ClinVar Miner

Variants from Gharavi Laboratory, Columbia University with conflicting interpretations

Location: United States  Primary collection method: research
Minimum review status of the submission from Gharavi Laboratory, Columbia University: Collection method of the submission from Gharavi Laboratory, Columbia University:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
1150 210 1 73 48 6 90 200

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
Gharavi Laboratory, Columbia University pathogenic likely pathogenic uncertain significance likely benign benign drug response risk factor other
pathogenic 0 30 9 0 0 1 3 1
likely pathogenic 40 0 30 4 1 0 0 0
uncertain significance 27 27 1 35 16 2 0 0
likely benign 0 3 5 0 2 0 0 0
benign 0 0 0 1 0 0 0 0

Submitter to submitter summary #

Total submitters: 46
Download table as spreadsheet
Submitter Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
Invitae 0 98 0 34 24 0 44 102
GeneDx 0 133 0 23 17 0 22 62
PreventionGenetics, part of Exact Sciences 0 51 0 12 11 0 8 31
CeGaT Center for Human Genetics Tuebingen 0 30 0 9 10 0 7 26
Women's Health and Genetics/Laboratory Corporation of America, LabCorp 0 18 0 0 4 0 10 14
Eurofins Ntd Llc (ga) 0 17 0 4 3 0 6 13
Athena Diagnostics Inc 0 39 0 7 0 0 5 12
Revvity Omics, Revvity 0 15 0 4 2 0 6 12
Mayo Clinic Laboratories, Mayo Clinic 0 18 0 4 2 0 2 8
Joint Genome Diagnostic Labs from Nijmegen and Maastricht, Radboudumc and MUMC+ 0 14 0 5 0 0 2 7
Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center 0 9 0 2 4 0 1 7
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine 0 8 0 0 4 0 2 6
Laboratory of Diagnostic Genome Analysis, Leiden University Medical Center (LUMC) 0 8 0 2 3 0 1 6
OMIM 0 0 0 0 0 4 0 4
Genetic Services Laboratory, University of Chicago 0 3 0 0 4 0 0 4
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories 0 14 0 2 0 0 2 4
Genome Diagnostics Laboratory, University Medical Center Utrecht 0 13 0 2 1 0 1 4
Blueprint Genetics 0 15 0 3 1 0 0 4
Department of Pathology and Laboratory Medicine, Sinai Health System 0 5 0 0 1 0 3 4
AiLife Diagnostics, AiLife Diagnostics 0 8 0 4 0 0 0 4
Ambry Genetics 0 17 0 1 2 0 0 3
Fulgent Genetics, Fulgent Genetics 0 10 0 0 0 0 3 3
Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital 0 7 0 1 1 0 1 3
Genome Diagnostics Laboratory, Amsterdam University Medical Center 0 3 0 2 0 0 1 3
Al Jalila Children's Genomics Center, Al Jalila Childrens Speciality Hospital 0 0 0 0 2 0 1 3
Genome-Nilou Lab 0 0 0 0 0 0 3 3
Molecular Genetics of Inherited Kidney Disorders Laboratory, Garvan Institute of Medical Research 0 2 0 2 0 0 1 3
Baylor Genetics 0 0 0 0 0 0 2 2
