ClinVar Miner

Variants from Center for Advanced Laboratory Medicine, UC San Diego Health,University of California San Diego with conflicting interpretations

Location: United States — Primary collection method: clinical testing
Minimum review status of the submission from Center for Advanced Laboratory Medicine, UC San Diego Health,University of California San Diego: Collection method of the submission from Center for Advanced Laboratory Medicine, UC San Diego Health,University of California San Diego:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
600 66 0 31 29 0 3 55

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
Center for Advanced Laboratory Medicine, UC San Diego Health,University of California San Diego likely pathogenic uncertain significance likely benign benign
pathogenic 2 1 0 0
likely pathogenic 0 1 0 0
uncertain significance 0 0 2 1
likely benign 1 20 0 18
benign 0 6 11 0

Submitter to submitter summary #

Total submitters: 22
Download table as spreadsheet
Submitter Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
CHEO Genetics Diagnostic Laboratory,Children's Hospital of Eastern Ontario 0 27 0 14 7 0 0 21
Color Health, Inc 0 18 0 3 5 0 1 9
Ambry Genetics 0 6 0 5 1 0 0 6
Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine 0 15 0 3 1 0 0 4
GeneDx 0 11 0 4 0 0 0 4
Integrated Genetics/Laboratory Corporation of America 0 6 0 3 1 0 0 4
University of Washington Center for Mendelian Genomics, University of Washington 0 1 0 0 3 0 1 4
Biesecker Lab/Clinical Genomics Section,National Institutes of Health 0 6 0 2 1 0 0 3
Stanford Center for Inherited Cardiovascular Disease, Stanford University 0 0 0 0 3 0 0 3
CeGaT Praxis fuer Humangenetik Tuebingen 0 2 0 0 3 0 0 3
ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories 0 2 0 2 0 0 0 2
EGL Genetic Diagnostics, Eurofins Clinical Diagnostics 0 4 0 0 2 0 0 2
CSER _CC_NCGL, University of Washington 0 3 0 0 2 0 0 2
Athena Diagnostics Inc 0 1 0 1 0 0 0 1
Genetic Services Laboratory, University of Chicago 0 0 0 0 1 0 0 1
Blueprint Genetics 0 2 0 1 0 0 0 1
Illumina Clinical Services Laboratory,Illumina 0 2 0 0 1 0 0 1
Agnes Ginges Centre for Molecular Cardiology,Centenary Institute 0 2 0 1 0 0 0 1
Scripps Translational Science Institute,Scripps Health and The Scripps Research Institute 0 0 0 0 0 0 1 1
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 0 0 0 1 0 0 0 1
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute 0 0 0 0 1 0 0 1
Loeys Lab,Universiteit Antwerpen 0 0 0 0 1 0 0 1

