ClinVar Miner

Variants from Department of Pathology and Laboratory Medicine,Sinai Health System with conflicting interpretations

Location: Canada — Primary collection method: clinical testing
Minimum review status of the submission from Department of Pathology and Laboratory Medicine,Sinai Health System: Collection method of the submission from Department of Pathology and Laboratory Medicine,Sinai Health System:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
5965 1013 38 395 668 41 183 1162

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
Department of Pathology and Laboratory Medicine,Sinai Health System pathogenic likely pathogenic uncertain significance likely benign benign affects association drug response protective risk factor other
pathogenic 0 37 13 3 6 0 1 4 1 10 5
likely pathogenic 29 0 9 0 0 0 0 0 0 1 1
uncertain significance 104 49 15 348 194 0 1 6 1 6 6
likely benign 9 2 135 1 209 2 3 0 0 5 2
benign 1 4 53 120 22 0 0 1 0 1 2

Submitter to submitter summary #

Total submitters: 119
Download table as spreadsheet
Submitter Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
GeneDx 0 564 0 95 180 0 86 359
Invitae 0 242 0 78 186 1 10 275
PreventionGenetics, PreventionGenetics 0 155 0 58 100 0 2 160
EGL Genetic Diagnostics, Eurofins Clinical Diagnostics 0 271 0 43 89 11 19 159
Quest Diagnostics Nichols Institute San Juan Capistrano 0 239 0 59 45 0 36 140
Integrated Genetics/Laboratory Corporation of America 0 235 0 52 80 0 3 135
CeGaT Praxis fuer Humangenetik Tuebingen 0 165 0 35 59 0 21 114
ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories 0 211 0 41 44 1 17 103
Genetic Services Laboratory, University of Chicago 0 60 0 27 61 1 0 89
Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine 0 123 0 14 71 1 2 88
Mayo Clinic Laboratories, Mayo Clinic 0 90 0 23 31 0 21 74
Biesecker Lab/Clinical Genomics Section,National Institutes of Health 0 8 35 8 21 0 0 64
Illumina Clinical Services Laboratory,Illumina 0 52 0 19 32 0 7 57
OMIM 0 18 0 0 3 24 15 41
Athena Diagnostics Inc 0 50 0 14 25 0 3 41
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 0 40 0 12 10 0 9 31
Counsyl 0 61 0 17 11 0 1 29
CHEO Genetics Diagnostic Laboratory,Children's Hospital of Eastern Ontario 0 28 0 19 7 0 1 27
Ambry Genetics 0 27 0 3 24 0 0 27
Mendelics 0 32 0 12 6 0 2 20
Sharing Clinical Reports Project (SCRP) 0 46 0 9 10 0 0 19
Breast Cancer Information Core (BIC) (BRCA2) 0 32 0 0 16 0 1 17
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) 0 65 0 13 4 0 0 17
Foulkes Cancer Genetics LDI, Lady Davis Institute for Medical Research 0 27 0 0 5 0 9 14
Clinical Genetics Karolinska University Hospital,Karolinska University Hospital 0 18 0 1 0 0 13 14
Breast Cancer Information Core (BIC) (BRCA1) 0 23 0 0 9 0 3 12
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute 0 4 0 1 8 2 0 11
Research Molecular Genetics Laboratory,Women's College Hospital, University of Toronto 0 26 0 7 2 0 2 11
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics,Children's Hospital of Philadelphia 0 6 0 3 7 0 0 10
International Society for Gastrointestinal Hereditary Tumours (InSiGHT) 0 30 1 6 0 0 1 8
GeneKor MSA 0 46 0 1 2 0 5 8
Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen 0 23 0 2 0 0 6 8
Natera, Inc. 0 7 0 0 7 0 0 7
Fulgent Genetics,Fulgent Genetics 0 27 0 4 0 0 3 7
PharmGKB 0 0 0 0 0 7 0 7
GeneReviews 0 2 0 0 0 0 6 6
Constitutional Genetics Lab,Leon Berard Cancer Center 0 5 0 0 0 0 6 6
Genomic Research Center, Shahid Beheshti University of Medical Sciences 0 8 0 2 1 0 2 5
DNA and Cytogenetics Diagnostics Unit,Erasmus Medical Center 0 9 0 4 1 0 0 5
University of Washington Department of Laboratory Medicine, University of Washington 0 5 0 0 2 0 3 5
Pathway Genomics 0 11 0 4 0 0 0 4
Centre for Mendelian Genomics,University Medical Centre Ljubljana 0 5 0 1 1 0 2 4
Department of Pathology and Molecular Medicine,Queen's University 0 12 0 4 0 0 0 4
King Laboratory,University of Washington 0 0 0 1 1 0 1 3
Blueprint Genetics 0 3 0 1 1 0 1 3
CSER _CC_NCGL, University of Washington 0 10 0 2 1 0 0 3
Lupski Lab, Baylor-Hopkins CMG, Baylor College of Medicine 0 0 0 0 0 0 3 3
NIHR Bioresource Rare Diseases, University of Cambridge 0 4 0 3 0 0 1 3
Center of Medical Genetics and Primary Health Care 0 5 0 3 0 0 0 3
Yale Center for Mendelian Genomics,Yale University 0 0 0 0 0 0 3 3
Leiden Open Variation Database 0 9 0 1 2 0 0 3
Gharavi Laboratory,Columbia University 0 6 0 0 1 0 2 3
Institute for Genomic Medicine (IGM) Clinical Laboratory,Nationwide Children's Hospital 0 1 0 2 1 0 0 3
ClinGen CDH1 Variant Curation Expert Panel 0 2 0 1 2 0 0 3
CFTR-France 0 1 0 1 0 0 2 3
Center for Human Genetics, Inc,Center for Human Genetics, Inc 0 0 0 0 0 0 2 2
Medical Genetics Laboratory, Kennedy Center,Juliane Marie Center, Rigshospitalet 0 0 0 1 0 0 1 2
Genome Diagnostics Laboratory,University Medical Center Utrecht 0 5 0 1 1 0 0 2
Martin Pollak Laboratory, Beth Israel Deaconess Medical Center 0 0 2 0 0 0 0 2
Developmental Genetics Unit,King Faisal Specialist Hospital & Research Centre 0 1 0 1 0 0 2 2
Molecular Genetics and Enzymology, National Research Centre 0 0 0 0 1 0 1 2
University of Washington Center for Mendelian Genomics, University of Washington 0 0 0 1 0 0 2 2
Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA), c/o University of Cambridge 0 50 0 2 0 0 0 2
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego 0 0 0 1 0 0 1 2
CIViC knowledgebase,Washington University School of Medicine 0 0 0 0 0 2 0 2
3DMed Clinical Laboratory Inc 0 3 0 0 2 0 0 2
New York Genome Center 0 3 0 0 1 0 1 2
Baylor Genetics 0 4 0 1 0 0 1 1
Elsea Laboratory,Baylor College of Medicine 0 0 0 0 0 0 1 1
FirmaLab,FirmaLab 0 0 0 0 0 0 1 1
Michigan Medical Genetics Laboratories,University of Michigan 0 8 0 1 0 0 0 1
Human Genome Sequencing Center Clinical Lab, Baylor College of Medicine 0 9 0 0 0 1 0 1
Department of Psychiatry,Nagoya University 0 0 0 1 0 0 1 1
Wellcome Centre for Mitochondrial Research,Newcastle University 0 0 0 1 0 0 0 1
Northcott Neuroscience Laboratory, ANZAC Research Institute 0 0 0 0 0 0 1 1
Department of Medical Genetics, Oslo University Hospital 0 8 0 1 0 0 0 1
Center for Medical Genetics Ghent,University of Ghent 0 0 0 1 0 0 1 1
Vavilov Institute of General Genetics RAS, Laboratory of Evolutional Genomics 0 0 0 0 0 1 0 1
Stanford Center for Inherited Cardiovascular Disease, Stanford University 0 2 0 0 1 0 0 1
Division of Human Genetics,Children's Hospital of Philadelphia 0 1 0 0 0 0 1 1
Lyon Laboratory, Cold Spring Harbor Laboratory 0 0 0 0 0 0 1 1
HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology 0 3 0 0 0 0 1 1
Genome Sciences Centre,British Columbia Cancer Agency 0 0 0 1 0 0 1 1
Pediatric Highly Intensive Care Unit,Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico 0 0 0 0 0 0 1 1
Daryl Scott Lab,Baylor College of Medicine 0 0 0 0 0 0 1 1
Neurogenetics Laboratory - MEYER,AOU Meyer 0 0 0 0 0 0 1 1
Undiagnosed Diseases Network,NIH 0 0 0 1 0 0 1 1
Equipe Genetique des Anomalies du Developpement, Université de Bourgogne 0 3 0 1 0 0 1 1
Institute of Human Genetics, University of Leipzig Medical Center 0 5 0 0 1 0 0 1
Neurogenetics Research Program, University of Adelaide 0 0 0 0 1 0 0 1
Department of Pathology and Laboratory Medicine,Sinai Health System 8138 1 0 0 0 0 1 1
Geisinger Autism and Developmental Medicine Institute,Geisinger Health System 0 0 0 1 1 0 1 1
Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde,Academisch Medisch Centrum 0 0 0 0 1 0 0 1
Rare Disease Group, Clinical Genetics,Karolinska Institutet 0 0 0 1 1 0 1 1
Institute of Cellular and Molecular Medicine,Copenhagen University 0 0 0 1 0 0 1 1
Flegel Lab,National Institutes of Health 0 0 0 0 0 0 1 1
Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago 0 2 0 0 1 0 0 1
Laboratoire de Genetique Moleculaire,Centre Hospitalier Universitaire de Bordeaux 0 0 0 0 0 0 1 1
Medical Genetics Lab,Policlinico S. Orsola.Malpighi 0 0 0 1 0 0 1 1
Medical Cytogenetics and Molecular Genetics Laboratory,IRCCS Istituto Auxologico Italiano 0 0 0 0 1 0 1 1
Broad Institute Rare Disease Group, Broad Institute 0 2 0 1 0 0 0 1
Department of Molecular Diagnostics, Institute of Oncology Ljubljana 0 4 0 0 0 0 1 1
St. Jude Clinical Genomics Lab, St. Jude Children's Research Hospital 0 2 0 1 0 0 0 1
Clinical Cancer Genetics and Family Consultants,Athens Medical Center 0 0 0 0 0 0 1 1
Michaelson Lab,University of Iowa 0 0 0 0 0 0 1 1
Cavalleri Lab, Royal College of Surgeons in Ireland 0 1 0 1 0 0 0 1
Pathology and Clinical Laboratory Medicine,King Fahad Medical City 0 0 0 0 0 0 1 1
Molecular Pathology Diagnostics Labratory,University of Iowa Hospitals & Clinics 0 0 0 1 0 0 1 1
Biochemistry Laboratory of CDMU,Chengde Medical University 0 0 0 1 0 0 1 1
CZECANCA consortium 0 10 0 0 0 0 1 1