Greenwood Genetic Center Diagnostic Laboratories, Greenwood Genetic Center 0 4 0 1 0 0 1 2
Quest Diagnostics Nichols Institute San Juan Capistrano 0 14 0 1 0 0 1 2
Albrecht-Kossel-Institute, Medical University Rostock 0 0 0 0 0 2 0 2
Center for Pediatric Genomic Medicine, Children's Mercy Hospital and Clinics 0 4 0 0 0 0 2 2
Centre for Mendelian Genomics, University Medical Centre Ljubljana 0 1 0 2 0 0 0 2
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen 0 4 0 1 1 0 0 2
Biesecker Lab/Clinical Genomics Section, National Institutes of Health 0 0 1 0 0 0 0 1
Clinical Genetics, Academic Medical Center 0 5 0 1 0 0 0 1
Mendelics 0 2 0 0 1 0 0 1
PharmGKB 0 0 0 0 0 1 0 1
Illumina Laboratory Services, Illumina 0 5 0 0 1 0 0 1
Stanford Center for Inherited Cardiovascular Disease, Stanford University 0 5 0 1 0 0 0 1
Institute for Clinical Genetics, University Hospital TU Dresden, University Hospital TU Dresden 0 4 0 0 1 0 0 1
Clinical Genetics, Erasmus University Medical Center 0 0 0 0 0 0 1 1
Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen 0 8 0 1 0 0 0 1
Ocular Genomics Institute, Massachusetts Eye and Ear 0 0 0 0 0 0 1 1
Practice for Gait Abnormalities, David Pomarino, Competency Network Toe Walking c/o Practice Pomarino 0 0 0 1 0 0 0 1
Laboratorio de Genetica e Diagnostico Molecular, Hospital Israelita Albert Einstein 0 3 0 0 0 0 1 1

All variants with conflicting interpretations #

Total variants: 200
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_014625.4(NPHS2):c.686G>A (p.Arg229Gln) rs61747728 0.02796
NM_000518.5(HBB):c.20A>T (p.Glu7Val) rs334 0.01298
NM_000371.4(TTR):c.424G>A (p.Val142Ile) rs76992529 0.00501
NM_004525.3(LRP2):c.6473A>C (p.Asn2158Thr) rs34052957 0.00157
NM_001126108.2(SLC12A3):c.363G>C (p.Glu121Asp) rs146632606 0.00102
NM_001360.3(DHCR7):c.199G>A (p.Ala67Thr) rs143999854 0.00093
NM_001177316.2(SLC34A3):c.575C>T (p.Ser192Leu) rs199690076 0.00059
NM_001126108.2(SLC12A3):c.37G>C (p.Ala13Pro) rs147200024 0.00048
NM_000169.3(GLA):c.376A>G (p.Ser126Gly) rs149391489 0.00043
NM_000169.3(GLA):c.352C>T (p.Arg118Cys) rs148158093 0.00040
NM_000091.5(COL4A3):c.4981C>T (p.Arg1661Cys) rs201697532 0.00039
NM_000551.4(VHL):c.241C>T (p.Pro81Ser) rs104893829 0.00039
NM_001009944.3(PKD1):c.9829C>T (p.Arg3277Cys) rs148812376 0.00032
NM_022042.4(SLC26A1):c.1073C>T (p.Ser358Leu) rs148832260 0.00032
NM_006005.3(WFS1):c.1371G>T (p.Arg457Ser) rs113446173 0.00030
NM_000168.6(GLI3):c.2119C>T (p.Pro707Ser) rs121917716 0.00028
NM_153240.5(NPHP3):c.2694-2_2694-1del rs751527253 0.00026
NM_020975.6(RET):c.785T>C (p.Val262Ala) rs139790943 0.00024
NM_024426.6(WT1):c.760C>T (p.Pro254Ser) rs2234584 0.00022
NM_004064.5(CDKN1B):c.-80C>T rs551236750 0.00021
