554381
NM_001040616.3(LINS1):c.1479T>C (p.Cys493=) rs144513217
NM_001042472.3(ABHD12):c.769C>T (p.Arg257Trp) rs41306784
NM_001042537.1(SLC9A6):c.1703G>A (p.Arg568Gln) rs146263125
NM_001042537.1(SLC9A6):c.171C>G (p.Ile57Met) rs782296172
NM_001042545.2(LTBP4):c.1882C>T (p.Arg628Cys) rs200338042
NM_001042545.2(LTBP4):c.4034C>G (p.Pro1345Arg) rs199678003
NM_001042631.2(SDHAF1):c.334C>T (p.Pro112Ser) rs78119534
NM_001042723.2(RYR1):c.12936_12944GCGGCGGCT[3] (p.4313_4315RRL[3]) rs193922846
NM_001042723.2(RYR1):c.2654G>A (p.Arg885His) rs370634440
NM_001042723.2(RYR1):c.4405C>T (p.Arg1469Trp) rs200546266
NM_001042723.2(RYR1):c.5665_5667GAG[2] (p.Glu1891del) rs559371263
NM_001048166.1(STIL):c.1069G>A (p.Ala357Thr) rs75426387
NM_001048166.1(STIL):c.1455G>C (p.Leu485Phe) rs139912214
NM_001048171.1(MUTYH):c.37-7G>A rs780029247
NM_001048171.1(MUTYH):c.439G>C (p.Asp147His) rs564930066
NM_001048171.1(MUTYH):c.53C>T (p.Pro18Leu) rs79777494
NM_001048171.1(MUTYH):c.672C>T (p.Asn224=) rs767327888
NM_001048171.1(MUTYH):c.74G>A (p.Gly25Asp) rs75321043
NM_001065.3(TNFRSF1A):c.362G>A (p.Arg121Gln) rs4149584
NM_001065.3(TNFRSF1A):c.988G>A (p.Ala330Thr) rs200029309
NM_001065.4(TNFRSF1A):c.1329C>A (p.Gly443=)
NM_001077365.2(POMT1):c.2178G>A (p.Ter726=) rs147143094
NM_001077415.3(CRELD1):c.985C>T (p.Arg329Cys) rs28942091
NM_001079846.1(CREBBP):c.4345C>T (p.His1449Tyr) rs1057519207
NM_001079846.1(CREBBP):c.5242C>T (p.Arg1748Cys) rs1555471394
NM_001079846.1(CREBBP):c.5605G>A (p.Ala1869Thr) rs199990883
NM_001079846.1(CREBBP):c.6402C>T (p.Asn2134=) rs763852812
NM_001079878.2(CNGA3):c.143C>T (p.Pro48Leu) rs62156348
NM_001079878.2(CNGA3):c.1564G>A (p.Val522Ile) rs116448158
NM_001079878.2(CNGA3):c.686C>T (p.Thr229Met) rs148616345
NM_001080116.1(LDB3):c.780C>T (p.Asn260=) rs372789789
NM_001080414.4(CCDC88C):c.1527+8G>A
NM_001080414.4(CCDC88C):c.322G>A (p.Gly108Ser) rs61745604
NM_001080414.4(CCDC88C):c.4265C>T (p.Ser1422Leu) rs202217944
NM_001080414.4(CCDC88C):c.5296G>A (p.Val1766Met)
NM_001080414.4(CCDC88C):c.5980C>G (p.Arg1994Gly) rs45560241
NM_001080414.4(CCDC88C):c.766C>T (p.Leu256=) rs183742506
NM_001080414.4(CCDC88C):c.912C>T (p.Asp304=) rs61736349
NM_001080449.3(DNA2):c.1796G>A (p.Arg599His) rs201999986
NM_001080449.3(DNA2):c.2713C>A (p.Gln905Lys) rs181679245
NM_001080467.3(MYO5B):c.2125G>A (p.Val709Met) rs192207329
NM_001080467.3(MYO5B):c.2203-7T>C
NM_001080467.3(MYO5B):c.5395-6C>T rs140275825
NM_001080479.2(ARHGEF28):c.4054G>A (p.Val1352Ile) rs188040167
NM_001080510.4(METTL23):c.569T>C (p.Leu190Pro) rs147321492
NM_001080517.2(SETD5):c.2644C>T (p.Arg882Ter) rs1553635637
NM_001080522.2(CC2D2A):c.2844G>A (p.Arg948=) rs182369056
NM_001080522.2(CC2D2A):c.351T>G (p.Ser117Arg) rs186264635
NM_001081.3(CUBN):c.2922C>T (p.Phe974=) rs201802902
NM_001083602.2(PTCH1):c.1108G>A (p.Asp370Asn) rs142274954
NM_001083602.2(PTCH1):c.126A>G (p.Ile42Met) rs144182921
NM_001083602.2(PTCH1):c.1876G>A (p.Val626Met) rs758487789
NM_001083602.2(PTCH1):c.2436C>T (p.Asp812=) rs771732591
NM_001083602.2(PTCH1):c.3178G>A (p.Val1060Ile) rs147025073
NM_001083602.2(PTCH1):c.3692G>A (p.Arg1231Gln) rs386833412
NM_001083602.2(PTCH1):c.3749A>G (p.Tyr1250Cys) rs147067171
NM_001083602.2(PTCH1):c.4-1649del rs751977093
NM_001083602.2(PTCH1):c.4-1726C>G rs779791579
NM_001083961.2(WDR62):c.3763G>A (p.Val1255Ile) rs146180208
NM_001083961.2(WDR62):c.3946C>G (p.Gln1316Glu) rs35811023
NM_001083961.2(WDR62):c.4033C>T (p.Arg1345Cys)
NM_001083961.2(WDR62):c.4159C>A (p.Leu1387Ile) rs147652186
NM_001083961.2(WDR62):c.4312-5T>G rs182467995
NM_001084.5(PLOD3):c.1678G>C (p.Glu560Gln) rs140879834
NM_001084.5(PLOD3):c.805G>A (p.Val269Ile)
NM_001085049.3(MRAS):c.203C>T (p.Thr68Ile)
NM_001085411.3(NADK2):c.349A>G (p.Ile117Val)
NM_001098.3(ACO2):c.220C>G (p.Leu74Val) rs141772938
NM_001098484.3(SLC4A4):c.1805A>G (p.Lys602Arg)
NM_001099287.1(NIPAL4):c.446C>T (p.Thr149Met) rs188020393
NM_001099404.1(SCN5A):c.4509C>T (p.Ser1503=) rs45548237
NM_001099922.3(ALG13):c.3008A>G (p.Tyr1003Cys) rs201055779
NM_001099922.3(ALG13):c.371A>G (p.Tyr124Cys) rs145518377
NM_001101.5(ACTB):c.1043C>T (p.Ser348Leu) rs886041309
NM_001101426.4(CRPPA):c.184del (p.Val62fs) rs1048457038
NM_001103.3(ACTN2):c.1235C>T (p.Thr412Met) rs139515659
NM_001103.3(ACTN2):c.1452G>A (p.Gln484=) rs200529923
NM_001103.3(ACTN2):c.2147C>T (p.Thr716Met) rs193922635
NM_001103.3(ACTN2):c.2601C>T (p.Pro867=) rs147245615
NM_001103.3(ACTN2):c.893G>A (p.Arg298His) rs142482143
NM_001104631.2(PDE4D):c.1762A>G (p.Met588Val) rs1554033934
NM_001105206.3(LAMA4):c.2655C>T (p.Leu885=) rs35772073
NM_001110219.3(GJB6):c.595T>A (p.Ser199Thr) rs111033338
NM_001110556.2(FLNA):c.1029C>T (p.Ser343=) rs199853721
NM_001110556.2(FLNA):c.1579C>T (p.Arg527Cys) rs202029322
NM_001110556.2(FLNA):c.1997C>T (p.Ala666Val) rs374295965
NM_001110556.2(FLNA):c.2449C>T (p.Pro817Ser) rs200053635
NM_001110556.2(FLNA):c.3045G>A (p.Ala1015=) rs370868704
NM_001110556.2(FLNA):c.5251C>T (p.Pro1751Ser) rs56102764
NM_001110556.2(FLNA):c.759C>T (p.Asp253=) rs782701643
NM_001110792.2(MECP2):c.1176G>A (p.Val392=) rs201711454
NM_001110792.2(MECP2):c.1198_1215del (p.Pro400_Pro405del) rs267608406
NM_001110792.2(MECP2):c.1200A>C (p.Pro400=) rs797044732
NM_001110792.2(MECP2):c.1224C>T (p.Ser408=) rs781816931
NM_001110792.2(MECP2):c.1225G>A (p.Glu409Lys) rs56268439
NM_001110792.2(MECP2):c.1241C>T (p.Pro414Leu) rs61753014
NM_001110792.2(MECP2):c.1291C>T (p.Pro431Ser) rs140258520
NM_001110792.2(MECP2):c.1351G>A (p.Ala451Thr) rs61753973
NM_001110792.2(MECP2):c.1363G>A (p.Ala455Thr) rs193922677
NM_001110792.2(MECP2):c.1366G>A (p.Ala456Thr) rs61753975
NM_001110792.2(MECP2):c.1371G>A (p.Thr457=) rs3027927
NM_001110792.2(MECP2):c.204C>T (p.Pro68=) rs61754435
NM_001110792.2(MECP2):c.411C>A (p.Ile137=) rs146107517
NM_001110792.2(MECP2):c.429C>G (p.Ala143=) rs61748385
NM_001110792.2(MECP2):c.633C>G (p.Pro211=)
NM_001110792.2(MECP2):c.644C>T (p.Thr215Met) rs61749720
NM_001110792.2(MECP2):c.813C>T (p.Ala271=) rs1042870
NM_001110792.2(MECP2):c.844C>T (p.Arg282Ter) rs61750240
NM_001110792.2(MECP2):c.870C>T (p.Ala290=) rs61750248
NM_001110792.2(MECP2):c.876C>T (p.Ala292=) rs61750251
NM_001110792.2(MECP2):c.961C>T (p.Arg321Trp) rs61751444
NM_001111.5(ADAR):c.2079+8G>A rs376867928
NM_001111.5(ADAR):c.2668+6T>C rs190881240
NM_001111125.3(IQSEC2):c.4293C>T (p.Ile1431=) rs782536136
NM_001111125.3(IQSEC2):c.684C>T (p.Ser228=) rs781940286
NM_001113378.1(FANCI):c.3947G>A (p.Gly1316Glu) rs138461165
NM_001114636.1(FANCL):c.1111_1114dup (p.Thr372fs) rs759217526
NM_001122659.3(EDNRB):c.169G>A (p.Gly57Ser) rs1801710