UT Southwestern Medical Center, UT Southwestern Medical Center 0 0 0 0 0 1 0 1
Myriad Women's Health, Inc. 0 1 0 1 0 0 0 1
University Health Network,Princess Margaret Cancer Centre 0 0 0 0 0 0 1 1
Central Laboratory,The First Hospital of Lanzhou University 0 0 0 0 0 0 1 1
Suna and Inan Kirac Foundation Neurodegeneration Research Laboratory, Koc University 0 0 0 0 0 0 1 1
Genetics and Prenatal Diagnosis Center,The First Affiliated Hospital of Zhengzhou University 0 0 0 1 0 0 1 1
Faculty of Health Sciences,Beirut Arab University 0 0 0 1 0 0 0 1
Dept. Genetics and Cancer, Menzies Institute for Medical Research,University of Tasmania 0 0 0 0 1 0 1 1
Wilkie Group, Clinical Genetics Lab, WIMM,University of Oxford 0 0 0 0 0 0 1 1

All variants with conflicting interpretations #

Total variants: 1162
Download table as spreadsheet
HGVS dbSNP
NC_000002.12:g.(?_47482779)_(47482949_?)del
NM_000029.4(AGT):c.151T>C (p.Cys51Arg) rs61731497
NM_000030.3(AGXT):c.836T>C (p.Ile279Thr) rs140992177
NM_000033.4(ABCD1):c.1823G>A (p.Gly608Asp) rs78993751
NM_000036.2(AMPD1):c.1261C>T (p.Arg421Trp) rs35859650
NM_000036.2(AMPD1):c.133C>T (p.Gln45Ter) rs17602729
NM_000036.2(AMPD1):c.567G>T (p.Gln189His) rs139582106
NM_000036.2(AMPD1):c.959A>T (p.Lys320Ile) rs34526199
NM_000038.6(APC):c.120G>A (p.Glu40=) rs142720069
NM_000038.6(APC):c.1549-13A>T rs587781267
NM_000038.6(APC):c.1557A>G (p.Leu519=) rs765537673
NM_000038.6(APC):c.1596A>G (p.Gln532=) rs1331131200
NM_000038.6(APC):c.1690C>T (p.Arg564Ter) rs137854574
NM_000038.6(APC):c.2395dup (p.Tyr799fs) rs879254110
NM_000038.6(APC):c.2547_2550del (p.Asp849fs) rs398123118
NM_000038.6(APC):c.2805C>A (p.Tyr935Ter) rs137854575
NM_000038.6(APC):c.3147G>A (p.Trp1049Ter) rs863225340
NM_000038.6(APC):c.3173A>G (p.Asp1058Gly) rs148725540
NM_000038.6(APC):c.317G>A (p.Arg106His) rs201764637
NM_000038.6(APC):c.3249T>G (p.Asp1083Glu) rs201629780
NM_000038.6(APC):c.3352A>G (p.Asn1118Asp) rs140493115
NM_000038.6(APC):c.3378C>G (p.Ser1126Arg) rs149353082
NM_000038.6(APC):c.3511C>T (p.Arg1171Cys) rs201830995
NM_000038.6(APC):c.3529A>G (p.Ile1177Val) rs369834416
NM_000038.6(APC):c.3632T>G (p.Met1211Arg) rs575268622
NM_000038.6(APC):c.388A>G (p.Ser130Gly) rs150973053
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000038.6(APC):c.4072G>A (p.Ala1358Thr) rs139618756
NM_000038.6(APC):c.4212C>T (p.Ser1404=) rs144655979
NM_000038.6(APC):c.423-4del rs730881230
NM_000038.6(APC):c.4645C>T (p.Gln1549Ter) rs863225357
NM_000038.6(APC):c.487C>T (p.Gln163Ter) rs863225362
NM_000038.6(APC):c.5140G>A (p.Asp1714Asn) rs148275069
NM_000038.6(APC):c.5225G>A (p.Arg1742His) rs199775075
NM_000038.6(APC):c.5250C>T (p.Val1750=) rs2229997
NM_000038.6(APC):c.5265G>A (p.Ala1755=) rs34506289
NM_000038.6(APC):c.5274T>A (p.Ser1758=) rs199600387
NM_000038.6(APC):c.5304G>A (p.Lys1768=) rs863224285
NM_000038.6(APC):c.5363G>A (p.Arg1788His) rs201472075
NM_000038.6(APC):c.562C>T (p.Gln188Ter) rs869312753
NM_000038.6(APC):c.607C>G (p.Gln203Glu) rs141576417
NM_000038.6(APC):c.6354TGC[5] (p.Ala2122dup) rs587780602
NM_000038.6(APC):c.645+1G>A rs863225370
NM_000038.6(APC):c.6510A>C (p.Pro2170=) rs138571760
NM_000038.6(APC):c.7036C>T (p.Pro2346Ser) rs200756935
NM_000038.6(APC):c.7514G>A (p.Arg2505Gln) rs147549623
NM_000038.6(APC):c.7821C>T (p.Ser2607=) rs532235331
NM_000038.6(APC):c.7986G>A (p.Glu2662=) rs571645304
NM_000038.6(APC):c.8107A>G (p.Lys2703Glu) rs730881270
NM_000038.6(APC):c.841A>G (p.Thr281Ala) rs769727966
NM_000038.6(APC):c.904C>T (p.Arg302Ter) rs137854568
NM_000041.2(APOE):c.526C>T (p.Arg176Cys) rs7412
NM_000041.4(APOE):c.388T>C (p.Cys130Arg) rs429358
NM_000044.6(AR):c.1174C>T (p.Pro392Ser) rs201934623
NM_000044.6(AR):c.2395C>G (p.Gln799Glu) rs137852591
NM_000051.3(ATM):c.162T>C (p.Tyr54=) rs3218690
NM_000051.3(ATM):c.1744T>C (p.Phe582Leu) rs2235006
NM_000051.3(ATM):c.186A>G (p.Arg62=) rs876658224
NM_000051.3(ATM):c.1953A>G (p.Leu651=) rs730881283
NM_000051.3(ATM):c.2085G>A (p.Leu695=) rs786202229
NM_000051.3(ATM):c.2119T>C (p.Ser707Pro) rs4986761
NM_000051.3(ATM):c.2466+7A>G rs55812024
NM_000051.3(ATM):c.2839-4T>C rs1057522619
NM_000051.3(ATM):c.3118A>G (p.Met1040Val) rs3092857
NM_000051.3(ATM):c.3285-15C>T rs770928986
NM_000051.3(ATM):c.4138C>T (p.His1380Tyr) rs3092856
NM_000051.3(ATM):c.4167A>G (p.Thr1389=) rs183214437
NM_000051.3(ATM):c.4949A>G (p.Asn1650Ser) rs55870064
NM_000051.3(ATM):c.6095+6T>C rs1057522992
NM_000051.3(ATM):c.609C>T (p.Asp203=) rs144709948
NM_000051.3(ATM):c.6234C>T (p.Ser2078=) rs569483748
NM_000051.3(ATM):c.7271T>G (p.Val2424Gly) rs28904921
NM_000051.3(ATM):c.7592T>C (p.Met2531Thr) rs587781365
NM_000051.3(ATM):c.876G>A (p.Pro292=) rs755860432
NM_000051.3(ATM):c.998C>T (p.Ser333Phe) rs28904919
NM_000051.4(ATM):c.295A>G (p.Ser99Gly) rs137882485
NM_000051.4(ATM):c.8977C>T (p.Arg2993Ter) rs770641163
NM_000053.4(ATP7B):c.1216T>G (p.Ser406Ala) rs1801243
NM_000053.4(ATP7B):c.1366G>C (p.Val456Leu) rs1801244
NM_000053.4(ATP7B):c.2495A>G (p.Lys832Arg) rs1061472
NM_000053.4(ATP7B):c.2855G>A (p.Arg952Lys) rs732774
NM_000053.4(ATP7B):c.3396C>T (p.Ser1132=) rs370947152
NM_000053.4(ATP7B):c.3419T>C (p.Val1140Ala) rs1801249
NM_000053.4(ATP7B):c.3903+6C>T rs2282057
NM_000059.3(BRCA2):c.10220A>G (p.Asn3407Ser) rs80358401
NM_000059.3(BRCA2):c.10222A>T (p.Lys3408Ter) rs80358402
NM_000059.3(BRCA2):c.1244A>G (p.His415Arg) rs80358417
NM_000059.3(BRCA2):c.1460C>A (p.Ala487Glu) rs56390402
NM_000059.3(BRCA2):c.1889C>T (p.Thr630Ile) rs80358479
NM_000059.3(BRCA2):c.1964del (p.Pro655fs) rs1555282375
NM_000059.3(BRCA2):c.2095C>T (p.Gln699Ter) rs878853559
NM_000059.3(BRCA2):c.2145A>G (p.Gly715=) rs112566179
NM_000059.3(BRCA2):c.2320A>G (p.Thr774Ala) rs55968715
NM_000059.3(BRCA2):c.2412A>G (p.Glu804=) rs587780866
NM_000059.3(BRCA2):c.267G>A (p.Pro89=) rs587780648
NM_000059.3(BRCA2):c.2786del (p.Leu929fs) rs80359347
NM_000059.3(BRCA2):c.2870del (p.Asn957fs) rs397507645
NM_000059.3(BRCA2):c.314T>G (p.Leu105Ter) rs80358561
NM_000059.3(BRCA2):c.3578C>T (p.Ala1193Val) rs431825310
NM_000059.3(BRCA2):c.3672C>T (p.Gly1224=) rs587780650
NM_000059.3(BRCA2):c.3682A>G (p.Asn1228Asp) rs28897722
NM_000059.3(BRCA2):c.3785C>G (p.Ser1262Ter) rs80358620
NM_000059.3(BRCA2):c.3873del (p.Gln1291fs) rs398122772
NM_000059.3(BRCA2):c.4061C>T (p.Thr1354Met) rs80358656
NM_000059.3(BRCA2):c.4090A>C (p.Ile1364Leu) rs56248502
NM_000059.3(BRCA2):c.425+33A>G rs200065709
NM_000059.3(BRCA2):c.426-37T>A rs81002859
NM_000059.3(BRCA2):c.4314C>T (p.Val1438=) rs730881590
NM_000059.3(BRCA2):c.455C>A (p.Thr152Lys) rs80358691
NM_000059.3(BRCA2):c.4578A>G (p.Thr1526=) rs202022822
NM_000059.3(BRCA2):c.4686A>G (p.Gln1562=) rs28897730
NM_000059.3(BRCA2):c.469_470del (p.Lys157fs) rs397507739
NM_000059.3(BRCA2):c.4828G>A (p.Val1610Met) rs80358705
NM_000059.3(BRCA2):c.506A>G (p.Lys169Arg) rs80358730
NM_000059.3(BRCA2):c.5095G>A (p.Asp1699Asn) rs80358731
NM_000059.3(BRCA2):c.5159C>A (p.Ser1720Ter) rs80358740
NM_000059.3(BRCA2):c.516+14C>T rs182828913
NM_000059.3(BRCA2):c.517-19C>T rs11571623
NM_000059.3(BRCA2):c.5344C>A (p.Gln1782Lys) rs80358757
NM_000059.3(BRCA2):c.5455C>T (p.Pro1819Ser) rs80358768
NM_000059.3(BRCA2):c.5704G>A (p.Asp1902Asn) rs4987048
NM_000059.3(BRCA2):c.5710C>G (p.Leu1904Val) rs55875643
NM_000059.3(BRCA2):c.5723_5724del (p.Leu1908fs) rs886040608
NM_000059.3(BRCA2):c.5862_5863del (p.Ser1955fs) rs786202700
NM_000059.3(BRCA2):c.627C>T (p.Leu209=) rs28897704
NM_000059.3(BRCA2):c.6412G>T (p.Val2138Phe) rs11571659
NM_000059.3(BRCA2):c.67+62T>G rs11571574
NM_000059.3(BRCA2):c.6935A>T (p.Asp2312Val) rs80358916
NM_000059.3(BRCA2):c.7008-2A>T rs81002823
NM_000059.3(BRCA2):c.7008-62A>G rs76584943
NM_000059.3(BRCA2):c.7188G>A (p.Leu2396=) rs587780871
NM_000059.3(BRCA2):c.7601C>T (p.Ala2534Val) rs74047012
NM_000059.3(BRCA2):c.7618-6G>T rs1057520251
NM_000059.3(BRCA2):c.7806-40A>G rs9590939
NM_000059.3(BRCA2):c.7928C>G (p.Ala2643Gly) rs80359018
NM_000059.3(BRCA2):c.8014A>G (p.Ile2672Val) rs80359037
NM_000059.3(BRCA2):c.8487+9T>A rs1593930592
NM_000059.3(BRCA2):c.8924del (p.Val2975fs) rs397508020
NM_000059.3(BRCA2):c.8991T>G (p.Tyr2997Ter) rs397508028
NM_000059.3(BRCA2):c.9076C>G (p.Gln3026Glu) rs80359159
NM_000059.3(BRCA2):c.9148C>T (p.Gln3050Ter) rs80359170
NM_000059.3(BRCA2):c.9235del (p.Val3079fs) rs397507422
NM_000059.3(BRCA2):c.9253A>C (p.Thr3085Pro) rs397507423
NM_000059.3(BRCA2):c.9270C>T (p.Phe3090=) rs587780873
NM_000059.3(BRCA2):c.927A>G (p.Ser309=) rs80359806
NM_000059.3(BRCA2):c.9302T>G (p.Leu3101Arg) rs28897758
NM_000059.3(BRCA2):c.9433G>C (p.Val3145Leu) rs587776476
NM_000059.3(BRCA2):c.943T>A (p.Cys315Ser) rs79483201
NM_000059.3(BRCA2):c.9649-6dup rs276174929
NM_000059.3(BRCA2):c.9843A>G (p.Pro3281=) rs11571832
NM_000059.4(BRCA2):c.10095delinsGAATTATATCT (p.Ser3366fs) rs276174803
NM_000059.4(BRCA2):c.10110G>A (p.Arg3370=) rs28897762
NM_000059.4(BRCA2):c.10121C>T (p.Thr3374Ile) rs56309455