NM_000216.4(ANOS1):c.555G>C (p.Lys185Asn) rs140670828 0.00019
NM_004646.4(NPHS1):c.559G>A (p.Val187Met) rs199646884 0.00016
NM_022042.4(SLC26A1):c.554C>T (p.Thr185Met) rs139024319 0.00016
NM_001126108.2(SLC12A3):c.1928C>T (p.Pro643Leu) rs140012781 0.00014
NM_033380.3(COL4A5):c.4567C>A (p.Pro1523Thr) rs201220208 0.00014
NM_170784.3(MKKS):c.1553G>A (p.Arg518His) rs149051148 0.00014
NM_000169.3(GLA):c.1088G>A (p.Arg363His) rs111422676 0.00013
NM_000503.6(EYA1):c.865G>T (p.Asp289Tyr) rs201504674 0.00011
NM_014625.4(NPHS2):c.868G>A (p.Val290Met) rs200482683 0.00011
NM_024753.5(TTC21B):c.626C>T (p.Pro209Leu) rs140511594 0.00011
NM_000092.5(COL4A4):c.5045G>A (p.Arg1682Gln) rs368404711 0.00010
NM_001110556.2(FLNA):c.2609A>G (p.His870Arg) rs200679107 0.00009
NM_004646.4(NPHS1):c.2335-1G>A rs150038620 0.00009
NM_001126108.2(SLC12A3):c.2864G>A (p.Arg955Gln) rs202114767 0.00008
NM_002968.3(SALL1):c.1738A>G (p.Ile580Val) rs761575154 0.00008
NM_017780.4(CHD7):c.2194C>G (p.Pro732Ala) rs200277422 0.00008
NM_033380.3(COL4A5):c.4246C>T (p.Arg1416Cys) rs104886270 0.00008
NM_000540.3(RYR1):c.7300G>A (p.Gly2434Arg) rs121918593 0.00006
NM_014140.4(SMARCAL1):c.836T>C (p.Phe279Ser) rs775057827 0.00006
NM_138694.4(PKHD1):c.4870C>T (p.Arg1624Trp) rs200391019 0.00006
NM_170784.3(MKKS):c.830T>C (p.Leu277Pro) rs74315398 0.00006
NM_000091.5(COL4A3):c.1096G>A (p.Gly366Arg) rs539765620 0.00005
NM_001126108.2(SLC12A3):c.2191G>A (p.Gly731Arg) rs752101663 0.00005
NM_017780.4(CHD7):c.8356G>A (p.Gly2786Arg) rs765315726 0.00005
NM_138694.4(PKHD1):c.9530T>C (p.Ile3177Thr) rs200511261 0.00005
NM_000091.5(COL4A3):c.172G>A (p.Gly58Ser) rs184730597 0.00004
NM_002473.6(MYH9):c.5630G>A (p.Arg1877Gln) rs759777823 0.00004
NM_014625.4(NPHS2):c.851C>T (p.Ala284Val) rs780761368 0.00004
NM_015272.5(RPGRIP1L):c.583A>T (p.Lys195Ter) rs1277577195 0.00004
NM_138694.4(PKHD1):c.2414C>T (p.Pro805Leu) rs199531851 0.00004
NM_000257.4(MYH7):c.2389G>A (p.Ala797Thr) rs3218716 0.00003
NM_000455.5(STK11):c.566C>T (p.Thr189Ile) rs587781515 0.00003
NM_000466.3(PEX1):c.721del (p.Ser241fs) rs894289737 0.00003
NM_001009944.3(PKD1):c.3496G>A (p.Gly1166Ser) rs573566419 0.00003
NM_001126108.2(SLC12A3):c.1844C>T (p.Ser615Leu) rs779160677 0.00003
NM_001126108.2(SLC12A3):c.815T>C (p.Leu272Pro) rs568513106 0.00003
NM_003000.3(SDHB):c.136C>T (p.Arg46Ter) rs74315370 0.00003
NM_000069.3(CACNA1S):c.1948+1G>A rs745712829 0.00002
NM_000091.5(COL4A3):c.898G>A (p.Gly300Arg) rs772708743 0.00002
NM_000092.5(COL4A4):c.1223G>A (p.Gly408Glu) rs1026613471 0.00002
NM_000545.8(HNF1A):c.1576G>A (p.Asp526Asn) rs1315721381 0.00002
NM_033380.3(COL4A5):c.5048G>A (p.Arg1683Gln) rs104886308 0.00002
NM_000069.3(CACNA1S):c.2269C>T (p.Arg757Ter) rs770073633 0.00001