NM_001122955.3(BSCL2):c.124C>T (p.Arg42Cys) rs201493373
NM_001126049.1(KLLN):c.-794_-783del rs587781340
NM_001126049.1(KLLN):c.-898G>A rs538728843
NM_001126112.2(TP53):c.1014C>T (p.Phe338=) rs150293825
NM_001126112.2(TP53):c.478A>G (p.Met160Val) rs377274728
NM_001126112.2(TP53):c.843C>A (p.Asp281Glu) rs1057519984
NM_001126112.2(TP53):c.847C>T (p.Arg283Cys) rs149633775
NM_001126112.2(TP53):c.920-5C>T rs34361146
NM_001126112.2(TP53):c.949C>A (p.Gln317Lys) rs764735889
NM_001126131.2(POLG):c.1399G>A (p.Ala467Thr) rs113994095
NM_001126131.2(POLG):c.1550G>T (p.Gly517Val) rs61752783
NM_001126131.2(POLG):c.1760C>T (p.Pro587Leu) rs113994096
NM_001126131.2(POLG):c.2542G>A (p.Gly848Ser) rs113994098
NM_001126131.2(POLG):c.2890C>T (p.Arg964Cys) rs201477273
NM_001126131.2(POLG):c.752C>T (p.Thr251Ile) rs113994094
NM_001127221.1(CACNA1A):c.1364G>A (p.Arg455Gln) rs561858384
NM_001127221.1(CACNA1A):c.1398G>A (p.Ser466=) rs374307014
NM_001127221.1(CACNA1A):c.1986T>C (p.Phe662=) rs368033271
NM_001127221.1(CACNA1A):c.2623T>G (p.Ser875Ala) rs751675055
NM_001127221.1(CACNA1A):c.2690C>G (p.Pro897Arg) rs121908242
NM_001127221.1(CACNA1A):c.2958G>C (p.Pro986=) rs749357610
NM_001127221.1(CACNA1A):c.3046G>A (p.Gly1016Arg) rs190551509
NM_001127221.1(CACNA1A):c.3230C>T (p.Ala1077Val) rs199512932
NM_001127221.1(CACNA1A):c.3387G>A (p.Pro1129=) rs370541345
NM_001127221.1(CACNA1A):c.3621A>G (p.Glu1207=) rs201236364
NM_001127221.1(CACNA1A):c.3686C>T (p.Thr1229Met) rs1057518532
NM_001127221.1(CACNA1A):c.4314G>A (p.Lys1438=) rs572036869
NM_001127221.1(CACNA1A):c.4809C>T (p.Ile1603=) rs372240227
NM_001127221.1(CACNA1A):c.5160C>T (p.Asp1720=) rs758409135
NM_001127221.1(CACNA1A):c.5262C>T (p.Thr1754=) rs376684786
NM_001127221.1(CACNA1A):c.6018C>T (p.Ala2006=) rs369675855
NM_001127221.1(CACNA1A):c.631+5G>A rs786200963
NM_001127221.1(CACNA1A):c.6375A>G (p.Ser2125=) rs760994682
NM_001127221.1(CACNA1A):c.6467G>A (p.Arg2156His) rs572722130
NM_001127221.1(CACNA1A):c.6467G>T (p.Arg2156Leu) rs572722130
NM_001127221.1(CACNA1A):c.6486C>T (p.Arg2162=) rs745609731
NM_001127221.1(CACNA1A):c.6650_6661del (p.His2217_His2220del) rs770368215
NM_001127221.1(CACNA1A):c.6672C>T (p.Pro2224=)
NM_001127221.1(CACNA1A):c.680T>G (p.Leu227Arg) rs1057522420
NM_001127221.1(CACNA1A):c.924G>A (p.Val308=)
NM_001127464.2(ZNF469):c.2914_2919delGGCGGC (p.Gly972_Gly973del) rs775423936
NM_001127464.2(ZNF469):c.9011_9025delTTCCCGGGAACACCC (p.Leu3004_Thr3008del) rs281865162
NM_001127500.3(MET):c.3029C>T (p.Thr1010Ile) rs56391007
NM_001127500.3(MET):c.607T>A (p.Ser203Thr) rs200861145
NM_001127644.2(GABRA1):c.1155C>A (p.Gly385=) rs41308303
NM_001127644.2(GABRA1):c.1350A>G (p.Lys450=) rs142385746
NM_001127644.2(GABRA1):c.441G>T (p.Arg147=) rs190024862
NM_001127644.2(GABRA1):c.501G>A (p.Pro167=) rs200750234
NM_001127649.3(PEX26):c.728C>T (p.Ala243Val) rs149153003
NM_001127698.2(SPINK5):c.802C>T (p.Arg268Cys) rs142558269
NM_001127713.1(ATL1):c.1173C>T (p.His391=) rs149340140
NM_001127713.1(ATL1):c.715C>T (p.Arg239Cys) rs119476046
NM_001127713.1(ATL1):c.757G>A (p.Val253Ile) rs864622520
NM_001128225.3(SLC39A13):c.216C>T (p.Leu72=) rs34986695
NM_001128225.3(SLC39A13):c.398C>T (p.Thr133Met) rs140574574
NM_001128225.3(SLC39A13):c.439C>G (p.Gln147Glu) rs148291843
NM_001128425.1(MUTYH):c.1038G>A (p.Ser346=) rs372673338
NM_001128425.1(MUTYH):c.1567C>T (p.Arg523Cys) rs147480076
NM_001128425.1(MUTYH):c.553C>T (p.Arg185Trp) rs750592289
NM_001128425.1(MUTYH):c.627G>A (p.Gln209=) rs730881837
NM_001128425.1(MUTYH):c.998-9C>T rs3219488
NM_001128425.2(MUTYH):c.1187-27C>T
NM_001128840.3(CACNA1D):c.2552T>G (p.Leu851Trp) rs186968009
NM_001128844.2(SMARCA4):c.2275-3C>A rs117611401
NM_001128849.2(SMARCA4):c.1287G>A (p.Ala429=) rs143600641
NM_001128849.2(SMARCA4):c.223-5C>T rs376775933
NM_001128849.2(SMARCA4):c.258C>T (p.Asp86=) rs115992445
NM_001128849.2(SMARCA4):c.3045C>T (p.Gly1015=) rs56101423
NM_001128849.2(SMARCA4):c.3528C>T (p.Ser1176=) rs573885719
NM_001128849.2(SMARCA4):c.4211T>G (p.Val1404Gly) rs200469979
NM_001128849.2(SMARCA4):c.4284G>T (p.Thr1428=) rs199847974
NM_001128849.2(SMARCA4):c.696T>C (p.Pro232=) rs573767517
NM_001128929.3(ROBO2):c.3905G>T (p.Arg1302Leu) rs200131009
NM_001130089.1(KARS1):c.1262G>A (p.Arg421Gln) rs149772470
NM_001130089.1(KARS1):c.1342C>T (p.Arg448Cys) rs77573084
NM_001130438.3(SPTAN1):c.1667A>G (p.Asn556Ser) rs778489951
NM_001130438.3(SPTAN1):c.2610A>G (p.Gln870=) rs138101005
NM_001130438.3(SPTAN1):c.2700C>T (p.Asn900=) rs147466898
NM_001130438.3(SPTAN1):c.3970C>T (p.Leu1324=) rs147233101
NM_001130438.3(SPTAN1):c.641A>G (p.Lys214Arg) rs760419507
NM_001130438.3(SPTAN1):c.7155G>A (p.Pro2385=) rs200456378
NM_001130690.2(PDE10A):c.1459C>G (p.Pro487Ala) rs61733392
NM_001130823.3(DNMT1):c.1320C>T (p.Thr440=) rs143925123
NM_001130823.3(DNMT1):c.393C>T (p.Pro131=) rs143904813
NM_001130823.3(DNMT1):c.406C>T (p.Arg136Cys) rs138841970
NM_001130987.2(DYSF):c.1216G>C (p.Val406Leu) rs150724610
NM_001130987.2(DYSF):c.1931T>C (p.Met644Thr) rs141867897
NM_001130987.2(DYSF):c.2020A>G (p.Lys674Glu) rs139754493
NM_001130987.2(DYSF):c.3946A>G (p.Ile1316Val) rs121908954
NM_001130987.2(DYSF):c.4037C>T (p.Ala1346Val) rs201476613
NM_001130987.2(DYSF):c.404C>T (p.Pro135Leu) rs773837400
NM_001130987.2(DYSF):c.4254C>T (p.Pro1418=) rs142769942
NM_001130987.2(DYSF):c.4261G>A (p.Val1421Ile) rs767049254
NM_001130987.2(DYSF):c.4462C>T (p.Gln1488Ter) rs886044411
NM_001130987.2(DYSF):c.5139del (p.Phe1713fs) rs1057519132
NM_001130987.2(DYSF):c.5333C>A (p.Pro1778Gln) rs145272777
NM_001130987.2(DYSF):c.5547-4C>T rs373098428
NM_001130987.2(DYSF):c.5743G>A (p.Asp1915Asn) rs115013641
NM_001130987.2(DYSF):c.6116G>A (p.Arg2039Gln) rs115407852
NM_001130987.2(DYSF):c.6174G>A (p.Arg2058=) rs143762717
NM_001131023.1(PEX5):c.649G>C (p.Val217Leu) rs149102738
NM_001134363.3(RBM20):c.1986G>A (p.Pro662=) rs537723089
NM_001134363.3(RBM20):c.2069C>T (p.Pro690Leu) rs550942448
NM_001134363.3(RBM20):c.2264G>A (p.Arg755His) rs986602724
NM_001134363.3(RBM20):c.2452G>T (p.Ala818Ser) rs200271618
NM_001134363.3(RBM20):c.2904C>T (p.Ala968=) rs587781138
NM_001134363.3(RBM20):c.2989G>A (p.Val997Met)
NM_001134363.3(RBM20):c.3115C>T (p.Pro1039Ser) rs727503392
NM_001134363.3(RBM20):c.3373G>A (p.Glu1125Lys) rs116908219
NM_001134363.3(RBM20):c.3584C>A (p.Ser1195Tyr) rs753102653
NM_001134407.3(GRIN2A):c.2069C>T (p.Thr690Met) rs1445802934
NM_001134407.3(GRIN2A):c.2179G>A (p.Ala727Thr) rs1555488144
NM_001134407.3(GRIN2A):c.2883C>T (p.Asn961=) rs77705198
NM_001134407.3(GRIN2A):c.3190A>G (p.Thr1064Ala) rs138809301
NM_001134407.3(GRIN2A):c.3535T>G (p.Ser1179Ala) rs142670870
