ClinVar Miner

Variants from CeGaT Praxis fuer Humangenetik Tuebingen with conflicting interpretations

Location: Germany — Primary collection method: clinical testing
Minimum review status of the submission from CeGaT Praxis fuer Humangenetik Tuebingen: Collection method of the submission from CeGaT Praxis fuer Humangenetik Tuebingen:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
13863 4088 37 1811 2855 74 507 4866

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
CeGaT Praxis fuer Humangenetik Tuebingen pathogenic likely pathogenic uncertain significance likely benign benign association drug response protective risk factor other
pathogenic 0 327 137 23 15 2 23 1 20 7
likely pathogenic 162 0 139 16 10 1 1 0 1 1
uncertain significance 82 115 30 1930 814 0 2 2 15 7
likely benign 9 9 612 7 1323 0 1 1 3 3

Submitter to submitter summary #

Total submitters: 151
Download table as spreadsheet
Submitter Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
GeneDx 0 2822 0 706 1136 1 148 1989
Invitae 0 1207 0 458 848 1 82 1388
EGL Genetic Diagnostics, Eurofins Clinical Diagnostics 0 1608 0 323 673 10 102 1105
Athena Diagnostics Inc 0 432 0 285 338 0 29 650
Integrated Genetics/Laboratory Corporation of America 0 332 0 225 269 0 28 522
Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine 0 687 0 154 314 2 35 505
ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories 0 533 0 209 178 1 27 414
Ambry Genetics 0 613 0 71 273 0 13 357
PreventionGenetics, PreventionGenetics 0 372 0 155 189 0 11 355
Genetic Services Laboratory, University of Chicago 0 359 0 68 161 2 15 246
Quest Diagnostics Nichols Institute San Juan Capistrano 0 316 0 113 96 0 16 225
Biesecker Lab/Clinical Genomics Section,National Institutes of Health 0 108 35 25 115 0 2 177
Illumina Clinical Services Laboratory,Illumina 0 214 0 20 118 0 33 170
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 0 249 0 19 126 0 19 163
Department of Pathology and Laboratory Medicine,Sinai Health System 0 165 0 35 59 0 21 114
Mayo Clinic Laboratories, Mayo Clinic 0 140 0 30 49 0 8 85
OMIM 0 65 0 4 5 41 15 64
Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen 0 313 0 43 0 0 18 61
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics,Children's Hospital of Philadelphia 0 45 0 19 21 0 3 43
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute 0 30 0 7 29 1 0 37
Clinical Genetics Karolinska University Hospital,Karolinska University Hospital 0 75 0 27 0 0 8 35
Stanford Center for Inherited Cardiovascular Disease, Stanford University 0 53 0 7 16 0 4 27
NIHR Bioresource Rare Diseases, University of Cambridge 0 17 0 18 2 0 5 23
PharmGKB 0 0 0 0 0 21 0 21
Leiden Open Variation Database 0 18 0 7 10 0 1 18
RettBASE 0 0 0 8 8 0 1 17
Centre for Mendelian Genomics,University Medical Centre Ljubljana 0 43 0 7 1 2 7 17
Cancer Genetics and Genomics Laboratory,British Columbia Cancer Agency 0 2 0 15 1 0 0 16
CHEO Genetics Diagnostic Laboratory,Children's Hospital of Eastern Ontario 0 30 0 10 4 0 1 15
Foulkes Cancer Genetics LDI, Lady Davis Institute for Medical Research 0 19 0 3 9 0 2 14
CSER _CC_NCGL, University of Washington 0 17 0 0 11 0 2 13
Genomic Research Center, Shahid Beheshti University of Medical Sciences 0 16 0 5 4 0 3 12
Blueprint Genetics 0 55 0 2 7 0 2 11
Molecular Genetics Laboratory,Institute for Ophthalmic Research 0 1 0 8 0 0 2 10
Natera, Inc. 0 21 0 1 7 0 1 9
Mendelics 0 21 0 0 8 0 1 9
University of Washington Center for Mendelian Genomics, University of Washington 0 3 0 5 1 0 4 9
University of Washington Department of Laboratory Medicine, University of Washington 0 6 0 1 2 1 5 9
Developmental Genetics Unit,King Faisal Specialist Hospital & Research Centre 0 1 0 5 0 0 4 8
Lupski Lab, Baylor-Hopkins CMG, Baylor College of Medicine 0 1 0 1 1 0 7 8
Gharavi Laboratory,Columbia University 0 16 0 3 2 0 3 8
Practice for Gait Abnormalities, David Pomarino,Competency Network Toe Walking c/o Practice Pomarino 0 8 0 0 2 0 6 8
Laboratory of Molecular Genetics (Pr. Bezieau's lab), CHU de Nantes 0 25 0 3 0 0 4 7
Research Molecular Genetics Laboratory,Women's College Hospital, University of Toronto 0 2 0 6 1 0 0 7
Medical Genetics Laboratory, Kennedy Center,Juliane Marie Center, Rigshospitalet 0 13 0 4 1 0 1 6
Northcott Neuroscience Laboratory, ANZAC Research Institute 0 0 0 3 2 0 1 6
Institute for Genomic Medicine (IGM) Clinical Laboratory,Nationwide Children's Hospital 0 10 0 2 4 0 0 6
Faculty of Health Sciences,Beirut Arab University 0 14 0 2 0 0 4 6
Clinical Molecular Genetics Laboratory,Johns Hopkins All Children's Hospital 0 8 0 2 1 0 2 5
King Laboratory,University of Washington 0 0 0 1 3 0 1 5
Fulgent Genetics,Fulgent Genetics 0 49 0 1 3 0 1 5
Equipe Genetique des Anomalies du Developpement, Université de Bourgogne 0 1 0 2 0 0 4 5
Greenwood Genetic Center Diagnostic Laboratories,Greenwood Genetic Center 0 15 0 2 1 0 1 4
Molecular Diagnostics Lab,Nemours Alfred I. duPont Hospital for Children 0 8 0 3 0 0 1 4
Knight Diagnostic Laboratories, Oregon Health and Sciences University 0 17 0 3 0 0 1 4
Department of Pathology and Molecular Medicine,Queen's University 0 3 0 4 0 0 0 4
New York Genome Center 0 6 0 2 1 0 2 4
Human Genome Sequencing Center Clinical Lab, Baylor College of Medicine 0 3 0 3 0 0 0 3
Department of Ophthalmology and Visual Sciences Kyoto University 0 0 1 0 2 0 0 3
GeneKor MSA 0 11 0 3 0 0 0 3
Undiagnosed Diseases Network,NIH 0 5 0 1 2 0 2 3
Laboratoire de Génétique Moléculaire, CHU Bordeaux 0 6 0 2 0 0 1 3
Sharon lab,Hadassah-Hebrew University Medical Center 0 5 0 2 0 0 1 3
Inherited Neuropathy Consortium 0 2 0 0 1 0 2 3
Center for Advanced Laboratory Medicine, UC San Diego Health,University of California San Diego 0 2 0 0 3 0 0 3
MAGI's Lab - Research,MAGI Group 0 7 0 1 0 0 2 3
Molecular Genetics of Inherited Kidney Disorders Laboratory,Garvan Institute of Medical Research 0 0 0 2 0 0 1 3
Genetics Laboratory, UDIAT-Centre Diagnòstic, Hospital Universitari Parc Tauli 0 9 0 1 0 0 2 3
Baylor Genetics 0 2 0 2 0 0 1 2
Elsea Laboratory,Baylor College of Medicine 0 0 0 0 0 0 2 2
Institute of Medical Molecular Genetics, University of Zurich 0 0 0 2 0 0 0 2
Counsyl 0 15 0 0 2 0 0 2
GeneReviews 0 3 0 2 0 0 0 2
Martin Pollak Laboratory, Beth Israel Deaconess Medical Center 0 0 1 0 0 0 1 2
Agnes Ginges Centre for Molecular Cardiology,Centenary Institute 0 1 0 1 1 0 0 2
Génétique et pathophysiologie de maladies neurodéveloppementales et épileptogènes, Institut de génétique et de biologie moléculaire et cellulaire 0 0 0 0 2 0 0 2
HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology 0 2 0 1 1 0 1 2
Forensic Genetics Laboratory,Harris County Institute of Forensic Sciences 0 0 0 0 0 0 2 2
Research and Development, ARUP Laboratories 0 3 0 1 1 0 0 2
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego 0 8 0 1 1 0 1 2
Institute of Human Genetics, University of Leipzig Medical Center 0 1 0 0 0 0 2 2
CHLA Center for Personalized Medicine,Children's Hospital, Los Angeles 0 3 0 0 0 0 2 2
Rare Disease Group, Clinical Genetics,Karolinska Institutet 0 0 0 1 1 0 2 2
Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago 0 2 0 0 2 0 0 2
Department of Human Genetics, University Hospital Magdeburg 0 0 0 0 2 0 0 2
Génétique des Maladies du Développement, Hospices Civils de Lyon 0 9 0 0 0 0 2 2
St. Jude Clinical Genomics Lab, St. Jude Children's Research Hospital 0 2 0 1 1 0 0 2
CZECANCA consortium 0 31 0 1 0 0 1 2
CFTR-France 0 6 0 2 0 0 0 2
Suna and Inan Kirac Foundation Neurodegeneration Research Laboratory, Koc University 0 0 0 0 0 0 2 2
Claritas Genomics 0 1 0 0 1 0 0 1
Molecular Genetics Laboratory,Children's Mercy Hospital and Clinics 0 0 0 0 1 0 0 1
FirmaLab,FirmaLab 0 0 0 0 0 0 1 1
Genome Diagnostics Laboratory,University Medical Center Utrecht 0 0 0 1 0 0 0 1
Eye Genetics Research Group,Children's Medical Research Institute 0 1 0 1 0 0 0 1
GenMed Metabolism Lab 0 5 0 0 0 0 1 1
Nyegaard lab; Aarhus University 0 0 0 1 0 0 0 1
Department of Psychiatry,Nagoya University 0 0 0 1 0 0 1 1
Wellcome Centre for Mitochondrial Research,Newcastle University 0 7 0 0 0 0 1 1
Institute of Human Genetics,Friedrich-Alexander-Universität Erlangen-Nürnberg 0 3 0 0 0 0 1 1
Center for Genetic Medicine Research,Children's National Medical Center 0 2 0 0 0 0 1 1
Department of Medical Genetics, Oslo University Hospital 0 0 0 0 1 0 0 1
Sydney Children's Hospital, SCHN 0 0 0 0 0 0 1 1
Center for Medical Genetics Ghent,University of Ghent 0 0 0 1 0 0 1 1
Bone Marrow Failure laboratory,Queen Mary University London 0 0 0 1 0 0 0 1
Vavilov Institute of General Genetics RAS, Laboratory of Evolutional Genomics 0 0 0 0 0 1 0 1
Lyon Laboratory, Cold Spring Harbor Laboratory 0 0 0 0 1 0 1 1
Tgen's Center For Rare Childhood Disorders,Translational Genomics Research Institute (TGEN) 0 0 0 0 0 0 1 1
Undiagnosed Diseases Program Translational Research Laboratory,National Institutes of Health 0 0 0 1 0 0 0 1
Genome Sciences Centre,British Columbia Cancer Agency 0 0 0 1 0 0 1 1
Beijing Municipal Key Laboratory,Capital Institute of Pediatrics 0 0 0 0 0 1 0 1
Center for Statistical Genetics, Columbia University 0 0 0 1 0 0 0 1
CeGaT Praxis fuer Humangenetik Tuebingen 22814 2 0 0 1 0 1 1
Human Genetics - Radboudumc,Radboudumc 0 1 0 0 0 0 1 1
Pediatric Highly Intensive Care Unit,Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico 0 0 0 0 0 0 1 1
Daryl Scott Lab,Baylor College of Medicine 0 0 0 0 0 0 1 1
Neurogenetics Laboratory - MEYER,AOU Meyer 0 3 0 0 0 0 1 1
Oxford Haemato-Oncology Service,Oxford University Hospitals NHS Foundation Trust 0 0 0 0 0 1 0 1
Endocrine oncology group, Uppsala University 0 0 0 1 0 0 0 1
Yale Center for Mendelian Genomics,Yale University 0 1 0 1 0 0 0 1
Santos-Cortez Lab,University of Colorado School of Medicine 0 0 0 0 1 0 0 1
Geisinger Autism and Developmental Medicine Institute,Geisinger Health System 0 0 0 1 1 0 1 1
Institute of Cellular and Molecular Medicine,Copenhagen University 0 0 0 1 0 0 1 1
Flegel Lab,National Institutes of Health 0 0 0 0 0 0 1 1
Pediatric Genomics Discovery Program,Yale University 0 0 0 1 0 0 0 1
Medical Genetics Summaries 0 0 0 0 0 1 0 1
Laboratoire de Genetique Moleculaire,Centre Hospitalier Universitaire de Bordeaux 0 0 0 0 1 0 1 1
Medical Genetics Lab,Policlinico S. Orsola.Malpighi 0 0 0 1 1 0 1 1
Medical Cytogenetics and Molecular Genetics Laboratory,IRCCS Istituto Auxologico Italiano 0 0 0 0 1 0 1 1
Broad Institute Rare Disease Group, Broad Institute 0 4 0 1 0 0 0 1
Lab. Molecular Oncology,VUB, Free University of Brussels 0 3 0 0 1 0 0 1
ClinGen Hearing Loss Variant Curation Expert Panel 0 0 0 0 1 0 0 1
Michaelson Lab,University of Iowa 0 0 0 0 1 0 1 1
Pathology and Clinical Laboratory Medicine,King Fahad Medical City 0 0 0 1 0 0 0 1
Molecular Pathology Diagnostics Labratory,University of Iowa Hospitals & Clinics 0 0 0 1 0 0 1 1
Institute of Reproductive Genetics, University of Münster 0 0 0 0 1 0 0 1
Department of Pediatrics,University of Ottawa 0 0 0 0 0 0 1 1
Biochemistry Laboratory of CDMU,Chengde Medical University 0 0 0 1 0 0 1 1
Institute for Genomic Statistics and Bioinformatics, University Hospital Bonn 0 0 0 1 0 0 0 1
Institute for Human Genetics, University Hospital Essen 0 2 0 0 0 0 1 1
Reproductive Health Research and Development,BGI Genomics 0 1 0 0 0 1 0 1
UT Southwestern Medical Center, UT Southwestern Medical Center 0 0 0 0 0 1 0 1
Department of Haematogenetics,ICMR National Institute of Immunohaematology 0 0 0 0 0 0 1 1
Central Laboratory,The First Hospital of Lanzhou University 0 0 0 0 0 0 1 1
Genetics and Prenatal Diagnosis Center,The First Affiliated Hospital of Zhengzhou University 0 0 0 1 0 0 1 1
Constitutional Genetics Lab,Leon Berard Cancer Center 0 4 0 1 0 0 0 1
GenomeConnect - Simons Searchlight 0 0 0 1 0 0 0 1
Department of Vascular Biology,Beijing Anzhen Hospital 0 2 0 1 0 0 0 1
Dept. Genetics and Cancer, Menzies Institute for Medical Research,University of Tasmania 0 0 0 0 1 0 1 1
Department of Otolaryngology – Head & Neck Surgery,Cochlear Implant Center 0 0 0 0 0 0 1 1
Wilkie Group, Clinical Genetics Lab, WIMM,University of Oxford 0 0 0 0 0 0 1 1

All variants with conflicting interpretations #

Total variants: 4866
Download table as spreadsheet
HGVS dbSNP
NM_000016.5(ACADM):c.127G>A (p.Glu43Lys) rs147559466
NM_000016.5(ACADM):c.994C>T (p.Leu332=) rs138098371
NM_000018.4(ACADVL):c.1473A>G (p.Leu491=) rs150518187
NM_000018.4(ACADVL):c.1700G>A (p.Arg567Gln) rs398123084
NM_000018.4(ACADVL):c.1844G>A (p.Arg615Gln) rs148584617
NM_000018.4(ACADVL):c.829_831del (p.Glu277del) rs796051913
NM_000018.4(ACADVL):c.881G>A (p.Gly294Glu) rs200573371
NM_000020.2(ACVRL1):c.88C>T (p.Pro30Ser) rs149664056
NM_000023.4(SGCA):c.329G>A (p.Arg110Gln) rs145697858
NM_000023.4(SGCA):c.690G>C (p.Leu230=) rs139454982
NM_000023.4(SGCA):c.739G>A (p.Val247Met) rs143570936
NM_000030.3(AGXT):c.508G>A (p.Gly170Arg) rs121908529
NM_000032.5(ALAS2):c.1560C>A (p.Pro520=) rs150055592
NM_000033.4(ABCD1):c.1252C>T (p.Arg418Trp) rs128624220
NM_000033.4(ABCD1):c.1900G>A (p.Ala634Thr) rs782041940
NM_000033.4(ABCD1):c.258C>T (p.Val86=) rs200660869
NM_000033.4(ABCD1):c.757C>G (p.Leu253Val) rs150151955
NM_000035.4(ALDOB):c.1013C>T (p.Ala338Val) rs77718928
NM_000036.2(AMPD1):c.242C>T (p.Pro81Leu) rs61752479
NM_000036.2(AMPD1):c.567G>T (p.Gln189His) rs139582106
NM_000037.4(ANK1):c.1801-17G>A rs786205243
NM_000038.6(APC):c.1005A>G (p.Leu335=) rs3797704
NM_000038.6(APC):c.1240C>T (p.Arg414Cys) rs137854567
NM_000038.6(APC):c.1631T>C (p.Ile544Thr) rs144056494
NM_000038.6(APC):c.1761C>T (p.Ser587=) rs370783137
NM_000038.6(APC):c.2204C>T (p.Ala735Val) rs147655929
NM_000038.6(APC):c.2205G>A (p.Ala735=) rs141001261
NM_000038.6(APC):c.2627G>A (p.Arg876Gln) rs373428732
NM_000038.6(APC):c.2805C>T (p.Tyr935=) rs137854575
NM_000038.6(APC):c.295C>T (p.Arg99Trp) rs139196838
NM_000038.6(APC):c.3006C>T (p.Ala1002=) rs72541810
NM_000038.6(APC):c.3386T>C (p.Leu1129Ser) rs143638171
NM_000038.6(APC):c.3471G>A (p.Glu1157=) rs143927847
NM_000038.6(APC):c.379A>G (p.Ser127Gly) rs200089324
NM_000038.6(APC):c.388A>G (p.Ser130Gly) rs150973053
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000038.6(APC):c.3949G>C (p.Glu1317Gln) rs1801166
NM_000038.6(APC):c.4326T>A (p.Pro1442=) rs67622085
NM_000038.6(APC):c.4372C>T (p.Pro1458Ser) rs143796828
NM_000038.6(APC):c.450A>G (p.Lys150=) rs116020626
NM_000038.6(APC):c.5009C>T (p.Ala1670Val) rs202228932
NM_000038.6(APC):c.5140G>A (p.Asp1714Asn) rs148275069
NM_000038.6(APC):c.5265G>A (p.Ala1755=) rs34506289
NM_000038.6(APC):c.6525A>G (p.Thr2175=) rs200151646
NM_000038.6(APC):c.6526T>C (p.Leu2176=) rs183468041
NM_000038.6(APC):c.6669A>G (p.Ser2223=) rs372680843
NM_000038.6(APC):c.6821C>T (p.Ala2274Val) rs34919187
NM_000038.6(APC):c.6873A>T (p.Gln2291His) rs148878262
NM_000038.6(APC):c.6921G>A (p.Ser2307=) rs2229993
NM_000038.6(APC):c.7036C>T (p.Pro2346Ser) rs200756935
NM_000038.6(APC):c.7490C>T (p.Ser2497Leu) rs141010008
NM_000038.6(APC):c.7514G>A (p.Arg2505Gln) rs147549623
NM_000038.6(APC):c.7766A>G (p.Glu2589Gly) rs200406572
NM_000038.6(APC):c.777G>T (p.Arg259=) rs147704593
NM_000038.6(APC):c.7862C>G (p.Ser2621Cys) rs72541816
NM_000038.6(APC):c.7929A>G (p.Leu2643=) rs138796072
NM_000041.4(APOE):c.137T>C (p.Leu46Pro) rs769452
NM_000044.6(AR):c.1937C>A (p.Ala646Asp) rs1800053
NM_000048.4(ASL):c.162C>T (p.Leu54=) rs140221164
NM_000048.4(ASL):c.35G>A (p.Arg12Gln) rs145138923
NM_000049.4(ASPA):c.637A>G (p.Lys213Glu) rs528179434
NM_000051.3(ATM):c.1229T>C (p.Val410Ala) rs56128736
NM_000051.3(ATM):c.1272T>C (p.Pro424=) rs35578748
NM_000051.3(ATM):c.162T>C (p.Tyr54=) rs3218690
NM_000051.3(ATM):c.1744T>C (p.Phe582Leu) rs2235006
NM_000051.3(ATM):c.1773T>C (p.Asn591=) rs61734356
NM_000051.3(ATM):c.1898+2T>G rs587782124
NM_000051.3(ATM):c.1986T>C (p.Phe662=) rs1800055
NM_000051.3(ATM):c.2119T>C (p.Ser707Pro) rs4986761
NM_000051.3(ATM):c.2181C>T (p.Gly727=) rs876658836
NM_000051.3(ATM):c.2466+7A>G rs55812024
