Variants from Al Jalila Children's Genomics Center, Al Jalila Childrens Speciality Hospital with conflicting interpretations

Minimum review status of the submission from Al Jalila Children's Genomics Center, Al Jalila Childrens Speciality Hospital:		Collection method of the submission from Al Jalila Children's Genomics Center, Al Jalila Childrens Speciality Hospital:
Minimum review status of the other submission:		Collection method of the other submission:
Minimum conflict level: Report conflict between different conditions
Show significances as they were submitted (without aggregation into standard terms)
		ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition	Variants with at least 2 submissions on the same condition and no conflicts	Variants with a synonymous conflict (e.g. benign vs non-pathogenic)	Variants with a confidence conflict (e.g. benign vs likely benign)	Variants with a benign or likely benign vs uncertain conflict	Variants with a category conflict (e.g. benign vs affects)	Variants with a clinically significant conflict (e.g. benign vs pathogenic)	Variants with any conflict
525	269	1	131	110	19	56	265

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

	All submitters
Al Jalila Children's Genomics Center, Al Jalila Childrens Speciality Hospital		pathogenic	likely pathogenic	uncertain significance	likely benign	benign	affects	association	drug response	likely risk allele	pathogenic, low penetrance	risk factor	other
	pathogenic	0	31	10	1	2	2	1	3	0	0	1	2
	likely pathogenic	17	0	10	1	1	0	0	0	1	0	1	0
	uncertain significance	17	17	0	34	7	1	0	0	0	0	1	0
	likely benign	2	1	47	0	21	0	0	0	0	0	0	0
	benign	5	2	23	63	1	1	0	0	0	1	1	1
	likely risk allele	0	1	5	1	2	0	0	0	0	0	0	0

Submitter to submitter summary #

Total submitters: 101

Download table as spreadsheet

Submitter	Variants with only 1 submission per condition	Variants with at least 2 submissions on the same condition and no conflicts	Variants with a synonymous conflict (e.g. benign vs non-pathogenic)	Variants with a confidence conflict (e.g. benign vs likely benign)	Variants with a benign or likely benign vs uncertain conflict	Variants with a category conflict (e.g. benign vs affects)	Variants with a clinically significant conflict (e.g. benign vs pathogenic)	Variants with any conflict
Invitae	0	153	0	20	30	4	6	60
GeneDx	0	149	0	28	12	0	11	51
Illumina Laboratory Services, Illumina	0	43	0	10	24	0	2	36
CeGaT Center for Human Genetics Tuebingen	0	59	0	13	8	3	7	30
Eurofins Ntd Llc (ga)	0	67	0	8	15	0	4	27
OMIM	0	23	0	3	1	9	10	23
Revvity Omics, Revvity	0	57	0	4	10	2	6	22
PreventionGenetics, part of Exact Sciences	0	70	0	10	5	2	6	22
Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center	0	33	0	14	3	0	2	19
Genetic Services Laboratory, University of Chicago	0	18	0	9	2	1	1	13
Women's Health and Genetics/Laboratory Corporation of America, LabCorp	0	23	0	6	3	0	3	12
Joint Genome Diagnostic Labs from Nijmegen and Maastricht, Radboudumc and MUMC+	0	14	0	11	0	0	1	12
Laboratory of Diagnostic Genome Analysis, Leiden University Medical Center (LUMC)	0	8	0	11	1	0	0	12
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories	0	42	0	4	4	0	3	11