NM_001134407.3(GRIN2A):c.3578T>G (p.Leu1193Trp) rs75761674
NM_001134407.3(GRIN2A):c.447G>A (p.Ala149=) rs144464666
NM_001134407.3(GRIN2A):c.702C>T (p.Asp234=) rs150208429
NM_001134407.3(GRIN2A):c.939C>T (p.Ile313=) rs146867324
NM_001134407.3(GRIN2A):c.942C>T (p.Pro314=) rs145172949
NM_001134831.2(AHI1):c.2492+1G>A
NM_001134831.2(AHI1):c.2505G>A (p.Arg835=) rs41288017
NM_001134831.2(AHI1):c.2798A>G (p.Tyr933Cys) rs41288013
NM_001134831.2(AHI1):c.3032C>G (p.Ser1011Ter) rs777215595
NM_001135599.3(TGFB2):c.1137G>A (p.Pro379=) rs142741166
NM_001135599.3(TGFB2):c.272G>A (p.Arg91His) rs10482721
NM_001136.5(AGER):c.811T>A (p.Trp271Arg)
NM_001136.5(AGER):c.902G>C (p.Cys301Ser)
NM_001136193.2(FASTKD2):c.149A>G (p.Lys50Arg) rs141447598
NM_001136193.2(FASTKD2):c.29G>C (p.Ser10Thr) rs147727753
NM_001136473.1(LITAF):c.331G>A (p.Ala111Thr)
NM_001142279.2(RNASEH2B):c.455A>G (p.Asn152Ser) rs146451037
NM_001142301.1(TMEM67):c.1183C>T (p.Pro395Ser) rs145236803
NM_001142301.1(TMEM67):c.1457A>G (p.Tyr486Cys) rs148726767
NM_001142301.1(TMEM67):c.1918C>T (p.Pro640Ser) rs116445698
NM_001142301.1(TMEM67):c.474A>G (p.Val158=) rs111991507
NM_001142386.3(PDK3):c.376A>G (p.Met126Val) rs138321172
NM_001142769.3(PCDH15):c.4498_4500GAA[1] (p.Glu1501del) rs561144747
NM_001142800.2(EYS):c.1145A>T (p.Asn382Ile) rs144935927
NM_001142800.2(EYS):c.1459+5C>T rs200387978
NM_001142800.2(EYS):c.2000G>A (p.Arg667His) rs549456693
NM_001142800.2(EYS):c.2137+1G>A rs199740930
NM_001142800.2(EYS):c.2613C>T (p.Asp871=) rs192059823
NM_001142800.2(EYS):c.4985A>T (p.Asp1662Val) rs147641443
NM_001142800.2(EYS):c.5601T>C (p.Ser1867=) rs182322608
NM_001142800.2(EYS):c.5743A>G (p.Ser1915Gly) rs188093810
NM_001142800.2(EYS):c.6528C>A (p.Tyr2176Ter) rs797045089
NM_001142800.2(EYS):c.6535A>G (p.Ile2179Val)
NM_001142800.2(EYS):c.7796A>G (p.His2599Arg) rs74636274
NM_001142800.2(EYS):c.8793_8796del (p.Gln2931fs) rs1554163919
NM_001142800.2(EYS):c.977G>A (p.Ser326Asn) rs112822256
NM_001145536.2(C17orf107):c.*549C>A rs201434993
NM_001145809.2(MYH14):c.3778G>A (p.Gly1260Ser) rs200272339
NM_001145809.2(MYH14):c.820A>G (p.Ile274Val) rs200424400
NM_001145847.2(PROM1):c.2292C>T (p.Thr764=) rs185335345
NM_001145847.2(PROM1):c.577C>G (p.Arg193Gly) rs140872693
NM_001146289.1(P3H1):c.1322A>G (p.Asp441Gly) rs113593896
NM_001148.6(ANK2):c.10118C>T (p.Ala3373Val) rs371358639
NM_001148.6(ANK2):c.10531C>T (p.Leu3511=) rs148462839
NM_001148.6(ANK2):c.11231C>A (p.Thr3744Asn) rs121912705
NM_001148.6(ANK2):c.11594A>G (p.Asp3865Gly) rs140606121
NM_001148.6(ANK2):c.11716C>T (p.Arg3906Trp) rs121912706
NM_001148.6(ANK2):c.2460_2462CAC[4] (p.Thr826del) rs770530257
NM_001148.6(ANK2):c.6228G>T (p.Lys2076Asn) rs144848998
NM_001148.6(ANK2):c.6854T>C (p.Ile2285Thr) rs150684838
NM_001148.6(ANK2):c.962G>A (p.Arg321Gln) rs150226540
NM_001148.6(ANK2):c.9825T>G (p.Asp3275Glu) rs149043752
NM_001148.6(ANK2):c.997C>T (p.Leu333=) rs201024064
NM_001161352.2(KCNMA1):c.2398G>T (p.Asp800Tyr) rs142210216
NM_001161352.2(KCNMA1):c.3195C>T (p.Thr1065=) rs45527834
NM_001161352.2(KCNMA1):c.3507G>A (p.Thr1169=) rs201721843
NM_001163213.1(FGFR3):c.1758G>A (p.Pro586=) rs139020690
NM_001163213.1(FGFR3):c.1885G>A (p.Glu629Lys) rs200849753
NM_001163673.1(WDR81):c.1234G>A (p.Gly412Arg)
NM_001163673.1(WDR81):c.1509T>C (p.Leu503=) rs138211651
NM_001163673.1(WDR81):c.1622C>T (p.Ala541Val) rs137952560
NM_001163673.1(WDR81):c.59-2550T>C
NM_001163673.1(WDR81):c.59-3167C>T
NM_001163673.1(WDR81):c.59-3285G>A
NM_001163673.1(WDR81):c.715-8G>A
NM_001163817.2(DHCR7):c.1341C>T (p.Asp447=) rs139721775
NM_001164277.1(SLC37A4):c.467C>T (p.Ala156Val) rs201036248
NM_001164277.1(SLC37A4):c.781G>A (p.Val261Ile)
NM_001164731.2(REEP1):c.*50G>A rs189652973
NM_001165927.1(MKS1):c.1378-34_1378-6del rs386834043
NM_001165927.1(MKS1):c.1468A>G (p.Met490Val) rs144635826
NM_001165928.3(DAG1):c.258G>C (p.Leu86Phe) rs145403829
NM_001166107.1(HMGCS2):c.174C>T (p.Ala58=) rs138739620
NM_001166108.2(PALLD):c.1273A>T (p.Thr425Ser) rs140454899
NM_001166108.2(PALLD):c.1394G>A (p.Arg465His) rs115372194
NM_001166108.2(PALLD):c.1965-12530C>T rs753092219
NM_001166108.2(PALLD):c.1965-12594T>G rs587780760
NM_001166108.2(PALLD):c.1965-12665G>C rs535155432
NM_001166108.2(PALLD):c.2199+8G>A rs200060953
NM_001166108.2(PALLD):c.2393T>C (p.Met798Thr) rs142116575
NM_001166108.2(PALLD):c.2442A>G (p.Thr814=) rs113676921
NM_001166108.2(PALLD):c.365C>T (p.Pro122Leu) rs116158771
NM_001167617.2(MLH1):c.1066G>C (p.Gly356Arg) rs63750527
NM_001168272.1(ITPR1):c.1435G>A (p.Val479Ile) rs41289628
NM_001168272.1(ITPR1):c.1962-3T>C rs200335594
NM_001168272.1(ITPR1):c.3412A>G (p.Met1138Val) rs199698357
NM_001168272.1(ITPR1):c.4798-8C>T rs41304179
NM_001168272.1(ITPR1):c.6304G>T (p.Ala2102Ser) rs373973399
NM_001168272.1(ITPR1):c.7054G>A (p.Ala2352Thr) rs201144431
NM_001170535.3(ATAD3A):c.158C>T (p.Thr53Ile) rs1057517687
NM_001171.5(ABCC6):c.1171A>G (p.Arg391Gly) rs72653762
NM_001171.5(ABCC6):c.1284C>T (p.Asn428=) rs57499497
NM_001171.5(ABCC6):c.1526C>G (p.Ala509Gly) rs779408186
NM_001171.5(ABCC6):c.1990C>T (p.Pro664Ser) rs59002125
NM_001171.5(ABCC6):c.4253G>A (p.Arg1418Gln) rs63751262
NM_001171603.1(PREPL):c.1862A>G (p.Lys621Arg) rs111438719
NM_001171603.1(PREPL):c.954A>G (p.Glu318=) rs113272276
NM_001174089.2(SLC4A11):c.893C>T (p.Ala298Val) rs141705330
NM_001174116.2(DMXL2):c.23C>G (p.Thr8Ser)
NM_001178010.2(CDC45):c.1756C>T (p.Arg586Trp) rs778665661
NM_001182.4(ALDH7A1):c.-80T>G rs563928852
NM_001182.5(ALDH7A1):c.-13T>G rs774190967
NM_001182.5(ALDH7A1):c.575C>T (p.Thr192Met) rs376917645
NM_001183.6(ATP6AP1):c.361G>C (p.Glu121Gln) rs148803059
NM_001184.4(ATR):c.2226T>C (p.Cys742=) rs147895945
NM_001184.4(ATR):c.2290A>G (p.Lys764Glu) rs77208665
NM_001184.4(ATR):c.6394T>G (p.Tyr2132Asp) rs28910273
NM_001184785.2(PARD3):c.1046G>A (p.Arg349His) rs199923448
NM_001184832.2(SLC12A1):c.3096+7A>T rs200662267
NM_001184880.2(PCDH19):c.1683G>A (p.Pro561=) rs192354176
NM_001184880.2(PCDH19):c.2796C>T (p.Asn932=) rs193148631
NM_001184880.2(PCDH19):c.684G>A (p.Val228=) rs201810406
NM_001184880.2(PCDH19):c.769G>C (p.Val257Leu) rs201713027
NM_001191061.2(SLC25A22):c.413-7T>C rs969941249
NM_001191061.2(SLC25A22):c.500G>A (p.Arg167Gln) rs201089795
NM_001193416.3(DDX3X):c.1463G>A (p.Arg488His) rs796052235
NM_001193466.2(KANSL1):c.1022G>A (p.Arg341Gln) rs371321182
NM_001193466.2(KANSL1):c.2233A>G (p.Arg745Gly) rs796052596
NM_001193520.1(RASAL1):c.1810T>C (p.Phe604Leu) rs142556970
NM_001194998.2(CEP152):c.3313C>G (p.Leu1105Val) rs74553953
NM_001195248.2(APTX):c.431C>A (p.Ser144Tyr) rs34778324