NM_000051.3(ATM):c.2572T>C (p.Phe858Leu) rs1800056
NM_000051.3(ATM):c.2577C>T (p.Asn859=) rs730881286
NM_000051.3(ATM):c.3154-4G>A rs199543313
NM_000051.3(ATM):c.370A>G (p.Ile124Val) rs148590073
NM_000051.3(ATM):c.4473C>T (p.Phe1491=) rs4988008
NM_000051.3(ATM):c.4735C>T (p.Gln1579Ter) rs869312755
NM_000051.3(ATM):c.4949A>G (p.Asn1650Ser) rs55870064
NM_000051.3(ATM):c.4980C>T (p.Asn1660=) rs144338238
NM_000051.3(ATM):c.5009C>T (p.Ala1670Val) rs375131360
NM_000051.3(ATM):c.5414G>A (p.Trp1805Ter) rs879254171
NM_000051.3(ATM):c.5558A>T (p.Asp1853Val) rs1801673
NM_000051.3(ATM):c.609C>T (p.Asp203=) rs144709948
NM_000051.3(ATM):c.610G>A (p.Gly204Arg) rs147915571
NM_000051.3(ATM):c.7359T>G (p.Arg2453=) rs786201541
NM_000051.3(ATM):c.7390T>C (p.Cys2464Arg) rs55801750
NM_000051.3(ATM):c.7456C>T (p.Arg2486Ter) rs587779865
NM_000051.3(ATM):c.7463G>A (p.Cys2488Tyr) rs774281788
NM_000051.3(ATM):c.7494T>C (p.Ser2498=) rs34393781
NM_000051.3(ATM):c.7788+8G>T rs112775908
NM_000051.3(ATM):c.7983T>C (p.Asp2661=) rs143972422
NM_000051.3(ATM):c.8592C>T (p.Tyr2864=) rs56025670
NM_000051.3(ATM):c.8850+5A>C rs1057522186
NM_000051.3(ATM):c.998C>T (p.Ser333Phe) rs28904919
NM_000051.4(ATM):c.1066-6T>G rs201686625
NM_000051.4(ATM):c.146C>G rs1800054
NM_000051.4(ATM):c.1703G>T (p.Arg568Ile) rs200381392
NM_000051.4(ATM):c.1810C>T (p.Pro604Ser) rs2227922
NM_000051.4(ATM):c.2932T>C (p.Ser978Pro) rs139552233
NM_000051.4(ATM):c.3925G>A (p.Ala1309Thr) rs149711770
NM_000051.4(ATM):c.4060C>A (p.Pro1354Thr) rs145119475
NM_000051.4(ATM):c.4388T>G (p.Phe1463Cys) rs138327406
NM_000051.4(ATM):c.4424A>G (p.Tyr1475Cys) rs34640941
NM_000051.4(ATM):c.496+4T>C rs587781375
NM_000051.4(ATM):c.5071A>C (p.Ser1691Arg) rs1800059
NM_000051.4(ATM):c.5793T>C (p.Ala1931=) rs3092910
NM_000051.4(ATM):c.5821G>C (p.Val1941Leu) rs147187700
NM_000051.4(ATM):c.6067G>A (p.Gly2023Arg) rs11212587
NM_000051.4(ATM):c.6860G>C (p.Gly2287Ala) rs1800061
NM_000051.4(ATM):c.6988C>G (p.Leu2330Val) rs148432863
NM_000051.4(ATM):c.7630-2A>C rs587779866
NM_000051.4(ATM):c.8977C>T (p.Arg2993Ter) rs770641163
NM_000052.7(ATP7A):c.2499-7T>C rs782260332
NM_000052.7(ATP7A):c.2903A>G (p.Glu968Gly) rs138958687
NM_000052.7(ATP7A):c.3931A>G (p.Met1311Val) rs139781067
NM_000052.7(ATP7A):c.4389T>C (p.Ser1463=) rs371939448
NM_000052.7(ATP7A):c.880A>T (p.Asn294Tyr) rs150526992
NM_000053.4(ATP7B):c.1185C>T (p.Ala395=) rs764551529
NM_000053.4(ATP7B):c.1278C>T (p.Val426=) rs143556945
NM_000053.4(ATP7B):c.1543+13C>T rs200171850
NM_000053.4(ATP7B):c.1607T>C (p.Val536Ala) rs138427376
NM_000053.4(ATP7B):c.1620C>T (p.Leu540=) rs145798966
NM_000053.4(ATP7B):c.1877G>C (p.Gly626Ala) rs587783299
NM_000053.4(ATP7B):c.1995G>A (p.Met665Ile) rs72552259
NM_000053.4(ATP7B):c.19_20del (p.Gln7fs) rs749363958
NM_000053.4(ATP7B):c.2175G>A (p.Arg725=) rs61733684
NM_000053.4(ATP7B):c.2310C>G (p.Leu770=) rs398123136
NM_000053.4(ATP7B):c.2355+13T>G rs139211339
NM_000053.4(ATP7B):c.2972C>T (p.Thr991Met) rs41292782
NM_000053.4(ATP7B):c.3403G>A (p.Ala1135Thr) rs187200982
NM_000053.4(ATP7B):c.3557-6C>T rs140708492
NM_000053.4(ATP7B):c.3557-8C>T rs765668065
NM_000053.4(ATP7B):c.3620A>G (p.His1207Arg) rs7334118
NM_000053.4(ATP7B):c.3903+6C>T rs2282057
NM_000053.4(ATP7B):c.4058G>A (p.Trp1353Ter) rs193922110
NM_000053.4(ATP7B):c.4213G>A (p.Gly1405Ser) rs189601972
NM_000053.4(ATP7B):c.4301C>T (p.Thr1434Met) rs60986317
NM_000053.4(ATP7B):c.4311G>A (p.Lys1437=) rs73202048
NM_000057.4(BLM):c.1928G>A (p.Arg643His) rs12720097
NM_000057.4(BLM):c.3849G>A (p.Gln1283=) rs140524886
NM_000057.4(BLM):c.4076+4T>G rs183176301
NM_000059.3(BRCA2):c.10176del (p.Glu3393fs) rs80359258
NM_000059.3(BRCA2):c.1568A>G (p.His523Arg) rs80358443
NM_000059.3(BRCA2):c.1814T>C (p.Ile605Thr) rs80358468
NM_000059.3(BRCA2):c.2459A>G (p.Asp820Gly) rs80358511
NM_000059.3(BRCA2):c.2484T>C (p.Tyr828=) rs45619134
NM_000059.3(BRCA2):c.2817C>T (p.Thr939=) rs367921107
NM_000059.3(BRCA2):c.3420T>C (p.Ser1140=) rs118093942
NM_000059.3(BRCA2):c.3539A>G (p.Lys1180Arg) rs28897720
NM_000059.3(BRCA2):c.3568C>T (p.Arg1190Trp) rs80358604
NM_000059.3(BRCA2):c.3916G>A (p.Val1306Ile) rs80358636
NM_000059.3(BRCA2):c.4570T>G (p.Phe1524Val) rs56386506
NM_000059.3(BRCA2):c.4584C>T (p.Ser1528=) rs80359788
NM_000059.3(BRCA2):c.4686A>G (p.Gln1562=) rs28897730
NM_000059.3(BRCA2):c.5552T>G (p.Ile1851Ser) rs80358776
NM_000059.3(BRCA2):c.5700A>G (p.Ser1900=) rs730881591
NM_000059.3(BRCA2):c.6325G>A (p.Val2109Ile) rs79456940
NM_000059.3(BRCA2):c.6821G>T (p.Gly2274Val) rs55712212
NM_000059.3(BRCA2):c.7008-62A>G rs76584943
NM_000059.3(BRCA2):c.7413A>G (p.Thr2471=) rs138067005
NM_000059.3(BRCA2):c.7522G>A (p.Gly2508Ser) rs80358978
NM_000059.3(BRCA2):c.7601C>T (p.Ala2534Val) rs74047012
NM_000059.3(BRCA2):c.8124T>G (p.Thr2708=) rs587780662
NM_000059.3(BRCA2):c.8166A>G (p.Thr2722=) rs786201640
NM_000059.3(BRCA2):c.9285C>T (p.Asp3095=) rs80359198
NM_000059.3(BRCA2):c.943T>A (p.Cys315Ser) rs79483201
NM_000059.4(BRCA2):c.10202C>T (p.Thr3401Met) rs55853199
NM_000059.4(BRCA2):c.1151C>T (p.Ser384Phe) rs41293475
NM_000059.4(BRCA2):c.1385A>G (p.Glu462Gly) rs56403624
NM_000059.4(BRCA2):c.1395A>C (p.Val465=) rs11571641
NM_000059.4(BRCA2):c.1514T>C (p.Ile505Thr) rs28897708
NM_000059.4(BRCA2):c.162CAA[1] (p.Asn56del) rs11571587
NM_000059.4(BRCA2):c.1786G>C (p.Asp596His) rs56328701
NM_000059.4(BRCA2):c.1792A>G (p.Thr598Ala) rs28897710
NM_000059.4(BRCA2):c.1938C>T (p.Ser646=) rs28897711
NM_000059.4(BRCA2):c.223G>C (p.Ala75Pro) rs28897701
NM_000059.4(BRCA2):c.2803G>A (p.Asp935Asn) rs28897716
NM_000059.4(BRCA2):c.2883G>A (p.Gln961=) rs11571655
NM_000059.4(BRCA2):c.2919G>A (p.Ser973=) rs45525041
NM_000059.4(BRCA2):c.3055C>G (p.Leu1019Val) rs55638633
NM_000059.4(BRCA2):c.3516G>A (p.Ser1172=) rs1799952
NM_000059.4(BRCA2):c.4068G>A (p.Leu1356=) rs28897724
NM_000059.4(BRCA2):c.4187A>G (p.Gln1396Arg) rs55969723
NM_000059.4(BRCA2):c.4258G>T (p.Asp1420Tyr) rs28897727
NM_000059.4(BRCA2):c.4464_4465del (p.His1488fs) rs397507720
NM_000059.4(BRCA2):c.4928T>C (p.Val1643Ala) rs28897731
NM_000059.4(BRCA2):c.5199C>T (p.Ser1733=) rs28897734
NM_000059.4(BRCA2):c.5634C>G (p.Asn1878Lys) rs80358784
NM_000059.4(BRCA2):c.5645C>A (p.Ser1882Ter) rs80358785
NM_000059.4(BRCA2):c.5869A>G (p.Ile1957Val) rs80358817
NM_000059.4(BRCA2):c.5897A>G (p.His1966Arg) rs80358823
NM_000059.4(BRCA2):c.5946del (p.Ser1982fs) rs80359550
NM_000059.4(BRCA2):c.6100C>T (p.Arg2034Cys) rs1799954
NM_000059.4(BRCA2):c.6275_6276del rs11571658
NM_000059.4(BRCA2):c.6322C>T (p.Arg2108Cys) rs55794205
NM_000059.4(BRCA2):c.658_659del rs80359604
NM_000059.4(BRCA2):c.68-7T>A rs81002830
NM_000059.4(BRCA2):c.7448G>A (p.Ser2483Asn) rs80358967
NM_000059.4(BRCA2):c.7878G>C (p.Trp2626Cys) rs80359013
NM_000059.4(BRCA2):c.7879A>T (p.Ile2627Phe) rs80359014
NM_000059.4(BRCA2):c.8010G>A (p.Ser2670=) rs146430937
NM_000059.4(BRCA2):c.8182G>A (p.Val2728Ile) rs28897749
NM_000059.4(BRCA2):c.831T>G (p.Asn277Lys) rs28897705
NM_000059.4(BRCA2):c.8503T>C (p.Ser2835Pro) rs11571746
NM_000059.4(BRCA2):c.8567A>C (p.Glu2856Ala) rs11571747
NM_000059.4(BRCA2):c.8850G>T (p.Lys2950Asn) rs28897754
NM_000059.4(BRCA2):c.9038C>T (p.Thr3013Ile) rs28897755
NM_000059.4(BRCA2):c.9501+3A>T rs61757642
NM_000059.4(BRCA2):c.9586A>G (p.Lys3196Glu) rs80359228
NM_000059.4(BRCA2):c.9976A>T (p.Lys3326Ter) rs11571833
NM_000069.3(CACNA1S):c.1452C>T (p.Tyr484=) rs144206959
NM_000069.3(CACNA1S):c.1493G>A (p.Arg498His) rs150590855
NM_000069.3(CACNA1S):c.2440G>A (p.Ala814Thr) rs139956524
NM_000069.3(CACNA1S):c.3628G>A (p.Gly1210Arg) rs148870919
NM_000069.3(CACNA1S):c.3795+3G>A rs191758096
NM_000069.3(CACNA1S):c.398+3G>A rs764710968
NM_000069.3(CACNA1S):c.4060A>T (p.Thr1354Ser) rs145910245
NM_000069.3(CACNA1S):c.5048+8C>T rs759622507
NM_000069.3(CACNA1S):c.520C>T (p.Arg174Trp) rs772226819
NM_000070.3(CAPN3):c.1001A>T (p.His334Leu) rs749863676
NM_000070.3(CAPN3):c.1263G>A (p.Leu421=) rs372450879
NM_000070.3(CAPN3):c.1309C>T (p.Arg437Cys) rs777483913
NM_000070.3(CAPN3):c.145C>T (p.Arg49Cys) rs794726871
NM_000070.3(CAPN3):c.1543G>A (p.Gly515Arg) rs150226817
NM_000070.3(CAPN3):c.1621C>T (p.Arg541Trp) rs142004418
NM_000070.3(CAPN3):c.1668C>T (p.Ile556=) rs199884116
NM_000070.3(CAPN3):c.1745+4_1745+7del rs794727082
NM_000070.3(CAPN3):c.1746-20C>G rs201892814
NM_000070.3(CAPN3):c.2235C>T (p.Tyr745=) rs147774793
NM_000070.3(CAPN3):c.245C>T (p.Pro82Leu) rs886042478
NM_000070.3(CAPN3):c.552G>A (p.Thr184=) rs147808529
NM_000070.3(CAPN3):c.640G>A (p.Gly214Ser) rs369784333
NM_000075.4(CDK4):c.762C>T (p.Pro254=) rs753908111
NM_000077.4(CDKN2A):c.150+12G>A rs1057520264
NM_000077.4(CDKN2A):c.150+37G>C rs45456595
NM_000080.4(CHRNE):c.803-6_803-3del rs762704832
NM_000082.3(ERCC8):c.655G>C (p.Ala219Pro) rs150727525
NM_000082.4(ERCC8):c.839C>A rs61754098
NM_000083.3(CLCN1):c.1231G>T (p.Gly411Cys) rs756199349
NM_000083.3(CLCN1):c.1262G>A (p.Arg421His) rs780834658
NM_000083.3(CLCN1):c.1392C>T (p.Phe464=) rs201919331
NM_000083.3(CLCN1):c.1655A>G (p.Gln552Arg) rs80356696
NM_000083.3(CLCN1):c.2364+10G>A rs201855153
NM_000083.3(CLCN1):c.2680C>T (p.Arg894Ter) rs55960271
NM_000083.3(CLCN1):c.501C>G (p.Phe167Leu) rs149729531
NM_000083.3(CLCN1):c.568G>A (p.Gly190Arg) rs369773321
NM_000083.3(CLCN1):c.86A>C (p.His29Pro) rs146160029
NM_000083.3(CLCN1):c.899G>A (p.Arg300Gln) rs118066140
NM_000089.3(COL1A2):c.1866T>C (p.Gly622=) rs765470622
NM_000089.3(COL1A2):c.3313G>A (p.Gly1105Ser) rs139851311
NM_000089.3(COL1A2):c.3853A>C (p.Asn1285His) rs144797861
NM_000089.4(COL1A2):c.526T>C (p.Phe176Leu) rs370234887
NM_000089.4(COL1A2):c.594+5A>T rs200744314
NM_000090.3(COL3A1):c.1024G>A (p.Gly342Arg) rs794728040
NM_000090.3(COL3A1):c.114C>G (p.Ser38=) rs141241764
NM_000090.3(COL3A1):c.1188C>T (p.Gly396=) rs745743884
NM_000090.3(COL3A1):c.1461C>T (p.Ala487=) rs747522483
NM_000090.3(COL3A1):c.1804C>A (p.Pro602Thr) rs35795890
NM_000090.3(COL3A1):c.1927T>C (p.Leu643=) rs41263757
NM_000090.3(COL3A1):c.2035G>A (p.Ala679Thr) rs41263773
NM_000090.3(COL3A1):c.2805T>C (p.Pro935=) rs111567071
NM_000090.3(COL3A1):c.3642C>A (p.Gly1214=) rs184402915
NM_000090.3(COL3A1):c.3777T>C (p.Ala1259=) rs34781844
NM_000090.3(COL3A1):c.812G>A (p.Arg271Gln) rs112185887
NM_000090.4(COL3A1):c.2002C>A (p.Pro668Thr) rs1801183
NM_000090.4(COL3A1):c.3938A>G (p.Lys1313Arg) rs111840783
NM_000091.4(COL4A3):c.4421T>C (p.Leu1474Pro) rs200302125
NM_000091.4(COL4A3):c.898G>A (p.Gly300Arg) rs772708743
NM_000092.5(COL4A4):c.8C>T (p.Ser3Phe) rs201403066
NM_000094.3(COL7A1):c.3942dup (p.Asn1315fs) rs747912732
NM_000094.3(COL7A1):c.54G>C (p.Ala18=) rs35899847
NM_000094.4(COL7A1):c.5459C>G rs143037856
NM_000095.2(COMP):c.1417_1419dupGAC (p.Asp473_Asn474insAsp) rs193922900
NM_000095.3(COMP):c.1502G>A (p.Gly501Asp) rs1555791425
NM_000096.4(CP):c.2522C>G (p.Thr841Arg) rs56033670
NM_000098.3(CPT2):c.1602G>A (p.Glu534=) rs148110518
NM_000101.4(CYBA):c.179A>C (p.Lys60Thr) rs11547387
NM_000104.3(CYP1B1):c.1103G>A (p.Arg368His) rs79204362
NM_000104.3(CYP1B1):c.1294= (p.Leu432=) rs1056836
NM_000104.3(CYP1B1):c.1358A>G (p.Asn453Ser) rs1800440
NM_000104.3(CYP1B1):c.1590T>C (p.Asp530=) rs146770394
NM_000104.3(CYP1B1):c.241T>A (p.Tyr81Asn) rs9282671
NM_000104.3(CYP1B1):c.319C>G (p.Leu107Val) rs56339482
NM_000109.4(DMD):c.1294G>A (p.Glu432Lys) rs189143447
NM_000110.4(DPYD):c.1601G>A (p.Ser534Asn) rs1801158
NM_000110.4(DPYD):c.1905+1G>A rs3918290
NM_000110.4(DPYD):c.2846A>T (p.Asp949Val) rs67376798
NM_000113.3(TOR1A):c.990C>T (p.Tyr330=) rs148849547
NM_000116.5(TAFAZZIN):c.873G>A (p.Gly291=) rs35902788
NM_000117.2(EMD):c.445G>C (p.Asp149His) rs2070818
NM_000119.3(EPB42):c.642C>T (p.Phe214=) rs768899304
NM_000122.1(ERCC3):c.2111C>T (p.Ser704Leu) rs4150521
NM_000123.3(ERCC5):c.1789G>C (p.Val597Leu) rs4150319
NM_000123.3(ERCC5):c.2778C>G (p.Gly926=) rs9518857
NM_000124.4(ERCC6):c.1274A>C (p.Asp425Ala) rs4253046
NM_000124.4(ERCC6):c.150G>A (p.Val50=) rs80133923
NM_000124.4(ERCC6):c.207dup (p.Pro70fs) rs1554794641
NM_000124.4(ERCC6):c.3650T>G (p.Phe1217Cys) rs61760166
NM_000124.4(ERCC6):c.4063-1G>C rs766980240
NM_000124.4(ERCC6):c.4223A>C (p.Glu1408Ala) rs61760167
NM_000129.3(F13A1):c.103G>T (p.Val35Leu) rs5985
NM_000129.3(F13A1):c.1694C>T (p.Pro565Leu) rs5982
NM_000129.4(F13A1):c.1766T>A (p.Leu589Gln) rs5983
NM_000129.4(F13A1):c.2169C>T (p.Asp723=) rs5989
NM_000130.4(F5):c.1242A>G (p.Lys414=) rs6035
NM_000130.4(F5):c.2573A>G (p.Lys858Arg) rs4524
NM_000130.4(F5):c.2868T>C (p.Tyr956=) rs149067268
NM_000130.4(F5):c.5290A>G (p.Met1764Val) rs6030
NM_000130.5(F5):c.1601= (p.Arg534=) rs6025
NM_000131.4(F7):c.806-10T>C rs3093266
NM_000132.3(F8):c.102C>T (p.Asp34=) rs1800283
NM_000133.3(F9):c.819T>C (p.Val273=) rs1800455
NM_000133.3(F9):c.907C>T (p.His303Tyr) rs1801202
NM_000135.4(FANCA):c.2638C>G (p.Arg880Gly) rs762804216
NM_000135.4(FANCA):c.3391A>G (p.Thr1131Ala) rs574034197
NM_000135.4(FANCA):c.3412C>G (p.Leu1138Val) rs138417003
NM_000136.3(FANCC):c.1414G>A (p.Gly472Arg) rs201063698
NM_000136.3(FANCC):c.178G>A (p.Val60Ile) rs138629441
NM_000136.3(FANCC):c.584A>T (p.Asp195Val) rs1800365
NM_000136.3(FANCC):c.77C>T (p.Ser26Phe) rs1800361
NM_000137.4(FAH):c.1062+5G>A rs80338901
NM_000138.4(FBN1):c.1027G>A (p.Gly343Arg) rs146726731
NM_000138.4(FBN1):c.2723G>A (p.Cys908Tyr) rs1057523406
NM_000138.4(FBN1):c.3216C>T (p.Asp1072=) rs757177349
NM_000138.4(FBN1):c.4095C>T (p.Asp1365=) rs375402043
NM_000138.4(FBN1):c.4998C>G (p.Thr1666=) rs141925790
NM_000138.4(FBN1):c.6740A>G (p.Asp2247Gly) rs1060501032
NM_000138.4(FBN1):c.7056C>T (p.Ser2352=) rs149697299
NM_000138.4(FBN1):c.7204+7C>G rs371763964
NM_000138.4(FBN1):c.7902C>T (p.Pro2634=) rs138621371
NM_000138.4(FBN1):c.8005G>A (p.Gly2669Ser) rs794728281
NM_000138.4(FBN1):c.8521G>T (p.Glu2841Ter) rs587782948
NM_000138.4(FBN1):c.902G>T (p.Gly301Val) rs142888621
NM_000138.5(FBN1):c.184C>T (p.Arg62Cys) rs25403
NM_000138.5(FBN1):c.2895G>A (p.Glu965=) rs140591
NM_000138.5(FBN1):c.3294C>T (p.Asp1098=) rs140587
NM_000138.5(FBN1):c.510C>T (p.Tyr170=) rs111671429
NM_000138.5(FBN1):c.59A>G (p.Tyr20Cys) rs201309310
NM_000138.5(FBN1):c.6288C>T (p.Cys2096=) rs144822241
NM_000138.5(FBN1):c.6681A>C (p.Ser2227=) rs363824
NM_000138.5(FBN1):c.6700G>A (p.Val2234Met) rs112084407
NM_000138.5(FBN1):c.7379A>G (p.Lys2460Arg) rs144189837
NM_000142.4(FGFR3):c.1959+8C>T rs371666188
NM_000142.5(FGFR3):c.1752G>A (p.Pro584=) rs139020690
NM_000143.4(FH):c.1431_1433dup (p.Lys477dup) rs367543046
NM_000144.5(FXN):c.123C>T (p.Gly41=) rs1057519131
NM_000144.5(FXN):c.384+8T>C rs367974156
NM_000152.5(GAA):c.1593C>T (p.Asp531=) rs138732016
NM_000152.5(GAA):c.1920T>G (p.Pro640=) rs144090460
NM_000152.5(GAA):c.2152G>A (p.Val718Ile) rs141017311
NM_000152.5(GAA):c.2417C>T (p.Thr806Met) rs139850074
NM_000152.5(GAA):c.266G>A (p.Arg89His) rs200586324
NM_000153.4(GALC):c.1158_1161+6del rs759068540
NM_000153.4(GALC):c.329-10_329-8del rs770389075
NM_000153.4(GALC):c.334A>G (p.Thr112Ala) rs147313927
NM_000153.4(GALC):c.956A>G (p.Tyr319Cys) rs183105855
NM_000155.4(GALT):c.563A>G (p.Gln188Arg) rs75391579
NM_000156.6(GAMT):c.581T>C (p.Val194Ala) rs147739199
NM_000156.6(GAMT):c.79T>C (p.Tyr27His) rs200833152
NM_000157.3(GBA):c.1448T>C rs421016
NM_000157.4(GBA):c.1093G>A (p.Glu365Lys) rs2230288
NM_000157.4(GBA):c.1223C>T (p.Thr408Met) rs75548401
NM_000157.4(GBA):c.1226A>G (p.Asn409Ser) rs76763715
NM_000157.4(GBA):c.1227C>A (p.Asn409Lys) rs749227753
NM_000157.4(GBA):c.1505G>A (p.Arg502His) rs80356772
NM_000157.4(GBA):c.667T>C (p.Trp223Arg) rs61748906
NM_000157.4(GBA):c.701G>A (p.Gly234Glu) rs74462743
NM_000157.4(GBA):c.721G>A (p.Gly241Arg) rs409652
NM_000157.4(GBA):c.882T>G (p.His294Gln) rs367968666
NM_000157.4(GBA):c.928A>G (p.Ser310Gly) rs1057942
NM_000158.4(GBE1):c.2017G>A (p.Ala673Thr) rs193074572
NM_000158.4(GBE1):c.405C>T (p.Leu135=) rs139882066
NM_000159.4(GCDH):c.1143C>T (p.Ile381=) rs142553521
NM_000161.3(GCH1):c.195G>A (p.Glu65=) rs139350456
NM_000161.3(GCH1):c.206C>T (p.Pro69Leu) rs56127440
NM_000161.3(GCH1):c.610G>A (p.Val204Ile) rs200891969
NM_000161.3(GCH1):c.68C>T (p.Pro23Leu) rs41298432
NM_000162.5(GCK):c.1364T>A (p.Val455Glu) rs753795627
NM_000162.5(GCK):c.209-8G>A rs144798843