Genome Diagnostics Laboratory, University Medical Center Utrecht	0	24	0	7	2	0	1	10
Center for Pediatric Genomic Medicine, Children's Mercy Hospital and Clinics	0	16	0	9	1	0	0	10
Mayo Clinic Laboratories, Mayo Clinic	0	27	0	0	5	0	4	9
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen	0	21	0	6	2	0	1	9
Department of Pathology and Laboratory Medicine, Sinai Health System	0	6	0	2	2	1	4	8
Genome-Nilou Lab	0	20	0	4	4	0	0	8
Natera, Inc.	0	25	0	5	2	0	0	7
Fulgent Genetics, Fulgent Genetics	0	27	0	3	1	1	2	7
Baylor Genetics	0	23	0	2	1	0	2	5
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine	0	26	0	2	1	0	2	5
Counsyl	0	2	0	3	1	0	1	5
Genome Diagnostics Laboratory, Amsterdam University Medical Center	0	12	0	4	1	0	0	5
Clinical Genetics, Academic Medical Center	0	13	0	2	1	0	1	4
Mendelics	0	8	0	2	1	0	1	4
Quest Diagnostics Nichols Institute San Juan Capistrano	0	15	0	2	0	0	2	4
Centre for Mendelian Genomics, University Medical Centre Ljubljana	0	5	0	1	2	0	1	4
Equipe Genetique des Anomalies du Developpement, Université de Bourgogne	0	3	0	3	0	0	1	4
Al Jalila Children's Genomics Center, Al Jalila Childrens Speciality Hospital	1045	10	0	1	0	1	2	4
Athena Diagnostics Inc	0	25	0	2	1	0	0	3
Biesecker Lab/Clinical Genomics Section, National Institutes of Health	0	2	1	2	0	0	0	3
Gharavi Laboratory, Columbia University	0	0	0	0	2	0	1	3
3billion	0	10	0	1	0	0	2	3
Ambry Genetics	0	8	0	1	1	0	0	2
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics, Children's Hospital of Philadelphia	0	9	0	1	1	0	0	2
Blueprint Genetics	0	7	0	0	0	2	0	2
PharmGKB	0	0	0	0	0	2	0	2
UCLA Clinical Genomics Center, UCLA	0	0	0	1	0	0	1	2
Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital	0	7	0	1	0	0	1	2
NIHR Bioresource Rare Diseases, University of Cambridge	0	1	0	1	0	0	1	2
Institute of Human Genetics, University of Leipzig Medical Center	0	7	0	0	1	0	1	2
Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen	0	12	0	2	0	0	0	2
Department Of Genetics, Sultan Qaboos University Hospital, Sultan Qaboos University	0	3	0	1	0	0	1	2
Reproductive Health Research and Development, BGI Genomics	0	2	0	0	0	0	2	2
Clinical Genomics Program, Stanford Medicine	0	1	0	0	2	0	0	2
Lifecell International Pvt. Ltd	0	2	0	2	0	0	0	2
Practice for Gait Abnormalities, David Pomarino, Competency Network Toe Walking c/o Practice Pomarino	0	0	0	1	0	0	1	2
Neuberg Supratech Reference Laboratories Pvt Ltd, Neuberg Centre for Genomic Medicine	0	10	0	2	0	0	0	2
Department of Clinical Genetics, Copenhagen University Hospital, Rigshospitalet	0	0	0	0	0	0	1	1
Molecular Diagnostics Lab, Nemours Children's Health, Delaware	0	0	0	1	0	0	0	1
Institute for Genomic Medicine (IGM) Clinical Laboratory, Nationwide Children's Hospital	0	1	0	1	0	0	0	1
Elsea Laboratory, Baylor College of Medicine	0	0	0	0	0	0	1	1
MGZ Medical Genetics Center	0	4	0	0	0	0	1	1
Centogene AG - the Rare Disease Company	0	7	0	1	0	0	0	1
Institute of Medical Molecular Genetics, University of Zurich	0	0	0	1	0	0	0	1
Intergen, Intergen Genetics and Rare Diseases Diagnosis Center	0	1	0	0	0	0	1	1
Juha Muilu Group; Institute for Molecular Medicine Finland (FIMM)	0	0	0	1	0	0	0	1
IIFP, CONICET-UNLP	0	0	0	0	0	0	1	1
RettBASE	0	0	0	1	0	0	0	1