All variants with conflicting interpretations #

Total variants: 55
Download table as spreadsheet
HGVS dbSNP
NM_000256.3(MYBPC3):c.3004C>T (p.Arg1002Trp) rs3729799
NM_000256.3(MYBPC3):c.3413G>A (p.Arg1138His) rs187705120
NM_000256.3(MYBPC3):c.461T>C (p.Ile154Thr) rs373946195
NM_000256.3(MYBPC3):c.643C>T (p.Arg215Cys) rs397516063
NM_000256.3(MYBPC3):c.833del (p.Gly278fs) rs727503212
NM_000256.3(MYBPC3):c.961G>A (p.Val321Met) rs200119454
NM_000364.3(TNNT2):c.113C>T (p.Ala38Val) rs200754249
NM_001005242.3(PKP2):c.1379-2019C>T rs149930872
NM_001005242.3(PKP2):c.1460T>G (p.Ile487Ser) rs147240502
NM_001035.3(RYR2):c.3407C>T (p.Ala1136Val) rs72549415
NM_001105206.3(LAMA4):c.3054G>T (p.Leu1018Phe) rs183262122
NM_001105206.3(LAMA4):c.3175G>A (p.Val1059Met) rs373650093
NM_001105206.3(LAMA4):c.572G>A (p.Gly191Glu) rs782010849
NM_001134363.3(RBM20):c.1013T>C (p.Met338Thr) rs876657970
NM_001134363.3(RBM20):c.1286T>C (p.Leu429Pro) rs61735272
NM_001134363.3(RBM20):c.448G>A (p.Ala150Thr) rs199868951
NM_001148.6(ANK2):c.10901T>A (p.Val3634Asp) rs66785829
NM_001148.6(ANK2):c.11119G>A (p.Asp3707Asn) rs199549660
NM_001267550.2(TTN):c.104774A>C (p.Glu34925Ala) rs201218828
NM_001267550.2(TTN):c.15178G>C (p.Val5060Leu) rs72648929
NM_001267550.2(TTN):c.17871A>T (p.Gln5957His) rs181067357
NM_001267550.2(TTN):c.18325A>G (p.Lys6109Glu) rs73973139
NM_001267550.2(TTN):c.18856G>A (p.Val6286Ile) rs149131555
NM_001267550.2(TTN):c.18961A>G (p.Ile6321Val) rs145204073
NM_001267550.2(TTN):c.19738C>T (p.Pro6580Ser) rs116572520
NM_001267550.2(TTN):c.28741A>G (p.Ile9581Val) rs371826762
NM_001267550.2(TTN):c.29042-2A>C rs6716782
NM_001267550.2(TTN):c.34129GTTCTACCTGAAGAAGAGGAA[1] (p.11363VLPEEEE[3]) rs587780487
NM_001267550.2(TTN):c.48953T>C (p.Ile16318Thr) rs72677243
NM_001267550.2(TTN):c.71705T>C (p.Ile23902Thr) rs55837610
NM_001267550.2(TTN):c.73568del (p.Pro24523fs) rs1559415567
NM_001267550.2(TTN):c.78892G>A (p.Gly26298Arg) rs72648205
NM_001267550.2(TTN):c.86821+2T>A rs397517735
NM_001267550.2(TTN):c.92176C>T (p.Pro30726Ser) rs72648247
NM_001267550.2(TTN):c.95582A>G (p.Tyr31861Cys) rs59148238
NM_001267550.2(TTN):c.97760G>A (p.Arg32587His) rs55704830
NM_001943.5(DSG2):c.2759T>G (p.Val920Gly) rs142841727
NM_001943.5(DSG2):c.3059_3062del (p.Glu1020fs) rs397516706
NM_002471.4(MYH6):c.2579G>A (p.Arg860His) rs115845031
NM_002471.4(MYH6):c.3010G>T (p.Ala1004Ser) rs143978652
NM_003276.2(TMPO):c.1277C>T (p.Pro426Leu) rs141443652
NM_004281.3(BAG3):c.211C>T (p.Arg71Trp) rs387906874
NM_004415.4(DSP):c.12C>G (p.Asn4Lys) rs368802003
NM_004415.4(DSP):c.4372C>G (p.Arg1458Gly) rs28763965
NM_004415.4(DSP):c.6038G>A (p.Arg2013Gln) rs557263443
NM_004415.4(DSP):c.6881C>G (p.Ala2294Gly) rs147000526
NM_005751.4(AKAP9):c.11273G>A (p.Arg3758His) rs141856443
NM_014000.3(VCL):c.590C>T (p.Thr197Ile) rs189242810
NM_017636.4(TRPM4):c.3611C>T (p.Pro1204Leu) rs150391806
NM_024334.2(TMEM43):c.286C>G (p.Arg96Gly) rs754797146
NM_032578.4(MYPN):c.59A>G (p.Tyr20Cys) rs140148105
NM_033118.4(MYLK2):c.173C>A (p.Ala58Asp) rs138130914
NM_033337.2(CAV3):c.216C>G (p.Cys72Trp) rs116840776
NM_144573.4(NEXN):c.995A>C (p.Glu332Ala) rs201763096
NM_170707.4(LMNA):c.952G>A (p.Ala318Thr) rs267607574

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.