NM_000163.5(GHR):c.535C>T (p.Arg179Cys) rs121909362
NM_000166.6(GJB1):c.235C>T (p.Leu79=) rs144717157
NM_000166.6(GJB1):c.271G>A (p.Val91Met) rs756928158
NM_000166.6(GJB1):c.689G>T (p.Arg230Leu) rs780335726
NM_000167.5(GK):c.730-5A>T rs186543786
NM_000168.6(GLI3):c.2432-5T>C rs768250382
NM_000169.2(GLA):c.123C>T (p.Thr41=) rs137902198
NM_000169.3(GLA):c.129C>T (p.Gly43=) rs146177035
NM_000169.3(GLA):c.376A>G (p.Ser126Gly) rs149391489
NM_000169.3(GLA):c.427G>A (p.Ala143Thr) rs104894845
NM_000169.3(GLA):c.937G>T (p.Asp313Tyr) rs28935490
NM_000169.3(GLA):c.945C>T (p.Asp315=) rs151208856
NM_000170.2(GLDC):c.1705G>A (p.Ala569Thr) rs151268759
NM_000170.2(GLDC):c.2053-5C>G rs140877566
NM_000170.2(GLDC):c.2113G>A (p.Val705Met) rs147275962
NM_000170.2(GLDC):c.2380G>A (p.Ala794Thr) rs141933811
NM_000179.2(MSH6):c.-6G>T rs730881822
NM_000179.2(MSH6):c.-8C>T rs565211544
NM_000179.2(MSH6):c.1050C>T (p.Ala350=) rs730881802
NM_000179.2(MSH6):c.1449G>T (p.Val483=) rs35590297
NM_000179.2(MSH6):c.1508C>G (p.Ser503Cys) rs63750897
NM_000179.2(MSH6):c.1776A>T (p.Val592=) rs56132616
NM_000179.2(MSH6):c.1827A>G (p.Leu609=) rs767064953
NM_000179.2(MSH6):c.2314C>T (p.Arg772Trp) rs63750138
NM_000179.2(MSH6):c.2633T>C (p.Val878Ala) rs2020912
NM_000179.2(MSH6):c.3024C>T (p.Thr1008=) rs587780675
NM_000179.2(MSH6):c.3300G>A (p.Thr1100=) rs540252208
NM_000179.2(MSH6):c.3727A>T (p.Thr1243Ser) rs147453999
NM_000179.2(MSH6):c.660A>C (p.Glu220Asp) rs1800938
NM_000179.2(MSH6):c.957G>A (p.Thr319=) rs375210430
NM_000179.3(MSH6):c.1526T>C (p.Val509Ala) rs63751005
NM_000179.3(MSH6):c.2561A>T (p.Lys854Met) rs34374438
NM_000179.3(MSH6):c.3217C>T (p.Pro1073Ser) rs142254875
NM_000179.3(MSH6):c.3245C>T (p.Pro1082Leu) rs191109849
NM_000179.3(MSH6):c.3246G>T (p.Pro1082=) rs3136351
NM_000179.3(MSH6):c.3964G>T rs1553333707
NM_000179.3(MSH6):c.3986C>T (p.Ser1329Leu) rs199594809
NM_000179.3(MSH6):c.4001+2TAAC[2] rs267608132
NM_000179.3(MSH6):c.4002-10T>A rs545466048
NM_000179.3(MSH6):c.663A>C (p.Glu221Asp) rs41557217
NM_000179.3(MSH6):c.884A>G (p.Lys295Arg) rs267608051
NM_000180.3(GUCY2D):c.129_134delTCTGCT (p.Leu44_Leu45del) rs552184470
NM_000180.4(GUCY2D):c.1537C>T (p.Leu513Phe) rs61749682
NM_000180.4(GUCY2D):c.2513G>A (p.Arg838His) rs61750173
NM_000180.4(GUCY2D):c.271G>C (p.Ala91Pro) rs573367793
NM_000182.5(HADHA):c.-1G>T rs72809666
NM_000182.5(HADHA):c.1212G>C (p.Val404=) rs116396996
NM_000182.5(HADHA):c.1981C>T (p.Leu661=) rs142348718
NM_000182.5(HADHA):c.2107G>A (p.Gly703Arg) rs200438844
NM_000182.5(HADHA):c.2175C>T (p.Gly725=) rs375399631
NM_000185.4(SERPIND1):c.842T>C (p.Ile281Thr) rs145370736
NM_000186.3(CFH):c.2850G>T (p.Gln950His) rs149474608
NM_000188.3(HK1):c.1370C>T (p.Thr457Met) rs1057517928
NM_000188.3(HK1):c.1515C>T (p.Asn505=) rs140498607
NM_000188.3(HK1):c.828G>A (p.Glu276=) rs41279658
NM_000199.5(SGSH):c.220C>T (p.Arg74Cys) rs104894636
NM_000202.8(IDS):c.1074C>G (p.Pro358=) rs61736891
NM_000202.8(IDS):c.754G>A (p.Asp252Asn) rs146458524
NM_000207.3(INS):c.72C>A (p.Ala24=)
NM_000208.4(INSR):c.888G>A (p.Ser296=) rs2229428
NM_000213.5(ITGB4):c.2929C>T (p.Arg977Cys) rs145976111
NM_000214.3(JAG1):c.601C>T (p.Arg201Cys) rs794727618
NM_000218.3(KCNQ1):c.-5T>C rs532941548
NM_000218.3(KCNQ1):c.1179G>T (p.Lys393Asn) rs12720457
NM_000218.3(KCNQ1):c.1514+7G>T rs372593469
NM_000218.3(KCNQ1):c.1860C>T (p.His620=) rs139893266
NM_000218.3(KCNQ1):c.328G>A (p.Val110Ile) rs199472677
NM_000218.3(KCNQ1):c.459G>A (p.Thr153=) rs148121889
NM_000218.3(KCNQ1):c.811C>T (p.Leu271=) rs189991547
NM_000219.6(KCNE1):c.226G>A (p.Asp76Asn) rs74315445
NM_000219.6(KCNE1):c.253G>A (p.Asp85Asn) rs1805128
NM_000219.6(KCNE1):c.292C>T (p.Arg98Trp) rs199473362
NM_000219.6(KCNE1):c.30G>A (p.Thr10=) rs187686559
NM_000219.6(KCNE1):c.84G>A (p.Ser28=) rs17173510
NM_000227.5(LAMA3):c.1562C>T (p.Ser521Phe) rs199684626
NM_000227.5(LAMA3):c.3201C>T (p.Asn1067=) rs35737354
NM_000227.5(LAMA3):c.3242A>G (p.Gln1081Arg) rs147208526
NM_000232.4(SGCB):c.31C>T (p.Gln11Ter) rs752492870
NM_000232.4(SGCB):c.943G>A (p.Gly315Arg) rs150395645
NM_000238.4(KCNH2):c.2738C>T (p.Ala913Val) rs77331749
NM_000238.4(KCNH2):c.2750C>T (p.Pro917Leu) rs76420733
NM_000238.4(KCNH2):c.3348G>A (p.Ala1116=) rs376180501
NM_000238.4(KCNH2):c.551GCGCGGGCG[1] (p.184GAG[1]) rs551056698
NM_000243.2(MEFV):c.1043G>A (p.Arg348His) rs104895198
NM_000243.2(MEFV):c.1437C>G (p.Phe479Leu) rs104895083
NM_000243.2(MEFV):c.1467G>A (p.Gln489=) rs61732424
NM_000243.2(MEFV):c.1772T>C (p.Ile591Thr) rs11466045
NM_000243.2(MEFV):c.2084A>G rs104895094
NM_000243.2(MEFV):c.2230G>T rs61732874
NM_000243.2(MEFV):c.2292G>T (p.Gly764=) rs142352887
NM_000243.2(MEFV):c.501G>C (p.Glu167Asp) rs104895079
NM_000243.2(MEFV):c.800C>T (p.Thr267Ile) rs104895081
NM_000243.2(MEFV):c.986G>A (p.Arg329His) rs104895112
NM_000243.3(MEFV):c.1105C>T rs11466023
NM_000243.3(MEFV):c.1223G>A rs11466024
NM_000243.3(MEFV):c.2282G>A (p.Arg761His) rs104895097
NM_000243.3(MEFV):c.374AGGGGAACG[3] (p.125EGN[3]) rs104895121
NM_000243.3(MEFV):c.442G>C rs3743930
NM_000244.3(MEN1):c.1201-6G>A rs576193460
NM_000244.3(MEN1):c.1311G>A (p.Leu437=) rs138770431
NM_000244.3(MEN1):c.30G>T (p.Leu10=) rs371192390
NM_000245.4(MET):c.2908C>T (p.Arg970Cys) rs34589476
NM_000245.4(MET):c.2975C>T (p.Thr992Ile) rs56391007
NM_000245.4(MET):c.607T>A (p.Ser203Thr) rs200861145
NM_000249.3(MLH1):c.1401C>T (p.Ser467=) rs587778910
NM_000249.3(MLH1):c.1744C>T (p.Leu582Phe) rs63751713
NM_000249.3(MLH1):c.198C>T (p.Thr66=) rs61751642
NM_000249.3(MLH1):c.277A>G (p.Ser93Gly) rs41295282
NM_000249.3(MLH1):c.375A>G (p.Ala125=) rs1800144
NM_000249.3(MLH1):c.702G>A (p.Glu234=) rs35908749
NM_000249.4(MLH1):c.-28A>G rs56198082
NM_000249.4(MLH1):c.1013A>G (p.Asn338Ser) rs63751467
NM_000249.4(MLH1):c.1217G>A (p.Ser406Asn) rs41294980
NM_000249.4(MLH1):c.1321G>A (p.Ala441Thr) rs63750365
NM_000249.4(MLH1):c.1360G>C (p.Gly454Arg) rs63750527
NM_000249.4(MLH1):c.1852A>G (p.Lys618Glu) rs35001569
NM_000249.4(MLH1):c.191A>G (p.Asn64Ser) rs63750952
NM_000249.4(MLH1):c.2066A>G (p.Gln689Arg) rs63750702
NM_000249.4(MLH1):c.649C>T (p.Arg217Cys) rs4986984
NM_000249.4(MLH1):c.677G>T (p.Arg226Leu) rs63751711
NM_000249.4(MLH1):c.977T>C (p.Val326Ala) rs63751049
NM_000250.2(MPO):c.1555_1568del (p.Met519fs) rs536522394
NM_000250.2(MPO):c.1705C>T (p.Arg569Trp) rs119468010
NM_000251.2(MSH2):c.1255C>A (p.Gln419Lys) rs63750006
NM_000251.2(MSH2):c.1275A>G (p.Glu425=) rs63751650
NM_000251.2(MSH2):c.1387-8G>T rs187525243
NM_000251.2(MSH2):c.1666T>C (p.Leu556=) rs61756466
NM_000251.2(MSH2):c.1680T>C (p.Asn560=) rs200056411
NM_000251.2(MSH2):c.1737A>G (p.Lys579=) rs61756467
NM_000251.2(MSH2):c.1748A>G (p.Asn583Ser) rs201118107
NM_000251.2(MSH2):c.1886A>G (p.Gln629Arg) rs61756468
NM_000251.2(MSH2):c.211+8C>T rs267607916
NM_000251.2(MSH2):c.2154A>G (p.Gln718=) rs63750810
NM_000251.2(MSH2):c.2164G>A (p.Val722Ile) rs587781996
NM_000251.2(MSH2):c.2425G>A (p.Glu809Lys) rs202145681
NM_000251.2(MSH2):c.505A>G (p.Ile169Val) rs63750716
NM_000251.2(MSH2):c.557A>G (p.Asn186Ser) rs151129360
NM_000251.3(MSH2):c.1563T>C (p.Tyr521=) rs63750330
NM_000251.3(MSH2):c.1730T>C (p.Ile577Thr) rs63749910
NM_000251.3(MSH2):c.1787A>G (p.Asn596Ser) rs41295288
NM_000251.3(MSH2):c.339G>A (p.Lys113=) rs35898375
NM_000251.3(MSH2):c.645+2T>C rs876658996
NM_000253.3(MTTP):c.2673C>T (p.Ser891=) rs115222767
NM_000254.2(MTR):c.1076-8C>T rs115186224
NM_000255.4(MMUT):c.1629C>T (p.Ser543=) rs150642856
NM_000256.3(MYBPC3):c.12G>A (p.Pro4=) rs377292092
NM_000256.3(MYBPC3):c.1321G>A (p.Glu441Lys) rs193922377
NM_000256.3(MYBPC3):c.1484G>A (p.Arg495Gln) rs200411226
NM_000256.3(MYBPC3):c.1519G>A (p.Gly507Arg) rs35736435
NM_000256.3(MYBPC3):c.1720C>A (p.Arg574=) rs61897383
NM_000256.3(MYBPC3):c.1828G>C (p.Asp610His) rs371564200
NM_000256.3(MYBPC3):c.246T>C (p.Ile82=) rs372502369
NM_000256.3(MYBPC3):c.2497G>A (p.Ala833Thr) rs199865688
NM_000256.3(MYBPC3):c.2870C>G (p.Thr957Ser) rs193922380
NM_000256.3(MYBPC3):c.2873C>T (p.Thr958Ile) rs376504548
NM_000256.3(MYBPC3):c.2905+1G>A rs397515991
NM_000256.3(MYBPC3):c.3190+5G>A rs587782958
NM_000256.3(MYBPC3):c.3392T>C (p.Ile1131Thr) rs370890951
NM_000256.3(MYBPC3):c.3657G>T (p.Leu1219=) rs770157084
NM_000256.3(MYBPC3):c.442G>A (p.Gly148Arg) rs397516050
NM_000256.3(MYBPC3):c.471C>T (p.Phe157=) rs150291001
NM_000256.3(MYBPC3):c.501C>T (p.Thr167=) rs397516054
NM_000256.3(MYBPC3):c.709T>C (p.Tyr237His) rs730880624
NM_000256.3(MYBPC3):c.821+1G>A rs397516073
NM_000256.3(MYBPC3):c.906-7G>T rs397516079
NM_000256.3(MYBPC3):c.926+8C>T rs377595584
NM_000256.3(MYBPC3):c.977G>A (p.Arg326Gln) rs34580776
NM_000257.4(MYH7):c.1191G>A (p.Lys397=) rs139506719
NM_000257.4(MYH7):c.1324C>T (p.Arg442Cys) rs148808089
NM_000257.4(MYH7):c.1749C>T (p.Ala583=) rs758665829
NM_000257.4(MYH7):c.2168G>A (p.Arg723His) rs397516135
NM_000257.4(MYH7):c.2302G>A (p.Gly768Arg) rs727503260
NM_000257.4(MYH7):c.2332G>A (p.Asp778Asn) rs730880895
NM_000257.4(MYH7):c.2348G>A (p.Arg783His) rs397516142
NM_000257.4(MYH7):c.2769C>T (p.Asn923=) rs36211716
NM_000257.4(MYH7):c.2890G>C (p.Val964Leu) rs45496496
NM_000257.4(MYH7):c.2945T>C (p.Met982Thr) rs145532615
NM_000257.4(MYH7):c.3036C>T (p.Ala1012=) rs145379951
NM_000257.4(MYH7):c.3153G>A (p.Ala1051=) rs45540831
NM_000257.4(MYH7):c.3351G>A (p.Glu1117=) rs45554236
NM_000257.4(MYH7):c.3853+7C>T rs45467397
NM_000257.4(MYH7):c.3981C>A (p.Asn1327Lys) rs141764279
NM_000257.4(MYH7):c.4145G>A (p.Arg1382Gln) rs727504325
NM_000257.4(MYH7):c.4293C>T (p.Asp1431=) rs45560242
NM_000257.4(MYH7):c.4353+6C>T rs765398896
NM_000257.4(MYH7):c.4659C>T (p.His1553=) rs570079347
NM_000257.4(MYH7):c.4806C>T (p.Asp1602=) rs142034311
NM_000257.4(MYH7):c.5561C>T (p.Thr1854Met) rs372381770
NM_000257.4(MYH7):c.5661G>A (p.Glu1887=) rs730880727
NM_000257.4(MYH7):c.5690G>A (p.Arg1897His) rs727503240
NM_000257.4(MYH7):c.5726G>A (p.Arg1909Gln) rs397516253
NM_000257.4(MYH7):c.610C>T (p.Arg204Cys) rs397516259
NM_000258.3(MYL3):c.170C>A (p.Ala57Asp) rs139794067
NM_000258.3(MYL3):c.81T>C (p.Pro27=) rs147584015
NM_000259.3(MYO5A):c.2814G>A (p.Glu938=) rs190656197
NM_000259.3(MYO5A):c.3136G>A (p.Val1046Met) rs56132571
NM_000259.3(MYO5A):c.4357C>T (p.Pro1453Ser) rs147898420
NM_000260.4(MYO7A):c.1190C>A (p.Ala397Asp) rs1555067667
NM_000260.4(MYO7A):c.1554+8G>A rs111033227
NM_000260.4(MYO7A):c.2476G>A (p.Ala826Thr) rs368341987
NM_000260.4(MYO7A):c.2798G>A (p.Arg933His) rs201489714
NM_000260.4(MYO7A):c.285+2T>G rs782292032
NM_000260.4(MYO7A):c.2886G>C (p.Gln962His) rs200641606
NM_000260.4(MYO7A):c.3503G>A (p.Arg1168Gln) rs797044516
NM_000260.4(MYO7A):c.3723A>T (p.Thr1241=) rs767426033
NM_000260.4(MYO7A):c.3978C>T (p.Cys1326=) rs111033376
NM_000260.4(MYO7A):c.448C>A (p.Arg150=) rs121965079
NM_000260.4(MYO7A):c.4505A>G (p.Asp1502Gly) rs757460257
NM_000260.4(MYO7A):c.486C>T (p.Ala162=) rs367687624
NM_000260.4(MYO7A):c.5494C>A (p.Arg1832=) rs748080151
NM_000260.4(MYO7A):c.5598C>A (p.Leu1866=) rs111033504
NM_000260.4(MYO7A):c.5772C>A (p.Ala1924=) rs749438001
NM_000260.4(MYO7A):c.5866G>A (p.Val1956Ile) rs142293185
NM_000260.4(MYO7A):c.803A>G (p.Lys268Arg) rs184866544
NM_000260.4(MYO7A):c.905G>A (p.Arg302His) rs41298135
NM_000261.2(MYOC):c.1193A>G (p.Lys398Arg) rs56314834
NM_000261.2(MYOC):c.227G>A (p.Arg76Lys) rs2234926
NM_000261.2(MYOC):c.855G>T (p.Thr285=) rs146606638
NM_000263.4(NAGLU):c.889C>T (p.Arg297Ter) rs104894592
NM_000264.5(PTCH1):c.114del (p.Leu39fs) rs751977093
NM_000264.5(PTCH1):c.1306G>A (p.Asp436Asn) rs142274954
NM_000264.5(PTCH1):c.2634C>T (p.Asp878=) rs771732591
NM_000264.5(PTCH1):c.3890G>A (p.Arg1297Gln) rs386833412
NM_000264.5(PTCH1):c.3947A>G (p.Tyr1316Cys) rs147067171
NM_000267.3(NF1):c.1296G>A (p.Val432=) rs371599283
NM_000267.3(NF1):c.2294G>A (p.Arg765His) rs199474777
NM_000267.3(NF1):c.2622G>A (p.Lys874=) rs77917884
NM_000267.3(NF1):c.31C>T (p.Gln11Ter) rs876658658
NM_000267.3(NF1):c.4111-8_4111-6del rs751729752
NM_000271.5(NPC1):c.2972_2973del (p.Gln991fs) rs756815030
NM_000271.5(NPC1):c.2974G>C (p.Gly992Arg) rs80358254
NM_000271.5(NPC1):c.3217G>A (p.Gly1073Ser) rs141440861
NM_000271.5(NPC1):c.3331C>T (p.Leu1111=) rs151125564
NM_000271.5(NPC1):c.3561G>T (p.Ala1187=) rs55724504
NM_000271.5(NPC1):c.665A>G (p.Asn222Ser) rs55680026
NM_000272.4(NPHP1):c.1035A>G (p.Gln345=) rs371112962
NM_000275.3(OCA2):c.1441G>A (p.Ala481Thr) rs74653330
NM_000275.3(OCA2):c.2037G>C (p.Trp679Cys) rs121918169
NM_000275.3(OCA2):c.574-19A>G rs145242923
NM_000275.3(OCA2):c.619_636del (p.Leu207_Leu212del) rs767489236
NM_000277.3(PAH):c.1139C>T (p.Thr380Met) rs62642937
NM_000277.3(PAH):c.1243G>A (p.Asp415Asn) rs62644499
NM_000277.3(PAH):c.169G>A (p.Glu57Lys) rs140945592
NM_000277.3(PAH):c.506G>A (p.Arg169His) rs199475679
NM_000277.3(PAH):c.520A>G (p.Ile174Val) rs199475632
NM_000277.3(PAH):c.688G>A (p.Val230Ile) rs62516152
NM_000278.5(PAX2):c.357G>T (p.Leu119=) rs543423053
NM_000278.5(PAX2):c.360C>T (p.Ala120=) rs41291450
NM_000280.4(PAX6):c.423C>G (p.Gly141=) rs139803630
NM_000283.3(PDE6B):c.1107+3A>G rs370898371
NM_000283.3(PDE6B):c.655T>C (p.Tyr219His) rs62295357
NM_000283.3(PDE6B):c.928-9_940dup rs539992414
NM_000283.4(PDE6B):c.1920+2T>C
NM_000284.4(PDHA1):c.491A>G (p.Asn164Ser) rs1555933963
NM_000286.3(PEX12):c.959C>T (p.Ser320Phe) rs28936697
NM_000287.4(PEX6):c.1802G>A (p.Arg601Gln) rs34324426
NM_000288.4(PEX7):c.377A>C (p.Gln126Pro) rs113268723
NM_000291.4(PGK1):c.1188T>A (p.Gly396=) rs782667719
NM_000291.4(PGK1):c.1234G>A (p.Asp412Asn) rs782165735
NM_000294.3(PHKG2):c.324C>T (p.Asp108=) rs138416154
NM_000302.4(PLOD1):c.1203-3C>T rs376288573
NM_000302.4(PLOD1):c.1534C>T (p.Arg512Cys) rs138490756
NM_000302.4(PLOD1):c.1927G>A (p.Val643Ile) rs149425237
NM_000302.4(PLOD1):c.555G>T (p.Lys185Asn) rs142978362
NM_000303.3(PMM2):c.91T>C (p.Phe31Leu) rs749720760
NM_000304.4(PMP22):c.152A>G (p.His51Arg) rs368908933
NM_000304.4(PMP22):c.178+7C>A rs147885521
NM_000304.4(PMP22):c.320-4C>T rs377467465
NM_000304.4(PMP22):c.353C>T (p.Thr118Met) rs104894619
NM_000304.4(PMP22):c.79-6C>T rs201682989
NM_000312.3(PROC):c.1216A>G (p.Met406Val) rs1553425459
NM_000312.3(PROC):c.169C>T (p.Arg57Trp) rs757583846
NM_000312.3(PROC):c.565C>T (p.Arg189Trp) rs146922325
NM_000314.7(PTEN):c.132C>T (p.Gly44=) rs150651961
NM_000314.7(PTEN):c.579G>A (p.Leu193=) rs568851024
NM_000314.7(PTEN):c.855A>G (p.Glu285=) rs751888926
NM_000314.8(PTEN):c.464A>G (p.Tyr155Cys) rs1060500126
NM_000316.3(PTH1R):c.1305G>A (p.Thr435=) rs142921504
NM_000316.3(PTH1R):c.436C>A (p.Arg146=) rs143863124
NM_000318.3(PEX2):c.748T>C (p.Trp250Arg) rs142645936
NM_000321.2(RB1):c.1770T>C (p.Cys590=) rs145310579
NM_000321.2(RB1):c.1966C>T (p.Arg656Trp) rs142509759
NM_000322.5(PRPH2):c.331del (p.Ile111fs) rs1562434099
NM_000322.5(PRPH2):c.499G>A (p.Gly167Ser) rs527236098
NM_000322.5(PRPH2):c.514C>T (p.Arg172Trp) rs61755792
NM_000322.5(PRPH2):c.628C>T (p.Pro210Ser) rs61755797
NM_000322.5(PRPH2):c.653C>T (p.Ser218Leu) rs986748364
NM_000322.5(PRPH2):c.715C>T (p.Gln239Ter) rs61755814
NM_000322.5(PRPH2):c.866C>T (p.Ser289Leu) rs62645939
NM_000326.5(RLBP1):c.141+6G>A rs181321141
NM_000328.3(RPGR):c.732G>A (p.Lys244=) rs62638654
NM_000334.4(SCN4A):c.1100+7G>A rs200770684
NM_000334.4(SCN4A):c.1902C>T (p.Pro634=) rs368811155
NM_000334.4(SCN4A):c.2697G>A (p.Leu899=) rs199827271
NM_000334.4(SCN4A):c.2854-5C>T rs374039266
NM_000334.4(SCN4A):c.3466G>A (p.Ala1156Thr) rs80338958
NM_000334.4(SCN4A):c.403A>C (p.Met135Leu) rs148028364
NM_000334.4(SCN4A):c.4215C>T (p.Leu1405=) rs141215137
NM_000334.4(SCN4A):c.4364T>C (p.Ile1455Thr)
NM_000334.4(SCN4A):c.5113T>A (p.Phe1705Ile) rs1064794243
NM_000334.4(SCN4A):c.5367G>A (p.Ser1789=) rs189230866
NM_000334.4(SCN4A):c.5468C>G (p.Pro1823Arg) rs376833596
NM_000334.4(SCN4A):c.952T>C (p.Trp318Arg) rs199676994
NM_000335.5(SCN5A):c.1044C>T (p.Pro348=) rs370346797
NM_000335.5(SCN5A):c.1587T>C (p.Ile529=) rs45624133
NM_000335.5(SCN5A):c.1681C>T (p.Leu561=) rs45522138
NM_000335.5(SCN5A):c.1844G>A (p.Gly615Glu) rs12720452
NM_000335.5(SCN5A):c.3875T>C (p.Phe1292Ser) rs41311127
NM_000335.5(SCN5A):c.3904C>A (p.Arg1302=) rs200334972