NM_001195248.2(APTX):c.742T>A (p.Leu248Met) rs141195622
NM_001195248.2(APTX):c.971A>T (p.Gln324Leu) rs141493373
NM_001195553.2(DCX):c.305G>A (p.Arg102His) rs267606317
NM_001195553.2(DCX):c.667G>A (p.Gly223Arg) rs587783577
NM_001195553.2(DCX):c.856G>T (p.Ala286Ser) rs149495971
NM_001195803.2(LDLR):c.680-8T>C rs72658861
NM_001197104.1(KMT2A):c.478C>T (p.Arg160Ter) rs1555034779
NM_001198800.3(ASCC1):c.107A>G (p.Tyr36Cys)
NM_001199107.2(TBC1D24):c.1026G>A (p.Ser342=) rs370244846
NM_001199107.2(TBC1D24):c.1078C>T (p.Arg360Cys) rs1057519629
NM_001199107.2(TBC1D24):c.169C>T (p.Arg57Cys) rs202162520
NM_001199107.2(TBC1D24):c.179G>A (p.Arg60Gln) rs200226466
NM_001199107.2(TBC1D24):c.22T>C (p.Cys8Arg) rs77585883
NM_001199107.2(TBC1D24):c.285C>T (p.Phe95=) rs774354974
NM_001199107.2(TBC1D24):c.641G>A (p.Arg214His) rs200324356
NM_001199107.2(TBC1D24):c.702G>A (p.Val234=) rs188739853
NM_001199107.2(TBC1D24):c.885C>G (p.Phe295Leu) rs72768728
NM_001199563.2(BVES):c.457C>T (p.Gln153Ter) rs1562137622
NM_001199771.2(RDH5):c.572G>A (p.Arg191Gln) rs367757406
NM_001201402.1(GALC):c.18T>C (p.His6=) rs556647825
NM_001201543.2(FAM161A):c.1133T>G (p.Leu378Arg) rs187695569
NM_001201543.2(FAM161A):c.1153C>G (p.Gln385Glu) rs139266382
NM_001206999.1(CIT):c.753+8delA rs771292782
NM_001220.5(CAMK2B):c.903+1G>A rs1554385102
NM_001231.5(CASQ1):c.1039G>T (p.Gly347Ter)
NM_001232.3(CASQ2):c.1185_1187del (p.Asp398del) rs397516641
NM_001232.3(CASQ2):c.874G>T (p.Ala292Ser) rs200643387
NM_001232.3(CASQ2):c.928G>A (p.Asp310Asn) rs141314684
NM_001234.5(CAV3):c.336C>T (p.Ile112=) rs139985460
NM_001242897.2(DEPDC5):c.1290C>T (p.Pro430=) rs201202102
NM_001242897.2(DEPDC5):c.1870+3527A>C rs370940232
NM_001242897.2(DEPDC5):c.2052C>T (p.Asp684=) rs200465447
NM_001242897.2(DEPDC5):c.3007A>C (p.Thr1003Pro) rs142540948
NM_001242897.2(DEPDC5):c.501G>A (p.Thr167=) rs766360619
NM_001242957.2(MAK):c.1715T>C (p.Ile572Thr) rs79544660
NM_001242957.2(MAK):c.975G>A (p.Pro325=) rs145014649
NM_001244008.1(KIF1A):c.2813G>A (p.Arg938Gln) rs192102667
NM_001253852.3(AP4B1):c.1723A>G (p.Ile575Val) rs114734921
NM_001253852.3(AP4B1):c.755T>C (p.Val252Ala) rs141417436
NM_001254.4(CDC6):c.597C>G (p.Tyr199Ter) rs200468440
NM_001254.4(CDC6):c.712A>G (p.Thr238Ala) rs4135010
NM_001256047.1(C19orf12):c.205C>T (p.Gln69Ter) rs1064797235
NM_001256047.1(C19orf12):c.391A>G (p.Lys131Glu) rs146170087
NM_001256447.2(BCAP31):c.383C>T (p.Thr128Met) rs111450526
NM_001256545.2(MEGF10):c.1841-5T>C rs372378202
NM_001256545.2(MEGF10):c.3026-8C>T rs185480820
NM_001256789.3(CACNA1F):c.1523G>A (p.Arg508Gln) rs34162630
NM_001256850.1(TTN):c.32389+5A>C rs373367032
NM_001256850.1(TTN):c.34690+6C>T rs187365142
NM_001256850.1(TTN):c.35188+6C>T rs72650067
NM_001256850.1(TTN):c.36407-7T>A rs373636988
NM_001256850.1(TTN):c.83383+8T>C rs369690199
NM_001257988.1(TYMP):c.622G>A (p.Val208Met) rs121913039
NM_001267550.1(TTN):c.45599C>G rs201057307
NM_001267550.2(TTN):c.100446dup (p.Glu33483fs) rs878854281
NM_001267550.2(TTN):c.100696A>G (p.Thr33566Ala) rs878854282
NM_001267550.2(TTN):c.101037G>A (p.Gln33679=) rs377190399
NM_001267550.2(TTN):c.101212C>T (p.Arg33738Cys) rs56273463
NM_001267550.2(TTN):c.101665G>A (p.Val33889Ile) rs34924609
NM_001267550.2(TTN):c.10188A>G (p.Glu3396=) rs183336802
NM_001267550.2(TTN):c.101925A>G (p.Leu33975=) rs201246720
NM_001267550.2(TTN):c.10242C>T (p.Tyr3414=) rs45447891
NM_001267550.2(TTN):c.102520G>A (p.Val34174Ile) rs200430493
NM_001267550.2(TTN):c.102561C>T (p.Tyr34187=) rs375625664
NM_001267550.2(TTN):c.102751A>G (p.Met34251Val) rs56173891
NM_001267550.2(TTN):c.102984C>T (p.Asp34328=) rs541125667
NM_001267550.2(TTN):c.103302T>C (p.Tyr34434=) rs773408387
NM_001267550.2(TTN):c.103412G>A (p.Arg34471Gln) rs149391616
NM_001267550.2(TTN):c.103688T>C (p.Val34563Ala) rs55945684
NM_001267550.2(TTN):c.104364C>T (p.Ser34788=) rs181679744
NM_001267550.2(TTN):c.104414G>A (p.Arg34805Gln) rs115150240
NM_001267550.2(TTN):c.104560G>C (p.Val34854Leu) rs55866005
NM_001267550.2(TTN):c.104774A>C (p.Glu34925Ala) rs201218828
NM_001267550.2(TTN):c.1050C>T (p.Tyr350=) rs375448572
NM_001267550.2(TTN):c.105228G>A (p.Ser35076=) rs55938627
NM_001267550.2(TTN):c.105424G>A (p.Glu35142Lys)
NM_001267550.2(TTN):c.106121T>A (p.Phe35374Tyr) rs727504609
NM_001267550.2(TTN):c.106293T>C (p.Val35431=) rs749108651
NM_001267550.2(TTN):c.106675G>C (p.Glu35559Gln) rs199632397
NM_001267550.2(TTN):c.106820C>T (p.Ala35607Val) rs377337528
NM_001267550.2(TTN):c.106920G>A (p.Leu35640=) rs183923129
NM_001267550.2(TTN):c.107576T>C (p.Met35859Thr) rs72629793
NM_001267550.2(TTN):c.107961T>C (p.His35987=) rs377439315
NM_001267550.2(TTN):c.10922T>C (p.Ile3641Thr) rs141027782
NM_001267550.2(TTN):c.11183dup (p.Leu3729fs) rs778172350
NM_001267550.2(TTN):c.11311+1641C>T rs140804168
NM_001267550.2(TTN):c.11311+1644T>C rs142585268
NM_001267550.2(TTN):c.11311+2573T>C rs72647897
NM_001267550.2(TTN):c.11311+3440C>T rs72647901
NM_001267550.2(TTN):c.11311+3847G>T rs72647902
NM_001267550.2(TTN):c.11311+4088A>G rs142304137
NM_001267550.2(TTN):c.11311+4346A>G rs147073497
NM_001267550.2(TTN):c.11311+4672C>T rs149748934
NM_001267550.2(TTN):c.11311+4802T>C rs139486133
NM_001267550.2(TTN):c.11311+4938C>T rs147513899
NM_001267550.2(TTN):c.11311+5340C>T rs148105798
NM_001267550.2(TTN):c.11312-4319G>A rs72648913
NM_001267550.2(TTN):c.11440G>A (p.Glu3814Lys) rs375103237
NM_001267550.2(TTN):c.11672C>T (p.Thr3891Ile) rs148164929
NM_001267550.2(TTN):c.11756C>A (p.Thr3919Asn) rs727503661
NM_001267550.2(TTN):c.11996A>G (p.Asn3999Ser) rs199844346
NM_001267550.2(TTN):c.12145C>T (p.Pro4049Ser) rs201888760
NM_001267550.2(TTN):c.12181G>A (p.Ala4061Thr) rs397517829
NM_001267550.2(TTN):c.12195T>C (p.Leu4065=) rs201129413
NM_001267550.2(TTN):c.12234C>G (p.Thr4078=) rs192857526
NM_001267550.2(TTN):c.12748G>A (p.Val4250Met) rs201437752
NM_001267550.2(TTN):c.13262A>G (p.Asn4421Ser) rs72648922
NM_001267550.2(TTN):c.13520T>C (p.Met4507Thr) rs191968963
NM_001267550.2(TTN):c.14698G>A (p.Ala4900Thr) rs72648923
NM_001267550.2(TTN):c.14870C>G (p.Thr4957Ser) rs72648925
NM_001267550.2(TTN):c.15178G>C (p.Val5060Leu) rs72648929
NM_001267550.2(TTN):c.15563A>C (p.Gln5188Pro) rs72648930
NM_001267550.2(TTN):c.156C>T (p.Pro52=) rs72647842
NM_001267550.2(TTN):c.1585G>A (p.Ala529Thr) rs143030869
NM_001267550.2(TTN):c.16113T>C (p.Asn5371=) rs143845692
NM_001267550.2(TTN):c.16313A>G (p.Lys5438Arg) rs190636272
NM_001267550.2(TTN):c.16551G>A (p.Ser5517=) rs376037792
NM_001267550.2(TTN):c.16581C>T (p.Val5527=) rs373179717
NM_001267550.2(TTN):c.16621+7A>T rs10200398