NM_000059.4(BRCA2):c.10202C>T (p.Thr3401Met) rs55853199
NM_000059.4(BRCA2):c.10203G>A (p.Thr3401=) rs147854265
NM_000059.4(BRCA2):c.1114A>C (p.Asn372His) rs144848
NM_000059.4(BRCA2):c.1151C>T (p.Ser384Phe) rs41293475
NM_000059.4(BRCA2):c.125A>G (p.Tyr42Cys) rs4987046
NM_000059.4(BRCA2):c.1362A>G (p.Lys454=) rs55919657
NM_000059.4(BRCA2):c.1385A>G (p.Glu462Gly) rs56403624
NM_000059.4(BRCA2):c.1395A>C (p.Val465=) rs11571641
NM_000059.4(BRCA2):c.1514T>C (p.Ile505Thr) rs28897708
NM_000059.4(BRCA2):c.1662T>G (p.Cys554Trp) rs80358451
NM_000059.4(BRCA2):c.1773_1776del (p.Ile591fs) rs80359304
NM_000059.4(BRCA2):c.1792A>G (p.Thr598Ala) rs28897710
NM_000059.4(BRCA2):c.1938C>T (p.Ser646=) rs28897711
NM_000059.4(BRCA2):c.1964C>G (p.Pro655Arg) rs28897712
NM_000059.4(BRCA2):c.2233A>G (p.Lys745Glu) rs374691587
NM_000059.4(BRCA2):c.223G>C (p.Ala75Pro) rs28897701
NM_000059.4(BRCA2):c.2550A>G (p.Gln850=) rs80359785
NM_000059.4(BRCA2):c.2716A>G (p.Thr906Ala) rs80358528
NM_000059.4(BRCA2):c.2751A>G (p.Val917=) rs765644162
NM_000059.4(BRCA2):c.2883G>A (p.Gln961=) rs11571655
NM_000059.4(BRCA2):c.2971A>G (p.Asn991Asp) rs1799944
NM_000059.4(BRCA2):c.3515C>T (p.Ser1172Leu) rs80358600
NM_000059.4(BRCA2):c.3516G>A (p.Ser1172=) rs1799952
NM_000059.4(BRCA2):c.3581G>A (p.Gly1194Asp) rs28897721
NM_000059.4(BRCA2):c.3869G>A (p.Cys1290Tyr) rs41293485
NM_000059.4(BRCA2):c.4405_4409del (p.Asp1469fs) rs397507331
NM_000059.4(BRCA2):c.4436G>C (p.Ser1479Thr) rs80358678
NM_000059.4(BRCA2):c.4585G>A (p.Gly1529Arg) rs28897728
NM_000059.4(BRCA2):c.5199C>T (p.Ser1733=) rs28897734
NM_000059.4(BRCA2):c.5312G>A (p.Gly1771Asp) rs80358755
NM_000059.4(BRCA2):c.5616_5620del (p.Lys1872fs) rs80359525
NM_000059.4(BRCA2):c.5635G>A (p.Glu1879Lys) rs55996097
NM_000059.4(BRCA2):c.5640T>G (p.Asn1880Lys) rs11571657
NM_000059.4(BRCA2):c.5645C>A (p.Ser1882Ter) rs80358785
NM_000059.4(BRCA2):c.5729A>T (p.Asn1910Ile) rs276174863
NM_000059.4(BRCA2):c.5744C>T (p.Thr1915Met) rs4987117
NM_000059.4(BRCA2):c.5752C>T (p.His1918Tyr) rs80358803
NM_000059.4(BRCA2):c.5785A>G (p.Ile1929Val) rs79538375
NM_000059.4(BRCA2):c.5813G>C (p.Gly1938Ala) rs41293499
NM_000059.4(BRCA2):c.5851_5854del rs80359543
NM_000059.4(BRCA2):c.5869A>G (p.Ile1957Val) rs80358817
NM_000059.4(BRCA2):c.6100C>T (p.Arg2034Cys) rs1799954
NM_000059.4(BRCA2):c.6275_6276del rs11571658
NM_000059.4(BRCA2):c.6317T>C (p.Leu2106Pro) rs56172926
NM_000059.4(BRCA2):c.6322C>T (p.Arg2108Cys) rs55794205
NM_000059.4(BRCA2):c.6323G>A (p.Arg2108His) rs35029074
NM_000059.4(BRCA2):c.6347A>G (p.His2116Arg) rs55953736
NM_000059.4(BRCA2):c.6748A>G (p.Thr2250Ala) rs80358899
NM_000059.4(BRCA2):c.6853A>G (p.Ile2285Val) rs56272235
NM_000059.4(BRCA2):c.7057G>C (p.Gly2353Arg) rs80358935
NM_000059.4(BRCA2):c.7435+6G>A rs81002852
NM_000059.4(BRCA2):c.7436-4A>G rs81002904
NM_000059.4(BRCA2):c.7448G>A (p.Ser2483Asn) rs80358967
NM_000059.4(BRCA2):c.7463G>A (p.Arg2488Lys) rs80358968
NM_000059.4(BRCA2):c.7504C>T (p.Arg2502Cys) rs55716624
NM_000059.4(BRCA2):c.7521A>G (p.Pro2507=) rs759383358
NM_000059.4(BRCA2):c.7544C>T (p.Thr2515Ile) rs28897744
NM_000059.4(BRCA2):c.7563C>A (p.Ile2521=) rs786204282
NM_000059.4(BRCA2):c.7806-2A>G rs81002836
NM_000059.4(BRCA2):c.7879A>T (p.Ile2627Phe) rs80359014
NM_000059.4(BRCA2):c.793+1G>A rs81002846
NM_000059.4(BRCA2):c.794-11T>C rs81002822
NM_000059.4(BRCA2):c.7988A>T (p.Glu2663Val) rs80359031
NM_000059.4(BRCA2):c.8010G>A (p.Ser2670=) rs146430937
NM_000059.4(BRCA2):c.8243G>A (p.Gly2748Asp) rs80359071
NM_000059.4(BRCA2):c.8470A>T (p.Arg2824Ter) rs886040778
NM_000059.4(BRCA2):c.8487+19A>G rs11571743
NM_000059.4(BRCA2):c.8503T>C (p.Ser2835Pro) rs11571746
NM_000059.4(BRCA2):c.8567A>C (p.Glu2856Ala) rs11571747
NM_000059.4(BRCA2):c.865A>C (p.Asn289His) rs766173
NM_000059.4(BRCA2):c.8830A>T (p.Ile2944Phe) rs4987047
NM_000059.4(BRCA2):c.8850G>T (p.Lys2950Asn) rs28897754
NM_000059.4(BRCA2):c.8917C>T (p.Arg2973Cys) rs45469092
NM_000059.4(BRCA2):c.8954-5A>G rs886040949
NM_000059.4(BRCA2):c.9038C>T (p.Thr3013Ile) rs28897755
NM_000059.4(BRCA2):c.9501+3A>T rs61757642
NM_000059.4(BRCA2):c.9502-12T>G rs81002803
NM_000059.4(BRCA2):c.956A>G (p.Asn319Ser) rs55939572
NM_000059.4(BRCA2):c.978C>A (p.Ser326Arg) rs28897706
NM_000059.4(BRCA2):c.9976A>T (p.Lys3326Ter) rs11571833
NM_000065.4(C6):c.2381+2T>C rs76202909
NM_000071.3(CBS):c.1080C>T (p.Ala360=) rs1801181
NM_000080.4(CHRNE):c.488C>T (p.Ser163Leu) rs121909516
NM_000091.5(COL4A3):c.3829G>A rs190598500
NM_000092.4(COL4A4):c.4760C>G (p.Pro1587Arg) rs190148408
NM_000092.5(COL4A4):c.3018A>T (p.Arg1006Ser) rs531161419
NM_000094.3(COL7A1):c.1613G>A (p.Arg538His) rs138791004
NM_000094.3(COL7A1):c.4559C>T (p.Pro1520Leu) rs140114392
NM_000094.3(COL7A1):c.5819C>T (p.Pro1940Leu) rs149267939
NM_000094.3(COL7A1):c.724G>A (p.Glu242Lys) rs549872555
NM_000094.3(COL7A1):c.923T>C (p.Ile308Thr) rs145738101
NM_000094.4(COL7A1):c.5096C>T rs121912845
NM_000094.4(COL7A1):c.8539C>T (p.Pro2847Ser)
NM_000096.4(CP):c.1430C>T (p.Pro477Leu) rs35331711
NM_000112.3(SLC26A2):c.172C>T (p.Arg58Cys) rs369318758
NM_000122.1(ERCC3):c.2111C>T (p.Ser704Leu) rs4150521
NM_000123.3(ERCC5):c.1586G>C (p.Cys529Ser) rs2227869
NM_000123.3(ERCC5):c.1789G>C (p.Val597Leu) rs4150319
NM_000123.3(ERCC5):c.2636A>G (p.Asn879Ser) rs4150342
NM_000123.3(ERCC5):c.2877A>C (p.Arg959Ser) rs41281674
NM_000123.3(ERCC5):c.3177C>T (p.Gly1059=) rs148856875
NM_000124.4(ERCC6):c.1996C>T (p.Arg666Cys) rs61760163
NM_000124.4(ERCC6):c.3122A>C (p.Gln1041Pro) rs139007661
NM_000125.3(ESR1):c.406C>T (p.Pro136Ser) rs201145204
NM_000128.3(F11):c.901T>C (p.Phe301Leu) rs121965064
NM_000130.4(F5):c.3853C>A (p.Leu1285Ile) rs1046712
NM_000130.4(F5):c.4095C>T (p.Thr1365=) rs9332607
NM_000130.4(F5):c.730+7C>T rs6023
NM_000130.5(F5):c.1601= (p.Arg534=) rs6025
NM_000135.4(FANCA):c.3412C>G (p.Leu1138Val) rs138417003
NM_000136.3(FANCC):c.1069C>T (p.Gln357Ter) rs759900071
NM_000136.3(FANCC):c.1407G>A (p.Thr469=) rs79722116
NM_000136.3(FANCC):c.816C>T (p.Ile272=) rs55719336
NM_000136.3(FANCC):c.934A>G (p.Ile312Val) rs1800366
NM_000136.3(FANCC):c.973G>A (p.Ala325Thr) rs201407189
NM_000137.4(FAH):c.1062+5G>A rs80338901
NM_000152.5(GAA):c.1203G>A (p.Gln401=) rs1800304
NM_000152.5(GAA):c.2338G>A (p.Val780Ile) rs1126690
NM_000152.5(GAA):c.2553G>A (p.Gly851=) rs1042397
NM_000152.5(GAA):c.324T>C (p.Cys108=) rs1800300
NM_000152.5(GAA):c.546G>A (p.Thr182=) rs143523371
NM_000152.5(GAA):c.547-4C>G rs3816256
NM_000152.5(GAA):c.596A>G (p.His199Arg) rs1042393
NM_000152.5(GAA):c.668G>A (p.Arg223His) rs1042395
NM_000152.5(GAA):c.955+12G>A rs2252455
NM_000153.4(GALC):c.334A>G (p.Thr112Ala) rs147313927
NM_000155.4(GALT):c.563A>G (p.Gln188Arg) rs75391579
NM_000155.4(GALT):c.598del (p.Gln200fs) rs111033738
NM_000155.4(GALT):c.940A>G (p.Asn314Asp) rs2070074
NM_000155.4(GALT):c.945T>C (p.His315=) rs61735982
NM_000168.6(GLI3):c.2119C>T (p.Pro707Ser) rs121917716
NM_000179.2(MSH6):c.1081C>T (p.Arg361Cys) rs587782651
NM_000179.2(MSH6):c.1714C>T (p.Gln572Ter) rs1064795256
NM_000179.2(MSH6):c.1822A>G (p.Ile608Val) rs201613780
NM_000179.2(MSH6):c.2418C>T (p.Ser806=) rs770992427
NM_000179.2(MSH6):c.260+22C>G rs55927047
NM_000179.2(MSH6):c.2910G>A (p.Trp970Ter) rs765411990
NM_000179.2(MSH6):c.3173-10C>T rs587780559
NM_000179.2(MSH6):c.3399T>C (p.Thr1133=) rs61748084
NM_000179.2(MSH6):c.3439-16C>T rs192614006
NM_000179.2(MSH6):c.3439-1G>T rs587779263
NM_000179.2(MSH6):c.3456A>G (p.Val1152=) rs750998416
NM_000179.2(MSH6):c.3557-4del rs267608102
NM_000179.2(MSH6):c.3646+35_3646+38del rs1805181
NM_000179.2(MSH6):c.3802-40C>G rs3136367
NM_000179.2(MSH6):c.3852G>A (p.Thr1284=) rs2229018
NM_000179.2(MSH6):c.3911G>A (p.Arg1304Lys) rs34625968
NM_000179.2(MSH6):c.4001+11_4001+15dup rs587779302
NM_000179.2(MSH6):c.4002-10del rs59056100
NM_000179.2(MSH6):c.694C>T (p.Gln232Ter) rs587779318
NM_000179.2(MSH6):c.867C>A (p.Gly289=) rs267608047
NM_000179.3(MSH6):c.1135_1139del (p.Arg378_Arg379insTer) rs267608077
NM_000179.3(MSH6):c.2667G>T (p.Gln889His) rs149945495
NM_000179.3(MSH6):c.3246G>T (p.Pro1082=) rs3136351
NM_000179.3(MSH6):c.3261dup (p.Phe1088fs) rs267608078
NM_000179.3(MSH6):c.3964G>T rs1553333707
NM_000179.3(MSH6):c.4001+4_4001+8dup rs587782853
NM_000179.3(MSH6):c.4004A>C (p.Glu1335Ala) rs564434147
NM_000179.3(MSH6):c.4068_4071dup (p.Lys1358delinsAspTer) rs55740729
NM_000179.3(MSH6):c.884A>G (p.Lys295Arg) rs267608051
NM_000203.5(IDUA):c.246C>G (p.His82Gln) rs148775298
NM_000218.3(KCNQ1):c.1590+14T>C rs11024034
NM_000218.3(KCNQ1):c.1986C>T (p.Tyr662=) rs11601907
NM_000219.6(KCNE1):c.253G>A (p.Asp85Asn) rs1805128
NM_000222.2(KIT):c.1694G>T (p.Gly565Val) rs200945282
NM_000222.2(KIT):c.821C>T (p.Thr274Met) rs138585275
NM_000224.3(KRT18):c.689G>C (p.Ser230Thr) rs58472472
NM_000228.3(LAMB3):c.332A>G (p.Asp111Gly) rs55824996
NM_000233.4(LHCGR):c.568C>A (p.Gln190Lys) rs61996318
NM_000237.3(LPL):c.953A>G (p.Asn318Ser) rs268