NM_000335.5(SCN5A):c.4506C>T (p.Ser1502=) rs45548237
NM_000335.5(SCN5A):c.4821C>T (p.Leu1607=) rs45437099
NM_000335.5(SCN5A):c.5199C>T (p.Asn1733=) rs368980118
NM_000335.5(SCN5A):c.5357G>A (p.Ser1786Asn) rs199473316
NM_000335.5(SCN5A):c.5848G>T (p.Val1950Leu) rs41315493
NM_000335.5(SCN5A):c.5882C>T (p.Pro1961Leu) rs199473638
NM_000335.5(SCN5A):c.6007T>C (p.Phe2003Leu) rs41311117
NM_000335.5(SCN5A):c.6013C>G (p.Pro2005Ala) rs45489199
NM_000335.5(SCN5A):c.659C>T (p.Thr220Ile) rs45620037
NM_000335.5(SCN5A):c.717C>T (p.Ile239=) rs41285129
NM_000337.5(SGCD):c.213G>A (p.Arg71=) rs74846539
NM_000337.5(SGCD):c.451T>G (p.Ser151Ala) rs121909298
NM_000338.3(SLC12A1):c.3096+7A>T rs200662267
NM_000342.3(SLC4A1):c.118G>A (p.Glu40Lys) rs45562031
NM_000342.4(SLC4A1):c.2701C>T (p.Arg901Trp) rs201265160
NM_000346.4(SOX9):c.685+7C>T rs370951695
NM_000349.3(STAR):c.120G>A (p.Leu40=) rs138786388
NM_000349.3(STAR):c.361C>T (p.Arg121Trp) rs34908868
NM_000350.2(ABCA4):c.2588G>C rs76157638
NM_000350.2(ABCA4):c.5882G>A rs1800553
NM_000350.3(ABCA4):c.1140T>A (p.Asn380Lys) rs61748549
NM_000350.3(ABCA4):c.1268A>G (p.His423Arg) rs3112831
NM_000350.3(ABCA4):c.1532G>A (p.Arg511His) rs140482171
NM_000350.3(ABCA4):c.1622T>C (p.Leu541Pro) rs61751392
NM_000350.3(ABCA4):c.1654G>A (p.Val552Ile) rs145525174
NM_000350.3(ABCA4):c.1807T>C (p.Tyr603His) rs1064793006
NM_000350.3(ABCA4):c.1928T>G (p.Val643Gly) rs61754024
NM_000350.3(ABCA4):c.1957C>T (p.Arg653Cys) rs61749420
NM_000350.3(ABCA4):c.1958G>A (p.Arg653His) rs141823837
NM_000350.3(ABCA4):c.2023G>A (p.Val675Ile) rs575453437
NM_000350.3(ABCA4):c.214G>A (p.Gly72Arg) rs61751412
NM_000350.3(ABCA4):c.2300T>A (p.Val767Asp) rs61751395
NM_000350.3(ABCA4):c.2588-12C>G rs61751396
NM_000350.3(ABCA4):c.2690C>T (p.Thr897Ile) rs61749440
NM_000350.3(ABCA4):c.2875A>T (p.Thr959Ser) rs368846708
NM_000350.3(ABCA4):c.2877C>T (p.Thr959=) rs61754033
NM_000350.3(ABCA4):c.2948C>T (p.Thr983Ile) rs61752411
NM_000350.3(ABCA4):c.2966T>C (p.Val989Ala) rs61749454
NM_000350.3(ABCA4):c.3113C>T (p.Ala1038Val) rs61751374
NM_000350.3(ABCA4):c.3292C>T (p.Arg1098Cys) rs756840095
NM_000350.3(ABCA4):c.3482G>A (p.Arg1161His) rs768278935
NM_000350.3(ABCA4):c.3608G>A (p.Gly1203Glu) rs146786552
NM_000350.3(ABCA4):c.4070C>A (p.Ala1357Glu) rs552517556
NM_000350.3(ABCA4):c.4139C>T (p.Pro1380Leu) rs61750130
NM_000350.3(ABCA4):c.4246TTC[1] (p.Phe1417del)
NM_000350.3(ABCA4):c.4297G>A (p.Val1433Ile) rs56357060
NM_000350.3(ABCA4):c.4538A>G (p.Gln1513Arg) rs281865402
NM_000350.3(ABCA4):c.4539+2064C>T rs1553189179
NM_000350.3(ABCA4):c.455G>A (p.Arg152Gln) rs62646862
NM_000350.3(ABCA4):c.4578G>A (p.Thr1526=) rs138831474
NM_000350.3(ABCA4):c.463G>A (p.Asp155Asn) rs1570426424
NM_000350.3(ABCA4):c.466A>G (p.Ile156Val) rs62646863
NM_000350.3(ABCA4):c.4685T>C (p.Ile1562Thr) rs1762111
NM_000350.3(ABCA4):c.4771G>A (p.Gly1591Arg) rs113106943
NM_000350.3(ABCA4):c.5077G>A (p.Val1693Ile) rs61750563
NM_000350.3(ABCA4):c.5318C>T (p.Ala1773Val) rs760549861
NM_000350.3(ABCA4):c.5338C>G (p.Pro1780Ala) rs121909207
NM_000350.3(ABCA4):c.5461-10T>C rs1800728
NM_000350.3(ABCA4):c.5527C>T (p.Arg1843Trp) rs62642576
NM_000350.3(ABCA4):c.5603A>T (p.Asn1868Ile) rs1801466
NM_000350.3(ABCA4):c.5693G>A (p.Arg1898His) rs1800552
NM_000350.3(ABCA4):c.571-1G>T rs61748533
NM_000350.3(ABCA4):c.5774G>T (p.Arg1925Ile) rs1208195953
NM_000350.3(ABCA4):c.5908C>T (p.Leu1970Phe) rs28938473
NM_000350.3(ABCA4):c.6089G>A (p.Arg2030Gln) rs61750641
NM_000350.3(ABCA4):c.6148G>C (p.Val2050Leu) rs41292677
NM_000350.3(ABCA4):c.6529G>A (p.Asp2177Asn) rs1800555
NM_000350.3(ABCA4):c.656G>C (p.Arg219Thr) rs61748537
NM_000350.3(ABCA4):c.6729+5_6729+19del rs749526785
NM_000350.3(ABCA4):c.6730-19G>A rs375179475
NM_000350.3(ABCA4):c.768G>T (p.Val256=) rs62645944
NM_000355.4(TCN2):c.280G>A (p.Gly94Ser) rs11557600
NM_000359.3(TGM1):c.125C>A (p.Ser42Tyr) rs41295338
NM_000360.4(TH):c.16G>A (p.Ala6Thr) rs74555599
NM_000361.2(THBD):c.127G>A (p.Ala43Thr) rs1800576
NM_000361.2(THBD):c.1502C>T (p.Pro501Leu) rs1800579
NM_000361.3(THBD):c.282C>G (p.Pro94=) rs538290084
NM_000363.5(TNNI3):c.151-6C>G rs377258542
NM_000363.5(TNNI3):c.493G>T (p.Glu165Ter) rs1057521530
NM_000364.3(TNNT2):c.113C>T (p.Ala38Val) rs200754249
NM_000368.4(TSC1):c.1208C>T (p.Ser403Leu) rs118203504
NM_000368.4(TSC1):c.1460C>G (p.Ser487Cys) rs118203532
NM_000368.4(TSC1):c.1977G>A (p.Ala659=) rs35958226
NM_000368.4(TSC1):c.346T>G (p.Leu116Val) rs199620268
NM_000368.4(TSC1):c.532G>A (p.Val178Ile) rs118203395
NM_000368.4(TSC1):c.782A>G (p.Lys261Arg) rs371225009
NM_000368.5(TSC1):c.2285A>G (p.Asn762Ser) rs118203670
NM_000368.5(TSC1):c.3184C>T (p.Arg1062Trp) rs118203745
NM_000371.3(TTR):c.379A>G (p.Ile127Val) rs121918089
NM_000371.3(TTR):c.88T>C (p.Cys30Arg) rs121918083
NM_000371.4(TTR):c.14G>A (p.Arg5His) rs138657343
NM_000371.4(TTR):c.328C>A (p.His110Asn) rs121918074
NM_000371.4(TTR):c.354C>T (p.Asn118=) rs11541797
NM_000371.4(TTR):c.416C>T (p.Thr139Met) rs28933981
NM_000372.5(TYR):c.1209G>T (p.Arg403Ser) rs104894316
NM_000377.2(WAS):c.538C>A (p.His180Asn) rs145040665
NM_000380.4(XPA):c.545_546dup (p.Lys183Ter)
NM_000382.3(ALDH3A2):c.1270C>T (p.Pro424Ser) rs61737992
NM_000382.3(ALDH3A2):c.28C>G (p.Gln10Glu) rs72547554
NM_000383.4(AIRE):c.1567-5C>T rs192215705
NM_000384.3(APOB):c.10131G>A (p.Leu3377=) rs1799812
NM_000384.3(APOB):c.10740C>T (p.Asn3580=) rs150312765
NM_000384.3(APOB):c.11319G>A (p.Lys3773=) rs780811733
NM_000384.3(APOB):c.11401T>A (p.Ser3801Thr)
NM_000384.3(APOB):c.11477C>T (p.Thr3826Met)
NM_000384.3(APOB):c.11833A>G (p.Thr3945Ala) rs1801698
NM_000384.3(APOB):c.12016G>A (p.Val4006Ile) rs183117027
NM_000384.3(APOB):c.12382G>A (p.Val4128Met)
NM_000384.3(APOB):c.12794T>C (p.Val4265Ala) rs61743502
NM_000384.3(APOB):c.12940A>G (p.Ile4314Val)
NM_000384.3(APOB):c.13680T>C (p.Thr4560=) rs72654427
NM_000384.3(APOB):c.2068-4T>A rs41291161
NM_000384.3(APOB):c.2188G>A (p.Val730Ile)
NM_000384.3(APOB):c.3383G>A (p.Arg1128His) rs12713843
NM_000384.3(APOB):c.3427C>T (p.Pro1143Ser)
NM_000384.3(APOB):c.3607A>G (p.Ser1203Gly) rs78875649
NM_000384.3(APOB):c.4299G>A (p.Ser1433=) rs376103623
NM_000384.3(APOB):c.4825T>C (p.Leu1609=) rs72653083
NM_000384.3(APOB):c.4838G>C (p.Ser1613Thr) rs61742247
NM_000384.3(APOB):c.5066G>A (p.Arg1689His)
NM_000384.3(APOB):c.6636TGA[1] (p.Asp2213del) rs541497967
NM_000384.3(APOB):c.7285T>A (p.Ser2429Thr)
NM_000384.3(APOB):c.7331G>A (p.Arg2444His) rs200143030
NM_000384.3(APOB):c.7615G>A (p.Val2539Ile) rs148170480
NM_000384.3(APOB):c.7696G>A (p.Glu2566Lys) rs1801696
NM_000384.3(APOB):c.8148C>T (p.Ile2716=) rs6413458
NM_000384.3(APOB):c.8295A>G (p.Gln2765=) rs767506952
NM_000384.3(APOB):c.8462C>T (p.Pro2821Leu) rs72653095
NM_000384.3(APOB):c.9883T>C (p.Tyr3295His) rs186299244
NM_000388.4(CASR):c.748G>A (p.Glu250Lys) rs62269092
NM_000390.4(CHM):c.49+5G>A rs1057521475
NM_000391.4(TPP1):c.1015C>T (p.Arg339Trp) rs750428882
NM_000391.4(TPP1):c.1094G>A (p.Cys365Tyr) rs119455954
NM_000391.4(TPP1):c.1439T>G (p.Val480Gly)
NM_000391.4(TPP1):c.1497T>C (p.Pro499=) rs142672910
NM_000391.4(TPP1):c.14C>A (p.Ala5Asp) rs138976576
NM_000391.4(TPP1):c.542C>T (p.Ser181Phe) rs139059149
NM_000391.4(TPP1):c.617G>A (p.Arg206His) rs121908209
NM_000392.5(ABCC2):c.2073C>A (p.Val691=) rs17222624
NM_000392.5(ABCC2):c.842G>A (p.Ser281Asn) rs56131651
NM_000393.5(COL5A2):c.403-3T>C rs369733690
NM_000393.5(COL5A2):c.4450G>A (p.Gly1484Ser) rs147420365
NM_000393.5(COL5A2):c.75A>G (p.Lys25=) rs549894501
NM_000398.7(CYB5R3):c.352C>T (p.His118Tyr) rs772310694
NM_000399.5(EGR2):c.644C>T (p.Thr215Met) rs139147487
NM_000399.5(EGR2):c.832G>A (p.Ala278Thr) rs565355765
NM_000400.3(ERCC2):c.1381C>G (p.Leu461Val) rs121913016
NM_000400.3(ERCC2):c.2150C>G (p.Ala717Gly) rs144564120
NM_000400.3(ERCC2):c.601C>T (p.His201Tyr) rs1799792
NM_000400.4(ERCC2):c.1426G>A (p.Val476Ile) rs531021258
NM_000400.4(ERCC2):c.1789C>T (p.Leu597=) rs138038607
NM_000400.4(ERCC2):c.1866C>T (p.Gly622=) rs16979773
NM_000402.4(G6PD):c.1093G>A (p.Ala365Thr) rs5030869
NM_000402.4(G6PD):c.653C>T (p.Ser218Phe) rs5030868
NM_000406.3(GNRHR):c.317A>G (p.Gln106Arg) rs104893836
NM_000410.3(HFE):c.340+4T>C rs2071303
NM_000410.3(HFE):c.845G>A (p.Cys282Tyr) rs1800562
NM_000414.4(HSD17B4):c.1471G>A (p.Ala491Thr) rs28943591
NM_000414.4(HSD17B4):c.46G>A (p.Gly16Ser) rs137853096
NM_000426.3(LAMA2):c.1308T>G (p.Gly436=) rs41285286
NM_000426.3(LAMA2):c.2049_2050delAG rs202247790
NM_000426.3(LAMA2):c.2451-2A>G rs993196576
NM_000426.3(LAMA2):c.2462C>T (p.Thr821Met) rs117422805
NM_000426.3(LAMA2):c.3004G>A (p.Gly1002Ser) rs200953311
NM_000426.3(LAMA2):c.3582T>C (p.Ile1194=) rs137962409
NM_000426.3(LAMA2):c.411G>A (p.Ala137=) rs149347601
NM_000426.3(LAMA2):c.4301C>T (p.Ser1434Leu) rs368379507
NM_000426.3(LAMA2):c.4487C>T (p.Ala1496Val) rs147077184
NM_000426.3(LAMA2):c.4717+1G>T rs1131691660
NM_000426.3(LAMA2):c.5530C>T (p.Arg1844Cys) rs56173620
NM_000426.3(LAMA2):c.5562+5G>C rs771046502
NM_000426.3(LAMA2):c.5688C>T (p.His1896=) rs573779258
NM_000426.3(LAMA2):c.6506A>G (p.Asn2169Ser) rs144845618
NM_000426.3(LAMA2):c.6567C>T (p.Ala2189=) rs748650667
NM_000426.3(LAMA2):c.6788C>T (p.Thr2263Met) rs56209257
NM_000426.3(LAMA2):c.7344T>C (p.Asn2448=) rs199931560
NM_000426.3(LAMA2):c.9211+6T>C rs201375881
NM_000426.3(LAMA2):c.922G>A (p.Glu308Lys) rs146462599
NM_000426.3(LAMA2):c.9340G>A (p.Val3114Ile) rs200796753
NM_000431.4(MVK):c.1129G>A (p.Val377Ile) rs28934897
NM_000431.4(MVK):c.924C>T (p.Leu308=) rs72648042
NM_000432.4(MYL2):c.37G>A (p.Ala13Thr) rs104894363
NM_000432.4(MYL2):c.401A>C (p.Glu134Ala) rs143139258
NM_000434.4(NEU1):c.1034C>T (p.Thr345Ile)
NM_000435.3(NOTCH3):c.1774C>T (p.Arg592Cys) rs764148985
NM_000435.3(NOTCH3):c.1819C>T (p.Arg607Cys) rs777751303
NM_000435.3(NOTCH3):c.203C>T (p.Pro68Leu) rs146810942
NM_000435.3(NOTCH3):c.2149C>T (p.Arg717Cys) rs144163298
NM_000435.3(NOTCH3):c.2182C>T (p.Arg728Cys) rs1057519101
NM_000435.3(NOTCH3):c.3664T>G (p.Cys1222Gly) rs199638166
NM_000435.3(NOTCH3):c.391G>A (p.Gly131Ser)
NM_000435.3(NOTCH3):c.4044C>T (p.Gly1348=) rs78926093
NM_000435.3(NOTCH3):c.4869G>C (p.Pro1623=) rs148574670
NM_000435.3(NOTCH3):c.487C>T (p.Arg163Trp) rs367707092
NM_000435.3(NOTCH3):c.505C>T (p.Arg169Cys) rs28933696
NM_000435.3(NOTCH3):c.6061G>A (p.Val2021Met) rs199620476
NM_000435.3(NOTCH3):c.619C>T (p.Arg207Cys) rs775267348
NM_000435.3(NOTCH3):c.831G>A (p.Glu277=) rs145049433
NM_000436.4(OXCT1):c.112C>T (p.Arg38Cys) rs76956231
NM_000436.4(OXCT1):c.1491C>T (p.Asp497=) rs144283422
NM_000440.3(PDE6A):c.1086G>A (p.Ala362=) rs142259966
NM_000440.3(PDE6A):c.1476A>C (p.Gln492His) rs17711594
NM_000440.3(PDE6A):c.1955_1974dup (p.Ile659fs) rs773065850
NM_000440.3(PDE6A):c.304C>A (p.Arg102Ser) rs141252097
NM_000441.2(SLC26A4):c.365dup (p.Ile124fs) rs786204730
NM_000441.2(SLC26A4):c.441G>A (p.Met147Ile) rs201905280
NM_000443.4(ABCB4):c.1529A>G (p.Asn510Ser) rs375315619
NM_000444.6(PHEX):c.2198G>A (p.Cys733Tyr) rs1057517981
NM_000447.3(PSEN2):c.364A>C (p.Thr122Pro) rs63749851
NM_000447.3(PSEN2):c.415G>A (p.Val139Met) rs202178897
NM_000448.2(RAG1):c.2210G>A (p.Arg737His) rs104894286
NM_000452.3(SLC10A2):c.868C>T (p.Pro290Ser) rs56398830
NM_000452.3(SLC10A2):c.910T>C (p.Phe304Leu) rs61966074
NM_000454.4(SOD1):c.272A>C (p.Asp91Ala) rs80265967
NM_000455.4(STK11):c.1185A>G (p.Thr395=) rs370207155
NM_000455.4(STK11):c.357C>T (p.Asn119=) rs372511774
NM_000455.4(STK11):c.375-7G>A rs587781176
NM_000455.4(STK11):c.615G>A (p.Ala205=) rs532889728
NM_000455.4(STK11):c.795G>A (p.Glu265=) rs730881963
NM_000455.5(STK11):c.1211C>T (p.Ser404Phe) rs200078204
NM_000458.4(HNF1B):c.1006C>G (p.His336Asp)
NM_000465.4(BARD1):c.1194A>G (p.Thr398=) rs781482219
NM_000465.4(BARD1):c.1216C>T (p.Arg406Ter) rs377153250
NM_000465.4(BARD1):c.1317C>T (p.Gly439=) rs369986649
NM_000465.4(BARD1):c.1347A>G (p.Gln449=) rs373257776
NM_000465.4(BARD1):c.1409A>G (p.Asn470Ser) rs587781976
NM_000465.4(BARD1):c.1972C>T (p.Arg658Cys) rs3738888
NM_000465.4(BARD1):c.1977A>G (p.Arg659=) rs147215925
NM_000466.3(PEX1):c.1579A>G (p.Thr527Ala) rs144942544
NM_000466.3(PEX1):c.2442C>T (p.Phe814=) rs145430946
NM_000466.3(PEX1):c.3216T>C (p.Ser1072=) rs140963147
NM_000466.3(PEX1):c.330C>G (p.Pro110=) rs71560821
NM_000478.6(ALPL):c.526G>A (p.Ala176Thr) rs121918019
NM_000478.6(ALPL):c.571G>A (p.Glu191Lys) rs121918007
NM_000481.4(AMT):c.354G>A (p.Leu118=) rs145194293
NM_000481.4(AMT):c.631G>A (p.Glu211Lys) rs116192290
NM_000487.6(ARSA):c.466-7G>C rs6151414
NM_000487.6(ARSA):c.636C>T (p.Ala212=) rs200182983
NM_000488.3(SERPINC1):c.1246G>T (p.Ala416Ser) rs121909548
NM_000488.3(SERPINC1):c.218C>T (p.Pro73Leu) rs121909551
NM_000488.3(SERPINC1):c.89T>A (p.Val30Glu) rs2227624
NM_000489.5(ATRX):c.4249C>T (p.Arg1417Trp) rs1557118764
NM_000489.5(ATRX):c.6254G>A (p.Arg2085His) rs1057517948
NM_000489.5(ATRX):c.736C>T (p.Arg246Cys) rs122445105
NM_000492.3(CFTR):c.1210-12T[5] rs1805177
NM_000492.3(CFTR):c.1521_1523delCTT (p.Phe508delPhe) rs113993960
NM_000492.3(CFTR):c.2173G>A (p.Glu725Lys) rs199791061
NM_000492.3(CFTR):c.2909-15T>G rs397508455
NM_000492.3(CFTR):c.3080T>C (p.Ile1027Thr) rs1800112
NM_000492.3(CFTR):c.3485G>T (p.Arg1162Leu) rs1800120
NM_000492.3(CFTR):c.360G>A (p.Ala120=) rs1800077
NM_000492.4(CFTR):c.1210-11T>G rs73715573
NM_000492.4(CFTR):c.1327G>T (p.Asp443Tyr) rs147422190
NM_000492.4(CFTR):c.1399C>T (p.Leu467Phe) rs1800089
NM_000492.4(CFTR):c.1584G>A (p.Glu528=) rs1800095
NM_000492.4(CFTR):c.1624G>T (p.Gly542Ter) rs113993959
NM_000492.4(CFTR):c.1727G>C (p.Gly576Ala) rs1800098
NM_000492.4(CFTR):c.2002C>T (p.Arg668Cys) rs1800100
NM_000492.4(CFTR):c.224G>A (p.Arg75Gln) rs1800076
NM_000492.4(CFTR):c.2991G>C (p.Leu997Phe) rs1800111
NM_000492.4(CFTR):c.3154T>G (p.Phe1052Val) rs150212784
NM_000492.4(CFTR):c.3285A>T (p.Thr1095=) rs1800118
NM_000492.4(CFTR):c.350G>A (p.Arg117His) rs78655421
NM_000492.4(CFTR):c.3705T>G (p.Ser1235Arg) rs34911792
NM_000492.4(CFTR):c.3897A>G (p.Thr1299=) rs1800131
NM_000492.4(CFTR):c.4333G>A (p.Asp1445Asn) rs148783445
NM_000492.4(CFTR):c.617T>G (p.Leu206Trp) rs121908752
NM_000492.4(CFTR):c.695T>A (p.Val232Asp) rs397508783
NM_000492.4(CFTR):c.772A>G (p.Arg258Gly) rs191456345
NM_000492.4(CFTR):c.890G>A (p.Arg297Gln) rs143486492
NM_000494.4(COL17A1):c.1590G>A (p.Ala530=) rs150738577
NM_000501.4(ELN):c.1178_1201del (p.Gly393_Gly400del) rs781838239
NM_000501.4(ELN):c.328G>A (p.Ala110Thr) rs137953195
NM_000503.6(EYA1):c.1460C>T (p.Ser487Leu) rs139717960
NM_000503.6(EYA1):c.630T>C (p.Ser210=) rs373102227
NM_000504.4(F10):c.424G>A (p.Glu142Lys) rs61753266
NM_000504.4(F10):c.60C>T (p.Leu20=) rs3211718
NM_000506.3(F2):c.598G>A (p.Glu200Lys) rs62623459
NM_000506.4(F2):c.1824C>T (p.Arg608=) rs3136532
NM_000506.5(F2):c.*97G>A rs1799963
NM_000518.5(HBB):c.92+6T>C rs35724775
NM_000520.6(HEXA):c.1073+1G>A rs76173977
NM_000520.6(HEXA):c.1231G>A (p.Gly411Ser) rs575121167
NM_000520.6(HEXA):c.1435G>A (p.Ala479Thr) rs145012038
NM_000520.6(HEXA):c.739C>T (p.Arg247Trp) rs121907970
NM_000520.6(HEXA):c.759G>A (p.Val253=) rs117513345
NM_000521.4(HEXB):c.1614-14C>A rs201448394
NM_000521.4(HEXB):c.214C>T (p.Leu72Phe) rs147155126
NM_000527.4(LDLR):c.1056C>T (p.Cys352=) rs13306515
NM_000527.4(LDLR):c.1414G>A (p.Asp472Asn) rs730882102
NM_000527.5(LDLR):c.1061-8T>C
NM_000527.5(LDLR):c.1725C>T (p.Leu575=) rs1799898
NM_000527.5(LDLR):c.2177C>T (p.Thr726Ile)
NM_000527.5(LDLR):c.2231G>A (p.Arg744Gln)
NM_000527.5(LDLR):c.798T>A (p.Asp266Glu) rs139043155
NM_000527.5(LDLR):c.941-39C>T
NM_000530.8(MPZ):c.182A>G (p.Asp61Gly) rs786204119
NM_000530.8(MPZ):c.24C>T (p.Ser8=) rs144841836
NM_000530.8(MPZ):c.266_270dup (p.Glu91fs) rs1553259697
NM_000530.8(MPZ):c.356A>G (p.Tyr119Cys) rs879254038
NM_000530.8(MPZ):c.487G>C (p.Gly163Arg) rs281865128
NM_000531.6(OTC):c.374C>T (p.Thr125Met) rs72554356
NM_000531.6(OTC):c.596A>G (p.Asn199Ser) rs72558406
NM_000532.5(PCCB):c.815G>A (p.Arg272Gln) rs150555106
NM_000535.7(PMS2):c.1344A>T (p.Gly448=) rs759192470
NM_000535.7(PMS2):c.1437C>G (p.His479Gln) rs63750685
NM_000535.7(PMS2):c.1560G>A (p.Ala520=) rs201167814
NM_000535.7(PMS2):c.1569C>G (p.Ser523=) rs141458772