NM_001267550.2(TTN):c.17048A>G (p.Tyr5683Cys) rs72648942
NM_001267550.2(TTN):c.17082G>T (p.Leu5694=) rs750996600
NM_001267550.2(TTN):c.17184A>G (p.Glu5728=) rs200984007
NM_001267550.2(TTN):c.17224C>T (p.Leu5742Phe) rs72648943
NM_001267550.2(TTN):c.17871A>T (p.Gln5957His) rs181067357
NM_001267550.2(TTN):c.18407G>A (p.Arg6136Gln) rs117551279
NM_001267550.2(TTN):c.18550G>A (p.Ala6184Thr) rs72648947
NM_001267550.2(TTN):c.18745G>A (p.Asp6249Asn) rs201263441
NM_001267550.2(TTN):c.18776C>G (p.Thr6259Ser) rs72648949
NM_001267550.2(TTN):c.19150C>A (p.Pro6384Thr) rs72648953
NM_001267550.2(TTN):c.19356C>T (p.Ser6452=) rs369275615
NM_001267550.2(TTN):c.1943G>C (p.Arg648Thr) rs550441902
NM_001267550.2(TTN):c.20335A>T (p.Ser6779Cys) rs149470241
NM_001267550.2(TTN):c.20341G>A (p.Glu6781Lys) rs72648958
NM_001267550.2(TTN):c.204C>T (p.Pro68=) rs201089861
NM_001267550.2(TTN):c.20772G>A (p.Lys6924=) rs369993514
NM_001267550.2(TTN):c.20798G>C (p.Gly6933Ala) rs200118743
NM_001267550.2(TTN):c.210G>T (p.Val70=) rs746033038
NM_001267550.2(TTN):c.21148C>T (p.Leu7050=) rs202089818
NM_001267550.2(TTN):c.21364G>A (p.Ala7122Thr) rs201394117
NM_001267550.2(TTN):c.21548G>A (p.Cys7183Tyr) rs189951108
NM_001267550.2(TTN):c.21555C>A (p.Ile7185=) rs201155967
NM_001267550.2(TTN):c.21668G>A (p.Arg7223His) rs138853909
NM_001267550.2(TTN):c.2230G>A (p.Ala744Thr) rs144639994
NM_001267550.2(TTN):c.22922C>T (p.Ser7641Leu) rs369508943
NM_001267550.2(TTN):c.23121G>A (p.Lys7707=) rs72648971
NM_001267550.2(TTN):c.23616C>T (p.Asn7872=) rs181206334
NM_001267550.2(TTN):c.24156A>G (p.Thr8052=) rs749823104
NM_001267550.2(TTN):c.24820G>A (p.Glu8274Lys) rs72648981
NM_001267550.2(TTN):c.24952G>A (p.Val8318Ile) rs200103997
NM_001267550.2(TTN):c.24964G>T (p.Val8322Leu) rs201571580
NM_001267550.2(TTN):c.24973A>G (p.Lys8325Glu) rs72648984
NM_001267550.2(TTN):c.25209T>C (p.Asp8403=) rs569860898
NM_001267550.2(TTN):c.25640-8T>C rs1184501172
NM_001267550.2(TTN):c.25704G>A (p.Arg8568=) rs150544093
NM_001267550.2(TTN):c.26494A>G (p.Ile8832Val) rs72648989
NM_001267550.2(TTN):c.26672A>G (p.Asn8891Ser) rs146057575
NM_001267550.2(TTN):c.267G>A (p.Ala89=) rs577716745
NM_001267550.2(TTN):c.27498G>A (p.Ser9166=) rs372528823
NM_001267550.2(TTN):c.27702T>C (p.Ile9234=) rs143368674
NM_001267550.2(TTN):c.28200C>T (p.Asp9400=) rs886044076
NM_001267550.2(TTN):c.28262C>T (p.Thr9421Met) rs375209383
NM_001267550.2(TTN):c.28849G>A (p.Glu9617Lys) rs144025230
NM_001267550.2(TTN):c.29079G>A (p.Ala9693=) rs372997298
NM_001267550.2(TTN):c.3021G>A (p.Ala1007=) rs147603843
NM_001267550.2(TTN):c.30274C>T (p.His10092Tyr) rs72650011
NM_001267550.2(TTN):c.30309T>C (p.Phe10103=) rs762141482
NM_001267550.2(TTN):c.30485C>T (p.Thr10162Met) rs200593368
NM_001267550.2(TTN):c.30718G>T (p.Val10240Phe) rs111671438
NM_001267550.2(TTN):c.30888A>G (p.Lys10296=) rs587780978
NM_001267550.2(TTN):c.3100G>A (p.Val1034Met) rs142951505
NM_001267550.2(TTN):c.31456A>T (p.Ile10486Phe) rs772882862
NM_001267550.2(TTN):c.31757C>A (p.Pro10586Gln) rs200459347
NM_001267550.2(TTN):c.31762+5_31762+7del rs397517538
NM_001267550.2(TTN):c.31763-1G>A rs202234172
NM_001267550.2(TTN):c.31837C>G (p.Pro10613Ala) rs200213832
NM_001267550.2(TTN):c.32554+5_32554+6del rs771419718
NM_001267550.2(TTN):c.32557C>T (p.Pro10853Ser) rs201738153
NM_001267550.2(TTN):c.32624C>T (p.Pro10875Leu) rs72650031
NM_001267550.2(TTN):c.32731G>A (p.Glu10911Lys) rs199620003
NM_001267550.2(TTN):c.32970_32987del (p.10987_10989EEY[1]) rs766756026
NM_001267550.2(TTN):c.33059A>G (p.Tyr11020Cys) rs72650035
NM_001267550.2(TTN):c.33063A>G (p.Glu11021=) rs115744476
NM_001267550.2(TTN):c.33416G>C (p.Arg11139Thr) rs72650040
NM_001267550.2(TTN):c.33501_33503AGA[4] (p.Glu11172del) rs368327166
NM_001267550.2(TTN):c.33856G>A (p.Glu11286Lys) rs376874956
NM_001267550.2(TTN):c.34098_34118GGAAGAGGAAGTTCTACCTGA[1] (p.11363_11369VLPEEEE[3]) rs397517548
NM_001267550.2(TTN):c.3409G>C (p.Gly1137Arg) rs72647870
NM_001267550.2(TTN):c.34140A>G (p.Glu11380=) rs147418835
NM_001267550.2(TTN):c.34474C>A (p.Pro11492Thr) rs182428755
NM_001267550.2(TTN):c.34845C>T (p.Pro11615=) rs368781863
NM_001267550.2(TTN):c.34864G>A (p.Val11622Ile) rs202014478
NM_001267550.2(TTN):c.35794G>T (p.Glu11932Ter) rs878854299
NM_001267550.2(TTN):c.35875+8T>G rs192408585
NM_001267550.2(TTN):c.36285C>T (p.His12095=) rs201184203
NM_001267550.2(TTN):c.36347A>G (p.Glu12116Gly) rs200513156
NM_001267550.2(TTN):c.36405G>A (p.Val12135=) rs373815877
NM_001267550.2(TTN):c.36509A>T (p.Glu12170Val) rs200840285
NM_001267550.2(TTN):c.36676A>G (p.Lys12226Glu) rs200815663
NM_001267550.2(TTN):c.37247C>T (p.Ser12416Leu) rs370765948
NM_001267550.2(TTN):c.37525G>A (p.Glu12509Lys) rs201797790
NM_001267550.2(TTN):c.38311A>G (p.Lys12771Glu) rs551811137
NM_001267550.2(TTN):c.38336T>C (p.Val12779Ala) rs2099130
NM_001267550.2(TTN):c.38902C>T (p.Pro12968Ser) rs192528655
NM_001267550.2(TTN):c.39466C>A (p.Pro13156Thr) rs72650064
NM_001267550.2(TTN):c.40498G>T (p.Val13500Phe) rs201944202
NM_001267550.2(TTN):c.41103C>T (p.Gly13701=) rs72650077
NM_001267550.2(TTN):c.41521G>A (p.Asp13841Asn) rs201257644
NM_001267550.2(TTN):c.42672G>T (p.Leu14224=) rs368155350
NM_001267550.2(TTN):c.42687C>T (p.Ala14229=) rs775889693
NM_001267550.2(TTN):c.4359A>T (p.Arg1453Ser) rs376857956
NM_001267550.2(TTN):c.4396T>C (p.Phe1466Leu) rs151310601
NM_001267550.2(TTN):c.44418C>T (p.Ser14806=) rs368005198
NM_001267550.2(TTN):c.44589G>A (p.Thr14863=) rs369800903
NM_001267550.2(TTN):c.45408G>T (p.Lys15136Asn) rs72677225
NM_001267550.2(TTN):c.46451G>A (p.Arg15484Lys) rs72677229
NM_001267550.2(TTN):c.47077G>A (p.Val15693Ile) rs201717871
NM_001267550.2(TTN):c.47191C>T (p.Arg15731Cys) rs72677231
NM_001267550.2(TTN):c.47248G>A (p.Val15750Ile) rs72677232
NM_001267550.2(TTN):c.47315G>A (p.Arg15772Gln) rs72677233
NM_001267550.2(TTN):c.47513G>A (p.Arg15838Gln) rs199640194
NM_001267550.2(TTN):c.47936C>T (p.Pro15979Leu) rs184815126
NM_001267550.2(TTN):c.48727C>T (p.Pro16243Ser) rs72677242
NM_001267550.2(TTN):c.49395C>T (p.Asp16465=) rs749308557
NM_001267550.2(TTN):c.50714G>A (p.Arg16905His) rs191539637
NM_001267550.2(TTN):c.50858-3C>T rs587782987
NM_001267550.2(TTN):c.51678C>T (p.Asn17226=) rs372635204
NM_001267550.2(TTN):c.51809G>T (p.Ser17270Ile) rs200650668
NM_001267550.2(TTN):c.52852C>T (p.Arg17618Cys) rs201213901
NM_001267550.2(TTN):c.53096G>A (p.Arg17699His) rs72646808
NM_001267550.2(TTN):c.53122A>G (p.Lys17708Glu) rs185913848
NM_001267550.2(TTN):c.54160G>C (p.Val18054Leu) rs200968679
NM_001267550.2(TTN):c.543C>T (p.Ser181=) rs758598014
NM_001267550.2(TTN):c.55290C>T (p.Pro18430=) rs777904054