NM_000238.3(KCNH2):c.2617G>A (p.Gly873Ser) rs41314354
NM_000243.2(MEFV):c.1760-30T>A rs1231123
NM_000243.2(MEFV):c.2084A>G rs104895094
NM_000243.2(MEFV):c.306T>C (p.Asp102=) rs224225
NM_000243.2(MEFV):c.414A>G (p.Gly138=) rs224224
NM_000243.2(MEFV):c.495C>A (p.Ala165=) rs224223
NM_000243.2(MEFV):c.605G>A (p.Arg202Gln) rs224222
NM_000243.2(MEFV):c.910G>A (p.Gly304Arg) rs75977701
NM_000243.2(MEFV):c.942C>T (p.Arg314=) rs224213
NM_000243.3(MEFV):c.1105C>T rs11466023
NM_000243.3(MEFV):c.1223G>A rs11466024
NM_000243.3(MEFV):c.442G>C rs3743930
NM_000249.3(MLH1):c.1128T>C (p.Asp376=) rs267607824
NM_000249.3(MLH1):c.1266C>T (p.Gly422=) rs63750791
NM_000249.3(MLH1):c.1401C>T (p.Ser467=) rs587778910
NM_000249.3(MLH1):c.1731G>A (p.Ser577=) rs63751657
NM_000249.3(MLH1):c.1896G>A (p.Glu632=) rs63751632
NM_000249.3(MLH1):c.1963A>G (p.Ile655Val) rs55907433
NM_000249.3(MLH1):c.1975C>T (p.Arg659Ter) rs63751310
NM_000249.3(MLH1):c.198C>T (p.Thr66=) rs61751642
NM_000249.3(MLH1):c.2001C>T (p.Asp667=) rs63750014
NM_000249.3(MLH1):c.2041G>A (p.Ala681Thr) rs63750217
NM_000249.3(MLH1):c.2061G>A (p.Arg687=) rs1553664545
NM_000249.3(MLH1):c.207+1G>A rs267607718
NM_000249.3(MLH1):c.2101C>A (p.Gln701Lys) rs63750114
NM_000249.3(MLH1):c.2103+1G>A rs267607888
NM_000249.3(MLH1):c.2174G>A (p.Arg725His) rs566928243
NM_000249.3(MLH1):c.2250C>G (p.Tyr750Ter) rs267607893
NM_000249.3(MLH1):c.277A>G (p.Ser93Gly) rs41295282
NM_000249.3(MLH1):c.301G>A (p.Gly101Ser) rs267607726
NM_000249.3(MLH1):c.303T>G (p.Gly101=) rs4647220
NM_000249.3(MLH1):c.307-29C>A rs139620056
NM_000249.3(MLH1):c.30G>T (p.Arg10=) rs876660759
NM_000249.3(MLH1):c.453+1G>T rs267607750
NM_000249.3(MLH1):c.579A>G (p.Ser193=) rs587781038
NM_000249.3(MLH1):c.589-15C>T rs55658850
NM_000249.3(MLH1):c.676C>T (p.Arg226Ter) rs63751615
NM_000249.3(MLH1):c.790+10A>G rs182733777
NM_000249.3(MLH1):c.843A>C (p.Ala281=) rs146796765
NM_000249.4(MLH1):c.-28A>G rs56198082
NM_000249.4(MLH1):c.1166G>A (p.Arg389Gln) rs63750361
NM_000249.4(MLH1):c.1379A>C (p.Glu460Ala) rs202038499
NM_000249.4(MLH1):c.1565G>A (p.Arg522Gln) rs63751630
NM_000249.4(MLH1):c.1668-19A>G rs9876116
NM_000249.4(MLH1):c.1820T>A (p.Leu607His) rs41295284
NM_000249.4(MLH1):c.1852A>G (p.Lys618Glu) rs35001569
NM_000249.4(MLH1):c.1853A>C (p.Lys618Thr) rs63750449
NM_000249.4(MLH1):c.394G>C (p.Asp132His) rs28930073
NM_000249.4(MLH1):c.655A>G (p.Ile219Val) rs1799977
NM_000249.4(MLH1):c.677G>T (p.Arg226Leu) rs63751711
NM_000250.2(MPO):c.1705C>T (p.Arg569Trp) rs119468010
NM_000251.2(MSH2):c.1077-10T>C rs17224360
NM_000251.2(MSH2):c.1386+1G>A rs267607957
NM_000251.2(MSH2):c.1488A>G (p.Leu496=) rs267607960
NM_000251.2(MSH2):c.1662-10C>T rs752606387
NM_000251.2(MSH2):c.1705_1706del (p.Glu569fs) rs63750393
NM_000251.2(MSH2):c.211+8C>T rs267607916
NM_000251.2(MSH2):c.2154A>G (p.Gln718=) rs63750810
NM_000251.2(MSH2):c.2205C>T (p.Ile735=) rs533553381
NM_000251.2(MSH2):c.2211-2A>T rs267608001
NM_000251.2(MSH2):c.2228C>A (p.Ser743Ter) rs63751155
NM_000251.2(MSH2):c.2580G>T (p.Ser860=) rs752428475
NM_000251.2(MSH2):c.499G>C (p.Asp167His) rs63750255
NM_000251.2(MSH2):c.508C>T (p.Gln170Ter) rs63750843
NM_000251.2(MSH2):c.984C>T (p.Ala328=) rs4987189
NM_000251.3(MSH2):c.1147C>T (p.Arg383Ter) rs63749849
NM_000251.3(MSH2):c.1730T>C (p.Ile577Thr) rs63749910
NM_000251.3(MSH2):c.1787A>G (p.Asn596Ser) rs41295288
NM_000251.3(MSH2):c.2038C>T (p.Arg680Ter) rs63749932
NM_000251.3(MSH2):c.339G>A (p.Lys113=) rs35898375
NM_000251.3(MSH2):c.380A>G (p.Asn127Ser) rs17217772
NM_000253.3(MTTP):c.-149C>A rs886058955
NM_000255.4(MMUT):c.205A>G (p.Ile69Val) rs115923556
NM_000256.3(MYBPC3):c.3535G>A (p.Glu1179Lys) rs199669878
NM_000257.4(MYH7):c.1062C>T (p.Gly354=) rs735712
NM_000257.4(MYH7):c.189C>T (p.Thr63=) rs2069540
NM_000257.4(MYH7):c.2890G>C (p.Val964Leu) rs45496496
NM_000257.4(MYH7):c.2967T>C (p.Ile989=) rs7157716
NM_000257.4(MYH7):c.3337-4dup rs45504498
NM_000257.4(MYH7):c.732C>T (p.Phe244=) rs2069542
NM_000259.3(MYO5A):c.3136G>A (p.Val1046Met) rs56132571
NM_000267.3(NF1):c.1588G>A (p.Val530Ile) rs145191978
NM_000275.3(OCA2):c.79G>A (p.Gly27Arg) rs61738394
NM_000277.3(PAH):c.1139C>T (p.Thr380Met) rs62642937
NM_000283.3(PDE6B):c.794G>A (p.Arg265Gln) rs144562730
NM_000297.4(PKD2):c.290AGG[7] (p.Glu102dup) rs750077647
NM_000298.6(PKLR):c.1456C>T (p.Arg486Trp) rs116100695
NM_000298.6(PKLR):c.1516G>A (p.Val506Ile) rs8177988
NM_000298.6(PKLR):c.829G>A (p.Glu277Lys) rs147689373
NM_000305.3(PON2):c.358A>G (p.Ile120Val) rs116397473
NM_000307.5(POU3F4):c.139C>T (p.Pro47Ser) rs144417952
NM_000312.3(PROC):c.-50A>T rs1799810
NM_000312.3(PROC):c.768T>C (p.Asp256=) rs5937
NM_000313.3(PROS1):c.1501T>C (p.Ser501Pro) rs121918472
NM_000314.7(PTEN):c.802-12T>C rs587781129
NM_000314.8(PTEN):c.210-7_210-3del rs587780544
NM_000316.3(PTH1R):c.299G>A (p.Gly100Asp) rs41290646
NM_000321.2(RB1):c.45_53del (p.Ala16_Ala18del) rs572454921
NM_000330.4(RS1):c.264G>C (p.Gln88His) rs201680258
NM_000335.5(SCN5A):c.647C>T (p.Ser216Leu) rs41276525
NM_000338.3(SLC12A1):c.347G>A (p.Arg116His) rs34819316
NM_000342.3(SLC4A1):c.118G>A (p.Glu40Lys) rs45562031
NM_000350.2(ABCA4):c.5882G>A rs1800553
NM_000350.3(ABCA4):c.3602T>G (p.Leu1201Arg) rs61750126
NM_000350.3(ABCA4):c.3758C>T (p.Thr1253Met) rs61752424
NM_000350.3(ABCA4):c.4297G>A (p.Val1433Ile) rs56357060
NM_000350.3(ABCA4):c.455G>A (p.Arg152Gln) rs62646862
NM_000350.3(ABCA4):c.466A>G (p.Ile156Val) rs62646863
NM_000350.3(ABCA4):c.4685T>C (p.Ile1562Thr) rs1762111
NM_000350.3(ABCA4):c.5693G>A (p.Arg1898His) rs1800552
NM_000350.3(ABCA4):c.6148G>C (p.Val2050Leu) rs41292677
NM_000352.6(ABCC8):c.1858C>T (p.Arg620Cys) rs58241708
NM_000359.3(TGM1):c.61A>G (p.Thr21Ala) rs140542428
NM_000368.4(TSC1):c.1097C>T (p.Pro366Leu) rs763915012
NM_000369.5(TSHR):c.202C>T (p.Pro68Ser) rs142063461
NM_000369.5(TSHR):c.2161G>T (p.Val721Phe) rs61745409
NM_000372.5(TYR):c.1205G>A (p.Arg402Gln) rs1126809
NM_000380.3(XPA):c.754C>G (p.Leu252Val) rs3176750
NM_000384.3(APOB):c.10913G>A (p.Arg3638Gln)
NM_000384.3(APOB):c.13369G>A (p.Asp4457Asn) rs183812948
NM_000384.3(APOB):c.26TGGCGCTGC[1] (p.9LAL[1])
NM_000384.3(APOB):c.293C>T (p.Thr98Ile)
NM_000388.4(CASR):c.1192G>A (p.Asp398Asn) rs201177696
NM_000399.5(EGR2):c.457A>C (p.Thr153Pro) rs202183386
NM_000401.3(EXT2):c.1687G>A (p.Glu563Lys) rs148711133
NM_000402.4(G6PD):c.466A>G (p.Asn156Asp) rs1050829
NM_000409.4(GUCA1A):c.205G>T (p.Gly69Cys) rs146354667
NM_000410.3(HFE):c.845G>A (p.Cys282Tyr) rs1800562
NM_000426.3(LAMA2):c.1621A>G (p.Ser541Gly) rs141363186
NM_000426.3(LAMA2):c.1814C>T (p.Thr605Ile) rs112388307
NM_000431.4(MVK):c.1129G>A (p.Val377Ile) rs28934897
NM_000435.3(NOTCH3):c.3691C>T (p.Arg1231Cys) rs201680145
NM_000435.3(NOTCH3):c.6061G>A (p.Val2021Met) rs199620476
NM_000435.3(NOTCH3):c.6809C>T (p.Thr2270Met) rs148716935
NM_000440.3(PDE6A):c.878C>T (p.Pro293Leu) rs114973968
NM_000441.2(SLC26A4):c.-103T>C rs60284988
NM_000447.3(PSEN2):c.208G>A (p.Gly70Arg) rs139972151
NM_000455.4(STK11):c.1257C>T (p.Ser419=) rs375328708
NM_000455.4(STK11):c.369G>A (p.Gln123=) rs140112347
NM_000455.4(STK11):c.464+10C>T rs587782445
NM_000455.4(STK11):c.580G>A (p.Asp194Asn) rs121913315
NM_000455.4(STK11):c.723T>C (p.Ala241=) rs533550278
NM_000455.4(STK11):c.735-9G>A rs201899557
NM_000455.4(STK11):c.735C>G (p.Leu245=) rs773147894
NM_000455.4(STK11):c.825G>A (p.Pro275=) rs202011521
NM_000455.4(STK11):c.910C>T (p.Arg304Trp) rs786201090
NM_000455.4(STK11):c.920+6C>T rs730881964
NM_000455.4(STK11):c.920+7G>C rs2075607
NM_000455.4(STK11):c.921-10G>A rs183406870
NM_000455.5(STK11):c.1211C>T (p.Ser404Phe) rs200078204
NM_000465.4(BARD1):c.1738G>A (p.Glu580Lys) rs35306212
NM_000465.4(BARD1):c.33G>T (p.Gln11His) rs143914387
NM_000466.3(PEX1):c.1579A>G (p.Thr527Ala) rs144942544
NM_000466.3(PEX1):c.637C>T (p.Leu213Phe) rs141798874
NM_000478.6(ALPL):c.1363G>A (p.Gly455Ser) rs149889416
NM_000478.6(ALPL):c.744C>T (p.Asp248=) rs188689330
NM_000487.6(ARSA):c.1055A>G (p.Asn352Ser) rs2071421
NM_000489.6(ATRX):c.4365GGA[4] (p.Glu1464del) rs398123423
NM_000492.3(CFTR):c.1312A>G (p.Thr438Ala) rs201434579
NM_000492.3(CFTR):c.1521_1523delCTT (p.Phe508delPhe) rs113993960
NM_000492.4(CFTR):c.1265C>T (p.Ser422Phe) rs201880593
NM_000492.4(CFTR):c.2249C>T (p.Pro750Leu) rs140455771
NM_000492.4(CFTR):c.2657+2_2657+3insA rs397508414
NM_000492.4(CFTR):c.3154T>G (p.Phe1052Val) rs150212784
NM_000492.4(CFTR):c.350G>A (p.Arg117His) rs78655421
NM_000493.4(COL10A1):c.43T>G (p.Leu15Val) rs147612968
NM_000500.9(CYP21A2):c.844G>T (p.Val282Leu) rs6471
NM_000506.5(F2):c.*97G>A rs1799963
NM_000521.4(HEXB):c.115del (p.Val39fs) rs398123443
NM_000521.4(HEXB):c.1510C>T (p.Pro504Ser) rs121907985
NM_000527.5(LDLR):c.1024G>A (p.Asp342Asn)
NM_000527.5(LDLR):c.2441G>A (p.Arg814Gln)
NM_000527.5(LDLR):c.2479G>A (p.Val827Ile) rs137853964
NM_000535.7(PMS2):c.1145-10G>A rs533551639
NM_000535.7(PMS2):c.1238_1239delinsGG (p.Lys413Arg) rs587780041