NM_000535.7(PMS2):c.1688G>T (p.Arg563Leu) rs63750668
NM_000535.7(PMS2):c.180C>G (p.Asp60Glu) rs200313585
NM_000535.7(PMS2):c.2113G>A (p.Glu705Lys) rs267608161
NM_000535.7(PMS2):c.2187C>G (p.Leu729=) rs373630535
NM_000535.7(PMS2):c.2356C>A (p.Leu786Met) rs576055272
NM_000535.7(PMS2):c.255G>A (p.Leu85=) rs200491279
NM_000535.7(PMS2):c.379G>A (p.Ala127Thr) rs114090343
NM_000535.7(PMS2):c.52A>G (p.Ile18Val) rs63750123
NM_000535.7(PMS2):c.595C>T (p.Arg199Cys) rs372297364
NM_000535.7(PMS2):c.687T>C (p.Ser229=) rs786201508
NM_000535.7(PMS2):c.795T>C (p.Asn265=) rs766667186
NM_000535.7(PMS2):c.86G>C (p.Gly29Ala) rs146176004
NM_000539.3(RHO):c.480C>A (p.Thr160=) rs151063543
NM_000539.3(RHO):c.647T>A (p.Met216Lys)
NM_000539.3(RHO):c.762CAT[2] (p.Ile256del) rs1553781360
NM_000540.2(RYR1):c.10097G>A (p.Arg3366His) rs137932199
NM_000540.2(RYR1):c.10119G>A (p.Val3373=) rs140689610
NM_000540.2(RYR1):c.10501dup (p.Asp3501fs) rs1568537774
NM_000540.2(RYR1):c.10917G>A (p.Thr3639=) rs371952058
NM_000540.2(RYR1):c.12110del (p.Gly4037fs) rs1555795308
NM_000540.2(RYR1):c.12283-7C>T rs143861818
NM_000540.2(RYR1):c.1250T>C (p.Leu417Pro) rs764262446
NM_000540.2(RYR1):c.12869C>T (p.Ala4290Val) rs755065800
NM_000540.2(RYR1):c.12879G>C (p.Ala4293=) rs193922854
NM_000540.2(RYR1):c.12880A>G (p.Thr4294Ala) rs1003914966
NM_000540.2(RYR1):c.12884C>T (p.Ala4295Val) rs193922855
NM_000540.2(RYR1):c.12956G>A (p.Arg4319Gln) rs539194350
NM_000540.2(RYR1):c.131G>A (p.Arg44His) rs139161723
NM_000540.2(RYR1):c.14061G>A (p.Leu4687=) rs201629205
NM_000540.2(RYR1):c.14130-8C>G rs140808099
NM_000540.2(RYR1):c.14505G>A (p.Gly4835=) rs118126378
NM_000540.2(RYR1):c.14524G>A rs193922879
NM_000540.2(RYR1):c.1453A>G (p.Met485Val) rs147723844
NM_000540.2(RYR1):c.14589C>T (p.Phe4863=) rs146072491
NM_000540.2(RYR1):c.14642T>C (p.Met4881Thr) rs1568605367
NM_000540.2(RYR1):c.15084T>C (p.Cys5028=) rs758735802
NM_000540.2(RYR1):c.178G>A (p.Asp60Asn) rs118192160
NM_000540.2(RYR1):c.1956G>A (p.Ala652=) rs202105428
NM_000540.2(RYR1):c.2091C>T (p.Ala697=) rs138704724
NM_000540.2(RYR1):c.2121C>A (p.Gly707=) rs146104858
NM_000540.2(RYR1):c.2160C>G (p.Leu720=) rs200914778
NM_000540.2(RYR1):c.216G>T (p.Leu72=) rs113389877
NM_000540.2(RYR1):c.2223C>T (p.Asp741=) rs150831055
NM_000540.2(RYR1):c.2319C>T (p.Asp773=) rs374924686
NM_000540.2(RYR1):c.2356G>A (p.Val786Ile) rs369281291
NM_000540.2(RYR1):c.2488C>T (p.Arg830Trp) rs142548565
NM_000540.2(RYR1):c.2682+7G>A rs201498416
NM_000540.2(RYR1):c.271-7C>G rs192495718
NM_000540.2(RYR1):c.2919C>T (p.His973=) rs139363830
NM_000540.2(RYR1):c.3111C>T (p.Ser1037=) rs145434723
NM_000540.2(RYR1):c.3252C>T (p.Ser1084=) rs144164620
NM_000540.2(RYR1):c.3618C>T (p.Asp1206=) rs191970833
NM_000540.2(RYR1):c.3924G>C (p.Pro1308=) rs144350050
NM_000540.2(RYR1):c.4115C>T (p.Ala1372Val) rs370966353
NM_000540.2(RYR1):c.4178A>G (p.Lys1393Arg) rs137933390
NM_000540.2(RYR1):c.4294-4C>T rs368108496
NM_000540.2(RYR1):c.46-5C>T rs774388278
NM_000540.2(RYR1):c.4710C>T (p.Asn1570=) rs763113534
NM_000540.2(RYR1):c.4911G>A (p.Ala1637=) rs370350821
NM_000540.2(RYR1):c.4980C>T (p.Arg1660=) rs374115286
NM_000540.2(RYR1):c.4999C>T (p.Arg1667Cys) rs144157950
NM_000540.2(RYR1):c.5317C>T (p.Pro1773Ser) rs192863857
NM_000540.2(RYR1):c.5340_5341del (p.Cys1781fs) rs779723153
NM_000540.2(RYR1):c.5637C>T (p.Asp1879=) rs143418190
NM_000540.2(RYR1):c.6023T>C (p.Met2008Thr) rs199947661
NM_000540.2(RYR1):c.6645C>T (p.Leu2215=) rs146617004
NM_000540.2(RYR1):c.7355G>A (p.Arg2452Gln) rs193922815
NM_000540.2(RYR1):c.7488G>A (p.Pro2496=) rs375997435
NM_000540.2(RYR1):c.7522C>T (p.Arg2508Cys) rs118192178
NM_000540.2(RYR1):c.7830C>T (p.Leu2610=) rs140063541
NM_000540.2(RYR1):c.7860G>A (p.Gln2620=) rs147587000
NM_000540.2(RYR1):c.7881G>A (p.Val2627=) rs201877620
NM_000540.2(RYR1):c.7923C>G (p.Leu2641=) rs142558977
NM_000540.2(RYR1):c.8026C>T (p.Arg2676Trp) rs193922826
NM_000540.2(RYR1):c.8112C>T (p.Cys2704=) rs763722972
NM_000540.2(RYR1):c.8142T>C (p.Tyr2714=) rs567352621
NM_000540.2(RYR1):c.8505A>T (p.Glu2835Asp) rs144777676
NM_000540.2(RYR1):c.9262G>A (p.Val3088Met) rs145044872
NM_000540.2(RYR1):c.9348G>A (p.Ser3116=) rs763655831
NM_000540.2(RYR1):c.9635A>G (p.Glu3212Gly) rs199738299
NM_000540.3(RYR1):c.10204T>G (p.Cys3402Gly) rs367543058
NM_000540.3(RYR1):c.10616G>A (p.Arg3539His) rs143987857
NM_000540.3(RYR1):c.11314C>T rs763112609
NM_000540.3(RYR1):c.12951GCGGCGGCT[3] (p.4318RRL[3]) rs193922846
NM_000540.3(RYR1):c.13388C>T (p.Ala4463Val) rs1350916629
NM_000540.3(RYR1):c.13513G>C (p.Asp4505His) rs150396398
NM_000540.3(RYR1):c.14421CTT[2] (p.Phe4810del) rs1555803810
NM_000540.3(RYR1):c.14582G>A (p.Arg4861His) rs63749869
NM_000540.3(RYR1):c.14761TTC[3] (p.Phe4924del) rs1064794572
NM_000540.3(RYR1):c.1589G>A (p.Arg530His) rs111888148
NM_000540.3(RYR1):c.1598G>A (p.Arg533His) rs144336148
NM_000540.3(RYR1):c.1654C>T (p.Arg552Trp) rs193922770
NM_000540.3(RYR1):c.1655G>A (p.Arg552Gln)
NM_000540.3(RYR1):c.1840C>T (p.Arg614Cys) rs118192172
NM_000540.3(RYR1):c.2871-5C>T rs45585535
NM_000540.3(RYR1):c.325C>T rs118192173
NM_000540.3(RYR1):c.4711A>G (p.Ile1571Val) rs146429605
NM_000540.3(RYR1):c.5036G>A (p.Arg1679His) rs146504767
NM_000540.3(RYR1):c.5665GAG[2] (p.Glu1891del) rs559371263
NM_000540.3(RYR1):c.6487C>T (p.Arg2163Cys) rs118192175
NM_000540.3(RYR1):c.6813G>A (p.Thr2271=) rs147786842
NM_000540.3(RYR1):c.7007G>A (p.Arg2336His) rs112563513
NM_000540.3(RYR1):c.7300G>A (p.Gly2434Arg) rs121918593
NM_000540.3(RYR1):c.7354C>T (p.Arg2452Trp) rs118192124
NM_000540.3(RYR1):c.7360C>T (p.Arg2454Cys) rs193922816
NM_000540.3(RYR1):c.7361G>A (p.Arg2454His) rs118192122
NM_000540.3(RYR1):c.8327C>T (p.Ser2776Phe) rs147707463
NM_000543.5(SMPD1):c.1071C>T (p.Ala357=) rs72896268
NM_000543.5(SMPD1):c.1550A>T (p.Glu517Val) rs142787001
NM_000543.5(SMPD1):c.441G>A (p.Val147=) rs148944108
NM_000545.8(HNF1A):c.1748G>A (p.Arg583Gln) rs137853242
NM_000546.5(TP53):c.1014C>T (p.Phe338=) rs150293825
NM_000546.5(TP53):c.1079G>C (p.Gly360Ala) rs35993958
NM_000546.5(TP53):c.255T>C (p.Pro85=) rs775515332
NM_000546.5(TP53):c.404G>A (p.Cys135Tyr) rs587781991
NM_000546.5(TP53):c.6G>A (p.Glu2=) rs143458271
NM_000546.5(TP53):c.836G>A (p.Gly279Glu) rs1064793881
NM_000546.5(TP53):c.920-5C>T rs34361146
NM_000548.5(TSC2):c.1070C>T (p.Ala357Val) rs150195368
NM_000548.5(TSC2):c.1143G>A (p.Arg381=) rs45517155
NM_000548.5(TSC2):c.1281C>A (p.Ile427=) rs45478892
NM_000548.5(TSC2):c.1340C>T (p.Ala447Val) rs45486591
NM_000548.5(TSC2):c.1378G>A (p.Ala460Thr) rs137854154
NM_000548.5(TSC2):c.1387A>G (p.Ile463Val) rs45517171
NM_000548.5(TSC2):c.1818C>T (p.Ile606=) rs547389841
NM_000548.5(TSC2):c.1820C>T (p.Ala607Val) rs397515296
NM_000548.5(TSC2):c.1981G>A (p.Gly661Ser) rs137854168
NM_000548.5(TSC2):c.2331T>C (p.His777=) rs139963953
NM_000548.5(TSC2):c.2427C>T (p.Ser809=) rs182849638
NM_000548.5(TSC2):c.251C>T (p.Ala84Val) rs35660529
NM_000548.5(TSC2):c.2546-5C>T rs45517247
NM_000548.5(TSC2):c.2584G>A (p.Ala862Thr) rs759837836
NM_000548.5(TSC2):c.2585C>T (p.Ala862Val) rs45517249
NM_000548.5(TSC2):c.299C>T (p.Ala100Val) rs375824753
NM_000548.5(TSC2):c.300G>A (p.Ala100=) rs45517100
NM_000548.5(TSC2):c.3140T>C (p.Val1047Ala) rs45517284
NM_000548.5(TSC2):c.3420C>T (p.Gly1140=) rs373968155
NM_000548.5(TSC2):c.3489C>T (p.Ala1163=) rs200346578
NM_000548.5(TSC2):c.3610+6G>A rs45517301
NM_000548.5(TSC2):c.3744C>T (p.Ala1248=) rs45517307
NM_000548.5(TSC2):c.3770C>T (p.Ala1257Val) rs45466493
NM_000548.5(TSC2):c.3996C>T (p.Ala1332=) rs1421997373
NM_000548.5(TSC2):c.4094C>T (p.Ser1365Leu) rs377123510
NM_000548.5(TSC2):c.4105C>T (p.Arg1369Trp) rs45517328
NM_000548.5(TSC2):c.4216G>T (p.Asp1406Tyr) rs147719291
NM_000548.5(TSC2):c.4260A>G (p.Ser1420=) rs1285012780
NM_000548.5(TSC2):c.4272C>T (p.Asp1424=) rs371541319
NM_000548.5(TSC2):c.4302C>T (p.Gly1434=) rs137854000
NM_000548.5(TSC2):c.4493+7C>A rs199943270
NM_000548.5(TSC2):c.4795G>A (p.Val1599Met) rs772687631
NM_000548.5(TSC2):c.4905C>T (p.Cys1635=) rs397514999
NM_000548.5(TSC2):c.5035G>A (p.Glu1679Lys) rs370404391
NM_000548.5(TSC2):c.5106C>A (p.Ile1702=) rs45483700
NM_000548.5(TSC2):c.5116C>T (p.Arg1706Cys) rs45517391
NM_000548.5(TSC2):c.5117G>A (p.Arg1706His) rs45517392
NM_000548.5(TSC2):c.5161-4C>G rs45517406
NM_000548.5(TSC2):c.5307C>T (p.His1769=) rs562220073
NM_000548.5(TSC2):c.5312C>T (p.Pro1771Leu) rs137854214
NM_000548.5(TSC2):c.5364T>C (p.Tyr1788=) rs367703283
NM_000548.5(TSC2):c.5383C>T (p.Arg1795Cys) rs45517423
NM_000548.5(TSC2):c.538C>G (p.Leu180Val) rs45485591
NM_000548.5(TSC2):c.552C>T (p.Val184=) rs199991910
NM_000548.5(TSC2):c.618C>T (p.Cys206=) rs45498496
NM_000548.5(TSC2):c.759C>T (p.Cys253=) rs45517125
NM_000548.5(TSC2):c.814G>A (p.Ala272Thr) rs373818076
NM_000551.3(VHL):c.183C>G (p.Pro61=) rs63650860
NM_000551.3(VHL):c.74C>T (p.Pro25Leu) rs35460768
NM_000551.4(VHL):c.150C>G (p.Ala50=) rs61751580
NM_000551.4(VHL):c.241C>T (p.Pro81Ser) rs104893829
NM_000551.4(VHL):c.463+8C>T rs5030834
NM_000551.4(VHL):c.500G>A (p.Arg167Gln) rs5030821
NM_000552.4(VWF):c.1110-7dup rs534403271
NM_000552.4(VWF):c.1614C>T (p.Pro538=) rs138268387
NM_000552.4(VWF):c.2365A>G (p.Thr789Ala) rs1063856
NM_000552.4(VWF):c.2561G>A (p.Arg854Gln) rs41276738
NM_000552.4(VWF):c.3692A>C (p.Asn1231Thr) rs61749368
NM_000552.4(VWF):c.3789G>A (p.Ser1263=) rs199831474
NM_000552.4(VWF):c.3797C>A (p.Pro1266Gln) rs61749370
NM_000552.4(VWF):c.3797C>T (p.Pro1266Leu) rs61749370
NM_000552.4(VWF):c.4443G>T (p.Gly1481=) rs144796763
NM_000552.4(VWF):c.4751A>G (p.Tyr1584Cys) rs1800386
NM_000552.4(VWF):c.5170+10C>T rs61750601
NM_000552.4(VWF):c.5191T>A (p.Ser1731Thr) rs61750603
NM_000552.4(VWF):c.5277C>T (p.Asp1759=) rs41276736
NM_000552.4(VWF):c.5278G>A (p.Val1760Ile) rs61750604
NM_000552.4(VWF):c.5312-19A>C rs200237834
NM_000552.4(VWF):c.546G>A (p.Ser182=) rs143054357
NM_000552.4(VWF):c.5851A>G (p.Thr1951Ala) rs144072210
NM_000552.4(VWF):c.7682T>A (p.Phe2561Tyr) rs35335161
NM_000552.4(VWF):c.7988G>C (p.Arg2663Pro) rs149834874
NM_000553.6(WRN):c.1149G>T (p.Leu383Phe) rs4987238
NM_000553.6(WRN):c.2983G>A (p.Ala995Thr) rs140768346
NM_000553.6(WRN):c.3785C>G (p.Thr1262Arg) rs78488552
NM_000553.6(WRN):c.95A>G (p.Lys32Arg) rs34477820
NM_000554.6(CRX):c.196G>A (p.Val66Ile) rs61748438
NM_000554.6(CRX):c.425A>G (p.Tyr142Cys) rs61748442
NM_000562.2(C8A):c.385G>A (p.Asp129Asn) rs150404785
NM_000601.6(HGF):c.1008G>A (p.Glu336=) rs148714837
NM_000602.5(SERPINE1):c.357G>A (p.Ala119=) rs6091
NM_000637.5(GSR):c.694G>A (p.Gly232Ser) rs8190976
NM_000642.3(AGL):c.1481G>A (p.Arg494His) rs141043166
NM_000642.3(AGL):c.1875G>T (p.Thr625=) rs141944878
NM_000642.3(AGL):c.2522C>T (p.Ser841Phe) rs150441555
NM_000666.3(ACY1):c.1057C>T (p.Arg353Cys) rs121912698
NM_000666.3(ACY1):c.1178G>A (p.Arg393His) rs121912701
NM_000702.4(ATP1A2):c.2130C>T (p.Ala710=) rs374749325
NM_000718.4(CACNA1B):c.2093-4C>A rs76062311
NM_000718.4(CACNA1B):c.30C>T (p.Gly10=) rs767457983
NM_000719.7(CACNA1C):c.1126G>A (p.Val376Ile) rs1131653
NM_000719.7(CACNA1C):c.1783G>A (p.Val595Ile) rs201392574
NM_000719.7(CACNA1C):c.202G>A (p.Ala68Thr) rs752000790
NM_000719.7(CACNA1C):c.2391G>A (p.Gly797=) rs374857905
NM_000719.7(CACNA1C):c.375A>G (p.Pro125=) rs587780882
NM_000719.7(CACNA1C):c.426G>A (p.Ala142=) rs546786746
NM_000719.7(CACNA1C):c.4380C>T (p.Tyr1460=) rs747654175
NM_000719.7(CACNA1C):c.5593G>A (p.Glu1865Lys) rs200231105
NM_000719.7(CACNA1C):c.792C>A (p.Ala264=) rs750459136
NM_000744.7(CHRNA4):c.1116C>T (p.Ile372=) rs199889002
NM_000744.7(CHRNA4):c.1228G>A (p.Val410Ile) rs121912272
NM_000744.7(CHRNA4):c.1360G>A (p.Gly454Ser) rs78306886
NM_000744.7(CHRNA4):c.1634C>T (p.Thr545Met) rs121912282
NM_000744.7(CHRNA4):c.1635G>A (p.Thr545=) rs121912283
NM_000744.7(CHRNA4):c.274G>C (p.Glu92Gln) rs146651027
NM_000744.7(CHRNA4):c.296G>A (p.Arg99His) rs143103435
NM_000744.7(CHRNA4):c.38_49dup (p.Pro13_Leu16dup) rs1064794327
NM_000744.7(CHRNA4):c.729G>A (p.Pro243=) rs121912253
NM_000748.3(CHRNB2):c.109C>T (p.Leu37=) rs71651693
NM_000748.3(CHRNB2):c.1235G>A (p.Gly412Asp) rs112585933
NM_000748.3(CHRNB2):c.1378C>G (p.Arg460Gly) rs202079239
NM_000748.3(CHRNB2):c.297T>C (p.Phe99=) rs777276160
NM_000751.3(CHRND):c.862C>G (p.Gln288Glu) rs41265127
NM_000782.5(CYP24A1):c.1226T>C (p.Leu409Ser) rs6068812
NM_000784.4(CYP27A1):c.1016C>T (p.Thr339Met) rs121908102
NM_000784.4(CYP27A1):c.1184G>A (p.Arg395His) rs587778778
NM_000784.4(CYP27A1):c.1471G>T (p.Ala491Ser) rs72551323
NM_000784.4(CYP27A1):c.646G>C (p.Ala216Pro) rs201346271
NM_000814.6(GABRB3):c.1293G>A (p.Arg431=) rs75914945
NM_000814.6(GABRB3):c.380A>G (p.Lys127Arg) rs1057519201
NM_000814.6(GABRB3):c.916A>G (p.Ile306Val)
NM_000815.5(GABRD):c.1060-7C>T rs368961588
NM_000815.5(GABRD):c.147C>T (p.Ala49=) rs147463074
NM_000834.4(GRIN2B):c.1768G>A (p.Ala590Thr) rs145021339
NM_000834.4(GRIN2B):c.189C>T (p.Ser63=) rs199707487
NM_000834.4(GRIN2B):c.190G>A (p.Val64Met) rs150070901
NM_000834.4(GRIN2B):c.2539C>T (p.Arg847Ter) rs879253931
NM_000834.4(GRIN2B):c.3047G>A (p.Arg1016Lys) rs141109968
NM_000834.4(GRIN2B):c.3076G>A (p.Gly1026Ser) rs201963596
NM_000834.4(GRIN2B):c.3807A>T (p.Pro1269=) rs78765966
NM_000834.4(GRIN2B):c.3993G>A (p.Met1331Ile) rs200035225
NM_000836.2(GRIN2D):c.2910G>A (p.Pro970=) rs771799381
NM_000843.4(GRM6):c.19G>A (p.Ala7Thr) rs62642053
NM_000843.4(GRM6):c.2257G>A (p.Gly753Ser) rs79602188
NM_000875.5(IGF1R):c.1532G>A (p.Arg511Gln) rs33958176
NM_000883.4(IMPDH1):c.377T>C (p.Phe126Ser) rs367549284
NM_000902.4(MME):c.467del (p.Pro156fs) rs749320057
NM_000930.5(PLAT):c.860C>T (p.Thr287Met) rs114878147
NM_000934.3(SERPINF2):c.1107C>T (p.Ser369=) rs148395057
NM_000941.3(POR):c.1891G>A (p.Val631Ile) rs145782750
NM_001001344.2(ATP2B3):c.1099C>T (p.Leu367=) rs150989590
NM_001001344.2(ATP2B3):c.1686C>G (p.Arg562=) rs140240114
NM_001001433.3(STX16):c.557-7G>C rs41276952
NM_001003800.2(BICD2):c.1893C>T (p.Ile631=) rs141414055
NM_001003841.3(SLC6A19):c.775-5C>T rs149379208
NM_001004334.4(GPR179):c.1573C>T (p.Arg525Ter) rs773022324
NM_001005242.3(PKP2):c.1114G>C (p.Ala372Pro) rs200586695
NM_001005242.3(PKP2):c.1379-2019C>T rs149930872
NM_001005242.3(PKP2):c.1509T>C (p.Asn503=) rs143782040
NM_001005242.3(PKP2):c.2299C>A (p.Arg767Ser) rs139734328
NM_001005242.3(PKP2):c.234C>T (p.His78=) rs1591829350
NM_001005242.3(PKP2):c.302G>A (p.Arg101His) rs149542398
NM_001005360.2(DNM2):c.2201A>G (p.Asn734Ser) rs577767034
NM_001005360.2(DNM2):c.238C>T (p.His80Tyr) rs148790687
NM_001005360.2(DNM2):c.2543+7C>G rs201979143
NM_001005360.2(DNM2):c.2592C>T (p.Ala864=) rs373161548
NM_001005360.2(DNM2):c.633C>T (p.Asp211=) rs200191870
NM_001005746.4(CACNB4):c.-2T>G rs369342902
NM_001006658.2(CR2):c.2298G>A (p.Trp766Ter) rs151093663
NM_001006658.2(CR2):c.624C>A (p.Pro208=) rs61759494
NM_001006658.3(CR2):c.524C>T (p.Pro175Leu) rs75282758
NM_001007792.1(NTRK1):c.123-3367G>A rs1007211
NM_001007792.1(NTRK1):c.123-3404C>T rs201472270
NM_001007792.1(NTRK1):c.1800G>A (p.Ala600=) rs17838192
NM_001007792.1(NTRK1):c.415G>A (p.Gly139Arg) rs367836863
NM_001008212.2(OPTN):c.489A>G (p.Glu163=) rs113811959
NM_001008537.3(NEXMIF):c.1415C>G (p.Ser472Cys) rs770738202
NM_001008537.3(NEXMIF):c.3823A>G (p.Ser1275Gly) rs201434271
NM_001008781.2(FAT3):c.5391G>A (p.Val1797=) rs143705185
NM_001009944.3(PKD1):c.10958C>T (p.Ala3653Val)
NM_001009944.3(PKD1):c.11015G>A (p.Arg3672Gln) rs201220835
NM_001009944.3(PKD1):c.5453C>T (p.Ala1818Val) rs746910149
NM_001009944.3(PKD1):c.6749C>T (p.Thr2250Met) rs139971481
NM_001009944.3(PKD1):c.7300C>T (p.Arg2434Trp)
NM_001009944.3(PKD1):c.7483T>A (p.Cys2495Ser)
NM_001009944.3(PKD1):c.8161+5C>T rs534696523
NM_001009944.3(PKD1):c.8311G>A (p.Glu2771Lys) rs1057518897
NM_001015880.2(PAPSS2):c.712C>T (p.Arg238Ter)
NM_001018005.2(TPM1):c.842T>C (p.Met281Thr) rs199476321
NM_001018111.3(PODXL):c.376A>C (p.Thr126Pro) rs55698400
NM_001018113.3(FANCB):c.1371C>T (p.Val457=) rs149695930
NM_001024688.2(NBN):c.896del (p.Pro299fs) rs587781969
NM_001025295.3(IFITM5):c.186+5G>A rs1267542305
NM_001029882.3(AHDC1):c.2438G>A (p.Arg813His) rs138299564
NM_001029883.3(PCARE):c.2600C>T (p.Pro867Leu) rs182248363