Human Genetics School of Medicine of Albacete, Castilla-La Mancha University	0	0	0	0	0	0	1	1
Genomic Research Center, Shahid Beheshti University of Medical Sciences	0	4	0	1	0	0	0	1
CSER _CC_NCGL, University of Washington	0	0	0	1	0	0	0	1
Division of Human Genetics, Children's Hospital of Philadelphia	0	2	0	1	0	0	0	1
University of Washington Center for Mendelian Genomics, University of Washington	0	1	0	0	0	0	1	1
HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology	0	6	0	1	0	0	0	1
Foundation for Research in Genetics and Endocrinology, FRIGE's Institute of Human Genetics	0	0	0	1	0	0	0	1
Hadassah Hebrew University Medical Center	0	0	0	0	0	0	1	1
Institute for Clinical Genetics, University Hospital TU Dresden, University Hospital TU Dresden	0	6	0	0	1	0	0	1
Leeds Amelogenesis Imperfecta Research Group, University of Leeds	0	0	0	0	0	0	1	1
Color Diagnostics, LLC DBA Color Health	0	4	0	0	1	0	0	1
GenePathDx, GenePath diagnostics	0	0	0	1	0	0	0	1
Kasturba Medical College, Manipal, Kasturba Medical College, Manipal, Manipal Academy of Higher Education, Manipal, India	0	2	0	1	0	0	0	1
Undiagnosed Diseases Network, NIH	0	0	0	0	1	0	0	1
Genetics and Molecular Pathology, SA Pathology	0	4	0	0	0	0	1	1
Caryl and Israel Englander Institute for Precision Medicine, Weill Cornell Medicine	0	0	0	0	0	1	0	1
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego	0	5	0	0	0	0	1	1
Sharon lab, Hadassah-Hebrew University Medical Center	0	0	0	0	0	0	1	1
Dan Cohn Lab, University Of California Los Angeles	0	0	0	1	0	0	0	1
Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago	0	8	0	0	1	0	0	1
Laboratory of Diagnosis and Therapy of Lysosomal Disorders, University of Padova	0	0	0	1	0	0	0	1
Biochemical Molecular Genetic Laboratory, King Abdulaziz Medical City	0	5	0	0	0	0	1	1
Variantyx, Inc.	0	0	0	0	0	0	1	1
Clinical Genetics Laboratory, Department of Pathology, Netherlands Cancer Institute	0	0	0	1	0	0	0	1
Medical Genetics Summaries	0	0	0	0	0	1	0	1
Broad Center for Mendelian Genomics, Broad Institute of MIT and Harvard	0	0	0	1	0	0	0	1
Laboratory of Medical Genetics, National & Kapodistrian University of Athens	0	2	0	0	0	0	1	1
Johns Hopkins Genomics, Johns Hopkins University	0	1	0	1	0	0	0	1
Institute of Reproductive Genetics, University of Münster	0	1	0	1	0	0	0	1
Diagnostics Services (NGS), CSIR - Centre For Cellular And Molecular Biology	0	0	0	0	1	0	0	1
Institute of Human Genetics, University Hospital Muenster	0	3	0	1	0	0	0	1
CeMIA	0	0	0	0	1	0	0	1
AiLife Diagnostics, AiLife Diagnostics	0	3	0	0	0	0	1	1
ClinGen Malignant Hyperthermia Susceptibility Variant Curation Expert Panel, ClinGen	0	0	0	0	1	0	0	1
Center for Genomic Medicine, King Faisal Specialist Hospital and Research Center	0	4	0	1	0	0	0	1
Genomics England Pilot Project, Genomics England	0	0	0	1	0	0	0	1
Molecular Genetics, Royal Melbourne Hospital	0	1	0	0	0	0	1	1
Laboratorio de Genetica e Diagnostico Molecular, Hospital Israelita Albert Einstein	0	6	0	0	1	0	0	1
KCCC/NGS Laboratory, Kuwait Cancer Control Center	0	0	0	1	0	0	0	1

All variants with conflicting interpretations #

Total variants: 265

Download table as spreadsheet

HGVS	dbSNP	gnomAD frequency