NM_000535.7(PMS2):c.1242C>T (p.Asp414=) rs142839559
NM_000535.7(PMS2):c.1556A>G (p.Tyr519Cys) rs63750649
NM_000535.7(PMS2):c.1621= (p.Lys541=) rs2228006
NM_000535.7(PMS2):c.1629C>T (p.Asp543=) rs111673299
NM_000535.7(PMS2):c.180C>G (p.Asp60Glu) rs200313585
NM_000535.7(PMS2):c.1831dup (p.Ile611fs) rs63750250
NM_000535.7(PMS2):c.2149G>A (p.Val717Met) rs201671325
NM_000535.7(PMS2):c.2264T>C (p.Ile755Thr) rs386833410
NM_000535.7(PMS2):c.23+10G>C rs192027828
NM_000535.7(PMS2):c.2356C>A (p.Leu786Met) rs576055272
NM_000535.7(PMS2):c.2521del (p.Trp841fs) rs886039646
NM_000535.7(PMS2):c.354-2A>G rs786202098
NM_000535.7(PMS2):c.379G>A (p.Ala127Thr) rs114090343
NM_000535.7(PMS2):c.53T>C (p.Ile18Thr) rs201343342
NM_000535.7(PMS2):c.86G>C (p.Gly29Ala) rs146176004
NM_000535.7(PMS2):c.903+1G>A
NM_000540.3(RYR1):c.10188C>T (p.Asp3396=) rs2229145
NM_000540.3(RYR1):c.10616G>A (p.Arg3539His) rs143987857
NM_000540.3(RYR1):c.10687-7C>T rs2960354
NM_000540.3(RYR1):c.13317C>T (p.Ala4439=) rs113579185
NM_000540.3(RYR1):c.7089C>T (p.Cys2363=) rs2228071
NM_000540.3(RYR1):c.7098C>T (p.Pro2366=) rs2229147
NM_000540.3(RYR1):c.7614+10C>G rs2960323
NM_000540.3(RYR1):c.7835+5A>G rs1469695
NM_000540.3(RYR1):c.7863C>T (p.His2621=) rs2229142
NM_000540.3(RYR1):c.7977G>A (p.Thr2659=) rs2229144
NM_000540.3(RYR1):c.8118T>C (p.Ile2706=) rs2960340
NM_000540.3(RYR1):c.8190T>C (p.Asp2730=) rs2915951
NM_000540.3(RYR1):c.8337G>A (p.Glu2779=) rs2915952
NM_000540.3(RYR1):c.8589T>C (p.Ser2863=) rs2229146
NM_000540.3(RYR1):c.8693-10G>C rs2915958
NM_000540.3(RYR1):c.9186A>G (p.Pro3062=) rs2071089
NM_000542.5(SFTPB):c.403G>A (p.Gly135Ser) rs35373464
NM_000543.5(SMPD1):c.83C>T (p.Pro28Leu) rs556155962
NM_000546.5(TP53):c.472C>T (p.Arg158Cys) rs587780068
NM_000546.5(TP53):c.63C>T (p.Asp21=) rs1800369
NM_000546.5(TP53):c.97-9C>T rs202217267
NM_000548.5(TSC2):c.3818C>T (p.Ala1273Val) rs749367382
NM_000548.5(TSC2):c.5262C>G (p.Ile1754Met) rs397515318
NM_000552.4(VWF):c.1451A>G (p.His484Arg) rs1800378
NM_000552.4(VWF):c.1548T>C (p.Tyr516=) rs1800379
NM_000552.4(VWF):c.2365A>G (p.Thr789Ala) rs1063856
NM_000552.4(VWF):c.2385T>C (p.Tyr795=) rs1063857
NM_000552.4(VWF):c.2561G>A (p.Arg854Gln) rs41276738
NM_000552.4(VWF):c.2880G>A (p.Arg960=) rs1800380
NM_000552.4(VWF):c.3797C>A (p.Pro1266Gln) rs61749370
NM_000552.4(VWF):c.4141A>G (p.Thr1381Ala) rs216311
NM_000552.4(VWF):c.4641T>C (p.Thr1547=) rs216310
NM_000552.4(VWF):c.4751A>G (p.Tyr1584Cys) rs1800386
NM_000552.4(VWF):c.6846A>G (p.Thr2282=) rs1053523
NM_000601.6(HGF):c.137C>T (p.Ala46Val) rs150267054
NM_000784.4(CYP27A1):c.1435C>G (p.Arg479Gly) rs72551322
NM_001005360.2(DNM2):c.1782-7C>A rs200843089
NM_001007026.1(ATN1):c.1462CAG[17] (p.Gln488[17]) rs60216939
NM_001009944.3(PKD1):c.3502C>T (p.Pro1168Ser) rs146887330
NM_001009944.3(PKD1):c.3679G>T (p.Ala1227Ser) rs150710956
NM_001009944.3(PKD1):c.4546G>A (p.Ala1516Thr) rs148164067
NM_001009944.3(PKD1):c.7429C>T (p.Arg2477Cys) rs376283361
NM_001029883.3(PCARE):c.920T>A (p.Leu307Ter)
NM_001038.6(SCNN1A):c.614G>A (p.Ser205Asn) rs147866964
NM_001039141.3(TRIOBP):c.7010G>A (p.Arg2337Gln) rs200850285
NM_001040108.1(MLH3):c.4242+13C>G rs77157930
NM_001048171.1(MUTYH):c.1076C>T (p.Ala359Val) rs35352891
NM_001048171.1(MUTYH):c.697C>T (p.Arg233Ter) rs587782885
NM_001048174.2(MUTYH):c.637C>T (p.Arg213Trp) rs34126013
NM_001048174.2(MUTYH):c.737G>A (p.Arg246Gln) rs149866955
NM_001065.4(TNFRSF1A):c.362G>A (p.Arg121Gln) rs4149584
NM_001077653.2(TBX20):c.414G>A (p.Ser138=) rs144597480
NM_001080414.4(CCDC88C):c.4375G>A (p.Asp1459Asn) rs78570354
NM_001080522.2(CC2D2A):c.3055C>T (p.Arg1019Ter) rs370880399
NM_001082538.3(TCTN1):c.699TAA[1] (p.Asn235del) rs797046038
NM_001083116.3(PRF1):c.272C>T (p.Ala91Val) rs35947132
NM_001083603.1(PTCH1):c.131A>G (p.Glu44Gly) rs202111971
NM_001098.3(ACO2):c.220C>G (p.Leu74Val) rs141772938
NM_001110792.2(MECP2):c.1096C>T (p.Arg366Cys) rs143876280
NM_001122630.2(CDKN1C):c.573GGCCCC[2] (p.186AP[8]) rs759134767
NM_001127217.2(SMAD9):c.1035G>A (p.Val345=) rs150237947
NM_001127222.2(CACNA1A):c.3040G>A (p.Glu1014Lys) rs16024
NM_001127701.1(SERPINA1):c.1096G>A (p.Glu366Lys) rs28929474
NM_001127701.1(SERPINA1):c.839A>T (p.Asp280Val) rs121912714
NM_001127701.1(SERPINA1):c.863A>T (p.Glu288Val) rs17580
NM_001128164.2(ATXN1):c.588GCA[12] (p.Gln208del) rs193922926
NM_001128425.1(MUTYH):c.548G>A (p.Gly183Asp) rs587781864
NM_001128840.3(CACNA1D):c.5767_5769del (p.Phe1923del) rs72556363
NM_001130438.3(SPTAN1):c.1303T>G (p.Ser435Ala) rs144787939
NM_001130438.3(SPTAN1):c.1330G>A (p.Val444Ile) rs77358650
NM_001130823.3(DNMT1):c.694C>A (p.Pro232Thr) rs374856119
NM_001136193.2(FASTKD2):c.149A>G (p.Lys50Arg) rs141447598
NM_001136193.2(FASTKD2):c.756G>A (p.Gln252=) rs377619612
NM_001142800.2(EYS):c.4985A>T (p.Asp1662Val) rs147641443
NM_001142800.2(EYS):c.5743A>G (p.Ser1915Gly) rs188093810
NM_001142800.2(EYS):c.7796A>G (p.His2599Arg) rs74636274
NM_001142800.2(EYS):c.788A>G (p.His263Arg) rs139517572
NM_001142864.4(PIEZO1):c.645C>G (p.His215Gln) rs559847737
NM_001145252.3(CFP):c.895G>A (p.Asp299Asn) rs61737993
NM_001145809.2(MYH14):c.1427G>A (p.Arg476His)
NM_001151.4(SLC25A4):c.490A>G (p.Ile164Val) rs143511445
NM_001165927.1(MKS1):c.827A>G (p.Asp276Gly) rs151023718
NM_001165963.4(SCN1A):c.2926A>C (p.Met976Leu) rs773681556
NM_001165963.4(SCN1A):c.5951C>A (p.Pro1984His) rs146733308
NM_001166108.2(PALLD):c.1273A>T (p.Thr425Ser) rs140454899
NM_001166108.2(PALLD):c.1965-12594T>G rs587780760
NM_001166108.2(PALLD):c.556G>A (p.Ala186Thr)
NM_001166108.2(PALLD):c.764G>A (p.Arg255His) rs146018183
NM_001167617.2(MLH1):c.*32_*34CTT[1] rs193922366
NM_001167617.2(MLH1):c.1852G>A (p.Val618Met) rs35831931
NM_001167618.2(MLH1):c.-136del rs63751653
NM_001168338.1(PLG):c.112A>G (p.Lys38Glu) rs73015965
NM_001171.5(ABCC6):c.1171A>G (p.Arg391Gly) rs72653762
NM_001171.5(ABCC6):c.2695C>T (p.Arg899Cys) rs11861980
NM_001171.5(ABCC6):c.3064C>G (p.Gln1022Glu) rs57179857
NM_001171603.1(PREPL):c.1862A>G (p.Lys621Arg) rs111438719
NM_001184.4(ATR):c.2290A>G (p.Lys764Glu) rs77208665
NM_001184.4(ATR):c.2704T>C (p.Ser902Pro) rs146202702
NM_001184880.2(PCDH19):c.1330A>G (p.Thr444Ala) rs201671718
NM_001193466.2(KANSL1):c.2110T>C (p.Ser704Pro) rs202231419
NM_001201543.2(FAM161A):c.1153C>G (p.Gln385Glu) rs139266382
NM_001204.7(BMPR2):c.545G>A (p.Gly182Asp) rs137852754
NM_001205293.3(CACNA1E):c.1569G>A (p.Met523Ile)
NM_001256071.3(RNF213):c.13604T>C (p.Ile4535Thr) rs75161557
NM_001256317.3(TMPRSS3):c.1273G>A (p.Ala425Thr) rs56264519
NM_001267550.2(TTN):c.11311+4088A>G rs142304137
NM_001267550.2(TTN):c.11311+5536A>G rs145581345
NM_001267550.2(TTN):c.12145C>T (p.Pro4049Ser) rs201888760
NM_001267550.2(TTN):c.15659A>G (p.Asn5220Ser) rs565670799
NM_001267550.2(TTN):c.38902C>T (p.Pro12968Ser) rs192528655
NM_001267550.2(TTN):c.44281C>T (p.Pro14761Ser) rs192766485
NM_001267550.2(TTN):c.61409T>C (p.Ile20470Thr) rs202012910
NM_001267550.2(TTN):c.63626G>A (p.Arg21209Gln) rs148684589
NM_001267550.2(TTN):c.64903C>T (p.Arg21635Cys) rs201614524
NM_001267550.2(TTN):c.92750T>C (p.Val30917Ala) rs748545482
NM_001267550.2(TTN):c.96235G>A (p.Asp32079Asn) rs200540781
NM_001271208.2(NEB):c.18579+6T>C rs116189169
NM_001271208.2(NEB):c.23881C>T (p.Pro7961Ser) rs193224180
NM_001281492.1(MSH6):c.1511_1512del (p.Thr503_Leu504insTer) rs267608082
NM_001281492.1(MSH6):c.3542_3545dup (p.Ile1183fs) rs267608127
NM_001298.3(CNGA3):c.143C>T (p.Pro48Leu) rs62156348
NM_001301365.1(LYST):c.6710A>C (p.Gln2237Pro) rs138443479
NM_001354624.1(MLH1):c.-25del rs587778883
NM_001358530.2(MOCS1):c.1015C>T (p.Arg339Trp) rs148579886
NM_001358530.2(MOCS1):c.853G>A (p.Glu285Lys) rs140243105
NM_001365088.1(SLC12A6):c.2436+1del rs515726215
NM_001365536.1(SCN9A):c.3002A>G (p.Tyr1001Cys) rs199692186
NM_001365951.3(KIF1B):c.2115+6753A>G rs41274462
NM_001371928.1(AHDC1):c.1675G>A (p.Gly559Ser) rs765994795
NM_001374258.1(BRAF):c.1919T>A (p.Val640Glu) rs113488022
NM_001374353.1(GLI2):c.2657C>G (p.Thr886Ser) rs572826436
NM_001376.5(DYNC1H1):c.13385G>A (p.Arg4462Gln) rs376608392
NM_001377.3(DYNC2H1):c.3682C>A (p.Leu1228Ile) rs189806840
NM_001429.4(EP300):c.752A>G (p.Asn251Ser) rs142009367
NM_001457.4(FLNB):c.4495G>A (p.Asp1499Asn) rs150445941
NM_001510.4(GRID2):c.1203T>C (p.Leu401=) rs80091080
NM_001698.3(AUH):c.381A>G rs146227896
NM_001845.6(COL4A1):c.1588C>T (p.Pro530Ser) rs145172612
NM_001903.5(CTNNA1):c.618G>C (p.Gln206His) rs150893072
NM_001909.5(CTSD):c.294G>A (p.Thr98=) rs369373285
NM_001940.4(ATN1):c.1464GCA[8] (p.Gln496_Gln502del)
NM_001941.5(DSC3):c.2488G>A (p.Gly830Ser) rs142851621
NM_001982.4(ERBB3):c.3529C>A (p.Leu1177Ile) rs55699040
NM_001987.4(ETV6):c.602T>C (p.Leu201Pro) rs145477191
NM_001999.4(FBN2):c.93G>T (p.Gln31His) rs371491169
NM_002016.1(FLG):c.1501C>T (p.Arg501Ter) rs61816761
NM_002016.1(FLG):c.6950_6957del (p.Ala2316_Ser2317insTer) rs578184315