NM_001029896.2(WDR45):c.766_794del (p.Asp257fs) rs1569523457
NM_001033855.3(DCLRE1C):c.1284A>C (p.Lys428Asn) rs113870881
NM_001033855.3(DCLRE1C):c.2001A>G (p.Leu667=) rs61749163
NM_001034116.2(EIF2B4):c.51G>C (p.Lys17Asn) rs190259653
NM_001034850.2(RETREG1):c.607G>A (p.Val203Met) rs143878016
NM_001035.3(RYR2):c.10017C>T (p.His3339=) rs376439588
NM_001035.3(RYR2):c.10221G>A (p.Ser3407=) rs373769240
NM_001035.3(RYR2):c.10941T>G (p.Pro3647=) rs370332882
NM_001035.3(RYR2):c.1240C>T (p.Arg414Cys) rs764698152
NM_001035.3(RYR2):c.13449A>G (p.Lys4483=) rs1008224442
NM_001035.3(RYR2):c.13665C>T (p.Ile4555=) rs375213838
NM_001035.3(RYR2):c.13983C>T (p.Tyr4661=) rs138498780
NM_001035.3(RYR2):c.14703G>C (p.Val4901=) rs201371633
NM_001035.3(RYR2):c.2574G>A (p.Thr858=) rs367992907
NM_001035.3(RYR2):c.3038G>A (p.Arg1013Gln) rs149514924
NM_001035.3(RYR2):c.3888C>T (p.Asn1296=) rs373721253
NM_001035.3(RYR2):c.4734C>T (p.Pro1578=) rs201880756
NM_001035.3(RYR2):c.5001T>C (p.Leu1667=) rs397516537
NM_001035.3(RYR2):c.8162T>C (p.Ile2721Thr) rs201500134
NM_001035.3(RYR2):c.8367T>C (p.Ile2789=) rs563219502
NM_001035.3(RYR2):c.8913T>C (p.Ile2971=) rs755520825
NM_001036.5(RYR3):c.2214G>A (p.Ser738=) rs201215774
NM_001037.5(SCN1B):c.448+193G>A rs66876876
NM_001037.5(SCN1B):c.448+321G>A rs72558028
NM_001037.5(SCN1B):c.448+88G>A rs267607028
NM_001037.5(SCN1B):c.449-3C>A rs370937269
NM_001037.5(SCN1B):c.63C>T (p.Cys21=) rs200339565
NM_001039141.3(TRIOBP):c.3309C>T (p.His1103=) rs199594270
NM_001039141.3(TRIOBP):c.4031G>A (p.Arg1344Gln) rs34066624
NM_001039141.3(TRIOBP):c.584C>T (p.Thr195Ile) rs143157673
NM_001039141.3(TRIOBP):c.634G>A (p.Gly212Ser) rs201794404
NM_001040142.2(SCN2A):c.1416A>G (p.Arg472=) rs200246820
NM_001040142.2(SCN2A):c.2562+5A>G rs374738441
NM_001040142.2(SCN2A):c.2706C>G (p.Leu902=) rs192461273
NM_001040142.2(SCN2A):c.2859C>T (p.Val953=) rs139967593
NM_001040142.2(SCN2A):c.2990A>G (p.Asp997Gly) rs1057523786
NM_001040142.2(SCN2A):c.3210C>T (p.Asp1070=) rs187731029
NM_001040142.2(SCN2A):c.3457G>A (p.Glu1153Lys) rs200138205
NM_001040142.2(SCN2A):c.3579C>A (p.Leu1193=) rs367546924
NM_001040142.2(SCN2A):c.3643G>T (p.Val1215Phe) rs1064795832
NM_001040142.2(SCN2A):c.3954C>A (p.Ser1318=) rs139507841
NM_001040142.2(SCN2A):c.4879G>A (p.Val1627Met) rs796053156
NM_001040142.2(SCN2A):c.5319G>A (p.Ala1773=) rs373913233
NM_001040142.2(SCN2A):c.5397T>C (p.Tyr1799=) rs200603552
NM_001040142.2(SCN2A):c.5427G>A (p.Ala1809=) rs1177406324
NM_001040142.2(SCN2A):c.5517C>T (p.Leu1839=) rs148424455
NM_001040142.2(SCN2A):c.5580T>G (p.Ala1860=) rs752845880
NM_001040142.2(SCN2A):c.5752C>T (p.Arg1918Cys) rs139899756
NM_001040142.2(SCN2A):c.622G>A (p.Val208Met) rs1064796373
NM_001040436.3(YARS2):c.626A>G (p.Lys209Arg) rs541554381
NM_001040616.3(LINS1):c.1479T>C (p.Cys493=) rs144513217
NM_001042472.3(ABHD12):c.769C>T (p.Arg257Trp) rs41306784
NM_001042492.3(NF1):c.2288T>C (p.Leu763Pro) rs199474762
NM_001042492.3(NF1):c.6147+8C>G rs182709912
NM_001042492.3(NF1):c.7153AACTTT[1] (p.2385NF[1]) rs864622639
NM_001042492.3(NF1):c.7584A>G (p.Gln2528=) rs55865524
NM_001042545.2(LTBP4):c.1491G>T (p.Arg497=) rs117273116
NM_001042545.2(LTBP4):c.1882C>T (p.Arg628Cys) rs200338042
NM_001042545.2(LTBP4):c.4034C>G (p.Pro1345Arg) rs199678003
NM_001042545.2(LTBP4):c.891C>T (p.Gly297=) rs374427407
NM_001042631.2(SDHAF1):c.334C>T (p.Pro112Ser) rs78119534
NM_001042646.3(TRAK1):c.2348C>G (p.Pro783Arg) rs143591096
NM_001042723.2(RYR1):c.4405C>T (p.Arg1469Trp) rs200546266
NM_001048166.1(STIL):c.1069G>A (p.Ala357Thr) rs75426387
NM_001048166.1(STIL):c.1455G>C (p.Leu485Phe) rs139912214
NM_001048171.1(MUTYH):c.1076C>T (p.Ala359Val) rs35352891
NM_001048171.1(MUTYH):c.37-7G>A rs780029247
NM_001048171.1(MUTYH):c.771C>T (p.Asp257=) rs730881838
NM_001048171.1(MUTYH):c.956-9C>T rs3219488
NM_001048174.2(MUTYH):c.1103G>A (p.Gly368Asp) rs36053993
NM_001048174.2(MUTYH):c.11C>T (p.Pro4Leu) rs79777494
NM_001048174.2(MUTYH):c.1347G>C (p.Thr449=) rs74318065
NM_001048174.2(MUTYH):c.228C>T (p.Tyr76=) rs121908380
NM_001048174.2(MUTYH):c.32G>A (p.Gly11Asp) rs75321043
NM_001048174.2(MUTYH):c.637C>T (p.Arg213Trp) rs34126013
NM_001048174.2(MUTYH):c.774G>A (p.Gly258=) rs771290019
NM_001048174.2(MUTYH):c.954G>A (p.Ser318=) rs372673338
NM_001065.4(TNFRSF1A):c.123T>G (p.Asp41Glu) rs104895271
NM_001065.4(TNFRSF1A):c.1329C>A (p.Gly443=) rs756455040
NM_001065.4(TNFRSF1A):c.362G>A (p.Arg121Gln) rs4149584
NM_001070.5(TUBG1):c.776C>T (p.Ser259Leu) rs1555631383
NM_001072.4(UGT1A6):c.862-6606C>T rs34526305
NM_001077365.2(POMT1):c.1149C>T (p.His383=) rs202121299
NM_001077365.2(POMT1):c.1545C>G (p.Ser515Arg) rs150367385
NM_001077365.2(POMT1):c.2178G>A (p.Ter726=) rs147143094
NM_001077415.3(CRELD1):c.959del (p.Gln320fs) rs759473511
NM_001077446.4(TSEN34):c.786C>T (p.Cys262=) rs749845322
NM_001080397.3(SLC45A1):c.-43C>G rs542217083
NM_001080414.4(CCDC88C):c.1527+8G>A rs151228192
NM_001080414.4(CCDC88C):c.2456A>G (p.Asp819Gly) rs61743881
NM_001080414.4(CCDC88C):c.322G>A (p.Gly108Ser) rs61745604
NM_001080414.4(CCDC88C):c.3895C>T (p.Arg1299Cys) rs142539336
NM_001080414.4(CCDC88C):c.4265C>T (p.Ser1422Leu) rs202217944
NM_001080414.4(CCDC88C):c.4668G>A (p.Leu1556=) rs139544500
NM_001080414.4(CCDC88C):c.5296G>A (p.Val1766Met) rs201931182
NM_001080414.4(CCDC88C):c.5980C>G (p.Arg1994Gly) rs45560241
NM_001080414.4(CCDC88C):c.766C>T (p.Leu256=) rs183742506
NM_001080414.4(CCDC88C):c.809+7C>T rs575390201
NM_001080414.4(CCDC88C):c.912C>T (p.Asp304=) rs61736349
NM_001080449.3(DNA2):c.1796G>A (p.Arg599His) rs201999986
NM_001080449.3(DNA2):c.2713C>A (p.Gln905Lys) rs181679245
NM_001080449.3(DNA2):c.68C>T (p.Ala23Val) rs200467869
NM_001080467.3(MYO5B):c.2125G>A (p.Val709Met) rs192207329
NM_001080467.3(MYO5B):c.2203-7T>C rs151267350
NM_001080467.3(MYO5B):c.5395-6C>T rs140275825
NM_001080479.2(ARHGEF28):c.4054G>A (p.Val1352Ile) rs188040167
NM_001080510.4(METTL23):c.569T>C (p.Leu190Pro) rs147321492
NM_001080517.3(SETD5):c.2644C>T (p.Arg882Ter) rs1553635637
NM_001080522.2(CC2D2A):c.351T>G (p.Ser117Arg) rs186264635
NM_001083614.2(EARS2):c.16A>G (p.Arg6Gly) rs113722817
NM_001083961.2(WDR62):c.2976G>A (p.Ser992=) rs757294519
NM_001083961.2(WDR62):c.3763G>A (p.Val1255Ile) rs146180208
NM_001083961.2(WDR62):c.3812C>T (p.Ala1271Val) rs111294536
NM_001083961.2(WDR62):c.3946C>G (p.Gln1316Glu) rs35811023
NM_001083961.2(WDR62):c.4033C>T (p.Arg1345Cys) rs201363122
NM_001083961.2(WDR62):c.4159C>A (p.Leu1387Ile) rs147652186
NM_001083961.2(WDR62):c.4312-5T>G rs182467995
NM_001083962.2(TCF4):c.966T>C (p.Asp322=) rs142998298
NM_001084.5(PLOD3):c.1678G>C (p.Glu560Gln) rs140879834
NM_001084.5(PLOD3):c.805G>A (p.Val269Ile) rs377320080
NM_001097577.3(ANG):c.61C>T (p.Pro21Ser) rs149672657
NM_001098.3(ACO2):c.220C>G (p.Leu74Val) rs141772938
NM_001098.3(ACO2):c.250C>T (p.Arg84Ter) rs387907389
NM_001098484.3(SLC4A4):c.1805A>G (p.Lys602Arg) rs72650362
NM_001099287.1(NIPAL4):c.446C>T (p.Thr149Met) rs188020393
NM_001099857.5(IKBKG):c.169G>A (p.Glu57Lys) rs148695964
NM_001099922.3(ALG13):c.108A>G (p.Arg36=) rs769838471
NM_001100913.3(PACS2):c.625G>A (p.Glu209Lys) rs1555408401
NM_001101.5(ACTB):c.1043C>T (p.Ser348Leu) rs886041309
NM_001101.5(ACTB):c.124G>A (p.Gly42Ser) rs1562719872
NM_001101426.4(CRPPA):c.1054C>A (p.Gln352Lys) rs185594460
NM_001101426.4(CRPPA):c.1059G>A (p.Lys353=) rs181099904
NM_001101426.4(CRPPA):c.184del (p.Val62fs) rs1048457038
NM_001103.3(ACTN2):c.1235C>T (p.Thr412Met) rs139515659
NM_001103.3(ACTN2):c.1452G>A (p.Gln484=) rs200529923
NM_001103.3(ACTN2):c.2147C>T (p.Thr716Met) rs193922635
NM_001103.3(ACTN2):c.893G>A (p.Arg298His) rs142482143
NM_001105206.3(LAMA4):c.2655C>T (p.Leu885=) rs35772073
NM_001110219.3(GJB6):c.595T>A (p.Ser199Thr) rs111033338
NM_001110556.2(FLNA):c.1029C>T (p.Ser343=) rs199853721
NM_001110556.2(FLNA):c.1579C>T (p.Arg527Cys) rs202029322
NM_001110556.2(FLNA):c.1997C>T (p.Ala666Val) rs374295965
NM_001110556.2(FLNA):c.2449C>T (p.Pro817Ser) rs200053635
NM_001110556.2(FLNA):c.3045G>A (p.Ala1015=) rs370868704
NM_001110556.2(FLNA):c.5251C>T (p.Pro1751Ser) rs56102764
NM_001110556.2(FLNA):c.6412G>T (p.Gly2138Cys) rs200524526
NM_001110556.2(FLNA):c.759C>T (p.Asp253=) rs782701643
NM_001110792.2(MECP2):c.1169C>T (p.Ala390Val) rs201314910
NM_001110792.2(MECP2):c.1176G>A (p.Val392=) rs201711454
NM_001110792.2(MECP2):c.1198_1215del (p.Pro400_Pro405del) rs267608406
NM_001110792.2(MECP2):c.1200A>C (p.Pro400=) rs797044732
NM_001110792.2(MECP2):c.1224C>T (p.Ser408=) rs781816931
NM_001110792.2(MECP2):c.1225G>A (p.Glu409Lys) rs56268439
NM_001110792.2(MECP2):c.1232C>T (p.Pro411Leu) rs62915962
NM_001110792.2(MECP2):c.1241C>T (p.Pro414Leu) rs61753014
NM_001110792.2(MECP2):c.1351G>A (p.Ala451Thr) rs61753973
NM_001110792.2(MECP2):c.1363G>A (p.Ala455Thr) rs193922677
NM_001110792.2(MECP2):c.1366G>A (p.Ala456Thr) rs61753975
NM_001110792.2(MECP2):c.1371G>A (p.Thr457=) rs3027927
NM_001110792.2(MECP2):c.204C>T (p.Pro68=) rs61754435
NM_001110792.2(MECP2):c.411C>A (p.Ile137=) rs146107517
NM_001110792.2(MECP2):c.429C>G (p.Ala143=) rs61748385
NM_001110792.2(MECP2):c.433C>T (p.Arg145Cys) rs28934904
NM_001110792.2(MECP2):c.510G>A (p.Thr170=) rs61748413
NM_001110792.2(MECP2):c.633C>G (p.Pro211=) rs782619288
NM_001110792.2(MECP2):c.644C>T (p.Thr215Met) rs61749720
NM_001110792.2(MECP2):c.813C>T (p.Ala271=) rs1042870
NM_001110792.2(MECP2):c.870C>T (p.Ala290=) rs61750248
NM_001110792.2(MECP2):c.876C>T (p.Ala292=) rs61750251
NM_001110792.2(MECP2):c.961C>T (p.Arg321Trp) rs61751444
NM_001111.5(ADAR):c.577C>G (p.Pro193Ala) rs145588689
NM_001111125.3(IQSEC2):c.3364C>T (p.Arg1122Cys) rs782697291
NM_001111125.3(IQSEC2):c.4293C>T (p.Ile1431=) rs782536136
NM_001114636.1(FANCL):c.1111_1114dup (p.Thr372fs) rs759217526
NM_001114636.1(FANCL):c.2T>C (p.Met1Thr) rs761291501
NM_001114748.2(TMEM240):c.509C>T (p.Pro170Leu) rs606231451
NM_001122659.3(EDNRB):c.169G>A (p.Gly57Ser) rs1801710
NM_001126049.2(KLLN):c.-1007C>G rs587780001
NM_001126049.2(KLLN):c.-794_-783del rs587781340
NM_001126049.2(KLLN):c.-898G>A rs538728843
NM_001126131.2(POLG):c.1550G>T (p.Gly517Val) rs61752783
NM_001126131.2(POLG):c.1760C>T (p.Pro587Leu) rs113994096
NM_001126131.2(POLG):c.2890C>T (p.Arg964Cys) rs201477273
NM_001126131.2(POLG):c.752C>T (p.Thr251Ile) rs113994094
NM_001127222.2(CACNA1A):c.1361G>A (p.Arg454Gln) rs561858384
NM_001127222.2(CACNA1A):c.1395G>A (p.Ser465=) rs374307014
NM_001127222.2(CACNA1A):c.1499C>T (p.Thr500Met) rs121908240
NM_001127222.2(CACNA1A):c.1983T>C (p.Phe661=) rs368033271
NM_001127222.2(CACNA1A):c.1995G>A (p.Thr665=) rs376641545
NM_001127222.2(CACNA1A):c.2039_2040del (p.Gln680fs) rs1064794262
NM_001127222.2(CACNA1A):c.2620T>G (p.Ser874Ala) rs751675055
NM_001127222.2(CACNA1A):c.2687C>G (p.Pro896Arg) rs121908242
NM_001127222.2(CACNA1A):c.2955G>C (p.Pro985=) rs749357610
NM_001127222.2(CACNA1A):c.3043G>A (p.Gly1015Arg) rs190551509
NM_001127222.2(CACNA1A):c.3384G>A (p.Pro1128=) rs370541345
NM_001127222.2(CACNA1A):c.3409C>G (p.Pro1137Ala) rs199793367
NM_001127222.2(CACNA1A):c.3618A>G (p.Glu1206=) rs201236364
NM_001127222.2(CACNA1A):c.3683C>T (p.Thr1228Met) rs1057518532
NM_001127222.2(CACNA1A):c.4311G>A (p.Lys1437=) rs572036869
NM_001127222.2(CACNA1A):c.4806C>T (p.Ile1602=) rs372240227
NM_001127222.2(CACNA1A):c.5259C>T (p.Thr1753=) rs376684786
NM_001127222.2(CACNA1A):c.526G>A (p.Val176Met) rs1057521920
NM_001127222.2(CACNA1A):c.6015C>T (p.Ala2005=) rs369675855
NM_001127222.2(CACNA1A):c.6372A>G (p.Ser2124=) rs760994682
NM_001127222.2(CACNA1A):c.6464G>A (p.Arg2155His) rs572722130
NM_001127222.2(CACNA1A):c.6464G>T (p.Arg2155Leu) rs572722130
NM_001127222.2(CACNA1A):c.6483C>T (p.Arg2161=) rs745609731
NM_001127222.2(CACNA1A):c.6647_6658del (p.His2216_His2219del) rs770368215
NM_001127222.2(CACNA1A):c.6669C>T (p.Pro2223=) rs2304094
NM_001127222.2(CACNA1A):c.680T>G (p.Leu227Arg) rs1057522420
NM_001127222.2(CACNA1A):c.7189G>A (p.Val2397Met) rs768129470
NM_001127222.2(CACNA1A):c.888C>T (p.Asn296=) rs372812865
NM_001127222.2(CACNA1A):c.924G>A (p.Val308=) rs754935637
NM_001127644.2(GABRA1):c.1155C>A (p.Gly385=) rs41308303
NM_001127644.2(GABRA1):c.1350A>G (p.Lys450=) rs142385746
NM_001127644.2(GABRA1):c.335G>A (p.Arg112Gln) rs587777308
NM_001127644.2(GABRA1):c.441G>T (p.Arg147=) rs190024862
NM_001127644.2(GABRA1):c.501G>A (p.Pro167=) rs200750234
NM_001127649.3(PEX26):c.728C>T (p.Ala243Val) rs149153003
NM_001127671.2(LIFR):c.2447A>G (p.Asp816Gly) rs74856317
NM_001127698.2(SPINK5):c.1431-12G>A rs368134354
NM_001127698.2(SPINK5):c.802C>T (p.Arg268Cys) rs142558269
NM_001127701.1(SERPINA1):c.1096G>A (p.Glu366Lys) rs28929474
NM_001127701.1(SERPINA1):c.187C>T (p.Arg63Cys) rs28931570
NM_001127713.1(ATL1):c.1173C>T (p.His391=) rs149340140
NM_001127713.1(ATL1):c.715C>T (p.Arg239Cys) rs119476046
NM_001127713.1(ATL1):c.757G>A (p.Val253Ile) rs864622520
NM_001128225.3(SLC39A13):c.398C>T (p.Thr133Met) rs140574574
NM_001128225.3(SLC39A13):c.439C>G (p.Gln147Glu) rs148291843
NM_001128425.1(MUTYH):c.627G>A (p.Gln209=) rs730881837
NM_001128840.3(CACNA1D):c.2552T>G (p.Leu851Trp) rs186968009
NM_001128844.2(SMARCA4):c.2275-3C>A rs117611401
NM_001128849.2(SMARCA4):c.1287G>A (p.Ala429=) rs143600641
NM_001128849.2(SMARCA4):c.223-5C>T rs376775933
NM_001128849.2(SMARCA4):c.3045C>T (p.Gly1015=) rs56101423
NM_001128849.2(SMARCA4):c.3608G>A (p.Arg1203His) rs770680174
NM_001128849.2(SMARCA4):c.3975C>T (p.Arg1325=) rs144803359
NM_001128849.2(SMARCA4):c.4284G>T (p.Thr1428=) rs199847974
NM_001130438.3(SPTAN1):c.1667A>G (p.Asn556Ser) rs778489951
NM_001130438.3(SPTAN1):c.2610A>G (p.Gln870=) rs138101005
NM_001130438.3(SPTAN1):c.2700C>T (p.Asn900=) rs147466898
NM_001130438.3(SPTAN1):c.3912C>T (p.Pro1304=) rs143844598
NM_001130438.3(SPTAN1):c.3970C>T (p.Leu1324=) rs147233101
NM_001130438.3(SPTAN1):c.641A>G (p.Lys214Arg) rs760419507
NM_001130438.3(SPTAN1):c.7155G>A (p.Pro2385=) rs200456378
NM_001130438.3(SPTAN1):c.7199T>C (p.Met2400Thr) rs145054594
NM_001130438.3(SPTAN1):c.7359C>T (p.Tyr2453=) rs138634476
NM_001130823.3(DNMT1):c.393C>T (p.Pro131=) rs143904813
NM_001130823.3(DNMT1):c.406C>T (p.Arg136Cys) rs138841970
NM_001130987.2(DYSF):c.1216G>C (p.Val406Leu) rs150724610
NM_001130987.2(DYSF):c.1931T>C (p.Met644Thr) rs141867897
NM_001130987.2(DYSF):c.2020A>G (p.Lys674Glu) rs139754493
NM_001130987.2(DYSF):c.3111C>T (p.Pro1037=) rs143475751
NM_001130987.2(DYSF):c.3946A>G (p.Ile1316Val) rs121908954
NM_001130987.2(DYSF):c.3968C>A (p.Thr1323Lys) rs116426399
NM_001130987.2(DYSF):c.4037C>T (p.Ala1346Val) rs201476613
NM_001130987.2(DYSF):c.404C>T (p.Pro135Leu) rs773837400
NM_001130987.2(DYSF):c.4254C>T (p.Pro1418=) rs142769942
NM_001130987.2(DYSF):c.4261G>A (p.Val1421Ile) rs767049254
NM_001130987.2(DYSF):c.4462C>T (p.Gln1488Ter) rs886044411
NM_001130987.2(DYSF):c.4859G>A (p.Arg1620His) rs185596534
NM_001130987.2(DYSF):c.5139del (p.Phe1713fs) rs1057519132
NM_001130987.2(DYSF):c.5419C>T (p.Arg1807Trp) rs746243052
NM_001130987.2(DYSF):c.5547-4C>T rs373098428
NM_001130987.2(DYSF):c.5743G>A (p.Asp1915Asn) rs115013641
NM_001130987.2(DYSF):c.6116G>A (p.Arg2039Gln) rs115407852
NM_001130987.2(DYSF):c.6174G>A (p.Arg2058=) rs143762717
NM_001131023.1(PEX5):c.649G>C (p.Val217Leu) rs149102738
NM_001134363.3(RBM20):c.1027C>T (p.His343Tyr) rs112226602
NM_001134363.3(RBM20):c.1633G>A (p.Val545Ile) rs397516596
NM_001134363.3(RBM20):c.1986G>A (p.Pro662=) rs537723089
NM_001134363.3(RBM20):c.2069C>T (p.Pro690Leu) rs550942448
NM_001134363.3(RBM20):c.2452G>T (p.Ala818Ser) rs200271618
NM_001134363.3(RBM20):c.2904C>T (p.Ala968=) rs587781138
NM_001134363.3(RBM20):c.3115C>T (p.Pro1039Ser) rs727503392
NM_001134363.3(RBM20):c.3373G>A (p.Glu1125Lys) rs116908219
NM_001134363.3(RBM20):c.3574-6C>G rs762069628
NM_001134407.3(GRIN2A):c.2069C>T (p.Thr690Met) rs1445802934
NM_001134407.3(GRIN2A):c.2146G>A (p.Ala716Thr)
NM_001134407.3(GRIN2A):c.2191G>A (p.Asp731Asn) rs796052549
NM_001134407.3(GRIN2A):c.2441T>C (p.Ile814Thr) rs780654733
NM_001134407.3(GRIN2A):c.2883C>T (p.Asn961=) rs77705198
NM_001134407.3(GRIN2A):c.3190A>G (p.Thr1064Ala) rs138809301