NM_015602.4(TOR1AIP1):c.554-4G>A	rs2245425	0.58997
NM_020975.6(RET):c.2071G>A (p.Gly691Ser)	rs1799939	0.16640
NM_003465.3(CHIT1):c.1049_1072dup (p.Trp358Ter)	rs3831317	0.16576
NM_000141.5(FGFR2):c.557T>C (p.Met186Thr)	rs755793	0.10553
NM_000036.3(AMPD1):c.143C>T (p.Pro48Leu)	rs61752479	0.08857
NM_000036.3(AMPD1):c.34C>T (p.Gln12Ter)	rs17602729	0.08701
NM_207346.3(TSEN54):c.3_8dup (p.2_3EP[4])	rs398124622	0.06994
NM_000249.4(MLH1):c.1039-29A>T	rs6771325	0.03662
NM_001453.3(FOXC1):c.889C>T (p.Pro297Ser)	rs79691946	0.03108
NM_000295.5(SERPINA1):c.-10T>C	rs11558258	0.02837
NM_001199107.2(TBC1D24):c.1143-6C>T	rs73490287	0.02047
NM_001206744.2(TPO):c.1587A>C (p.Leu529Phe)	rs114796303	0.01634
NM_000202.8(IDS):c.641C>T (p.Thr214Met)	rs61736892	0.01492
NM_024312.5(GNPTAB):c.1042A>C (p.Ile348Leu)	rs7958709	0.01289
NM_000334.4(SCN4A):c.2717G>C (p.Ser906Thr)	rs41280102	0.01003
NM_006766.5(KAT6A):c.3577G>A (p.Val1193Ile)	rs34620183	0.00973
NM_144672.4(OTOA):c.2359G>T (p.Glu787Ter)	rs200988634	0.00927
NM_001330078.2(NRXN1):c.772+1140G>A	rs61658382	0.00837
NM_000124.4(ERCC6):c.3922G>C (p.Val1308Leu)	rs2229761	0.00814
NM_005689.4(ABCB6):c.1562C>G (p.Thr521Ser)	rs149363094	0.00792
NM_153460.4(IL17RC):c.1522+1G>C	rs148575246	0.00763
NM_000051.4(ATM):c.544G>C (p.Val182Leu)	rs3218707	0.00757
NM_022168.4(IFIH1):c.1641+1G>C	rs35337543	0.00728
NM_005529.7(HSPG2):c.3292G>A (p.Ala1098Thr)	rs2501264	0.00699
NM_022081.6(HPS4):c.751A>T (p.Thr251Ser)	rs34962745	0.00699
NM_025137.4(SPG11):c.3818A>G (p.Lys1273Arg)	rs76389165	0.00694
NM_005529.7(HSPG2):c.9719C>T (p.Ala3240Val)	rs62642505	0.00677
NM_001206744.2(TPO):c.2305C>T (p.Arg769Trp)	rs114406277	0.00629
NM_006031.6(PCNT):c.5771C>T (p.Ala1924Val)	rs184420466	0.00604
NM_000512.5(GALNS):c.1438G>T (p.Val480Phe)	rs151296605	0.00596
NM_022168.4(IFIH1):c.2807+1G>A	rs35732034	0.00502
NM_001277058.2(ERCC6):c.2249G>A (p.Cys750Tyr)	rs115162931	0.00494
NM_145309.6(LRRC51):c.352G>C (p.Gly118Arg)	rs149637884	0.00473
NM_144687.4(NLRP12):c.3046C>T (p.Arg1016Ter)	rs35064500	0.00470
NM_001142800.2(EYS):c.8429C>T (p.Thr2810Ile)	rs144513453	0.00443
NM_000051.4(ATM):c.1810C>T (p.Pro604Ser)	rs2227922	0.00431
NM_014625.4(NPHS2):c.59C>T (p.Pro20Leu)	rs74315344	0.00425
NM_001130987.2(DYSF):c.386G>A (p.Gly129Glu)	rs34997054	0.00411
NM_000081.4(LYST):c.1686G>C (p.Gln562His)	rs77091385	0.00394
NM_152419.3(HGSNAT):c.1843G>A (p.Ala615Thr)	rs112029032	0.00361
NM_006059.4(LAMC3):c.2891-8C>T	rs199535979	0.00339
NM_000169.3(GLA):c.937G>T (p.Asp313Tyr)	rs28935490	0.00308
NM_018122.5(DARS2):c.128-4A>T	rs769597479	0.00300
NM_207352.4(CYP4V2):c.610G>A (p.Ala204Thr)	rs61745524	0.00299
NM_000287.4(PEX6):c.1802G>A (p.Arg601Gln)	rs34324426	0.00294
NM_001369.3(DNAH5):c.4510G>C (p.Gly1504Arg)	rs143567667	0.00277
NM_000350.3(ABCA4):c.5882G>A (p.Gly1961Glu)	rs1800553	0.00269
NM_015409.5(EP400):c.4945G>A (p.Ala1649Thr)	rs148749054	0.00268
NM_015346.4(ZFYVE26):c.3722G>A (p.Arg1241Gln)	rs140756827	0.00258
NM_000552.5(VWF):c.4751A>G (p.Tyr1584Cys)	rs1800386	0.00237
NM_001199107.2(TBC1D24):c.785C>T (p.Ser262Leu)	rs201060500	0.00216
NM_002335.4(LRP5):c.3107G>A (p.Arg1036Gln)	rs61889560	0.00207
NM_201384.3(PLEC):c.5653G>A (p.Ala1885Thr)	rs201070741	0.00200