NM_000069.3(CACNA1S):c.3795G>T (p.Gln1265His) rs201627041 0.00001
NM_000069.3(CACNA1S):c.3988del (p.Leu1330fs) rs757045433 0.00001
NM_000091.5(COL4A3):c.1927G>A (p.Gly643Ser) rs778034451 0.00001
NM_000091.5(COL4A3):c.2452G>A (p.Gly818Arg) rs868002181 0.00001
NM_000091.5(COL4A3):c.3499G>A (p.Gly1167Arg) rs267606745 0.00001
NM_000091.5(COL4A3):c.352G>A (p.Gly118Arg) rs1293137291 0.00001
NM_000092.5(COL4A4):c.2092G>A (p.Gly698Arg) rs1241404192 0.00001
NM_000092.5(COL4A4):c.4122del (p.Cys1375fs) rs1162601696 0.00001
NM_000092.5(COL4A4):c.489+1G>A rs1040287646 0.00001
NM_000169.3(GLA):c.1196G>C (p.Trp399Ser) rs782449839 0.00001
NM_000368.5(TSC1):c.397G>A (p.Val133Ile) rs118203381 0.00001
NM_000388.4(CASR):c.1189G>A (p.Gly397Arg) rs1064794291 0.00001
NM_000435.3(NOTCH3):c.2182C>T (p.Arg728Cys) rs1057519101 0.00001
NM_000441.2(SLC26A4):c.1708-1G>A rs759414956 0.00001
NM_000478.6(ALPL):c.994G>T (p.Glu332Ter) rs768976020 0.00001
NM_001003841.3(SLC6A19):c.728del (p.Thr243fs) rs1561165786 0.00001
NM_001009944.3(PKD1):c.8311G>A (p.Glu2771Lys) rs1057518897 0.00001
NM_001034116.2(EIF2B4):c.1191+2T>C rs751867352 0.00001
NM_001042492.3(NF1):c.4813A>G (p.Ile1605Val) rs199474766 0.00001
NM_001110556.2(FLNA):c.5116G>A (p.Gly1706Ser) rs781993685 0.00001
NM_001126108.2(SLC12A3):c.557G>A (p.Gly186Asp) rs759426055 0.00001
NM_001177701.3(IFT27):c.234+1G>A rs1159774355 0.00001
NM_001360.3(DHCR7):c.1084C>T (p.Arg362Cys) rs371302153 0.00001
NM_001374828.1(ARID1B):c.3236-1G>A rs752642190 0.00001
NM_003361.4(UMOD):c.317G>T (p.Cys106Phe) rs398123697 0.00001
NM_003361.4(UMOD):c.326T>A (p.Val109Glu) rs780462125 0.00001
NM_004621.6(TRPC6):c.643C>T (p.Arg215Trp) rs768210838 0.00001
NM_004985.5(KRAS):c.34G>A (p.Gly12Ser) rs121913530 0.00001
NM_005912.3(MC4R):c.466C>T (p.Gln156Ter) rs369841551 0.00001
NM_015559.3(SETBP1):c.2612T>C (p.Ile871Thr) rs267607038 0.00001
NM_015631.6(TCTN3):c.627+1G>A rs1566074908 0.00001
NM_016341.4(PLCE1):c.2960A>G (p.His987Arg) rs762245091 0.00001
NM_018668.5(VPS33B):c.96+1G>T rs1567232168 0.00001
NM_019892.6(INPP5E):c.1787G>C (p.Arg596Thr) rs765327224 0.00001
NM_020937.4(FANCM):c.1060C>T (p.Gln354Ter) rs1156577591 0.00001
NM_033380.3(COL4A5):c.1276G>A (p.Gly426Arg) rs104886111 0.00001
NM_033380.3(COL4A5):c.2510-2A>G rs760109866 0.00001
NM_153240.5(NPHP3):c.3287T>C (p.Leu1096Pro) rs777276873 0.00001
NM_000039.3(APOA1):c.532_533dup (p.His179fs) rs781350389
NM_000059.4(BRCA2):c.8488-1G>A rs397507404
NM_000059.4(BRCA2):c.9593_9594del (p.Cys3198fs) rs1566260198
NM_000063.6(C2):c.1102C>T (p.Arg368Ter) rs866130958
NM_000069.3(CACNA1S):c.4113+1G>A rs1558056376
NM_000069.3(CACNA1S):c.5104C>T (p.Arg1702Ter) rs550371466
NM_000091.5(COL4A3):c.1006G>T (p.Gly336Cys) rs1559873550