NM_001134407.3(GRIN2A):c.3535T>G (p.Ser1179Ala) rs142670870
NM_001134407.3(GRIN2A):c.3578T>G (p.Leu1193Trp) rs75761674
NM_001134407.3(GRIN2A):c.447G>A (p.Ala149=) rs144464666
NM_001134407.3(GRIN2A):c.939C>T (p.Ile313=) rs146867324
NM_001134831.2(AHI1):c.2505G>A (p.Arg835=) rs41288017
NM_001134831.2(AHI1):c.2798A>G (p.Tyr933Cys) rs41288013
NM_001136.5(AGER):c.811T>A (p.Trp271Arg) rs140930365
NM_001136.5(AGER):c.902G>C (p.Cys301Ser) rs138178120
NM_001136193.2(FASTKD2):c.149A>G (p.Lys50Arg) rs141447598
NM_001136193.2(FASTKD2):c.29G>C (p.Ser10Thr) rs147727753
NM_001139.3(ALOX12B):c.1642C>T (p.Arg548Trp) rs397514532
NM_001139.3(ALOX12B):c.1790C>A (p.Ala597Glu) rs752509098
NM_001142279.2(RNASEH2B):c.455A>G (p.Asn152Ser) rs146451037
NM_001142386.3(PDK3):c.376A>G (p.Met126Val) rs138321172
NM_001142571.2(RAD51D):c.269A>G (p.Asp90Gly) rs180869630
NM_001142633.2(PIK3R5):c.1076T>C (p.Leu359Ser) rs141086831
NM_001142800.2(EYS):c.2137+1G>A rs199740930
NM_001142800.2(EYS):c.2511C>T (p.Cys837=) rs999155902
NM_001142800.2(EYS):c.2613C>T (p.Asp871=) rs192059823
NM_001142800.2(EYS):c.35T>C (p.Met12Thr)
NM_001142800.2(EYS):c.4554A>C (p.Thr1518=) rs772339340
NM_001142800.2(EYS):c.4985A>T (p.Asp1662Val) rs147641443
NM_001142800.2(EYS):c.5601T>C (p.Ser1867=) rs182322608
NM_001142800.2(EYS):c.5743A>G (p.Ser1915Gly) rs188093810
NM_001142800.2(EYS):c.6416G>A (p.Cys2139Tyr) rs749909863
NM_001142800.2(EYS):c.6528C>A (p.Tyr2176Ter) rs797045089
NM_001142800.2(EYS):c.6535A>G (p.Ile2179Val) rs148019592
NM_001142800.2(EYS):c.7796A>G (p.His2599Arg) rs74636274
NM_001142800.2(EYS):c.977G>A (p.Ser326Asn) rs112822256
NM_001144967.3(NEDD4L):c.1377+7C>T rs372739641
NM_001145026.2(PTPRQ):c.1233G>A (p.Thr411=) rs185755490
NM_001145026.2(PTPRQ):c.54+8G>A rs372908419
NM_001145809.2(MYH14):c.3778G>A (p.Gly1260Ser) rs200272339
NM_001145809.2(MYH14):c.820A>G (p.Ile274Val) rs200424400
NM_001145853.1(WFS1):c.2648_2651del (p.Phe883fs) rs797045076
NM_001146079.2(CLDN14):c.690C>T (p.His230=) rs149733854
NM_001148.6(ANK2):c.10118C>T (p.Ala3373Val) rs371358639
NM_001148.6(ANK2):c.11231C>A (p.Thr3744Asn) rs121912705
NM_001148.6(ANK2):c.11594A>G (p.Asp3865Gly) rs140606121
NM_001148.6(ANK2):c.11716C>T (p.Arg3906Trp) rs121912706
NM_001148.6(ANK2):c.2944C>T (p.Arg982Ter) rs1588354762
NM_001148.6(ANK2):c.6228G>T (p.Lys2076Asn) rs144848998
NM_001148.6(ANK2):c.6854T>C (p.Ile2285Thr) rs150684838
NM_001148.6(ANK2):c.962G>A (p.Arg321Gln) rs150226540
NM_001148.6(ANK2):c.9825T>G (p.Asp3275Glu) rs149043752
NM_001148.6(ANK2):c.997C>T (p.Leu333=) rs201024064
NM_001160372.4(TRAPPC9):c.2811-4G>A rs374826041
NM_001160372.4(TRAPPC9):c.3012C>T (p.Asn1004=) rs148805943
NM_001160372.4(TRAPPC9):c.3249C>T (p.Phe1083=) rs112551069
NM_001161352.2(KCNMA1):c.1320C>T (p.Ile440=) rs45617636
NM_001161352.2(KCNMA1):c.2398G>T (p.Asp800Tyr) rs142210216
NM_001161352.2(KCNMA1):c.3195C>T (p.Thr1065=) rs45527834
NM_001161352.2(KCNMA1):c.3635C>T (p.Thr1212Ile) rs200773083
NM_001163435.3(TBCK):c.2512C>T (p.Gln838Ter)
NM_001163809.1(WDR81):c.2136G>A (p.Gly712=) rs543853235
NM_001163809.1(WDR81):c.2254C>T (p.Pro752Ser) rs200781463
NM_001163809.1(WDR81):c.2871T>C (p.Asn957=) rs369322431
NM_001163809.1(WDR81):c.4324-8G>A rs200150228
NM_001163809.1(WDR81):c.4843G>A (p.Gly1615Arg) rs143688446
NM_001163809.1(WDR81):c.5118T>C (p.Leu1706=) rs138211651
NM_001163809.1(WDR81):c.5231C>T (p.Ala1744Val) rs137952560
NM_001163817.2(DHCR7):c.1341C>T (p.Asp447=) rs139721775
NM_001163817.2(DHCR7):c.89G>C (p.Gly30Ala) rs200334114
NM_001164508.2(NEB):c.154CTGGCACAGCCAGCA[3] (p.52LAQPA[3]) rs377452683
NM_001165927.1(MKS1):c.1378-34_1378-6del rs386834043
NM_001165963.4(SCN1A):c.144C>T (p.Gly48=) rs886043534
NM_001165963.4(SCN1A):c.2360T>C (p.Met787Thr) rs773695263
NM_001165963.4(SCN1A):c.2624C>T (p.Thr875Met) rs121918623
NM_001165963.4(SCN1A):c.2791C>T (p.Arg931Cys) rs121918788
NM_001165963.4(SCN1A):c.3039A>G (p.Gln1013=) rs780391343
NM_001165963.4(SCN1A):c.314C>T (p.Thr105Ile) rs796053089
NM_001165963.4(SCN1A):c.3698G>A (p.Gly1233Asp) rs1553532470
NM_001165963.4(SCN1A):c.3714A>C (p.Glu1238Asp) rs121917973
NM_001165963.4(SCN1A):c.3817G>C (p.Ala1273Pro) rs398123592
NM_001165963.4(SCN1A):c.3924A>T (p.Glu1308Asp) rs121917910
NM_001165963.4(SCN1A):c.4731T>C (p.Asn1577=) rs145296488
NM_001165963.4(SCN1A):c.4787G>A (p.Arg1596His) rs575368466
NM_001165963.4(SCN1A):c.4907G>A (p.Arg1636Gln) rs121917995
NM_001165963.4(SCN1A):c.5639G>A (p.Gly1880Glu) rs201905405
NM_001165963.4(SCN1A):c.5726C>T (p.Thr1909Ile) rs121918793
NM_001165963.4(SCN1A):c.5877G>T (p.Met1959Ile) rs763997333
NM_001165963.4(SCN1A):c.80G>C (p.Arg27Thr) rs121917906
NM_001165963.4(SCN1A):c.986G>T (p.Gly329Val) rs779184118
NM_001166107.1(HMGCS2):c.174C>T (p.Ala58=) rs138739620
NM_001166108.2(PALLD):c.1273A>T (p.Thr425Ser) rs140454899
NM_001166108.2(PALLD):c.1394G>A (p.Arg465His) rs115372194
NM_001166108.2(PALLD):c.1965-12594T>G rs587780760
NM_001166108.2(PALLD):c.2199+8G>A rs200060953
NM_001166108.2(PALLD):c.2393T>C (p.Met798Thr) rs142116575
NM_001166108.2(PALLD):c.2442A>G (p.Thr814=) rs113676921
NM_001166108.2(PALLD):c.365C>T (p.Pro122Leu) rs116158771
NM_001166108.2(PALLD):c.413G>A (p.Arg138Gln) rs138665337
NM_001166114.2(PNPLA6):c.1457C>T (p.Pro486Leu) rs145191932
NM_001166114.2(PNPLA6):c.2359G>A (p.Val787Met) rs145988230
NM_001166114.2(PNPLA6):c.4078G>A (p.Gly1360Ser) rs145178162
NM_001167617.2(MLH1):c.1852G>A (p.Val618Met) rs35831931
NM_001167734.1(VARS2):c.513G>A (p.Met171Ile) rs141408930
NM_001170535.3(ATAD3A):c.158C>T (p.Thr53Ile) rs1057517687
NM_001170629.2(CHD8):c.1690C>T (p.Arg564Ter) rs1057524677
NM_001170629.2(CHD8):c.1791AGA[3] (p.Glu601del) rs757502536
NM_001171.5(ABCC6):c.1171A>G (p.Arg391Gly) rs72653762
NM_001171.5(ABCC6):c.1248C>T (p.Asp416=) rs143487365
NM_001171.5(ABCC6):c.1284C>T (p.Asn428=) rs57499497
NM_001171.5(ABCC6):c.1424A>T (p.His475Leu) rs151187637
NM_001171603.1(PREPL):c.1862A>G (p.Lys621Arg) rs111438719
NM_001172509.2(SATB2):c.1946C>T (p.Ser649Leu) rs746319722
NM_001174089.2(SLC4A11):c.1206C>T (p.Gly402=) rs1396963242
NM_001174089.2(SLC4A11):c.893C>T (p.Ala298Val) rs141705330
NM_001174116.2(DMXL2):c.23C>G (p.Thr8Ser) rs75378828
NM_001174150.2(ARL13B):c.1186C>G (p.Pro396Ala) rs11554412
NM_001177316.2(SLC34A3):c.929G>A (p.Arg310His) rs200477567
NM_001182.5(ALDH7A1):c.-13T>G rs774190967
NM_001182.5(ALDH7A1):c.1232C>T (p.Pro411Leu) rs780233639
NM_001182.5(ALDH7A1):c.1305C>G (p.Val435=) rs142975776
NM_001182.5(ALDH7A1):c.1567A>G (p.Thr523Ala) rs61757684
NM_001182.5(ALDH7A1):c.575C>T (p.Thr192Met) rs376917645
NM_001183.6(ATP6AP1):c.361G>C (p.Glu121Gln) rs148803059
NM_001184.4(ATR):c.2226T>C (p.Cys742=) rs147895945
NM_001184.4(ATR):c.2290A>G (p.Lys764Glu) rs77208665
NM_001184.4(ATR):c.5739-11_5739-4del rs797045404
NM_001184.4(ATR):c.6394T>G (p.Tyr2132Asp) rs28910273
NM_001184785.2(PARD3):c.1046G>A (p.Arg349His) rs199923448
NM_001184880.2(PCDH19):c.1683G>A (p.Pro561=) rs192354176
NM_001184880.2(PCDH19):c.2796C>T (p.Asn932=) rs193148631
NM_001184880.2(PCDH19):c.593G>T (p.Arg198Leu) rs772837341
NM_001184880.2(PCDH19):c.684G>A (p.Val228=) rs201810406
NM_001184880.2(PCDH19):c.769G>C (p.Val257Leu) rs201713027
NM_001190274.2(FBXO11):c.319_320del (p.Leu107fs)
NM_001190417.2(ZNF674):c.586C>T (p.Arg196Ter) rs182004761
NM_001191061.2(SLC25A22):c.132C>T (p.Arg44=) rs146402942
NM_001191061.2(SLC25A22):c.327G>A (p.Ala109=) rs141975755
NM_001191061.2(SLC25A22):c.413-7T>C rs969941249
NM_001191061.2(SLC25A22):c.495C>T (p.Ala165=) rs374780430
NM_001191061.2(SLC25A22):c.500G>A (p.Arg167Gln) rs201089795
NM_001191061.2(SLC25A22):c.876G>A (p.Ala292=) rs146300431
NM_001193416.3(DDX3X):c.1463G>A (p.Arg488His) rs796052235
NM_001193466.2(KANSL1):c.1022G>A (p.Arg341Gln) rs371321182
NM_001193466.2(KANSL1):c.2233A>G (p.Arg745Gly) rs796052596
NM_001193520.1(RASAL1):c.1810T>C (p.Phe604Leu) rs142556970
NM_001194998.2(CEP152):c.1180A>G (p.Ile394Val) rs181295720
NM_001194998.2(CEP152):c.3313C>G (p.Leu1105Val) rs74553953
NM_001195248.2(APTX):c.431C>A (p.Ser144Tyr) rs34778324
NM_001195248.2(APTX):c.742T>A (p.Leu248Met) rs141195622
NM_001195248.2(APTX):c.971A>T (p.Gln324Leu) rs141493373
NM_001195553.2(DCX):c.305G>A (p.Arg102His) rs267606317
NM_001195553.2(DCX):c.339C>A (p.Ile113=) rs587783543
NM_001195553.2(DCX):c.667G>A (p.Gly223Arg) rs587783577
NM_001195553.2(DCX):c.856G>T (p.Ala286Ser) rs149495971
NM_001197104.1(KMT2A):c.478C>T (p.Arg160Ter) rs1555034779
NM_001198800.3(ASCC1):c.107A>G (p.Tyr36Cys) rs145940742
NM_001199107.2(TBC1D24):c.1026G>A (p.Ser342=) rs370244846
NM_001199107.2(TBC1D24):c.1078C>T (p.Arg360Cys) rs1057519629
NM_001199107.2(TBC1D24):c.1326C>T (p.Tyr442=) rs184639841
NM_001199107.2(TBC1D24):c.1500G>A (p.Ala500=) rs201059992
NM_001199107.2(TBC1D24):c.1544C>T (p.Ala515Val) rs267607105
NM_001199107.2(TBC1D24):c.169C>T (p.Arg57Cys) rs202162520
NM_001199107.2(TBC1D24):c.179G>A (p.Arg60Gln) rs200226466
NM_001199107.2(TBC1D24):c.22T>C (p.Cys8Arg) rs77585883
NM_001199107.2(TBC1D24):c.285C>T (p.Phe95=) rs774354974
NM_001199107.2(TBC1D24):c.441C>T (p.Asp147=) rs149371169
NM_001199107.2(TBC1D24):c.641G>A (p.Arg214His) rs200324356
NM_001199107.2(TBC1D24):c.885C>G (p.Phe295Leu) rs72768728
NM_001199861.2(KCNAB2):c.291G>A (p.Val97=) rs34975389
NM_001201543.2(FAM161A):c.1133T>G (p.Leu378Arg) rs187695569
NM_001201543.2(FAM161A):c.1153C>G (p.Gln385Glu) rs139266382
NM_001201543.2(FAM161A):c.847C>T (p.Arg283Ter) rs748847284
NM_001205293.3(CACNA1E):c.1569G>A (p.Met523Ile)
NM_001206744.2(TPO):c.1857C>G (p.Ala619=) rs140322336
NM_001206744.2(TPO):c.9G>A (p.Ala3=) rs61758084
NM_001206999.2(CIT):c.753+8del rs771292782
NM_001231.5(CASQ1):c.1039G>T (p.Gly347Ter) rs150143470
NM_001232.4(CASQ2):c.1185_1187del (p.Asp398del) rs397516641
NM_001235.4(SERPINH1):c.346C>A (p.Arg116Ser) rs200265134
NM_001242897.2(DEPDC5):c.1290C>T (p.Pro430=) rs201202102
NM_001242897.2(DEPDC5):c.501G>A (p.Thr167=) rs766360619
NM_001242957.3(MAK):c.1366_1367del (p.Lys456fs) rs935003657
NM_001242957.3(MAK):c.1700_1703del (p.Asn567fs) rs1347914291
NM_001242957.3(MAK):c.1715T>C (p.Ile572Thr) rs79544660
NM_001242957.3(MAK):c.975G>A (p.Pro325=) rs145014649
NM_001243133.2(NLRP3):c.2107C>A (p.Gln703Lys) rs35829419
NM_001243133.2(NLRP3):c.3005+25C>T rs61841189
NM_001243279.3(ACSF3):c.1470G>C (p.Glu490Asp) rs147538370
NM_001252024.2(TRPM1):c.2848C>T (p.Arg950Trp) rs727504182
NM_001252024.2(TRPM1):c.3549G>C (p.Gln1183His) rs182549235
NM_001253852.3(AP4B1):c.1160_1161del (p.Thr387fs) rs587779388
NM_001253852.3(AP4B1):c.1723A>G (p.Ile575Val) rs114734921
NM_001254.4(CDC6):c.712A>G (p.Thr238Ala) rs4135010
NM_001256071.3(RNF213):c.10424-8G>A rs139828251
NM_001256317.3(TMPRSS3):c.413C>A (p.Ala138Glu) rs147231991
NM_001256447.2(BCAP31):c.383C>T (p.Thr128Met) rs111450526
NM_001256545.2(MEGF10):c.3026-8C>T rs185480820
NM_001256789.3(CACNA1F):c.1523G>A (p.Arg508Gln) rs34162630
NM_001256850.1(TTN):c.32389+5A>C rs373367032
NM_001267550.1(TTN):c.45599C>G rs201057307
NM_001267550.2(TTN):c.100049C>T (p.Thr33350Ile) rs370300135
NM_001267550.2(TTN):c.100696A>G (p.Thr33566Ala) rs878854282
NM_001267550.2(TTN):c.101037G>A (p.Gln33679=) rs377190399
NM_001267550.2(TTN):c.10114+5G>A rs115985443
NM_001267550.2(TTN):c.10115-4G>A rs367648529
NM_001267550.2(TTN):c.101212C>T (p.Arg33738Cys) rs56273463
NM_001267550.2(TTN):c.10163G>A (p.Arg3388Gln) rs187703540
NM_001267550.2(TTN):c.101665G>A (p.Val33889Ile) rs34924609
NM_001267550.2(TTN):c.10188A>G (p.Glu3396=) rs183336802
NM_001267550.2(TTN):c.101925A>G (p.Leu33975=) rs201246720
NM_001267550.2(TTN):c.10242C>T (p.Tyr3414=) rs45447891
NM_001267550.2(TTN):c.102520G>A (p.Val34174Ile) rs200430493
NM_001267550.2(TTN):c.102561C>T (p.Tyr34187=) rs375625664
NM_001267550.2(TTN):c.102751A>G (p.Met34251Val) rs56173891
NM_001267550.2(TTN):c.102984C>T (p.Asp34328=) rs541125667
NM_001267550.2(TTN):c.103302T>C (p.Tyr34434=) rs773408387
NM_001267550.2(TTN):c.103412G>A (p.Arg34471Gln) rs149391616
NM_001267550.2(TTN):c.103688T>C (p.Val34563Ala) rs55945684
NM_001267550.2(TTN):c.104364C>T (p.Ser34788=) rs181679744
NM_001267550.2(TTN):c.104413C>T (p.Arg34805Ter) rs750519430
NM_001267550.2(TTN):c.104414G>A (p.Arg34805Gln) rs115150240
NM_001267550.2(TTN):c.104560G>C (p.Val34854Leu) rs55866005
NM_001267550.2(TTN):c.104774A>C (p.Glu34925Ala) rs201218828
NM_001267550.2(TTN):c.1050C>T (p.Tyr350=) rs375448572
NM_001267550.2(TTN):c.105228G>A (p.Ser35076=) rs55938627
NM_001267550.2(TTN):c.105424G>A (p.Glu35142Lys) rs765274398
NM_001267550.2(TTN):c.106121T>A (p.Phe35374Tyr) rs727504609
NM_001267550.2(TTN):c.106578T>A (p.Ser35526=) rs55838839
NM_001267550.2(TTN):c.106675G>C (p.Glu35559Gln) rs199632397
NM_001267550.2(TTN):c.106820C>T (p.Ala35607Val) rs377337528
NM_001267550.2(TTN):c.106920G>A (p.Leu35640=) rs183923129
NM_001267550.2(TTN):c.107377+1G>A rs112188483
NM_001267550.2(TTN):c.107576T>C (p.Met35859Thr) rs72629793
NM_001267550.2(TTN):c.107635C>T (p.Gln35879Ter) rs757082154
NM_001267550.2(TTN):c.107688G>A (p.Pro35896=) rs542575761
NM_001267550.2(TTN):c.107961T>C (p.His35987=) rs377439315
NM_001267550.2(TTN):c.10922T>C (p.Ile3641Thr) rs141027782
NM_001267550.2(TTN):c.11183dup (p.Leu3729fs) rs778172350
NM_001267550.2(TTN):c.11311+1641C>T rs140804168
NM_001267550.2(TTN):c.11311+1644T>C rs142585268
NM_001267550.2(TTN):c.11311+2465C>G rs116593093
NM_001267550.2(TTN):c.11311+2573T>C rs72647897
NM_001267550.2(TTN):c.11311+2791G>A rs143253411
NM_001267550.2(TTN):c.11311+3440C>T rs72647901
NM_001267550.2(TTN):c.11311+3847G>T rs72647902
NM_001267550.2(TTN):c.11311+4088A>G rs142304137
NM_001267550.2(TTN):c.11311+4338A>C rs139344272
NM_001267550.2(TTN):c.11311+4346A>G rs147073497
NM_001267550.2(TTN):c.11311+4672C>T rs149748934
NM_001267550.2(TTN):c.11311+4802T>C rs139486133
NM_001267550.2(TTN):c.11311+4938C>T rs147513899
NM_001267550.2(TTN):c.11311+5340C>T rs148105798
NM_001267550.2(TTN):c.11312-4319G>A rs72648913
NM_001267550.2(TTN):c.11312-5194_11312-5162dup rs397517815
NM_001267550.2(TTN):c.11338G>A (p.Glu3780Lys) rs727504586
NM_001267550.2(TTN):c.11440G>A (p.Glu3814Lys) rs375103237
NM_001267550.2(TTN):c.11672C>T (p.Thr3891Ile) rs148164929
NM_001267550.2(TTN):c.11756C>A (p.Thr3919Asn) rs727503661
NM_001267550.2(TTN):c.11996A>G (p.Asn3999Ser) rs199844346
NM_001267550.2(TTN):c.12145C>T (p.Pro4049Ser) rs201888760
NM_001267550.2(TTN):c.12181G>A (p.Ala4061Thr) rs397517829
NM_001267550.2(TTN):c.12195T>C (p.Leu4065=) rs201129413
NM_001267550.2(TTN):c.12234C>G (p.Thr4078=) rs192857526
NM_001267550.2(TTN):c.12748G>A (p.Val4250Met) rs201437752
NM_001267550.2(TTN):c.13262A>G (p.Asn4421Ser) rs72648922
NM_001267550.2(TTN):c.13520T>C (p.Met4507Thr) rs191968963
NM_001267550.2(TTN):c.1399-3C>T rs397517486
NM_001267550.2(TTN):c.14424G>C (p.Val4808=) rs374479775
NM_001267550.2(TTN):c.14698G>A (p.Ala4900Thr) rs72648923
NM_001267550.2(TTN):c.14870C>G (p.Thr4957Ser) rs72648925
NM_001267550.2(TTN):c.15178G>C (p.Val5060Leu) rs72648929
NM_001267550.2(TTN):c.15552C>T (p.Thr5184=) rs146353237
NM_001267550.2(TTN):c.15563A>C (p.Gln5188Pro) rs72648930
NM_001267550.2(TTN):c.156C>T (p.Pro52=) rs72647842
NM_001267550.2(TTN):c.1585G>A (p.Ala529Thr) rs143030869
NM_001267550.2(TTN):c.15986G>A (p.Gly5329Asp) rs202234492
NM_001267550.2(TTN):c.16113T>C (p.Asn5371=) rs143845692
NM_001267550.2(TTN):c.16313A>G (p.Lys5438Arg) rs190636272
NM_001267550.2(TTN):c.16551G>A (p.Ser5517=) rs376037792
NM_001267550.2(TTN):c.16581C>T (p.Val5527=) rs373179717
NM_001267550.2(TTN):c.16621+7A>T rs10200398
NM_001267550.2(TTN):c.17048A>G (p.Tyr5683Cys) rs72648942
NM_001267550.2(TTN):c.17082G>T (p.Leu5694=) rs750996600
NM_001267550.2(TTN):c.17184A>G (p.Glu5728=) rs200984007
NM_001267550.2(TTN):c.18407G>A (p.Arg6136Gln) rs117551279
NM_001267550.2(TTN):c.18550G>A (p.Ala6184Thr) rs72648947
NM_001267550.2(TTN):c.18745G>A (p.Asp6249Asn) rs201263441
NM_001267550.2(TTN):c.18776C>G (p.Thr6259Ser) rs72648949
NM_001267550.2(TTN):c.18816T>C (p.Ile6272=) rs146219199
NM_001267550.2(TTN):c.19150C>A (p.Pro6384Thr) rs72648953
NM_001267550.2(TTN):c.19356C>T (p.Ser6452=) rs369275615
NM_001267550.2(TTN):c.1943G>C (p.Arg648Thr) rs550441902