NM_002016.2(FLG):c.2282_2285del (p.Ser761fs) rs558269137
NM_002052.5(GATA4):c.1129A>G (p.Ser377Gly) rs3729856
NM_002052.5(GATA4):c.997+56C>A rs804280
NM_002180.2(IGHMBP2):c.2922T>G (p.Asp974Glu) rs147674615
NM_002253.3(KDR):c.1384T>G (p.Leu462Val) rs56286620
NM_002253.3(KDR):c.1615G>A (p.Gly539Arg) rs55716939
NM_002253.3(KDR):c.2066C>T (p.Thr689Met) rs34038364
NM_002272.4(KRT4):c.364C>G (p.Leu122Val) rs758695571
NM_002273.4(KRT8):c.184G>T (p.Gly62Cys) rs11554495
NM_002354.2(EPCAM):c.577A>G (p.Ile193Val) rs200676965
NM_002386.3(MC1R):c.252C>A (p.Asp84Glu) rs1805006
NM_002386.3(MC1R):c.451C>T (p.Arg151Cys) rs1805007
NM_002386.3(MC1R):c.464T>C (p.Ile155Thr) rs1110400
NM_002386.3(MC1R):c.478C>T (p.Arg160Trp) rs1805008
NM_002386.3(MC1R):c.880G>C (p.Asp294His) rs1805009
NM_002439.5(MSH3):c.1567G>A (p.Glu523Lys) rs34058399
NM_002439.5(MSH3):c.169G>C (p.Ala57Pro) rs144776112
NM_002439.5(MSH3):c.169GCCGCAGCG[1] (p.Ala60_Ala62del) rs758960105
NM_002439.5(MSH3):c.2732T>G (p.Leu911Trp) rs41545019
NM_002439.5(MSH3):c.356C>T (p.Ser119Phe) rs144607594
NM_002447.4(MST1R):c.2464C>G (p.Gln822Glu) rs375573917
NM_002470.4(MYH3):c.5254G>T (p.Ala1752Ser) rs34393601
NM_002485.4(NBN):c.1035C>T (p.Gly345=) rs146605798
NM_002485.4(NBN):c.1238A>G (p.Asn413Ser) rs529340553
NM_002485.4(NBN):c.758C>T (p.Thr253Ile) rs61754967
NM_002485.5(NBN):c.1354A>C (p.Thr452Pro) rs141137543
NM_002485.5(NBN):c.283G>A (p.Asp95Asn) rs61753720
NM_002485.5(NBN):c.381T>C (p.Ala127=) rs61754795
NM_002485.5(NBN):c.643C>T (p.Arg215Trp) rs34767364
NM_002491.3(NDUFB3):c.19C>T (p.His7Tyr) rs144513268
NM_002496.4(NDUFS8):c.19C>A (p.Pro7Thr) rs142658611
NM_002496.4(NDUFS8):c.4C>T (p.Arg2Cys) rs150278938
NM_002637.4(PHKA1):c.3043C>T (p.Arg1015Cys) rs782191011
NM_002691.4(POLD1):c.1433G>A (p.Ser478Asn) rs397514632
NM_002691.4(POLD1):c.1932C>G (p.Asp644Glu) rs80214209
NM_002691.4(POLD1):c.2017G>A (p.Glu673Lys) rs61751955
NM_002691.4(POLD1):c.2052G>C (p.Gln684His) rs144143245
NM_002691.4(POLD1):c.2275G>A (p.Val759Ile) rs145473716
NM_002691.4(POLD1):c.2967G>A (p.Thr989=) rs3218752
NM_002691.4(POLD1):c.88C>T (p.Arg30Trp) rs3218772
NM_002693.2(POLG):c.3151G>C (p.Gly1051Arg) rs121918049
NM_002769.5(PRSS1):c.47C>T (p.Ala16Val) rs202003805
NM_002769.5(PRSS1):c.86A>T (p.Asn29Ile) rs111033566
NM_002878.3(RAD51D):c.141C>G (p.Tyr47Ter) rs771077929
NM_002878.3(RAD51D):c.145-13G>T rs760867838
NM_002878.3(RAD51D):c.363del (p.Ala122fs) rs730881935
NM_002878.3(RAD51D):c.556C>T (p.Arg186Ter) rs387906843
NM_002907.4(RECQL):c.132_135del (p.Lys44_Lys45insTer)
NM_002907.4(RECQL):c.1460A>C (p.Lys487Thr) rs6501
NM_002907.4(RECQL):c.1483G>C (p.Asp495His) rs6499
NM_003000.3(SDHB):c.423+20T>A rs190139590
NM_003072.4(SMARCA4):c.722_733del (p.229_230GP[6]) rs568390760
NM_003079.5(SMARCE1):c.1079G>A (p.Gly360Asp) rs142193069
NM_003105.6(SORL1):c.5448T>C (p.Tyr1816=) rs150315143
NM_003126.4(SPTA1):c.3230G>A (p.Arg1077His) rs199612744
NM_003172.4(SURF1):c.211G>C (p.Val71Leu) rs147993882
NM_003172.4(SURF1):c.563A>G (p.Asn188Ser) rs200702528
NM_003193.5(TBCE):c.394G>A (p.Val132Ile) rs144448831
NM_003242.6(TGFBR2):c.1119G>A (p.Met373Ile) rs35719192
NM_003280.3(TNNC1):c.210C>T (p.Gly70=) rs141505676
NM_003282.4(TNNI2):c.61G>A (p.Val21Met) rs200110633
NM_003476.5(CSRP3):c.336G>A (p.Ala112=) rs13451
NM_003482.3(KMT2D):c.6836G>A (p.Gly2279Glu) rs200578414
NM_003571.4(BFSP2):c.1115C>T (p.Ala372Val) rs139944598
NM_003659.4(AGPS):c.148C>T (p.Arg50Trp) rs778087162
NM_003722.5(TP63):c.688G>C (p.Val230Leu)
NM_003742.4(ABCB11):c.3512T>C (p.Met1171Thr) rs183621659
NM_003835.4(RGS9):c.1658T>C (p.Val553Ala) rs201026246
NM_003859.2(DPM1):c.40C>T (p.Arg14Trp) rs117175017
NM_003900.5(SQSTM1):c.1175C>T (p.Pro392Leu) rs104893941
NM_003924.3(PHOX2B):c.741_758del (p.Ala255_Ala260del) rs771383153
NM_003977.4(AIP):c.26G>A (p.Arg9Gln) rs139459091
NM_003999.3(OSMR):c.2538T>A (p.Asn846Lys) rs771864692
NM_004004.6(GJB2):c.101T>C (p.Met34Thr) rs35887622
NM_004168.4(SDHA):c.969C>T (p.Gly323=) rs142849100
NM_004260.3(RECQL4):c.716C>T (p.Ala239Val) rs146709578
NM_004304.5(ALK):c.4297GAG[2] (p.Glu1435del) rs138827116
NM_004329.2(BMPR1A):c.1419T>G (p.Val473=) rs145756629
NM_004329.2(BMPR1A):c.4C>A (p.Pro2Thr) rs11528010
NM_004329.2(BMPR1A):c.618A>G (p.Leu206=) rs55992440
NM_004333.6(BRAF):c.1794_1796dup (p.Thr599dup) rs727502902
NM_004333.6(BRAF):c.1798_1799delinsAA (p.Val600Lys) rs121913227
NM_004360.5(CDH1):c.-71C>G rs34033771
NM_004360.5(CDH1):c.1018A>G (p.Thr340Ala) rs116093741
NM_004360.5(CDH1):c.1273G>A (p.Val425Ile) rs570930882
NM_004360.5(CDH1):c.1409C>T (p.Thr470Ile) rs370864592
NM_004360.5(CDH1):c.1565+1G>T rs587780113
NM_004360.5(CDH1):c.1680G>C (p.Thr560=) rs35741240
NM_004360.5(CDH1):c.1774G>A (p.Ala592Thr) rs35187787
NM_004360.5(CDH1):c.188G>A (p.Arg63Gln) rs587780117
NM_004360.5(CDH1):c.1937-13T>C rs2276330
NM_004360.5(CDH1):c.2100del (p.Val701fs) rs1555517136
NM_004360.5(CDH1):c.214G>A (p.Asp72Asn) rs35606263
NM_004360.5(CDH1):c.2165-15C>A rs552874184
NM_004360.5(CDH1):c.2398del (p.Arg800fs) rs587783048
NM_004360.5(CDH1):c.2520C>T (p.Ser840=) rs140328601
NM_004360.5(CDH1):c.2637C>T (p.Gly879=) rs141001592
NM_004360.5(CDH1):c.303C>T (p.Tyr101=) rs150789339
NM_004360.5(CDH1):c.33G>C (p.Leu11=) rs730881654
NM_004360.5(CDH1):c.48+6C>T rs3743674
NM_004360.5(CDH1):c.49-9C>A rs1555509752
NM_004360.5(CDH1):c.604G>A (p.Val202Ile) rs546716073
NM_004360.5(CDH1):c.88C>A (p.Pro30Thr) rs139866691
NM_004360.5(CDH1):c.892G>A (p.Ala298Thr) rs142822590
NM_004385.5(VCAN):c.2618T>G (p.Ile873Arg) rs150395515
NM_004407.4(DMP1):c.1151G>A (p.Ser384Asn) rs148498977
NM_004407.4(DMP1):c.263C>T (p.Ala88Val) rs144773084
NM_004407.4(DMP1):c.815G>A (p.Arg272His) rs145237146
NM_004415.4(DSP):c.2091A>G (p.Gly697=) rs2076304
NM_004415.4(DSP):c.4535A>G (p.Tyr1512Cys) rs2076299
NM_004456.4(EZH2):c.657T>C (p.Pro219=) rs148843424
NM_004519.4(KCNQ3):c.2123G>T (p.Ser708Ile) rs977989588
NM_004519.4(KCNQ3):c.35C>T (p.Ala12Val) rs796052672
NM_004525.3(LRP2):c.13921A>T (p.Thr4641Ser) rs79179577
NM_004525.3(LRP2):c.3122A>G (p.Asn1041Ser) rs143028579
NM_004525.3(LRP2):c.391A>G (p.Arg131Gly) rs34592807
NM_004525.3(LRP2):c.6130G>A (p.Ala2044Thr) rs142266106
NM_004544.4(NDUFA10):c.712G>A (p.Glu238Lys) rs35462421
NM_004589.4(SCO1):c.16C>G (p.Leu6Val) rs61753148
NM_004614.5(TK2):c.103C>T (p.Gln35Ter) rs886041321
NM_004621.6(TRPC6):c.1260G>A (p.Leu420=) rs138155461
NM_004625.4(WNT7A):c.470G>A (p.Arg157His)
NM_004655.4(AXIN2):c.1168A>G (p.Ser390Gly) rs139871607
NM_004655.4(AXIN2):c.1807G>C (p.Ala603Pro) rs145353986
NM_004807.3(HS6ST1):c.1144C>T (p.Arg382Trp) rs199538589
NM_004933.3(CDH15):c.365C>T (p.Ala122Val) rs121434541
NM_004958.4(MTOR):c.5473A>G (p.Ile1825Val)
NM_004977.3(KCNC3):c.1771A>G (p.Ser591Gly) rs549394447
NM_004980.4(KCND3):c.1573A>G (p.Met525Val) rs145890206
NM_004985.5(KRAS):c.13A>G (p.Lys5Glu) rs193929331
NM_004985.5(KRAS):c.24A>G (p.Val8=) rs147406419
NM_004985.5(KRAS):c.34G>A (p.Gly12Ser) rs121913530
NM_004985.5(KRAS):c.35G>A (p.Gly12Asp) rs121913529
NM_004985.5(KRAS):c.35G>T (p.Gly12Val) rs121913529
NM_004985.5(KRAS):c.37G>T (p.Gly13Cys) rs121913535
NM_004985.5(KRAS):c.38G>A (p.Gly13Asp) rs112445441
NM_004985.5(KRAS):c.38G>T (p.Gly13Val) rs112445441
NM_004985.5(KRAS):c.40G>A (p.Val14Ile) rs104894365
NM_004993.6(ATXN3):c.892CAG[18] (p.Gln296_Gln305dup) rs193922928
NM_004999.4(MYO6):c.92T>C (p.Ile31Thr) rs148735953
NM_005045.4(RELN):c.3477C>A (p.Asn1159Lys) rs114684479
NM_005199.5(CHRNG):c.125G>A (p.Arg42Gln) rs148468628
NM_005199.5(CHRNG):c.714G>T (p.Gln238His) rs17838626
NM_005211.3(CSF1R):c.2746G>A (p.Glu916Lys) rs142435467
NM_005245.4(FAT1):c.10487T>C (p.Val3496Ala) rs35216841
NM_005245.4(FAT1):c.10757T>C (p.Met3586Thr) rs115705222
NM_005245.4(FAT1):c.2236A>G (p.Thr746Ala) rs372906523
NM_005245.4(FAT1):c.2563G>A (p.Gly855Arg) rs180820128
NM_005245.4(FAT1):c.3874G>A (p.Glu1292Lys) rs184443677
NM_005245.4(FAT1):c.5384G>A (p.Arg1795Gln) rs56790426
NM_005245.4(FAT1):c.8535G>A (p.Met2845Ile) rs138948513
NM_005245.4(FAT1):c.9440T>G (p.Val3147Gly) rs188733415
NM_005359.5(SMAD4):c.746_747delAGinsCC (p.Gln249Pro) rs587782209
NM_005359.6(SMAD4):c.1086T>C (p.Phe362=) rs1801250
NM_005359.6(SMAD4):c.455-6A>G rs181178864
NM_005359.6(SMAD4):c.728_735del (p.Gly243fs) rs1060500742
NM_005373.3(MPL):c.79+2T>A rs146249964
NM_005422.4(TECTA):c.2061C>G (p.Asn687Lys) rs139165033
NM_005529.7(HSPG2):c.11072C>T (p.Thr3691Ile) rs149159881
NM_005529.7(HSPG2):c.1238G>A (p.Arg413Gln) rs140621959
NM_005529.7(HSPG2):c.12982G>A (p.Ala4328Thr) rs114015043
NM_005529.7(HSPG2):c.5297C>T (p.Ala1766Val) rs139794766
NM_005529.7(HSPG2):c.7235G>A (p.Ser2412Asn) rs146309392
NM_005562.3(LAMC2):c.493C>T (p.Arg165Cys) rs142335339
NM_005562.3(LAMC2):c.599C>A (p.Ala200Glu) rs138266625
NM_005591.3(MRE11):c.1727G>A (p.Arg576Gln) rs139461096
NM_005603.6(ATP8B1):c.208G>A (p.Asp70Asn) rs34719006
NM_005609.4(PYGM):c.1094C>T (p.Ala365Val) rs116135678