NM_206933.4(USH2A):c.4586A>T (p.Lys1529Ile)	rs41303255	0.00190
NM_001164508.2(NEB):c.17497G>A (p.Val5833Ile)	rs149881695	0.00187
NM_203447.4(DOCK8):c.3460C>T (p.Arg1154Cys)	rs34390308	0.00170
NM_024753.5(TTC21B):c.2600G>A (p.Arg867His)	rs76726265	0.00161
NM_000302.4(PLOD1):c.77-3358C>T	rs534978828	0.00153
NM_001142800.2(EYS):c.6632C>T (p.Ser2211Leu)	rs145623359	0.00148
NM_000431.4(MVK):c.924C>T (p.Leu308=)	rs72648042	0.00140
NM_006214.4(PHYH):c.244C>G (p.Arg82Gly)	rs145404396	0.00140
NM_001042545.2(LTBP4):c.2909C>G (p.Pro970Arg)	rs200667255	0.00135
NM_001080414.4(CCDC88C):c.4327G>A (p.Ala1443Thr)	rs189215037	0.00133
NM_001363711.2(DUOX2):c.1709A>T (p.Gln570Leu)	rs547116063	0.00131
NM_014239.4(EIF2B2):c.380C>T (p.Ala127Val)	rs150617429	0.00127
NM_000104.4(CYP1B1):c.1103G>A (p.Arg368His)	rs79204362	0.00125
NM_001875.5(CPS1):c.3643A>G (p.Ile1215Val)	rs141373204	0.00119
NM_001267550.2(TTN):c.21779C>A (p.Ser7260Tyr)	rs187925021	0.00118
NM_005562.3(LAMC2):c.196G>A (p.Glu66Lys)	rs146325169	0.00114
NM_000069.3(CACNA1S):c.3795+3G>A	rs191758096	0.00113
NM_004380.3(CREBBP):c.5719G>A (p.Ala1907Thr)	rs199990883	0.00113
NM_201378.4(PLEC):c.71-11512C>T	rs201053471	0.00108
NM_032119.4(ADGRV1):c.4214C>T (p.Ser1405Phe)	rs41305898	0.00104
NM_001267550.2(TTN):c.48953T>C (p.Ile16318Thr)	rs72677243	0.00094
NM_080911.3(UNG):c.262C>T (p.Arg88Cys)	rs151095402	0.00090
NM_002968.3(SALL1):c.1878G>C (p.Glu626Asp)	rs80248061	0.00089
NM_013391.3(DMGDH):c.972G>A (p.Trp324Ter)	rs139044238	0.00088
NM_001042545.2(LTBP4):c.2681-10C>G	rs200914063	0.00084
NM_206933.4(USH2A):c.5858C>G (p.Ala1953Gly)	rs41302239	0.00081
NM_001364905.1(LRBA):c.2209G>A (p.Val737Ile)	rs151213445	0.00078
NM_138694.4(PKHD1):c.7912-5T>G	rs371510537	0.00075
NM_001039141.3(TRIOBP):c.2201C>T (p.Ser734Phe)	rs199794705	0.00069
NM_001035235.4(SRA1):c.500T>C (p.Ile167Thr)	rs148108594	0.00066
NM_001127649.3(PEX26):c.643G>A (p.Glu215Lys)	rs138232280	0.00063
NM_001365536.1(SCN9A):c.4315G>A (p.Val1439Ile)	rs149346064	0.00061
NM_005751.5(AKAP9):c.5246T>C (p.Ile1749Thr)	rs150016098	0.00061
NM_016356.5(DCDC2):c.817C>T (p.Pro273Ser)	rs146787541	0.00061
NM_000054.7(AVPR2):c.1055G>A (p.Gly352Asp)	rs146350208	0.00060
NM_000023.4(SGCA):c.421C>A (p.Arg141Ser)	rs35130237	0.00056
NM_138694.4(PKHD1):c.5134G>A (p.Gly1712Arg)	rs141103838	0.00056
NM_024678.6(NARS2):c.1082A>G (p.Asn361Ser)	rs150355410	0.00054
NM_001849.4(COL6A2):c.2182G>A (p.Val728Met)	rs200585528	0.00051
NM_014629.4(ARHGEF10):c.2063G>A (p.Ser688Asn)	rs143290224	0.00051
NM_032444.4(SLX4):c.2975G>A (p.Gly992Glu)	rs139287784	0.00049
NM_145207.3(AFG2A):c.1622C>G (p.Pro541Arg)	rs143957561	0.00049
NM_000500.9(CYP21A2):c.1447C>T (p.Pro483Ser)	rs776989258	0.00047
NM_000751.3(CHRND):c.727C>T (p.Arg243Cys)	rs201733876	0.00042
NM_020442.6(VARS2):c.1691C>T (p.Ala564Val)	rs143408155	0.00041
NM_001099922.3(ALG13):c.2248-15G>C	rs139711892	0.00039
NM_000203.5(IDUA):c.299+988C>T	rs142262555	0.00037
NM_001128840.3(CACNA1D):c.2729G>A (p.Arg910His)	rs115066564	0.00036
NM_198578.4(LRRK2):c.6055G>A (p.Gly2019Ser)	rs34637584	0.00036
NM_004560.4(ROR2):c.730C>T (p.Arg244Trp)	rs148340413	0.00035
NM_001099274.3(TINF2):c.734C>A (p.Ser245Tyr)	rs142777869	0.00034