NM_001267550.2(TTN):c.55374C>G (p.Ser18458Arg) rs200550947
NM_001267550.2(TTN):c.55553A>G (p.Lys18518Arg) rs72646823
NM_001267550.2(TTN):c.55673G>A (p.Arg18558His) rs115867512
NM_001267550.2(TTN):c.55925T>A (p.Leu18642Gln) rs140714512
NM_001267550.2(TTN):c.56403A>G (p.Gln18801=) rs553313488
NM_001267550.2(TTN):c.56535G>A (p.Thr18845=) rs529480368
NM_001267550.2(TTN):c.5697C>T (p.Ile1899=) rs148434577
NM_001267550.2(TTN):c.57646A>G (p.Ile19216Val) rs374058726
NM_001267550.2(TTN):c.58008T>C (p.Asn19336=) rs770525693
NM_001267550.2(TTN):c.5823A>G (p.Arg1941=) rs149668487
NM_001267550.2(TTN):c.58419A>G (p.Gln19473=) rs186563991
NM_001267550.2(TTN):c.59318A>G (p.Glu19773Gly) rs371719028
NM_001267550.2(TTN):c.5993G>A (p.Arg1998His) rs144135510
NM_001267550.2(TTN):c.60721G>C (p.Glu20241Gln) rs200212521
NM_001267550.2(TTN):c.60928C>T (p.Arg20310Cys)
NM_001267550.2(TTN):c.61100G>A (p.Arg20367Gln) rs141973925
NM_001267550.2(TTN):c.6162C>T (p.Ala2054=) rs143265948
NM_001267550.2(TTN):c.61922G>A (p.Arg20641Gln) rs199895260
NM_001267550.2(TTN):c.62317C>A (p.Leu20773Met) rs375173874
NM_001267550.2(TTN):c.62385C>A (p.Gly20795=) rs72646848
NM_001267550.2(TTN):c.62424C>T (p.Asp20808=) rs374472044
NM_001267550.2(TTN):c.62468G>A (p.Arg20823His) rs758019778
NM_001267550.2(TTN):c.62572A>G (p.Thr20858Ala) rs200689750
NM_001267550.2(TTN):c.62723G>A (p.Arg20908Gln) rs377203669
NM_001267550.2(TTN):c.63109C>T (p.Arg21037Cys) rs191549948
NM_001267550.2(TTN):c.63165G>A (p.Pro21055=) rs72646852
NM_001267550.2(TTN):c.63329C>T (p.Ala21110Val) rs370687831
NM_001267550.2(TTN):c.63352C>T (p.Arg21118Trp) rs200726948
NM_001267550.2(TTN):c.63439G>A (p.Ala21147Thr) rs72646853
NM_001267550.2(TTN):c.63589A>G (p.Ile21197Val) rs72646855
NM_001267550.2(TTN):c.63626G>A (p.Arg21209Gln) rs148684589
NM_001267550.2(TTN):c.63942G>A (p.Ser21314=) rs201285872
NM_001267550.2(TTN):c.64174C>T (p.Arg21392Cys) rs72646859
NM_001267550.2(TTN):c.65459C>T (p.Thr21820Ile) rs56130023
NM_001267550.2(TTN):c.65534C>T (p.Pro21845Leu) rs201662134
NM_001267550.2(TTN):c.65672C>T (p.Pro21891Leu) rs397517662
NM_001267550.2(TTN):c.67099T>C (p.Ser22367Pro) rs72646873
NM_001267550.2(TTN):c.67706G>A (p.Arg22569Gln) rs185620750
NM_001267550.2(TTN):c.68082C>T (p.Cys22694=) rs79406408
NM_001267550.2(TTN):c.68437G>A (p.Glu22813Lys) rs200797552
NM_001267550.2(TTN):c.69130C>T (p.Pro23044Ser) rs55980498
NM_001267550.2(TTN):c.69821G>A (p.Gly23274Asp) rs201043950
NM_001267550.2(TTN):c.70102A>G (p.Ile23368Val) rs367914610
NM_001267550.2(TTN):c.70677T>C (p.Asp23559=) rs72646890
NM_001267550.2(TTN):c.70815G>A (p.Val23605=) rs55847238
NM_001267550.2(TTN):c.71036G>A (p.Arg23679Lys) rs200144345
NM_001267550.2(TTN):c.71373T>G (p.Leu23791=) rs56245285
NM_001267550.2(TTN):c.71705T>C (p.Ile23902Thr) rs55837610
NM_001267550.2(TTN):c.72132T>C (p.Gly24044=) rs56169243
NM_001267550.2(TTN):c.72146T>C (p.Leu24049Pro) rs56399205
NM_001267550.2(TTN):c.72231A>G (p.Glu24077=) rs1423712037
NM_001267550.2(TTN):c.72379G>A (p.Glu24127Lys) rs149763294
NM_001267550.2(TTN):c.72766A>G (p.Asn24256Asp) rs187868672
NM_001267550.2(TTN):c.72931A>G (p.Thr24311Ala) rs56201325
NM_001267550.2(TTN):c.7316G>A (p.Arg2439His) rs142129359
NM_001267550.2(TTN):c.73604C>A (p.Ser24535Tyr) rs201804005
NM_001267550.2(TTN):c.73705G>C (p.Val24569Leu) rs755676676
NM_001267550.2(TTN):c.73825G>C (p.Glu24609Gln) rs55762754
NM_001267550.2(TTN):c.74597_74599CAA[1] (p.Thr24867del) rs543318580
NM_001267550.2(TTN):c.74602A>G (p.Ile24868Val) rs72646898
NM_001267550.2(TTN):c.7523A>G (p.His2508Arg) rs146970027
NM_001267550.2(TTN):c.75738A>G (p.Glu25246=) rs371344165
NM_001267550.2(TTN):c.75762G>T (p.Val25254=) rs374003257
NM_001267550.2(TTN):c.76483G>A (p.Val25495Ile)
NM_001267550.2(TTN):c.76722T>C (p.Tyr25574=) rs55696153
NM_001267550.2(TTN):c.77052C>T (p.Gly25684=) rs372543652
NM_001267550.2(TTN):c.77205G>A (p.Val25735=) rs55857909
NM_001267550.2(TTN):c.77716G>A (p.Glu25906Lys) rs56341835
NM_001267550.2(TTN):c.77813G>C (p.Trp25938Ser) rs186681106
NM_001267550.2(TTN):c.78892G>A (p.Gly26298Arg) rs72648205
NM_001267550.2(TTN):c.79226G>A (p.Arg26409His) rs72648206
NM_001267550.2(TTN):c.79344G>T (p.Val26448=) rs369875680
NM_001267550.2(TTN):c.7957T>C (p.Leu2653=) rs201837864
NM_001267550.2(TTN):c.79863G>A (p.Thr26621=) rs186402008
NM_001267550.2(TTN):c.80586C>T (p.Ser26862=) rs748292845
NM_001267550.2(TTN):c.80722A>C (p.Arg26908=) rs573877174
NM_001267550.2(TTN):c.81105C>A (p.Thr27035=) rs72648212
NM_001267550.2(TTN):c.81472C>G (p.Pro27158Ala) rs200771189
NM_001267550.2(TTN):c.81539T>C (p.Ile27180Thr) rs182126530
NM_001267550.2(TTN):c.81558T>C (p.Asn27186=) rs56181243
NM_001267550.2(TTN):c.81892G>A (p.Asp27298Asn) rs200697681
NM_001267550.2(TTN):c.81899G>A (p.Arg27300His) rs55850344
NM_001267550.2(TTN):c.82402A>C (p.Lys27468Gln) rs201958805
NM_001267550.2(TTN):c.82489G>A (p.Gly27497Arg) rs201158906
NM_001267550.2(TTN):c.82691C>T (p.Ala27564Val) rs55634791
NM_001267550.2(TTN):c.8292G>A (p.Leu2764=) rs727503687
NM_001267550.2(TTN):c.82934G>A (p.Arg27645His) rs766522109
NM_001267550.2(TTN):c.82964G>A (p.Gly27655Asp) rs373745130
NM_001267550.2(TTN):c.83171T>G (p.Val27724Gly) rs201896662
NM_001267550.2(TTN):c.83516G>A (p.Arg27839Gln) rs376820301
NM_001267550.2(TTN):c.835C>T (p.Arg279Trp) rs138060032
NM_001267550.2(TTN):c.83733C>T (p.Ser27911=) rs375442124
NM_001267550.2(TTN):c.84263G>A (p.Ser28088Asn) rs200450022
NM_001267550.2(TTN):c.84640A>G (p.Met28214Val) rs72648221
NM_001267550.2(TTN):c.84871C>T (p.Arg28291Cys) rs192152102
NM_001267550.2(TTN):c.85406C>G (p.Ser28469Cys) rs202040332
NM_001267550.2(TTN):c.86729_86731AAG[1] (p.Glu28911del) rs727504797
NM_001267550.2(TTN):c.86949A>G (p.Glu28983=) rs375565646
NM_001267550.2(TTN):c.87412C>A (p.Pro29138Thr) rs72648227
NM_001267550.2(TTN):c.87495C>T (p.Asp29165=) rs371763584
NM_001267550.2(TTN):c.87623A>T (p.Tyr29208Phe) rs201831707
NM_001267550.2(TTN):c.88394C>T (p.Ser29465Phe) rs146181116
NM_001267550.2(TTN):c.88459G>A (p.Val29487Met) rs200899806
NM_001267550.2(TTN):c.88721G>A (p.Arg29574His) rs111727915
NM_001267550.2(TTN):c.89314G>A (p.Glu29772Lys) rs200503016
NM_001267550.2(TTN):c.89386G>A (p.Val29796Met) rs72648237
NM_001267550.2(TTN):c.8938G>A (p.Ala2980Thr) rs72647885
NM_001267550.2(TTN):c.89426G>A (p.Arg29809Gln) rs72648238
NM_001267550.2(TTN):c.89457A>G (p.Gly29819=) rs1553542686
NM_001267550.2(TTN):c.89946C>T (p.Val29982=) rs373311459
NM_001267550.2(TTN):c.90758_90760GAG[2] (p.Gly30255del) rs748912340
NM_001267550.2(TTN):c.91347T>C (p.Asp30449=) rs193022702
NM_001267550.2(TTN):c.9139T>A (p.Ser3047Thr) rs946142615