NM_005670.4(EPM2A):c.680C>T (p.Ala227Val) rs147399860
NM_005670.4(EPM2A):c.822C>T (p.Thr274=) rs763812238
NM_005732.4(RAD50):c.1094G>A (p.Arg365Gln) rs146370443
NM_005732.4(RAD50):c.2647C>T (p.Arg883Cys) rs138749920
NM_005902.4(SMAD3):c.879C>T (p.Gly293=) rs769683236
NM_005910.5(MAPT):c.374-3565T>G rs141120474
NM_005910.5(MAPT):c.715G>A (p.Ala239Thr) rs63750096
NM_005957.5(MTHFR):c.665C>T (p.Ala222Val) rs1801133
NM_006000.3(TUBA4A):c.909A>G (p.Val303=) rs141922502
NM_006019.4(TCIRG1):c.1249G>A (p.Ala417Thr) rs140963213
NM_006019.4(TCIRG1):c.2445C>T (p.Gly815=) rs150788130
NM_006019.4(TCIRG1):c.90C>T (p.Gly30=) rs141859450
NM_006206.6(PDGFRA):c.1325T>C (p.Leu442Pro) rs139236922
NM_006225.4(PLCD1):c.35-4000A>G rs143961610
NM_006231.3(POLE):c.1597G>A (p.Val533Met) rs374140892
NM_006231.3(POLE):c.2865-6_2865-4del rs369732588
NM_006231.3(POLE):c.4237G>A (p.Glu1413Lys) rs372901803
NM_006231.3(POLE):c.4246G>A (p.Ala1416Thr) rs146711942
NM_006231.3(POLE):c.4730A>C (p.Glu1577Ala) rs5744948
NM_006231.3(POLE):c.4941C>T (p.Phe1647=) rs145639967
NM_006231.3(POLE):c.6004+11A>G rs201591857
NM_006231.3(POLE):c.6418G>A (p.Glu2140Lys) rs5745066
NM_006231.3(POLE):c.6494G>A (p.Arg2165His) rs5745068
NM_006231.3(POLE):c.6751T>C (p.Phe2251Leu) rs373768478
NM_006231.3(POLE):c.6763A>T (p.Ile2255Phe) rs73155056
NM_006231.3(POLE):c.779G>A (p.Arg260Gln) rs5744752
NM_006231.4(POLE):c.1337G>A (p.Arg446Gln) rs151273553
NM_006231.4(POLE):c.2090C>G (p.Pro697Arg) rs36120395
NM_006416.5(SLC35A1):c.133A>G (p.Thr45Ala) rs145006535
NM_006496.4(GNAI3):c.509C>T (p.Thr170Ile) rs61754626
NM_006567.5(FARS2):c.667C>T (p.Arg223Cys) rs202060864
NM_006767.4(LZTR1):c.1723G>A (p.Asp575Asn) rs139368531
NM_006767.4(LZTR1):c.2407-2A>G rs1158550690
NM_006946.3(SPTBN2):c.1972C>T (p.Arg658Trp) rs199968321
NM_006947.4(SRP72):c.20G>C (p.Gly7Ala) rs139502866
NM_007194.4(CHEK2):c.*5C>T rs587781367
NM_007194.4(CHEK2):c.1263del (p.Ser422fs) rs587780174
NM_007194.4(CHEK2):c.1407G>A (p.Val469=) rs17881378
NM_007194.4(CHEK2):c.1489G>A (p.Asp497Asn) rs143965148
NM_007194.4(CHEK2):c.1593G>A (p.Glu531=) rs758555487
NM_007194.4(CHEK2):c.320-5T>A rs121908700
NM_007194.4(CHEK2):c.349A>G (p.Arg117Gly) rs28909982
NM_007194.4(CHEK2):c.538C>T (p.Arg180Cys) rs77130927
NM_007194.4(CHEK2):c.793-11G>A rs5997387
NM_007294.3(BRCA1):c.-86C>T rs143160357
NM_007294.3(BRCA1):c.212+4T>C rs398122652
NM_007294.3(BRCA1):c.301+55G>A rs868735744
NM_007294.3(BRCA1):c.301+8T>C rs80358101
NM_007294.3(BRCA1):c.3668_3671dupTTCC (p.Cys1225Serfs) rs80357797
NM_007294.3(BRCA1):c.4096+3A>G rs80358015
NM_007294.3(BRCA1):c.4485-63C>G rs273900734
NM_007294.3(BRCA1):c.4676-8C>G rs80358021
NM_007294.3(BRCA1):c.4987-2A>G rs397509212
NM_007294.3(BRCA1):c.5332+20C>A rs1057521961
NM_007294.3(BRCA1):c.5468-2A>G rs398122699
NM_007294.3(BRCA1):c.66dupA (p.Glu23Argfs) rs80357783
NM_007294.3(BRCA1):c.671-8A>G rs80358144
NM_007294.3(BRCA1):c.81-17C>G rs757442952
NM_007294.3(BRCA1):c.81-?_134+?del
NM_007294.4(BRCA1):c.1067A>G (p.Gln356Arg) rs1799950
NM_007294.4(BRCA1):c.1106_1108del (p.Asp369del) rs80358325
NM_007294.4(BRCA1):c.1227A>G (p.Val409=) rs149349675
NM_007294.4(BRCA1):c.1396C>T (p.Arg466Trp) rs80356964
NM_007294.4(BRCA1):c.140G>A (p.Cys47Tyr) rs80357150
NM_007294.4(BRCA1):c.1418A>G (p.Asn473Ser) rs80357057
NM_007294.4(BRCA1):c.1427A>G (p.His476Arg) rs55720177
NM_007294.4(BRCA1):c.1456T>C (p.Phe486Leu) rs55906931
NM_007294.4(BRCA1):c.1561G>A (p.Ala521Thr) rs80357122
NM_007294.4(BRCA1):c.1573G>A (p.Val525Ile) rs80357273
NM_007294.4(BRCA1):c.1617G>A (p.Thr539=) rs372002119
NM_007294.4(BRCA1):c.1703C>T (p.Pro568Leu) rs80356910
NM_007294.4(BRCA1):c.1843TCT[1] (p.Ser616del) rs80358329
NM_007294.4(BRCA1):c.1865C>T (p.Ala622Val) rs56039126
NM_007294.4(BRCA1):c.1911T>C (p.Thr637=) rs62625305
NM_007294.4(BRCA1):c.1974G>C (p.Met658Ile) rs55678461
NM_007294.4(BRCA1):c.2006T>C (p.Met669Thr) rs80356895
NM_007294.4(BRCA1):c.2077G>A (p.Asp693Asn) rs4986850
NM_007294.4(BRCA1):c.211A>G (p.Arg71Gly) rs80357382
NM_007294.4(BRCA1):c.2352G>A (p.Ser784=) rs372017932
NM_007294.4(BRCA1):c.2412G>C (p.Gln804His) rs55746541
NM_007294.4(BRCA1):c.2428A>T (p.Asn810Tyr) rs28897682
NM_007294.4(BRCA1):c.2447A>G (p.His816Arg) rs80357108
NM_007294.4(BRCA1):c.2458A>G (p.Lys820Glu) rs56082113
NM_007294.4(BRCA1):c.2477C>A (p.Thr826Lys) rs28897683
NM_007294.4(BRCA1):c.2521C>T (p.Arg841Trp) rs1800709
NM_007294.4(BRCA1):c.2580A>G (p.Thr860=) rs556684572
NM_007294.4(BRCA1):c.2596C>T (p.Arg866Cys) rs41286300
NM_007294.4(BRCA1):c.2612C>T (p.Pro871Leu) rs799917
NM_007294.4(BRCA1):c.2634A>G (p.Ala878=) rs730881451
NM_007294.4(BRCA1):c.2712A>G (p.Glu904=) rs1057522242
NM_007294.4(BRCA1):c.2722G>T (p.Glu908Ter) rs80356978
NM_007294.4(BRCA1):c.2733A>G (p.Gly911=) rs1800740
NM_007294.4(BRCA1):c.3024G>A (p.Met1008Ile) rs1800704
NM_007294.4(BRCA1):c.305C>G (p.Ala102Gly) rs80357190
NM_007294.4(BRCA1):c.3083G>A (p.Arg1028His) rs80357459
NM_007294.4(BRCA1):c.3113A>G (p.Glu1038Gly) rs16941
NM_007294.4(BRCA1):c.3119G>A (p.Ser1040Asn) rs4986852
NM_007294.4(BRCA1):c.3296C>T (p.Pro1099Leu) rs80357201
NM_007294.4(BRCA1):c.3302G>A (p.Ser1101Asn) rs41293447
NM_007294.4(BRCA1):c.3327A>C (p.Lys1109Asn) rs41293449
NM_007294.4(BRCA1):c.3328_3330del (p.Lys1110del) rs80358335
NM_007294.4(BRCA1):c.3418A>G (p.Ser1140Gly) rs2227945
NM_007294.4(BRCA1):c.3448C>T (p.Pro1150Ser) rs80357272
NM_007294.4(BRCA1):c.3541G>A (p.Val1181Ile) rs56336919
NM_007294.4(BRCA1):c.3548A>G (p.Lys1183Arg) rs16942
NM_007294.4(BRCA1):c.3596C>T (p.Ala1199Val) rs587782458
NM_007294.4(BRCA1):c.3600G>T (p.Gln1200His) rs56214134
NM_007294.4(BRCA1):c.3636A>G (p.Ser1212=) rs148038877
NM_007294.4(BRCA1):c.3657G>C (p.Glu1219Asp) rs80356876
NM_007294.4(BRCA1):c.3707A>G (p.Asn1236Ser) rs863224760
NM_007294.4(BRCA1):c.3739G>A (p.Val1247Ile) rs80357191
NM_007294.4(BRCA1):c.378A>G (p.Gln126=) rs786201256
NM_007294.4(BRCA1):c.3929C>A (p.Thr1310Lys) rs80357257
NM_007294.4(BRCA1):c.3967C>T (p.Gln1323Ter) rs80357262
NM_007294.4(BRCA1):c.3G>A (p.Met1Ile) rs80357475
NM_007294.4(BRCA1):c.4039A>G (p.Arg1347Gly) rs28897689
NM_007294.4(BRCA1):c.4115G>A (p.Cys1372Tyr) rs55848034
NM_007294.4(BRCA1):c.4213A>G (p.Ile1405Val) rs80357353
NM_007294.4(BRCA1):c.4255G>C (p.Glu1419Gln) rs80357309
NM_007294.4(BRCA1):c.427G>T (p.Glu143Ter) rs80356991
NM_007294.4(BRCA1):c.4358-10C>T rs80358111
NM_007294.4(BRCA1):c.4372C>T (p.Gln1458Ter) rs80356932
NM_007294.4(BRCA1):c.4399C>T (p.Gln1467Ter) rs397509171
NM_007294.4(BRCA1):c.4422T>C (p.Ala1474=) rs756281673
NM_007294.4(BRCA1):c.4524G>A (p.Trp1508Ter) rs80356885
NM_007294.4(BRCA1):c.4535G>T (p.Ser1512Ile) rs1800744
NM_007294.4(BRCA1):c.4600G>A (p.Val1534Met) rs55815649
NM_007294.4(BRCA1):c.4609C>T (p.Gln1537Ter) rs80357229
NM_007294.4(BRCA1):c.4689C>G (p.Tyr1563Ter) rs80357433
NM_007294.4(BRCA1):c.4812A>G (p.Gln1604=) rs28897693
NM_007294.4(BRCA1):c.4816A>G (p.Lys1606Glu) rs80356943
NM_007294.4(BRCA1):c.4837A>G (p.Ser1613Gly) rs1799966
NM_007294.4(BRCA1):c.4956G>A (p.Met1652Ile) rs1799967
NM_007294.4(BRCA1):c.4993G>A (p.Val1665Met) rs80357169
NM_007294.4(BRCA1):c.5035del (p.Asn1678_Leu1679insTer) rs80357896
NM_007294.4(BRCA1):c.5059GTT[1] (p.Val1688del) rs80358344
NM_007294.4(BRCA1):c.5074+6C>G rs80358032
NM_007294.4(BRCA1):c.5102_5103del (p.Leu1701fs) rs80357608
NM_007294.4(BRCA1):c.5144G>A (p.Ser1715Asn) rs45444999
NM_007294.4(BRCA1):c.5207T>C (p.Val1736Ala) rs45553935
NM_007294.4(BRCA1):c.5266C>T (p.Gln1756Ter) rs397509247
NM_007294.4(BRCA1):c.5406+33A>T rs80358092
NM_007294.4(BRCA1):c.5427dup (p.Val1810fs) rs1555574739
NM_007294.4(BRCA1):c.5497G>A (p.Val1833Met) rs80357268
NM_007294.4(BRCA1):c.5521A>C (p.Ser1841Arg) rs80357299
NM_007294.4(BRCA1):c.5576C>G (p.Pro1859Arg) rs80357322
NM_007294.4(BRCA1):c.669G>A (p.Lys223=) rs1131692066
NM_007294.4(BRCA1):c.66A>G (p.Leu22=) rs786202533
NM_007294.4(BRCA1):c.692C>T (p.Thr231Met) rs80357001
NM_007294.4(BRCA1):c.81-14C>T rs80358006
NM_007294.4(BRCA1):c.823G>A (p.Gly275Ser) rs8176153
NM_007294.4(BRCA1):c.844_850dup (p.Gln284fs) rs80357989
NM_007294.4(BRCA1):c.981A>G (p.Thr327=) rs1800063
NM_007297.4(BRCA1):c.407-58del rs8176144
NM_007299.4(BRCA1):c.1048+17A>G rs80358180
NM_007299.4(BRCA1):c.548-17G>T rs80358014
NM_012222.2(MUTYH):c.129C>T (p.Asn43=) rs141679570
NM_012222.2(MUTYH):c.1576C>A (p.Leu526Met) rs3219496
NM_012222.2(MUTYH):c.496-4A>G rs201678305
NM_012222.2(MUTYH):c.724C>T (p.Arg242Cys) rs200495564
NM_012232.6(CAVIN1):c.540G>A (p.Glu180=) rs143511306
NM_014000.3(VCL):c.2862_2864del (p.Leu955del) rs397517237
NM_014244.5(ADAMTS2):c.3154T>G (p.Ser1052Ala) rs201390756
NM_014249.4(NR2E3):c.932G>A (p.Arg311Gln) rs28937873
NM_014251.3(SLC25A13):c.1194A>G (p.Leu398=) rs2301629
NM_014251.3(SLC25A13):c.328+6A>G rs6957975
NM_014336.5(AIPL1):c.1006G>A (p.Ala336Thr) rs143092701
NM_014363.6(SACS):c.1373C>T (p.Thr458Ile) rs61729954