NM_000091.5(COL4A3):c.1201G>A (p.Gly401Arg) rs1559878824
NM_000091.5(COL4A3):c.1354G>A (p.Gly452Arg) rs772958162
NM_000091.5(COL4A3):c.1504+1G>A rs1559882199
NM_000091.5(COL4A3):c.190G>C (p.Gly64Arg) rs917643323
NM_000091.5(COL4A3):c.3546_3548dup (p.Gly1183dup) rs1175052474
NM_000091.5(COL4A3):c.3592G>A (p.Gly1198Ser) rs920061910
NM_000092.5(COL4A4):c.282_283del (p.Asp96fs) rs1559677146
NM_000092.5(COL4A4):c.4082-1G>T rs1559438651
NM_000092.5(COL4A4):c.4760del (p.Pro1587fs) rs1206142672
NM_000124.4(ERCC6):c.809del (p.Gly270fs) rs923535659
NM_000169.3(GLA):c.548G>A (p.Gly183Asp) rs398123212
NM_000169.3(GLA):c.926C>T (p.Ala309Val) rs869312155
NM_000179.3(MSH6):c.1483C>T (p.Arg495Ter) rs587779212
NM_000179.3(MSH6):c.3716_3717del (p.Ile1239fs) rs1064794384
NM_000210.4(ITGA6):c.400C>T (p.Arg134Ter) rs866151033
NM_000218.3(KCNQ1):c.797T>C (p.Leu266Pro) rs199473460
NM_000255.4(MMUT):c.912-1G>A rs1561957527
NM_000256.3(MYBPC3):c.3815-1G>A rs397516044
NM_000278.5(PAX2):c.219C>G (p.Tyr73Ter) rs139724326
NM_000297.4(PKD2):c.2208_2213del (p.Leu736_Asn737del) rs778896252
NM_000334.4(SCN4A):c.1173del (p.Phe392fs) rs1235665641
NM_000335.5(SCN5A):c.3943C>T (p.Arg1315Ter) rs1553695764
NM_000435.3(NOTCH3):c.1871G>A (p.Cys624Tyr) rs758997426
NM_000458.4(HNF1B):c.1006C>G (p.His336Asp)
NM_000466.3(PEX1):c.3115del (p.Thr1039fs) rs1562846257
NM_000516.7(GNAS):c.-178_-171del rs1420599206
NM_000522.5(HOXA13):c.351_377del (p.Ala125_Ala133del) rs1195806602
NM_000522.5(HOXA13):c.360_377del (p.Ala128_Ala133del) rs35861510
NM_000522.5(HOXA13):c.421_422insAGGCGGGCC (p.Gly140_Pro141insGlnAlaGly) rs35599078
NM_001005242.3(PKP2):c.1379-2047_1379-2043del rs775995156
NM_001009944.3(PKD1):c.1261C>T (p.Arg421Cys) rs1567216536
NM_001009944.3(PKD1):c.12691C>T (p.Gln4231Ter) rs755496450
NM_001009944.3(PKD1):c.2180T>C (p.Leu727Pro) rs1616940
NM_001009944.3(PKD1):c.3401_3404del (p.Ser1134fs) rs1567204146
NM_001009944.3(PKD1):c.3955G>A (p.Gly1319Arg) rs747362311
NM_001009944.3(PKD1):c.6508dup (p.Glu2170fs) rs1567192623
NM_001009944.3(PKD1):c.7327G>T (p.Gly2443Ter) rs1567186165
NM_001009944.3(PKD1):c.7546C>T (p.Arg2516Cys) rs797044902
NM_001009944.3(PKD1):c.8218G>T (p.Gly2740Ter) rs1555451368
NM_001009944.3(PKD1):c.8447T>C (p.Leu2816Pro) rs1567177684
NM_001041.4(SI):c.2654_2657del (p.Asp885fs) rs1221816681
NM_001123385.2(BCOR):c.2423_2424delinsAC (p.Leu808His) rs1569155643
NM_001127898.4(CLCN5):c.1609C>T (p.Arg537Ter) rs797044811
NM_001177316.2(SLC34A3):c.944del (p.Gly315fs) rs1473689787
NM_001360.3(DHCR7):c.91C>T (p.Arg31Cys) rs367585401
NM_001374828.1(ARID1B):c.1211GAG[4] (p.Gly408_Gly411del) rs747790383
NM_001374828.1(ARID1B):c.1266GGC[1] (p.Ala431_Ala433del) rs765410747