NM_001267550.2(TTN):c.91557T>C (p.Asp30519=) rs202185465
NM_001267550.2(TTN):c.91573A>G (p.Ile30525Val) rs72648244
NM_001267550.2(TTN):c.91601A>T (p.Asp30534Val) rs182549226
NM_001267550.2(TTN):c.91643C>T (p.Ala30548Val) rs553668520
NM_001267550.2(TTN):c.92176C>T (p.Pro30726Ser) rs72648247
NM_001267550.2(TTN):c.92696T>C (p.Ile30899Thr) rs373727636
NM_001267550.2(TTN):c.92699A>G (p.Asn30900Ser) rs186234393
NM_001267550.2(TTN):c.92780T>A (p.Ile30927Lys) rs531432790
NM_001267550.2(TTN):c.92806G>A (p.Val30936Ile) rs200476500
NM_001267550.2(TTN):c.93005G>T (p.Ser31002Ile) rs180975448
NM_001267550.2(TTN):c.93524G>A (p.Arg31175His) rs72648251
NM_001267550.2(TTN):c.9359G>A (p.Arg3120Gln) rs72647894
NM_001267550.2(TTN):c.93803A>C (p.Lys31268Thr) rs200766837
NM_001267550.2(TTN):c.93900C>T (p.Ser31300=) rs200173934
NM_001267550.2(TTN):c.94846C>T (p.Leu31616=) rs72648255
NM_001267550.2(TTN):c.94851T>A (p.Asp31617Glu) rs72648256
NM_001267550.2(TTN):c.94863C>T (p.His31621=) rs373871146
NM_001267550.2(TTN):c.95242C>T (p.Arg31748Cys) rs142525903
NM_001267550.2(TTN):c.95653G>A (p.Ala31885Thr) rs72648263
NM_001267550.2(TTN):c.96684C>T (p.Tyr32228=) rs368423941
NM_001267550.2(TTN):c.97099C>T (p.Arg32367Cys) rs202064385
NM_001267550.2(TTN):c.97294C>T (p.Leu32432=) rs72648267
NM_001267550.2(TTN):c.97386C>T (p.Thr32462=) rs376810671
NM_001267550.2(TTN):c.97538G>A (p.Arg32513His) rs201080904
NM_001267550.2(TTN):c.97612C>T (p.Arg32538Cys) rs761050391
NM_001267550.2(TTN):c.97760G>A (p.Arg32587His) rs55704830
NM_001267550.2(TTN):c.98022C>T (p.Arg32674=) rs372825562
NM_001267550.2(TTN):c.98242C>T (p.Arg32748Cys) rs72648272
NM_001267550.2(TTN):c.98294C>G (p.Ala32765Gly) rs72648273
NM_001267550.2(TTN):c.98390A>G (p.Asn32797Ser) rs149001703
NM_001267550.2(TTN):c.98431C>T (p.Arg32811Cys) rs371807358
NM_001267550.2(TTN):c.98716G>A (p.Val32906Ile) rs182683829
NM_001267550.2(TTN):c.99991T>C (p.Cys33331Arg) rs56061641
NM_001267550.2(TTN):c.99996G>A (p.Glu33332=)
NM_001270974.2(HYDIN):c.14857C>T (p.Arg4953Trp) rs79607350
NM_001271.4(CHD2):c.3735del (p.Lys1245fs) rs752940775
NM_001271.4(CHD2):c.4058C>T (p.Pro1353Leu) rs755088564
NM_001271.4(CHD2):c.4278+5T>C rs202174434
NM_001271.4(CHD2):c.4971G>A (p.Trp1657Ter) rs398122998
NM_001271.4(CHD2):c.568C>T (p.Arg190Cys) rs540770153
NM_001271.4(CHD2):c.630G>T (p.Glu210Asp) rs749147803
NM_001271.4(CHD2):c.826+4T>C rs369930157
NM_001271208.2(NEB):c.1366-4A>G rs886038438
NM_001271208.2(NEB):c.154_168CTGGCACAGCCAGCA[3] (p.52_56LAQPA[3]) rs377452683
NM_001271208.2(NEB):c.16192G>A (p.Asp5398Asn) rs750810441
NM_001271208.2(NEB):c.177G>A (p.Gln59=) rs200990309
NM_001271208.2(NEB):c.19455G>A (p.Lys6485=) rs182847302
NM_001271208.2(NEB):c.20098C>A (p.Leu6700Ile) rs202139330
NM_001271208.2(NEB):c.20128G>A (p.Val6710Ile) rs199890298
NM_001271208.2(NEB):c.20466+7G>A rs201684605
NM_001271208.2(NEB):c.21856C>G (p.Gln7286Glu) rs373946758
NM_001271208.2(NEB):c.22227C>G (p.Asp7409Glu) rs192402741
NM_001271208.2(NEB):c.22695+2T>C rs200449517
NM_001271208.2(NEB):c.23118C>T (p.Ser7706=) rs370873040
NM_001271208.2(NEB):c.23881C>T (p.Pro7961Ser) rs193224180
NM_001271208.2(NEB):c.24094C>T (p.Arg8032Ter) rs549794342
NM_001271208.2(NEB):c.25143A>G (p.Gln8381=) rs184319249
NM_001271208.2(NEB):c.3255C>T (p.Asp1085=) rs368625295
NM_001271208.2(NEB):c.3637G>A (p.Val1213Ile) rs202124287
NM_001271208.2(NEB):c.3778T>C (p.Leu1260=) rs886038452
NM_001271208.2(NEB):c.3858C>A (p.Cys1286Ter) rs1386238241
NM_001271208.2(NEB):c.4649A>G (p.Lys1550Arg) rs114089598
NM_001271208.2(NEB):c.5555T>G (p.Met1852Arg) rs144180493
NM_001271208.2(NEB):c.6033C>T (p.Pro2011=) rs773482640
NM_001271208.2(NEB):c.6615C>G (p.Arg2205=) rs200018782
NM_001271208.2(NEB):c.7581C>T (p.Tyr2527=) rs200425929
NM_001271208.2(NEB):c.9139C>A (p.His3047Asn) rs147168910
NM_001271696.3(ABCB7):c.246+1G>A rs61323727
NM_001271803.2(REEP2):c.605C>T (p.Pro202Leu)
NM_001271938.2(MEGF8):c.8176C>T (p.Arg2726Cys)
NM_001276345.2(TNNT2):c.208A>G (p.Met70Val) rs141837529
NM_001276345.2(TNNT2):c.451del (p.Arg151fs) rs730881115
NM_001277115.2(DNAH11):c.12632C>T (p.Pro4211Leu) rs142585703
NM_001277115.2(DNAH11):c.13305C>T (p.Gly4435=) rs150682314
NM_001277115.2(DNAH11):c.180C>T (p.Arg60=) rs781089233
NM_001277115.2(DNAH11):c.4501-7A>T rs62447794
NM_001277115.2(DNAH11):c.5132A>G (p.Gln1711Arg) rs189432084
NM_001277115.2(DNAH11):c.8478C>T (p.His2826=) rs62445328
NM_001278074.1(COL5A1):c.1224G>C (p.Thr408=) rs139406076
NM_001278074.1(COL5A1):c.2382C>T (p.Val794=) rs758190171
NM_001278074.1(COL5A1):c.2676C>A (p.Gly892=) rs143161140
NM_001278074.1(COL5A1):c.279G>A (p.Ala93=) rs145090868
NM_001278074.1(COL5A1):c.3591C>T (p.Asp1197=) rs370349155
NM_001278074.1(COL5A1):c.4410C>T (p.Pro1470=) rs41310953
NM_001278074.1(COL5A1):c.4698G>A (p.Pro1566=) rs147904867
NM_001278074.1(COL5A1):c.514G>T (p.Val172Phe) rs150147262
NM_001278116.2(L1CAM):c.1993C>G (p.Leu665Val) rs199592861
NM_001278116.2(L1CAM):c.984C>T (p.Thr328=) rs200638763
NM_001278512.2(AP3B2):c.113+7G>A rs756540347
NM_001278512.2(AP3B2):c.2394C>T (p.Ser798=)
NM_001281463.1(SMC1A):c.3324C>T (p.Gly1108=)
NM_001282225.2(ADA2):c.1045G>A (p.Val349Ile) rs74317375
NM_001282225.2(ADA2):c.145C>T (p.Arg49Trp) rs199614299
NM_001282225.2(ADA2):c.927G>A (p.Met309Ile) rs146597836
NM_001282386.1(IDH1):c.394C>T (p.Arg132Cys) rs121913499
NM_001286577.1(C2CD3):c.3671A>G (p.Gln1224Arg) rs78878933
NM_001289808.2(CRYAB):c.152C>T (p.Pro51Leu) rs2234704
NM_001289808.2(CRYAB):c.460G>A (p.Gly154Ser) rs150516929
NM_001292034.3(TAB2):c.156A>G (p.Arg52=)
NM_001297.5(CNGB1):c.2893-7G>A rs749199721
NM_001297.5(CNGB1):c.3115G>A (p.Gly1039Arg) rs148999583
NM_001297.5(CNGB1):c.838-4G>T rs375539469
NM_001301130.2(POLR2F):c.453-24294G>C rs533778281
NM_001301365.1(LYST):c.-5C>T rs141317482
NM_001301365.1(LYST):c.1655T>C (p.Val552Ala)
NM_001301365.1(LYST):c.1686G>C (p.Gln562His) rs77091385
NM_001301365.1(LYST):c.5518T>G (p.Ser1840Ala) rs115330112
NM_001301365.1(LYST):c.6482A>C (p.Glu2161Ala) rs147756847
NM_001301365.1(LYST):c.7870C>T (p.Arg2624Trp) rs150306354
NM_001301365.1(LYST):c.8913T>G (p.Asn2971Lys)
NM_001303.4(COX10):c.1291C>T (p.Arg431Trp) rs113058506
NM_001303.4(COX10):c.260C>T (p.Thr87Ile)
NM_001303.4(COX10):c.929-7C>T rs62052075
NM_001303.4(COX10):c.981C>T (p.Asn327=) rs146175179
NM_001308211.1(EARS2):c.16A>G (p.Arg6Gly) rs113722817
NM_001314077.1(PROS1):c.323C>T (p.Pro108Leu) rs73846070
NM_001314077.1(PROS1):c.380G>A (p.Gly127Glu) rs144526169
NM_001318510.2(ACSL4):c.1325A>G (p.Tyr442Cys) rs200451158
NM_001323289.2(CDKL5):c.2541G>A (p.Ser847=) rs781774964