NM_001161352.2(KCNMA1):c.2267-4486C>T	rs188354139	0.00032
NM_001457.4(FLNB):c.4061+4G>A	rs370061963	0.00032
NM_000158.4(GBE1):c.986A>G (p.Tyr329Cys)	rs80338671	0.00029
NM_000137.4(FAH):c.1062+5G>A	rs80338901	0.00028
NM_000402.4(G6PD):c.653C>T (p.Ser218Phe)	rs5030868	0.00028
NM_022168.4(IFIH1):c.2016del (p.Asp673fs)	rs773033563	0.00028
NM_005033.3(EXOSC9):c.41T>C (p.Leu14Pro)	rs139632595	0.00026
NM_004369.4(COL6A3):c.9128G>A (p.Arg3043His)	rs552651651	0.00025
NM_005419.4(STAT2):c.250C>A (p.Gln84Lys)	rs150901100	0.00024
NM_080680.3(COL11A2):c.2536C>T (p.Arg846Trp)	rs149071920	0.00024
NM_001370466.1(NOD2):c.1036C>T (p.Arg346Cys)	rs145293873	0.00021
NM_024422.6(DSC2):c.907G>A (p.Val303Met)	rs145560678	0.00021
NM_001292063.2(OTOG):c.3751G>A (p.Gly1251Ser)	rs769211682	0.00020
NM_144585.4(SLC22A12):c.1400C>T (p.Thr467Met)	rs200104135	0.00019
NM_198253.3(TERT):c.604G>A (p.Ala202Thr)	rs121918661	0.00018
NM_001848.3(COL6A1):c.2091G>A (p.Met697Ile)	rs372750707	0.00017
NM_000545.8(HNF1A):c.716C>T (p.Ala239Val)	rs587778397	0.00016
NM_001756.4(SERPINA6):c.1165G>A (p.Asp389Asn)	rs28929488	0.00016
NM_018941.4(CLN8):c.806A>T (p.Glu269Val)	rs139003032	0.00016
NM_001164508.2(NEB):c.539A>G (p.Lys180Arg)	rs200719359	0.00014
NM_053025.4(MYLK):c.3112A>G (p.Met1038Val)	rs763247566	0.00012
NM_006785.4(MALT1):c.1282G>A (p.Val428Ile)	rs140664950	0.00011
NM_032119.4(ADGRV1):c.466G>A (p.Ala156Thr)	rs201180985	0.00010
NM_133379.5(TTN):c.16001C>T (p.Pro5334Leu)	rs151253841	0.00010
NM_000341.4(SLC3A1):c.647C>T (p.Thr216Met)	rs369641941	0.00009
NM_012452.3(TNFRSF13B):c.577T>C (p.Cys193Arg)	rs764125338	0.00009
NM_182919.4(TICAM1):c.1774G>A (p.Gly592Arg)	rs74359855	0.00009
NM_000540.3(RYR1):c.10648C>T (p.Arg3550Trp)	rs536304635	0.00008
NM_000335.5(SCN5A):c.1336G>A (p.Glu446Lys)	rs199473339	0.00007
NM_000540.3(RYR1):c.6670C>T (p.Arg2224Cys)	rs199870223	0.00007
NM_001378778.1(MPDZ):c.394G>A (p.Gly132Ser)	rs201101621	0.00007
NM_003126.4(SPTA1):c.779T>C (p.Leu260Pro)	rs121918634	0.00006
NM_004153.4(ORC1):c.1745A>G (p.Gln582Arg)	rs547441862	0.00006
NM_004946.3(DOCK2):c.2704-3C>T	rs144101028	0.00006
NM_173660.5(DOK7):c.1133C>T (p.Ala378Val)	rs371846002	0.00006
NM_000243.3(MEFV):c.460T>C (p.Ser154Pro)	rs756975501	0.00005
NM_000441.2(SLC26A4):c.706C>G (p.Leu236Val)	rs111033242	0.00005
NM_000492.4(CFTR):c.3409A>G (p.Met1137Val)	rs397508553	0.00005
NM_001100913.3(PACS2):c.1269-4A>G	rs376690008	0.00005
NM_001103146.3(GIGYF2):c.2378C>T (p.Ala793Val)	rs748538823	0.00005
NM_001737.5(C9):c.460C>T (p.Arg154Ter)	rs144138616	0.00005
NM_004827.3(ABCG2):c.791_792del (p.Leu264fs)	rs387906870	0.00005
NM_001360.3(DHCR7):c.1091C>T (p.Thr364Met)	rs567600444	0.00004
NM_005458.8(GABBR2):c.613G>A (p.Val205Ile)	rs146801036	0.00004
NM_000303.3(PMM2):c.712C>T (p.Arg238Cys)	rs142459706	0.00003
NM_000492.4(CFTR):c.3208C>T (p.Arg1070Trp)	rs202179988	0.00003
NM_001377.3(DYNC2H1):c.4267C>T (p.Arg1423Cys)	rs745870321	0.00003
NM_003791.4(MBTPS1):c.1658C>T (p.Ser553Leu)	rs553862782	0.00003
NM_004369.4(COL6A3):c.2497+9C>A	rs774198344	0.00003
NM_013254.4(TBK1):c.1839G>T (p.Leu613Phe)	rs368859659	0.00003
NM_052867.4(NALCN):c.2495A>G (p.Tyr832Cys)	rs549182297	0.00003