NM_001374828.1(ARID1B):c.1281GGC[5] (p.Ala433dup) rs764418312
NM_001374828.1(ARID1B):c.1293_1311dup (p.Gly438fs) rs943407609
NM_001374828.1(ARID1B):c.1619CGG[5] (p.Ala543dup) rs757953295
NM_001374828.1(ARID1B):c.594GCAGCAGCAGCAGCAGCAACAGCA[1] (p.Gln207_Gln214del) rs770869529
NM_001374828.1(ARID1B):c.615GCA[4] (p.Gln212_Gln214del) rs587779744
NM_001384732.1(CPLANE1):c.2937dup (p.Ile980fs) rs1561601398
NM_001457.4(FLNB):c.4172_4173inv (p.Ala1391Val)
NM_001567.4(INPPL1):c.1893_1894delinsAA (p.Leu632Ile) rs1565392009
NM_001692.4(ATP6V1B1):c.367+1G>A rs1343871627
NM_002968.2(SALL1):c.466_477dup (p.Ser159_Gly160insSerSerSerSer) rs113614842
NM_003193.5(TBCE):c.841C>T (p.Gln281Ter) rs752790319
NM_003361.4(UMOD):c.197T>C (p.Leu66Pro) rs1567311288
NM_003361.4(UMOD):c.628G>A (p.Gly210Ser) rs1567309965
NM_004985.5(KRAS):c.108A>G (p.Ile36Met) rs727503109
NM_005515.4(MNX1):c.375CGC[7] (p.Ala133_Ala134del) rs548755417
NM_005515.4(MNX1):c.375CGC[8] (p.Ala134del) rs548755417
NM_005562.3(LAMC2):c.3328+1G>A rs1475860578
NM_006005.3(WFS1):c.1046TCT[1] (p.Phe350del) rs1560418164
NM_006005.3(WFS1):c.2563_2565delinsCCG (p.Ser855Pro) rs1560422132
NM_006005.3(WFS1):c.2643_2646del (p.Phe882fs) rs1560422383
NM_006015.6(ARID1A):c.48GCC[7] (p.Pro20_Pro21dup) rs748085214
NM_014270.5(SLC7A9):c.1353C>A (p.Tyr451Ter) rs1007096305
NM_014625.4(NPHS2):c.451+2T>A rs786204708
NM_015330.6(SPECC1L):c.3326C>T (p.Thr1109Met) rs1247798129
NM_017415.3(KLHL3):c.1079G>A (p.Arg360Gln) rs1561586322
NM_025074.7(FRAS1):c.2571del (p.Ala856_Cys857insTer) rs1560681144
NM_025114.4(CEP290):c.4704+1G>T rs1565835538
NM_030665.4(RAI1):c.834GCA[16] (p.Gln289_Gln291dup) rs371983878
NM_030665.4(RAI1):c.834GCA[7] (p.Gln286_Gln291del) rs371983878
NM_032444.4(SLX4):c.4823C>G (p.Ser1608Ter) rs200628199
NM_033380.3(COL4A5):c.1607G>A (p.Gly536Asp) rs104886125
NM_033380.3(COL4A5):c.2332G>A (p.Gly778Ser) rs104886174
NM_033380.3(COL4A5):c.2965_2982del (p.Asp989_Gly994del) rs104886374
NM_033380.3(COL4A5):c.3427G>A (p.Gly1143Ser) rs104886228
NM_033380.3(COL4A5):c.3685G>A (p.Gly1229Ser) rs1569505771
NM_033380.3(COL4A5):c.4282C>T (p.Arg1428Cys) rs144282156
NM_033380.3(COL4A5):c.646G>A (p.Gly216Arg) rs104886067
NM_139058.3(ARX):c.306GGC[5] (p.Ala111_Ala115del) rs387906492
NM_139058.3(ARX):c.451_465del (p.Ala151_Ala155del) rs757588621
NM_152618.3(BBS12):c.1151del (p.Ser384fs) rs1553941404
NM_173689.7(CRB2):c.2400C>G (p.Asn800Lys) rs765676223
NM_198252.3(GSN):c.-9-2091_-9-2064del rs764841269
NM_203486.3(DLL3):c.529_535del (p.Arg177fs) rs1452482256
NM_207361.6(FREM2):c.7002_7005del (p.Glu2335fs) rs768342700
NR_178195.1(LFNG):n.265_268GATG[8] rs34637446

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.