NM_014363.6(SACS):c.2146C>T (p.His716Tyr) rs146852400
NM_014363.6(SACS):c.2580A>G (p.Gln860=) rs41283958
NM_014363.6(SACS):c.2926C>A (p.Arg976Ser) rs139993038
NM_014363.6(SACS):c.4466A>G (p.Asn1489Ser) rs147099630
NM_014363.6(SACS):c.6781C>A (p.Leu2261Ile) rs146722795
NM_014467.3(SRPX2):c.980A>G (p.Asn327Ser) rs121918363
NM_014625.3(NPHS2):c.686G>A (p.Arg229Gln) rs61747728
NM_014915.2(ANKRD26):c.3384G>A (p.Lys1128=) rs41299210
NM_014915.2(ANKRD26):c.4445T>C (p.Ile1482Thr) rs80097260
NM_014915.2(ANKRD26):c.542C>T (p.Thr181Ile) rs191015656
NM_014915.2(ANKRD26):c.92G>C (p.Gly31Ala) rs199849785
NM_015046.7(SETX):c.1504C>T (p.Arg502Trp) rs534723946
NM_015046.7(SETX):c.6122T>C (p.Ile2041Thr) rs140676924
NM_015074.3(KIF1B):c.1977+6360G>T rs41274458
NM_015074.3(KIF1B):c.1977+6625G>A rs145248590
NM_015074.3(KIF1B):c.1977+6956A>G rs148481786
NM_015074.3(KIF1B):c.608+8dup rs139613776
NM_015102.5(NPHP4):c.2519G>A (p.Ser840Asn) rs147588666
NM_015102.5(NPHP4):c.944C>T (p.Thr315Met) rs200684272
NM_015294.6(TRIM37):c.1919G>A (p.Arg640His) rs112762655
NM_015311.3(OBSL1):c.4951G>T (p.Glu1651Ter) rs140825693
NM_015375.3(DSTYK):c.86G>A (p.Arg29Gln) rs200780796
NM_015425.6(POLR1A):c.1097C>T (p.Ser366Phe) rs183490100
NM_015425.6(POLR1A):c.2017C>G (p.Pro673Ala) rs191928354
NM_015559.3(SETBP1):c.4129G>C (p.Val1377Leu) rs77518617
NM_016006.6(ABHD5):c.26A>G (p.Asp9Gly) rs144420157
NM_016038.4(SBDS):c.127G>T (p.Val43Leu) rs147652512
NM_016239.4(MYO15A):c.3203G>T (p.Cys1068Phe) rs189061214
NM_016239.4(MYO15A):c.3659G>A (p.Gly1220Glu) rs201689819
NM_016239.4(MYO15A):c.730G>A (p.Asp244Asn) rs199899548
NM_016239.4(MYO15A):c.7984C>G (p.Leu2662Val) rs200930743
NM_016239.4(MYO15A):c.9913G>A (p.Glu3305Lys) rs535441567
NM_016335.5(PRODH):c.1322T>C (p.Leu441Pro) rs2904551
NM_016341.4(PLCE1):c.1567A>G (p.Ile523Val) rs61751494
NM_016341.4(PLCE1):c.1927G>T (p.Ala643Ser) rs61886330
NM_016953.4(PDE11A):c.919C>T (p.Arg307Ter) rs76308115
NM_017775.4(TTC19):c.820A>G (p.Arg274Gly) rs147111211
NM_017780.4(CHD7):c.8366C>T (p.Ala2789Val) rs376934539
NM_017882.3(CLN6):c.49G>A (p.Gly17Ser) rs763944821
NM_018480.5(TMEM126B):c.635G>T (p.Gly212Val) rs141542003
NM_018848.3(MKKS):c.862G>A (p.Val288Ile) rs113032343
NM_019098.5(CNGB3):c.2158CAAAAAGAAAATGAAGATAAA[1] (p.720QKENEDK[1]) rs746549330
NM_020320.5(RARS2):c.1026G>A (p.Met342Ile) rs34647222
NM_020320.5(RARS2):c.1366C>T (p.Arg456Cys) rs147844153
NM_020320.5(RARS2):c.726A>G (p.Gln242=) rs145499324
NM_020361.5(CPA6):c.1237C>T (p.Leu413Phe) rs142597675
NM_020366.3(RPGRIP1):c.2435G>A (p.Arg812Gln) rs190490019
NM_020435.4(GJC2):c.575C>G (p.Pro192Arg) rs375318012
NM_020745.4(AARS2):c.1084A>T (p.Met362Leu) rs147091256
NM_020921.3(NIN):c.2665G>C (p.Val889Leu) rs78251482
NM_020956.2(PRX):c.*1779T>C rs149715830
NM_021076.4(NEFH):c.2601G>T (p.Lys867Asn) rs138156220
NM_021870.3(FGG):c.124G>A (p.Gly42Ser)
NM_021870.3(FGG):c.571G>A (p.Gly191Arg) rs6063
NM_021930.6(RINT1):c.2276C>T (p.Pro759Leu) rs34310648
NM_021930.6(RINT1):c.782C>T (p.Pro261Leu) rs199535472
NM_022081.6(HPS4):c.1543T>C (p.Cys515Arg) rs148134252
NM_022114.4(PRDM16):c.171C>T (p.Ser57=) rs369648897
NM_022124.6(CDH23):c.2239C>T (p.Arg747Cys) rs200649500
NM_022124.6(CDH23):c.5038G>A (p.Val1680Ile) rs201364852
NM_022124.6(CDH23):c.9565C>T (p.Arg3189Trp) rs121908353
NM_022168.4(IFIH1):c.1641+1G>C rs35337543
NM_022370.4(ROBO3):c.1838C>T (p.Thr613Ile) rs200202857
NM_022455.4(NSD1):c.7576C>T (p.Pro2526Ser) rs373932824
NM_022464.5(SIL1):c.1039G>A (p.Glu347Lys) rs73265454
NM_024407.5(NDUFS7):c.47G>A (p.Gly16Asp)
NM_024411.5(PDYN):c.268G>A (p.Gly90Arg) rs201585283
NM_024642.5(GALNT12):c.673A>T (p.Thr225Ser) rs531023279
NM_024675.3(PALB2):c.1110G>A (p.Gln370=) rs756002989
NM_024675.3(PALB2):c.12T>C (p.Pro4=) rs567706422
NM_024675.3(PALB2):c.1470C>T (p.Pro490=) rs45612837
NM_024675.3(PALB2):c.2100A>T (p.Ser700=) rs757145884
NM_024675.3(PALB2):c.2607C>T (p.Ser869=) rs45542234
NM_024675.3(PALB2):c.2674G>A (p.Glu892Lys) rs45476495
NM_024675.3(PALB2):c.298C>T (p.Leu100Phe) rs61756147
NM_024675.3(PALB2):c.3549C>G (p.Tyr1183Ter) rs118203998
NM_024675.3(PALB2):c.400G>A (p.Asp134Asn) rs139555085
NM_024675.3(PALB2):c.48+7G>C rs190626072
NM_024675.3(PALB2):c.53A>G (p.Lys18Arg) rs138789658
NM_024996.7(GFM1):c.788A>G (p.Gln263Arg) rs115984741
NM_025000.4(DCAF17):c.322-14C>T rs192861143
NM_025074.7(FRAS1):c.5374G>A (p.Ala1792Thr) rs150916370
NM_025114.4(CEP290):c.7394_7395del (p.Glu2465fs) rs569673313
NM_030621.4(DICER1):c.4199A>G (p.Asp1400Gly) rs139536688
NM_030665.4(RAI1):c.3778GAG[1] (p.Glu1261del) rs149716029
NM_030665.4(RAI1):c.516C>A (p.His172Gln) rs147481626
NM_030665.4(RAI1):c.834GCA[7] (p.Gln286_Gln291del) rs371983878
NM_032043.2(BRIP1):c.1433A>G (p.His478Arg) rs45501097
NM_032043.2(BRIP1):c.1552G>A (p.Val518Ile) rs786201701
NM_032043.2(BRIP1):c.2324A>G (p.Asn775Ser) rs571108955
NM_032043.2(BRIP1):c.2406C>T (p.Asp802=) rs748981650
NM_032043.2(BRIP1):c.3459T>C (p.Asp1153=) rs4987050
NM_032043.2(BRIP1):c.584T>C (p.Leu195Pro) rs4988347
NM_032043.2(BRIP1):c.790C>T (p.Arg264Trp) rs28997569
NM_032043.2(BRIP1):c.918+1G>A rs587781655
NM_032043.2(BRIP1):c.924A>G (p.Lys308=) rs374974885
NM_032043.3(BRIP1):c.139C>G (p.Pro47Ala) rs28903098
NM_032119.4(ADGRV1):c.11974G>A (p.Asp3992Asn) rs201386977
NM_032119.4(ADGRV1):c.15608A>G (p.Glu5203Gly) rs202106463
NM_032119.4(ADGRV1):c.9447+6G>A rs201481219
NM_032119.4(ADGRV1):c.9466A>G (p.Ile3156Val) rs372484022
NM_032273.4(TMEM126A):c.314G>A (p.Arg105Gln) rs146573578
NM_032383.5(HPS3):c.1773G>A (p.Thr591=) rs559550536
NM_032581.4(FAM126A):c.191A>G (p.Tyr64Cys) rs146913158
NM_033084.5(FANCD2):c.2022-5C>T rs4019784
NM_033084.5(FANCD2):c.983G>A (p.Arg328Gln) rs35625434
NM_033305.3(VPS13A):c.775A>G (p.Asn259Asp) rs41307461
NM_052867.4(NALCN):c.2495A>G (p.Tyr832Cys) rs549182297
NM_053025.4(MYLK):c.5477C>T (p.Ala1826Val) rs147187907
NM_058216.3(RAD51C):c.397C>T (p.Gln133Ter) rs387907159
NM_058216.3(RAD51C):c.904+5G>T rs587782702
NM_080916.3(DGUOK):c.4G>T (p.Ala2Ser) rs147551003
NM_133259.4(LRPPRC):c.2210+4A>C rs190007694
NM_133259.4(LRPPRC):c.2569A>G (p.Arg857Gly) rs200138144
NM_133261.3(GIPC3):c.856G>A (p.Val286Ile) rs138339125
NM_138694.4(PKHD1):c.107C>T (p.Thr36Met) rs137852944
NM_138694.4(PKHD1):c.275G>A (p.Arg92Gln) rs145886657
NM_138694.4(PKHD1):c.8345G>C (p.Gly2782Ala) rs147222255
NM_138694.4(PKHD1):c.9530T>C (p.Ile3177Thr) rs200511261
NM_138715.3(MSR1):c.877C>T (p.Arg293Ter) rs41341748
NM_138959.3(VANGL1):c.715G>A (p.Val239Ile) rs121918218
NM_139011.3(HFE):c.77-2168C>G rs1799945
NM_139076.3(ABRAXAS1):c.7G>C (p.Gly3Arg) rs370520589
NM_139242.4(MTFMT):c.669G>T (p.Leu223Phe) rs372732702
NM_144508.5(KNL1):c.4772A>G (p.Asn1591Ser) rs200656662
NM_144508.5(KNL1):c.812C>G (p.Thr271Ser) rs201037775
NM_144773.3(PROKR2):c.518T>G (p.Leu173Arg) rs74315416
NM_144966.5(FREM1):c.4945A>G (p.Ile1649Val) rs199891537
NM_147127.5(EVC2):c.2263C>T (p.Gln755Ter) rs751356206
NM_152419.3(HGSNAT):c.1843G>A (p.Ala615Thr) rs112029032
NM_152841.2(HPS4):c.1381C>T (p.Arg461Cys) rs147435410
NM_153676.4(USH1C):c.1858C>T (p.Arg620Cys) rs143160805
NM_153704.6(TMEM67):c.1078A>G (p.Thr360Ala) rs140191346
NM_172362.3(KCNH1):c.2962G>T (p.Ala988Ser) rs371262198
NM_173076.3(ABCA12):c.1222T>C (p.Ser408Pro) rs189141015
NM_173076.3(ABCA12):c.3481A>T (p.Met1161Leu) rs141077206
NM_173076.3(ABCA12):c.6919A>G (p.Ile2307Val) rs150196545
NM_173472.2(FANCD2OS):c.44-5713G>A rs147675860
NM_173477.5(USH1G):c.837C>G (p.Asp279Glu) rs142486910
NM_173560.4(RFX6):c.223G>C (p.Glu75Gln) rs201996097
NM_173591.3(OTOGL):c.1788G>T (p.Gln596His) rs192234924
NM_173591.3(OTOGL):c.3250A>C (p.Asn1084His) rs867315415
NM_173591.3(OTOGL):c.3648G>C (p.Gln1216His) rs139375212
NM_175053.4(KRT74):c.143G>A (p.Arg48Gln) rs759304994
NM_175614.5(NDUFA11):c.138G>A (p.Pro46=) rs138889960
NM_177438.2(DICER1):c.5276A>G (p.Lys1759Arg) rs144259142
NM_177438.2(DICER1):c.59C>T (p.Ala20Val) rs147660793
NM_178335.3(CCDC50):c.1276A>G (p.Lys426Glu) rs114146378
NM_181507.1(HPS5):c.241G>A (p.Ala81Thr) rs147053126
NM_182760.4(SUMF1):c.463T>C (p.Ser155Pro) rs137852850
NM_182914.2(SYNE2):c.20410G>A (p.Asp6804Asn) rs150644129
NM_182961.4(SYNE1):c.12585G>A (p.Lys4195=) rs149536991
NM_198129.4(LAMA3):c.4060G>A (p.Glu1354Lys) rs34799994
NM_198253.3(TERT):c.1317GGA[2] (p.Glu441del) rs377639087
NM_198407.2(GHSR):c.531C>A (p.Pro177=) rs4988509
NM_198578.4(LRRK2):c.2264C>T (p.Pro755Leu) rs34410987
NM_198994.3(TGM6):c.115A>T (p.Ser39Cys) rs144201778
NM_201384.3(PLEC):c.8506G>A (p.Asp2836Asn) rs200814155
NM_206933.4(USH2A):c.5698T>G (p.Cys1900Gly) rs201026468
NM_206933.4(USH2A):c.7334C>T (p.Ser2445Phe) rs41315579
NM_207361.6(FREM2):c.2128C>T (p.Arg710Cys) rs41292753
NM_207361.6(FREM2):c.4960A>C (p.Ser1654Arg) rs114595447
NM_207361.6(FREM2):c.8902G>A (p.Val2968Ile) rs116099212
NM_212482.3(FN1):c.4486C>T (p.Arg1496Trp) rs139078629
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.