NM_001267550.2(TTN):c.19818A>G (p.Lys6606=) rs397517492
NM_001267550.2(TTN):c.20335A>T (p.Ser6779Cys) rs149470241
NM_001267550.2(TTN):c.20341G>A (p.Glu6781Lys) rs72648958
NM_001267550.2(TTN):c.204C>T (p.Pro68=) rs201089861
NM_001267550.2(TTN):c.20772G>A (p.Lys6924=) rs369993514
NM_001267550.2(TTN):c.20798G>C (p.Gly6933Ala) rs200118743
NM_001267550.2(TTN):c.210G>T (p.Val70=) rs746033038
NM_001267550.2(TTN):c.21148C>T (p.Leu7050=) rs202089818
NM_001267550.2(TTN):c.21364G>A (p.Ala7122Thr) rs201394117
NM_001267550.2(TTN):c.21404-4A>G rs72648965
NM_001267550.2(TTN):c.21548G>A (p.Cys7183Tyr) rs189951108
NM_001267550.2(TTN):c.21555C>A (p.Ile7185=) rs201155967
NM_001267550.2(TTN):c.21656C>T (p.Ser7219Phe) rs201029552
NM_001267550.2(TTN):c.21668G>A (p.Arg7223His) rs138853909
NM_001267550.2(TTN):c.2226C>A (p.Ser742=) rs151025677
NM_001267550.2(TTN):c.2230G>A (p.Ala744Thr) rs144639994
NM_001267550.2(TTN):c.22922C>T (p.Ser7641Leu) rs369508943
NM_001267550.2(TTN):c.23121G>A (p.Lys7707=) rs72648971
NM_001267550.2(TTN):c.23387G>A (p.Arg7796Gln) rs267599059
NM_001267550.2(TTN):c.23616C>T (p.Asn7872=) rs181206334
NM_001267550.2(TTN):c.24156A>G (p.Thr8052=) rs749823104
NM_001267550.2(TTN):c.24195C>T (p.Ser8065=) rs182425565
NM_001267550.2(TTN):c.24820G>A (p.Glu8274Lys) rs72648981
NM_001267550.2(TTN):c.24952G>A (p.Val8318Ile) rs200103997
NM_001267550.2(TTN):c.24964G>T (p.Val8322Leu) rs201571580
NM_001267550.2(TTN):c.24973A>G (p.Lys8325Glu) rs72648984
NM_001267550.2(TTN):c.25209T>C (p.Asp8403=) rs569860898
NM_001267550.2(TTN):c.25704G>A (p.Arg8568=) rs150544093
NM_001267550.2(TTN):c.26494A>G (p.Ile8832Val) rs72648989
NM_001267550.2(TTN):c.26672A>G (p.Asn8891Ser) rs146057575
NM_001267550.2(TTN):c.267G>A (p.Ala89=) rs577716745
NM_001267550.2(TTN):c.2686G>A (p.Val896Ile) rs376768790
NM_001267550.2(TTN):c.27498G>A (p.Ser9166=) rs372528823
NM_001267550.2(TTN):c.27702T>C (p.Ile9234=) rs143368674
NM_001267550.2(TTN):c.28200C>T (p.Asp9400=) rs886044076
NM_001267550.2(TTN):c.28262C>T (p.Thr9421Met) rs375209383
NM_001267550.2(TTN):c.28507G>A (p.Val9503Ile) rs202160275
NM_001267550.2(TTN):c.28849G>A (p.Glu9617Lys) rs144025230
NM_001267550.2(TTN):c.29079G>A (p.Ala9693=) rs372997298
NM_001267550.2(TTN):c.2916G>A (p.Pro972=) rs757569345
NM_001267550.2(TTN):c.29397C>T (p.Gly9799=) rs770084292
NM_001267550.2(TTN):c.30274C>T (p.His10092Tyr) rs72650011
NM_001267550.2(TTN):c.30309T>C (p.Phe10103=) rs762141482
NM_001267550.2(TTN):c.30485C>T (p.Thr10162Met) rs200593368
NM_001267550.2(TTN):c.30718G>T (p.Val10240Phe) rs111671438
NM_001267550.2(TTN):c.30888A>G (p.Lys10296=) rs587780978
NM_001267550.2(TTN):c.3100G>A (p.Val1034Met) rs142951505
NM_001267550.2(TTN):c.31399G>A (p.Val10467Ile) rs72650019
NM_001267550.2(TTN):c.31456A>T (p.Ile10486Phe) rs772882862
NM_001267550.2(TTN):c.31757C>A (p.Pro10586Gln) rs200459347
NM_001267550.2(TTN):c.31762+5_31762+7del rs397517538
NM_001267550.2(TTN):c.31837C>G (p.Pro10613Ala) rs200213832
NM_001267550.2(TTN):c.3241G>A (p.Ala1081Thr) rs55914517
NM_001267550.2(TTN):c.32462C>T (p.Pro10821Leu) rs146400809
NM_001267550.2(TTN):c.32480C>T (p.Ala10827Val) rs72650030
NM_001267550.2(TTN):c.32554+5_32554+6del rs771419718
NM_001267550.2(TTN):c.32557C>T (p.Pro10853Ser) rs201738153
NM_001267550.2(TTN):c.32624C>T (p.Pro10875Leu) rs72650031
NM_001267550.2(TTN):c.32731G>A (p.Glu10911Lys) rs199620003
NM_001267550.2(TTN):c.32970_32987del (p.10987_10989EEY[1]) rs766756026
NM_001267550.2(TTN):c.33059A>G (p.Tyr11020Cys) rs72650035
NM_001267550.2(TTN):c.33063A>G (p.Glu11021=) rs115744476
NM_001267550.2(TTN):c.33416G>C (p.Arg11139Thr) rs72650040
NM_001267550.2(TTN):c.33501AGA[4] (p.Glu11172del) rs368327166
NM_001267550.2(TTN):c.33856G>A (p.Glu11286Lys) rs376874956
NM_001267550.2(TTN):c.34098GGAAGAGGAAGTTCTACCTGA[1] (p.11363VLPEEEE[3]) rs397517548
NM_001267550.2(TTN):c.3409G>C (p.Gly1137Arg) rs72647870
NM_001267550.2(TTN):c.34140A>G (p.Glu11380=) rs147418835
NM_001267550.2(TTN):c.34474C>A (p.Pro11492Thr) rs182428755
NM_001267550.2(TTN):c.34845C>T (p.Pro11615=) rs368781863
NM_001267550.2(TTN):c.34864G>A (p.Val11622Ile) rs202014478
NM_001267550.2(TTN):c.35794G>T (p.Glu11932Ter) rs878854299
NM_001267550.2(TTN):c.36347A>G (p.Glu12116Gly) rs200513156
NM_001267550.2(TTN):c.36405G>A (p.Val12135=) rs373815877
NM_001267550.2(TTN):c.36509A>T (p.Glu12170Val) rs200840285
NM_001267550.2(TTN):c.37525G>A (p.Glu12509Lys) rs201797790
NM_001267550.2(TTN):c.38311A>G (p.Lys12771Glu) rs551811137
NM_001267550.2(TTN):c.38336T>C (p.Val12779Ala) rs2099130
NM_001267550.2(TTN):c.38902C>T (p.Pro12968Ser) rs192528655
NM_001267550.2(TTN):c.39211+6C>T rs187365142
NM_001267550.2(TTN):c.39466C>A (p.Pro13156Thr) rs72650064
NM_001267550.2(TTN):c.39709+6C>T rs72650067
NM_001267550.2(TTN):c.40408+8del rs727504922
NM_001267550.2(TTN):c.40498G>T (p.Val13500Phe) rs201944202
NM_001267550.2(TTN):c.41103C>T (p.Gly13701=) rs72650077
NM_001267550.2(TTN):c.41330-7T>A rs373636988
NM_001267550.2(TTN):c.41521G>A (p.Asp13841Asn) rs201257644
NM_001267550.2(TTN):c.42672G>T (p.Leu14224=) rs368155350
NM_001267550.2(TTN):c.42687C>T (p.Ala14229=) rs775889693
NM_001267550.2(TTN):c.43161G>A (p.Glu14387=) rs765214404
NM_001267550.2(TTN):c.4359A>T (p.Arg1453Ser) rs376857956
NM_001267550.2(TTN):c.4396T>C (p.Phe1466Leu) rs151310601
NM_001267550.2(TTN):c.44418C>T (p.Ser14806=) rs368005198
NM_001267550.2(TTN):c.44589G>A (p.Thr14863=) rs369800903
NM_001267550.2(TTN):c.45273C>T (p.Asn15091=) rs72677223
NM_001267550.2(TTN):c.45408G>T (p.Lys15136Asn) rs72677225
NM_001267550.2(TTN):c.46451G>A (p.Arg15484Lys) rs72677229
NM_001267550.2(TTN):c.46800A>G (p.Glu15600=) rs190058852
NM_001267550.2(TTN):c.47077G>A (p.Val15693Ile) rs201717871
NM_001267550.2(TTN):c.47191C>T (p.Arg15731Cys) rs72677231
NM_001267550.2(TTN):c.47248G>A (p.Val15750Ile) rs72677232
NM_001267550.2(TTN):c.47315G>A (p.Arg15772Gln) rs72677233
NM_001267550.2(TTN):c.47513G>A (p.Arg15838Gln) rs199640194
NM_001267550.2(TTN):c.47936C>T (p.Pro15979Leu) rs184815126
NM_001267550.2(TTN):c.47978C>A (p.Thr15993Asn) rs727503622
NM_001267550.2(TTN):c.48727C>T (p.Pro16243Ser) rs72677242
NM_001267550.2(TTN):c.49395C>T (p.Asp16465=) rs749308557
NM_001267550.2(TTN):c.49413G>T (p.Trp16471Cys) rs202094100
NM_001267550.2(TTN):c.50714G>A (p.Arg16905His) rs191539637
NM_001267550.2(TTN):c.50858-3C>T rs587782987
NM_001267550.2(TTN):c.51678C>T (p.Asn17226=) rs372635204
NM_001267550.2(TTN):c.51809G>T (p.Ser17270Ile) rs200650668
NM_001267550.2(TTN):c.52409C>A (p.Pro17470Gln) rs372618781
NM_001267550.2(TTN):c.52852C>T (p.Arg17618Cys) rs201213901
NM_001267550.2(TTN):c.53096G>A (p.Arg17699His) rs72646808
NM_001267550.2(TTN):c.53122A>G (p.Lys17708Glu) rs185913848
NM_001267550.2(TTN):c.54160G>C (p.Val18054Leu) rs200968679
NM_001267550.2(TTN):c.54189T>C (p.Tyr18063=) rs2303834
NM_001267550.2(TTN):c.543C>T (p.Ser181=) rs758598014
NM_001267550.2(TTN):c.54903C>G (p.Gly18301=) rs190830121
NM_001267550.2(TTN):c.55290C>T (p.Pro18430=) rs777904054
NM_001267550.2(TTN):c.55374C>G (p.Ser18458Arg) rs200550947
NM_001267550.2(TTN):c.55553A>G (p.Lys18518Arg) rs72646823
NM_001267550.2(TTN):c.55673G>A (p.Arg18558His) rs115867512
NM_001267550.2(TTN):c.55925T>A (p.Leu18642Gln) rs140714512
NM_001267550.2(TTN):c.56403A>G (p.Gln18801=) rs553313488
NM_001267550.2(TTN):c.56535G>A (p.Thr18845=) rs529480368
NM_001267550.2(TTN):c.5697C>T (p.Ile1899=) rs148434577
NM_001267550.2(TTN):c.57112-4C>T rs117072049
NM_001267550.2(TTN):c.57212T>C (p.Ile19071Thr) rs200001206
NM_001267550.2(TTN):c.57646A>G (p.Ile19216Val) rs374058726
NM_001267550.2(TTN):c.58008T>C (p.Asn19336=) rs770525693
NM_001267550.2(TTN):c.5823A>G (p.Arg1941=) rs149668487
NM_001267550.2(TTN):c.58419A>G (p.Gln19473=) rs186563991
NM_001267550.2(TTN):c.59318A>G (p.Glu19773Gly) rs371719028
NM_001267550.2(TTN):c.59344+3G>A rs142095604
NM_001267550.2(TTN):c.5993G>A (p.Arg1998His) rs144135510
NM_001267550.2(TTN):c.60721G>C (p.Glu20241Gln) rs200212521
NM_001267550.2(TTN):c.61100G>A (p.Arg20367Gln) rs141973925
NM_001267550.2(TTN):c.6162C>T (p.Ala2054=) rs143265948
NM_001267550.2(TTN):c.61876C>T (p.Arg20626Ter) rs72646846
NM_001267550.2(TTN):c.61922G>A (p.Arg20641Gln) rs199895260
NM_001267550.2(TTN):c.62317C>A (p.Leu20773Met) rs375173874
NM_001267550.2(TTN):c.62385C>A (p.Gly20795=) rs72646848
NM_001267550.2(TTN):c.62424C>T (p.Asp20808=) rs374472044
NM_001267550.2(TTN):c.62468G>A (p.Arg20823His) rs758019778
NM_001267550.2(TTN):c.62572A>G (p.Thr20858Ala) rs200689750
NM_001267550.2(TTN):c.63109C>T (p.Arg21037Cys) rs191549948
NM_001267550.2(TTN):c.63165G>A (p.Pro21055=) rs72646852
NM_001267550.2(TTN):c.63329C>T (p.Ala21110Val) rs370687831
NM_001267550.2(TTN):c.63352C>T (p.Arg21118Trp) rs200726948
NM_001267550.2(TTN):c.63439G>A (p.Ala21147Thr) rs72646853
NM_001267550.2(TTN):c.63577C>T (p.Arg21193Cys) rs376800688
NM_001267550.2(TTN):c.63589A>G (p.Ile21197Val) rs72646855
NM_001267550.2(TTN):c.63626G>A (p.Arg21209Gln) rs148684589
NM_001267550.2(TTN):c.63942G>A (p.Ser21314=) rs201285872
NM_001267550.2(TTN):c.64174C>T (p.Arg21392Cys) rs72646859
NM_001267550.2(TTN):c.65459C>T (p.Thr21820Ile) rs56130023
NM_001267550.2(TTN):c.65534C>T (p.Pro21845Leu) rs201662134
NM_001267550.2(TTN):c.65604T>C (p.Ala21868=) rs200825430
NM_001267550.2(TTN):c.65672C>T (p.Pro21891Leu) rs397517662
NM_001267550.2(TTN):c.66391A>G (p.Thr22131Ala) rs140842479
NM_001267550.2(TTN):c.66590G>A (p.Arg22197Gln) rs374656017
NM_001267550.2(TTN):c.67099T>C (p.Ser22367Pro) rs72646873
NM_001267550.2(TTN):c.67146C>T (p.Gly22382=) rs770418172
NM_001267550.2(TTN):c.67706G>A (p.Arg22569Gln) rs185620750
NM_001267550.2(TTN):c.68082C>T (p.Cys22694=) rs79406408
NM_001267550.2(TTN):c.68437G>A (p.Glu22813Lys) rs200797552
NM_001267550.2(TTN):c.68458G>C (p.Ala22820Pro) rs72646880
NM_001267550.2(TTN):c.68792G>A (p.Ser22931Asn) rs201567815
NM_001267550.2(TTN):c.68824G>A (p.Glu22942Lys) rs199506676
NM_001267550.2(TTN):c.69130C>T (p.Pro23044Ser) rs55980498
NM_001267550.2(TTN):c.69716-5C>G rs72646886
NM_001267550.2(TTN):c.69821G>A (p.Gly23274Asp) rs201043950
NM_001267550.2(TTN):c.70042G>A (p.Ala23348Thr) rs775146212
NM_001267550.2(TTN):c.70102A>G (p.Ile23368Val) rs367914610
NM_001267550.2(TTN):c.7061G>A (p.Arg2354His) rs75031300
NM_001267550.2(TTN):c.70677T>C (p.Asp23559=) rs72646890
NM_001267550.2(TTN):c.70815G>A (p.Val23605=) rs55847238
NM_001267550.2(TTN):c.71036G>A (p.Arg23679Lys) rs200144345
NM_001267550.2(TTN):c.71373T>G (p.Leu23791=) rs56245285
NM_001267550.2(TTN):c.71602C>T (p.Arg23868Ter) rs397517689
NM_001267550.2(TTN):c.71705T>C (p.Ile23902Thr) rs55837610
NM_001267550.2(TTN):c.72132T>C (p.Gly24044=) rs56169243
NM_001267550.2(TTN):c.72146T>C (p.Leu24049Pro) rs56399205
NM_001267550.2(TTN):c.72302C>A (p.Thr24101Asn) rs192962624
NM_001267550.2(TTN):c.72379G>A (p.Glu24127Lys) rs149763294
NM_001267550.2(TTN):c.72766A>G (p.Asn24256Asp) rs187868672
NM_001267550.2(TTN):c.72931A>G (p.Thr24311Ala) rs56201325
NM_001267550.2(TTN):c.7316G>A (p.Arg2439His) rs142129359
NM_001267550.2(TTN):c.73604C>A (p.Ser24535Tyr) rs201804005
NM_001267550.2(TTN):c.73705G>C (p.Val24569Leu) rs755676676
NM_001267550.2(TTN):c.73825G>C (p.Glu24609Gln) rs55762754
NM_001267550.2(TTN):c.74597CAA[1] (p.Thr24867del) rs543318580
NM_001267550.2(TTN):c.74602A>G (p.Ile24868Val) rs72646898
NM_001267550.2(TTN):c.74895A>C (p.Gln24965His) rs201512527
NM_001267550.2(TTN):c.75034C>T (p.Arg25012Trp) rs368914555
NM_001267550.2(TTN):c.75099C>T (p.Asp25033=) rs370272814
NM_001267550.2(TTN):c.7523A>G (p.His2508Arg) rs146970027
NM_001267550.2(TTN):c.75527G>A (p.Arg25176His) rs375693396
NM_001267550.2(TTN):c.75738A>G (p.Glu25246=) rs371344165
NM_001267550.2(TTN):c.75762G>T (p.Val25254=) rs374003257
NM_001267550.2(TTN):c.7619G>A (p.Arg2540His) rs397517725
NM_001267550.2(TTN):c.76722T>C (p.Tyr25574=) rs55696153
NM_001267550.2(TTN):c.77052C>T (p.Gly25684=) rs372543652
NM_001267550.2(TTN):c.77205G>A (p.Val25735=) rs55857909
NM_001267550.2(TTN):c.77716G>A (p.Glu25906Lys) rs56341835
NM_001267550.2(TTN):c.77813G>C (p.Trp25938Ser) rs186681106
NM_001267550.2(TTN):c.78855T>C (p.Asp26285=) rs139953862
NM_001267550.2(TTN):c.78892G>A (p.Gly26298Arg) rs72648205
NM_001267550.2(TTN):c.79226G>A (p.Arg26409His) rs72648206
NM_001267550.2(TTN):c.79344G>T (p.Val26448=) rs369875680
NM_001267550.2(TTN):c.7957T>C (p.Leu2653=) rs201837864
NM_001267550.2(TTN):c.79863G>A (p.Thr26621=) rs186402008
NM_001267550.2(TTN):c.80586C>T (p.Ser26862=) rs748292845
NM_001267550.2(TTN):c.8069C>T (p.Thr2690Ile) rs374620001
NM_001267550.2(TTN):c.80722A>C (p.Arg26908=) rs573877174
NM_001267550.2(TTN):c.81105C>A (p.Thr27035=) rs72648212
NM_001267550.2(TTN):c.81464T>C (p.Ile27155Thr) rs397517720
NM_001267550.2(TTN):c.81472C>G (p.Pro27158Ala) rs200771189
NM_001267550.2(TTN):c.81539T>C (p.Ile27180Thr) rs182126530
NM_001267550.2(TTN):c.81558T>C (p.Asn27186=) rs56181243
NM_001267550.2(TTN):c.81892G>A (p.Asp27298Asn) rs200697681
NM_001267550.2(TTN):c.81899G>A (p.Arg27300His) rs55850344
NM_001267550.2(TTN):c.82402A>C (p.Lys27468Gln) rs201958805
NM_001267550.2(TTN):c.82489G>A (p.Gly27497Arg) rs201158906
NM_001267550.2(TTN):c.82691C>T (p.Ala27564Val) rs55634791
NM_001267550.2(TTN):c.82810G>A (p.Gly27604Ser) rs199929362
NM_001267550.2(TTN):c.8292G>A (p.Leu2764=) rs727503687
NM_001267550.2(TTN):c.82934G>A (p.Arg27645His) rs766522109
NM_001267550.2(TTN):c.82964G>A (p.Gly27655Asp) rs373745130
NM_001267550.2(TTN):c.83171T>G (p.Val27724Gly) rs201896662
NM_001267550.2(TTN):c.83281G>A (p.Val27761Ile) rs371788070
NM_001267550.2(TTN):c.83516G>A (p.Arg27839Gln) rs376820301
NM_001267550.2(TTN):c.835C>T (p.Arg279Trp) rs138060032
NM_001267550.2(TTN):c.83618T>C (p.Val27873Ala) rs200775919
NM_001267550.2(TTN):c.83733C>T (p.Ser27911=) rs375442124
NM_001267550.2(TTN):c.84263G>A (p.Ser28088Asn) rs200450022
NM_001267550.2(TTN):c.84640A>G (p.Met28214Val) rs72648221
NM_001267550.2(TTN):c.84871C>T (p.Arg28291Cys) rs192152102
NM_001267550.2(TTN):c.85406C>G (p.Ser28469Cys) rs202040332
NM_001267550.2(TTN):c.85651C>A (p.Pro28551Thr) rs142478636
NM_001267550.2(TTN):c.86052T>C (p.Thr28684=) rs76928874
NM_001267550.2(TTN):c.8641A>C (p.Thr2881Pro) rs546667760
NM_001267550.2(TTN):c.86729AAG[1] (p.Glu28911del) rs727504797
NM_001267550.2(TTN):c.86949A>G (p.Glu28983=) rs375565646
NM_001267550.2(TTN):c.87412C>A (p.Pro29138Thr) rs72648227
NM_001267550.2(TTN):c.87495C>T (p.Asp29165=) rs371763584
NM_001267550.2(TTN):c.87623A>T (p.Tyr29208Phe) rs201831707
NM_001267550.2(TTN):c.87707-4G>T rs201770959
NM_001267550.2(TTN):c.8788G>A (p.Val2930Ile) rs56373393
NM_001267550.2(TTN):c.88394C>T (p.Ser29465Phe) rs146181116
NM_001267550.2(TTN):c.88459G>A (p.Val29487Met) rs200899806
NM_001267550.2(TTN):c.88721G>A (p.Arg29574His) rs111727915
NM_001267550.2(TTN):c.88972A>G (p.Ile29658Val) rs200193877
NM_001267550.2(TTN):c.89314G>A (p.Glu29772Lys) rs200503016
NM_001267550.2(TTN):c.89386G>A (p.Val29796Met) rs72648237
NM_001267550.2(TTN):c.8938G>A (p.Ala2980Thr) rs72647885
NM_001267550.2(TTN):c.89426G>A (p.Arg29809Gln) rs72648238
NM_001267550.2(TTN):c.89457A>G (p.Gly29819=) rs1553542686
NM_001267550.2(TTN):c.89946C>T (p.Val29982=) rs373311459
NM_001267550.2(TTN):c.90758GAG[2] (p.Gly30255del) rs748912340
NM_001267550.2(TTN):c.91347T>C (p.Asp30449=) rs193022702
NM_001267550.2(TTN):c.9139T>A (p.Ser3047Thr) rs946142615
NM_001267550.2(TTN):c.91557T>C (p.Asp30519=) rs202185465
NM_001267550.2(TTN):c.91573A>G (p.Ile30525Val) rs72648244
NM_001267550.2(TTN):c.91601A>T (p.Asp30534Val) rs182549226
NM_001267550.2(TTN):c.91643C>T (p.Ala30548Val) rs553668520
NM_001267550.2(TTN):c.92009T>C (p.Ile30670Thr) rs369342933
NM_001267550.2(TTN):c.92176C>T (p.Pro30726Ser) rs72648247
NM_001267550.2(TTN):c.92362G>A (p.Gly30788Ser) rs199891245
NM_001267550.2(TTN):c.92684G>A (p.Arg30895Gln) rs200141081
NM_001267550.2(TTN):c.92696T>C (p.Ile30899Thr) rs373727636
NM_001267550.2(TTN):c.92699A>G (p.Asn30900Ser) rs186234393
NM_001267550.2(TTN):c.92780T>A (p.Ile30927Lys) rs531432790
NM_001267550.2(TTN):c.92806G>A (p.Val30936Ile) rs200476500
NM_001267550.2(TTN):c.93005G>T (p.Ser31002Ile) rs180975448