NM_001329943.3(KIAA0586):c.3688T>C (p.Leu1230=)
NM_001329943.3(KIAA0586):c.4519G>A (p.Ala1507Thr)
NM_001330078.2(NRXN1):c.1158+26A>T rs201802152
NM_001330078.2(NRXN1):c.1945A>G (p.Ile649Val) rs200074974
NM_001330078.2(NRXN1):c.2122C>A (p.Leu708Ile) rs56086732
NM_001330078.2(NRXN1):c.3129A>G (p.Val1043=) rs200698497
NM_001330078.2(NRXN1):c.3201C>T (p.Ser1067=) rs75275592
NM_001330078.2(NRXN1):c.339C>T (p.Ala113=) rs767682431
NM_001330260.2(SCN8A):c.1215G>A (p.Leu405=) rs751093826
NM_001330260.2(SCN8A):c.1588C>T (p.Arg530Trp) rs761336234
NM_001330260.2(SCN8A):c.1779G>C (p.Glu593Asp) rs760717246
NM_001330260.2(SCN8A):c.1846_1854GGCTACAGC[1] (p.616_618GYS[1]) rs758276968
NM_001330260.2(SCN8A):c.3148G>A (p.Gly1050Ser) rs202006479
NM_001330260.2(SCN8A):c.3267C>A (p.Asn1089Lys) rs761386688
NM_001330260.2(SCN8A):c.3327C>T (p.Asn1109=) rs1349215930
NM_001330260.2(SCN8A):c.4748T>C (p.Ile1583Thr) rs201458257
NM_001330260.2(SCN8A):c.4764C>T (p.Phe1588=) rs200728478
NM_001330260.2(SCN8A):c.4840A>G (p.Thr1614Ala) rs1555230909
NM_001330260.2(SCN8A):c.4969C>T (p.Leu1657=) rs374755275
NM_001330260.2(SCN8A):c.5391C>T (p.Pro1797=) rs372155701
NM_001330260.2(SCN8A):c.5761A>C (p.Thr1921Pro) rs368796221
NM_001330260.2(SCN8A):c.5847T>C (p.Ser1949=)
NM_001349.4(DARS1):c.1150-5T>G
NM_001349253.2(SCN11A):c.408C>T (p.Ile136=) rs148425367
NM_001353921.2(ARHGEF9):c.675G>A (p.Gln225=) rs140777637
NM_001354663.2(OPA1):c.-260_-243del rs863224140
NM_001358530.2(MOCS1):c.1015C>T (p.Arg339Trp) rs148579886
NM_001358530.2(MOCS1):c.124-69G>A rs45487695
NM_001358530.2(MOCS1):c.853G>A (p.Glu285Lys) rs140243105
NM_001360.2(DHCR7):c.452G>A (p.Trp151Ter) rs11555217
NM_001363118.2(SLC52A2):c.1001+6C>T rs139398461
NM_001364905.1(LRBA):c.114G>T (p.Gly38=) rs72721739
NM_001364905.1(LRBA):c.1399A>G (p.Met467Val) rs116355217
NM_001364905.1(LRBA):c.2340A>G (p.Thr780=) rs79392371
NM_001364905.1(LRBA):c.2444A>G (p.Asn815Ser) rs140666848
NM_001364905.1(LRBA):c.4591T>G (p.Phe1531Val) rs114610541
NM_001364905.1(LRBA):c.5241T>C (p.Asn1747=) rs72719631
NM_001364905.1(LRBA):c.5906G>C (p.Gly1969Ala)
NM_001364905.1(LRBA):c.7564A>C (p.Thr2522Pro) rs62346982
NM_001365068.1(ASTN2):c.2806+26807G>A rs3747835
NM_001365068.1(ASTN2):c.2806+26922del rs759376012
NM_001365276.2(TNXB):c.10368C>T (p.Thr3456=) rs116701346
NM_001365276.2(TNXB):c.6074A>T (p.Asp2025Val) rs201397168
NM_001365536.1(SCN9A):c.1398C>T (p.Ser466=) rs201531206
NM_001365536.1(SCN9A):c.1554C>T (p.Val518=) rs201054032
NM_001365536.1(SCN9A):c.1997A>G (p.Lys666Arg) rs121908919
NM_001365536.1(SCN9A):c.2248A>G (p.Ile750Val) rs182650126
NM_001365536.1(SCN9A):c.3361C>T (p.Arg1121Trp) rs190664764
NM_001365536.1(SCN9A):c.3506A>C (p.Asn1169Thr) rs151241025
NM_001365536.1(SCN9A):c.3767A>G (p.Asn1256Ser) rs141268327
NM_001365536.1(SCN9A):c.377+5C>T rs200972952
NM_001365536.1(SCN9A):c.3832C>G (p.Leu1278Val) rs180922748
NM_001365536.1(SCN9A):c.4110T>C (p.Cys1370=) rs199673396
NM_001365536.1(SCN9A):c.4645T>C (p.Trp1549Arg) rs202084411
NM_001365536.1(SCN9A):c.4923T>C (p.Leu1641=) rs199550149
NM_001365536.1(SCN9A):c.684C>G (p.Ile228Met) rs71428908
NM_001365999.1(SZT2):c.2955C>T (p.Cys985=) rs151189395
NM_001365999.1(SZT2):c.4531G>A (p.Val1511Ile) rs76675748
NM_001365999.1(SZT2):c.4983T>C (p.Asp1661=) rs139810154
NM_001365999.1(SZT2):c.5377G>A (p.Glu1793Lys) rs143185010
NM_001365999.1(SZT2):c.7562T>C (p.Val2521Ala) rs150113647
NM_001365999.1(SZT2):c.8255G>A (p.Arg2752His) rs150591561
NM_001365999.1(SZT2):c.8702C>T (p.Pro2901Leu) rs139027171
NM_001366110.1(PAX4):c.313C>T (p.Arg105Cys) rs144792551
NM_001366145.2(TRPM3):c.3004G>A (p.Val1002Met) rs1564493599
NM_001367561.1(DOCK7):c.5208A>T (p.Val1736=) rs144604663
NM_001367624.1(ZNF469):c.1020C>T (p.Gly340=) rs273585633
NM_001367624.1(ZNF469):c.10327G>C (p.Gly3443Arg) rs532857190
NM_001367624.1(ZNF469):c.10328G>C (p.Gly3443Ala) rs140056980
NM_001367624.1(ZNF469):c.10328G>T (p.Gly3443Val) rs140056980
NM_001367624.1(ZNF469):c.10361G>A (p.Arg3454Gln) rs75288466
NM_001367624.1(ZNF469):c.10700G>A (p.Gly3567Glu) rs199610834
NM_001367624.1(ZNF469):c.11658G>C (p.Gln3886His) rs182269913
NM_001367624.1(ZNF469):c.1471G>A (p.Ala491Thr) rs117555121
NM_001367624.1(ZNF469):c.1615A>T (p.Ser539Cys) rs189476639
NM_001367624.1(ZNF469):c.1697C>T (p.Ala566Val) rs181785233
NM_001367624.1(ZNF469):c.2297G>A (p.Arg766Gln) rs144492145
NM_001367624.1(ZNF469):c.2699C>T (p.Pro900Leu) rs273585618
NM_001367624.1(ZNF469):c.2717C>T (p.Pro906Leu) rs77951481
NM_001367624.1(ZNF469):c.2841G>A (p.Arg947=) rs150435442
NM_001367624.1(ZNF469):c.3950A>G (p.Lys1317Arg) rs772817384
NM_001367624.1(ZNF469):c.4472C>T (p.Thr1491Met) rs375045076
NM_001367624.1(ZNF469):c.4778C>T (p.Ser1593Leu) rs768864900
NM_001367624.1(ZNF469):c.5548C>A (p.Pro1850Thr) rs199932922
NM_001367624.1(ZNF469):c.7267C>A (p.Pro2423Thr) rs199727372
NM_001367624.1(ZNF469):c.7553C>A (p.Pro2518His) rs201943633
NM_001367624.1(ZNF469):c.7675A>G (p.Lys2559Glu) rs146789160
NM_001367624.1(ZNF469):c.7831G>A (p.Glu2611Lys) rs281865151
NM_001367624.1(ZNF469):c.9696G>A (p.Thr3232=) rs573582117
NM_001367624.1(ZNF469):c.9919A>G (p.Thr3307Ala) rs273585627
NM_001368809.2(AMPD2):c.1407+3A>G rs41280332
NM_001369.2(DNAH5):c.1206T>A (p.Asn402Lys) rs140782270
NM_001369.2(DNAH5):c.6167A>T (p.Lys2056Ile) rs578128759
NM_001371986.1(UNC80):c.765T>C (p.Cys255=)
NM_001376.5(DYNC1H1):c.10833G>C (p.Arg3611=) rs35143882
NM_001376.5(DYNC1H1):c.12075C>T (p.Leu4025=) rs373636519
NM_001376.5(DYNC1H1):c.12441C>T (p.Phe4147=) rs146075696
NM_001376.5(DYNC1H1):c.5985C>T (p.Ala1995=) rs140841480
NM_001376.5(DYNC1H1):c.751C>T (p.Arg251Cys) rs879253979
NM_001376.5(DYNC1H1):c.8703T>C (p.Tyr2901=) rs755411424
NM_001377.3(DYNC2H1):c.9939T>C (p.Ala3313=) rs192003811
NM_001390.4(DTNA):c.1757C>T (p.Pro586Leu) rs145425478
NM_001414.4(EIF2B1):c.429G>A (p.Ala143=) rs148714712
NM_001457.4(FLNB):c.1196A>G (p.Lys399Arg) rs145673747
NM_001457.4(FLNB):c.3785G>C (p.Gly1262Ala) rs111330368
NM_001457.4(FLNB):c.5220C>T (p.Asn1740=) rs531970315
NM_001457.4(FLNB):c.6231C>T (p.Asp2077=) rs145280904
NM_001458.4(FLNC):c.1568T>C (p.Val523Ala) rs182845462
NM_001458.4(FLNC):c.1632G>A (p.Lys544=)
NM_001458.4(FLNC):c.1657G>A (p.Gly553Ser) rs201572079
NM_001458.4(FLNC):c.2142C>A (p.Ile714=) rs199595235
NM_001458.4(FLNC):c.2930-5C>T rs371599113
NM_001458.4(FLNC):c.294G>A (p.Glu98=) rs201839252
NM_001458.4(FLNC):c.3938G>A (p.Arg1313Gln) rs199804244
NM_001458.4(FLNC):c.4296G>A (p.Pro1432=) rs370827536
NM_001458.4(FLNC):c.6888C>T (p.His2296=) rs375259002
NM_001458.4(FLNC):c.7605G>A (p.Ser2535=) rs777724201