NM_152564.5(VPS13B):c.2885C>T (p.Thr962Met)	rs547184348	0.00003
NM_153026.3(PRICKLE1):c.311G>A (p.Arg104Gln)	rs113994140	0.00003
NM_198053.3(CD247):c.58+8C>T	rs201494226	0.00003
NM_000038.6(APC):c.7781C>G (p.Ser2594Cys)	rs543396310	0.00002
NM_000091.5(COL4A3):c.898G>A (p.Gly300Arg)	rs772708743	0.00002
NM_000426.4(LAMA2):c.4456G>A (p.Ala1486Thr)	rs372576669	0.00002
NM_000441.2(SLC26A4):c.1667A>G (p.Tyr556Cys)	rs763006761	0.00002
NM_000441.2(SLC26A4):c.200C>G (p.Thr67Ser)	rs111033240	0.00002
NM_000463.3(UGT1A1):c.1021C>T (p.Arg341Ter)	rs72551349	0.00002
NM_001164508.2(NEB):c.19325G>A (p.Arg6442Gln)	rs375182306	0.00002
NM_001458.5(FLNC):c.1976T>G (p.Leu659Arg)	rs576402053	0.00002
NM_000081.4(LYST):c.2724C>T (p.Cys908=)	rs201440611	0.00001
NM_000218.3(KCNQ1):c.514G>A (p.Val172Met)	rs199472694	0.00001
NM_000294.3(PHKG2):c.469G>A (p.Glu157Lys)	rs752961445	0.00001
NM_001005361.3(DNM2):c.2201A>G (p.Asn734Ser)	rs577767034	0.00001
NM_001134407.3(GRIN2A):c.77C>T (p.Ala26Val)	rs765986049	0.00001
NM_001142800.2(EYS):c.4045C>T (p.Arg1349Ter)	rs930421180	0.00001
NM_001252024.2(TRPM1):c.1263G>A (p.Pro421=)	rs768701595	0.00001
NM_001277115.2(DNAH11):c.4491G>A (p.Glu1497=)	rs564202359	0.00001
NM_001289125.3(IFNAR2):c.437A>G (p.Asn146Ser)	rs549962048	0.00001
NM_001369.3(DNAH5):c.5503C>T (p.Gln1835Ter)	rs761622153	0.00001
NM_002769.5(PRSS1):c.365G>A (p.Arg122His)	rs111033565	0.00001
NM_004369.4(COL6A3):c.3617C>T (p.Thr1206Ile)	rs949598599	0.00001
NM_004369.4(COL6A3):c.3668T>C (p.Leu1223Pro)	rs772944531	0.00001
NM_007373.4(SHOC2):c.4A>G (p.Ser2Gly)	rs267607048	0.00001
NM_015178.3(RHOBTB2):c.508C>T (p.Pro170Ser)	rs761440038	0.00001
NM_018122.5(DARS2):c.1825C>T (p.Arg609Trp)	rs200670286	0.00001
NM_018699.4(PRDM5):c.670A>T (p.Lys224Ter)	rs1064794819	0.00001
NM_021831.6(AGBL5):c.826C>T (p.Arg276Trp)	rs879253769	0.00001
NM_152443.3(RDH12):c.506G>A (p.Arg169Gln)	rs971610277	0.00001
NM_199242.3(UNC13D):c.3141C>A (p.Pro1047=)	rs866899109	0.00001
NM_000051.4(ATM):c.8977C>T (p.Arg2993Ter)	rs770641163
NM_000081.4(LYST):c.5634+11A>G
NM_000111.3(SLC26A3):c.1306C>T (p.Gln436Ter)	rs386833448
NM_000138.5(FBN1):c.4096G>A (p.Glu1366Lys)	rs763449629
NM_000243.3(MEFV):c.2230G>T (p.Ala744Ser)	rs61732874
NM_000284.4(PDHA1):c.1142_1145dup (p.Trp383fs)	rs606231189
NM_000287.4(PEX6):c.855C>A (p.Pro285=)	rs757897959
NM_000330.4(RS1):c.52+3A>G	rs2147209764
NM_000350.3(ABCA4):c.3639CCA[1] (p.His1215del)	rs1570367398
NM_000428.3(LTBP2):c.4978G>T (p.Gly1660Trp)	rs147223742
NM_000441.2(SLC26A4):c.1265T>C (p.Val422Ala)	rs1057520369
NM_000441.2(SLC26A4):c.304G>A (p.Gly102Arg)	rs1219724284
NM_000441.2(SLC26A4):c.716T>A (p.Val239Asp)	rs111033256
NM_000487.6(ARSA):c.449C>T (p.Pro150Leu)	rs199476375
NM_000492.3(CFTR):c.1210-12T[5]	rs1805177
NM_000492.3(CFTR):c.1521_1523del (p.Phe508del)	rs113993960
NM_000543.5(SMPD1):c.108_109insGCG (p.Val36_Leu37insAla)	rs775568984
NM_000814.6(GABRB3):c.756G>A (p.Met252Ile)
NM_001018115.3(FANCD2):c.2022-5C>T	rs4019784
NM_001024630.4(RUNX2):c.225GGCGGCTGCGGCGGCGGC[1] (p.Ala84_Ala89del)	rs11498192
NM_001035.3(RYR2):c.11092-11dup	rs397516499
NM_001042492.3(NF1):c.2410-12T>G	rs876657932
NM_001110792.2(MECP2):c.33AGG[6] (p.Gly16dup)	rs587783744
NM_001130438.3(SPTAN1):c.3215+15_3215+16del	rs551595039
NM_001130438.3(SPTAN1):c.6899ACCAGCTGG[3] (p.2300DQL[3])	rs587784440
NM_001134831.2(AHI1):c.2988del (p.Val997fs)	rs755246809
NM_001139.3(ALOX12B):c.944T>C (p.Leu315Pro)	rs1977160529
NM_001232.4(CASQ2):c.738-7_738-5del	rs56889721
NM_001232.4(CASQ2):c.738-8_738-5del	rs56889721
NM_001349338.3(FOXP1):c.1652+5G>A	rs794727216
NM_001353921.2(ARHGEF9):c.1497T>G (p.Phe499Leu)	rs2147114173
NM_001354768.3(NRL):c.339C>G (p.Tyr113Ter)	rs1566560531
NM_001364905.1(LRBA):c.3805C>G (p.Pro1269Ala)	rs555169864
NM_001370466.1(NOD2):c.2641G>C (p.Gly881Arg)	rs2066845
NM_001372574.1(ATXN2):c.59AGC[8] (p.Gln28del)	rs10560189
NM_001378454.1(ALMS1):c.36GGA[12] (p.Glu28del)	rs55889738
NM_001378457.1(DMXL2):c.5827_5841del (p.Asp1943_Ser1947del)	rs606231461
NM_001384732.1(CPLANE1):c.8959-2A>G
NM_001385641.1(SAMD11):c.1336G>A (p.Ala446Thr)	rs571654307
NM_001807.6(CEL):c.337C>T (p.Gln113Ter)	rs1200339761
NM_001940.4(ATN1):c.1464GCA[12] (p.Gln500_Gln502del)	rs60216939
NM_002180.3(IGHMBP2):c.2540del (p.Gln847fs)	rs1225532037
NM_002834.5(PTPN11):c.853T>G (p.Phe285Val)	rs397507531
NM_002968.2(SALL1):c.466_477dup (p.Ser159_Gly160insSerSerSerSer)	rs113614842
NM_003470.3(USP7):c.2596C>T (p.Gln866Ter)	rs2141167019
NM_004113.6(FGF12):c.155G>A (p.Arg52His)	rs886039903
NM_004168.4(SDHA):c.1909-12_1909-11del	rs372662724
NM_004646.4(NPHS1):c.3418C>A (p.Arg1140Ser)	rs143092783
NM_004999.4(MYO6):c.2898AGA[3] (p.Glu970del)	rs727504743
NM_005222.4(DLX6):c.81GCAGCAGCAGCAGCAGCAACAGCA[3] (p.Gln37_Gln44dup)	rs775320932
NM_005373.3(MPL):c.317C>T (p.Pro106Leu)	rs750046020
NM_005419.4(STAT2):c.1466C>T (p.Pro489Leu)	rs138681270
NM_005476.7(GNE):c.2086G>A (p.Val696Met)	rs121908627
NM_005807.6(PRG4):c.3254_3260dup (p.Val1088fs)	rs769917456
NM_006059.4(LAMC3):c.3250G>C (p.Glu1084Gln)	rs146221263
NM_006059.4(LAMC3):c.3379G>A (p.Glu1127Lys)	rs140955110
NM_006208.3(ENPP1):c.313+8_313+9insTTGTGT	rs879243445
NM_006208.3(ENPP1):c.313+9GT[20]	rs59956343
NM_007009.3(ZPBP):c.50G>C (p.Arg17Pro)	rs202231065
NM_007254.4(PNKP):c.1360C>A (p.Leu454Met)	rs200611702
NM_007272.3(CTRC):c.738_761del (p.Lys247_Arg254del)	rs515726210
NM_022437.3(ABCG8):c.965-1G>C	rs957176669
NM_024665.7(TBL1XR1):c.226C>T (p.Arg76Ter)	rs1577029680
NM_030632.3(ASXL3):c.6078_6083del (p.Pro2027_Pro2028del)	rs1235588816
NM_030787.4(CFHR5):c.486dup (p.Glu163fs)	rs565457964
NM_031924.8(RSPH3):c.-260dup	rs751193355
NM_052867.4(NALCN):c.4104-19dup	rs113354194
NM_130837.3(OPA1):c.2873_2876del	rs80356530
NM_138554.5(TLR4):c.526_544del (p.Asn176fs)	rs749154041
NM_138927.4(SON):c.5943_5963del (p.1957SRTPSRR[5])	rs766784590
NM_144687.4(NLRP12):c.1952C>A (p.Ser651Ter)	rs781361326
NM_145239.3(PRRT2):c.649dup (p.Arg217fs)
NM_147188.3(FBXO22):c.159_162del (p.Arg53fs)	rs2141698833
NM_152296.5(ATP1A3):c.2267G>A (p.Arg756His)	rs606231435
NM_172107.4(KCNQ2):c.1678C>T (p.Arg560Trp)	rs773171451
NM_178012.5(TUBB2B):c.743C>T (p.Ala248Val)	rs777598117
NM_178172.6(GPIHBP1):c.523G>C (p.Gly175Arg)	rs145844329
NR_178195.1(LFNG):n.265_268GATG[8]	rs34637446
UGT1A1*28	rs3064744

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.