ClinVar Miner

Variants from New York Genome Center with conflicting interpretations

Location: United States — Primary collection method: clinical testing
Minimum review status of the submission from New York Genome Center: Collection method of the submission from New York Genome Center:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
867 101 3 27 39 1 18 76

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
New York Genome Center pathogenic likely pathogenic uncertain significance likely benign benign drug response protective other
pathogenic 2 5 1 0 0 0 0 0
likely pathogenic 21 1 6 1 1 0 0 0
uncertain significance 4 7 0 30 11 1 1 1
likely benign 0 0 2 0 1 0 0 0

Submitter to submitter summary #

Total submitters: 65
Download table as spreadsheet
Submitter Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
Invitae 0 47 0 5 22 0 6 33
GeneDx 0 36 0 3 8 0 2 12
Baylor Genetics 0 5 0 3 0 0 2 5
Ambry Genetics 0 11 0 0 5 0 0 5
EGL Genetic Diagnostics, Eurofins Clinical Diagnostics 0 23 0 1 3 1 2 5
OMIM 0 6 0 3 0 0 1 4
CeGaT Praxis fuer Humangenetik Tuebingen 0 6 0 2 1 0 2 4
Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine 0 4 0 2 1 0 0 3
GeneReviews 0 1 2 0 0 0 1 3
Illumina Clinical Services Laboratory,Illumina 0 5 0 0 1 0 2 3
Centre for Mendelian Genomics,University Medical Centre Ljubljana 0 3 0 2 0 0 1 3
Athena Diagnostics Inc 0 12 0 0 2 0 0 2
Genetic Services Laboratory, University of Chicago 0 6 0 1 1 0 0 2
Counsyl 0 5 0 2 0 0 0 2
Integrated Genetics/Laboratory Corporation of America 0 4 0 1 1 0 0 2
Mendelics 0 1 0 0 1 0 1 2
University of Washington Center for Mendelian Genomics, University of Washington 0 0 0 1 0 0 1 2
Lupski Lab, Baylor-Hopkins CMG, Baylor College of Medicine 0 0 0 0 0 0 2 2
Centre de Biologie Pathologie Génétique, Centre Hospitalier Universitaire de Lille 0 2 0 1 1 0 0 2
SIB Swiss Institute of Bioinformatics 0 1 0 1 1 0 0 2
Department of Pathology and Laboratory Medicine,Sinai Health System 0 3 0 0 1 0 1 2
ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories 0 6 0 0 0 0 1 1
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics,Children's Hospital of Philadelphia 0 0 0 1 0 0 0 1
Elsea Laboratory,Baylor College of Medicine 0 0 0 0 0 0 1 1
Natera, Inc. 0 5 0 1 0 0 0 1
Mayo Clinic Laboratories, Mayo Clinic 0 0 0 0 0 0 1 1
Juha Muilu Group; Institute for Molecular Medicine Finland (FIMM) 0 0 1 0 0 0 0 1
Developmental Genetics Unit,King Faisal Specialist Hospital & Research Centre 0 0 0 0 0 0 1 1
Institute of Human Genetics, Klinikum rechts der Isar 0 1 0 0 0 0 1 1
RettBASE 0 0 0 1 0 0 0 1
Department of Psychiatry,Nagoya University 0 0 0 0 0 0 1 1
Genomic Research Center, Shahid Beheshti University of Medical Sciences 0 0 0 0 0 0 1 1
Center for Medical Genetics Ghent,University of Ghent 0 0 0 0 0 0 1 1
Service de Génétique Moléculaire,Hôpital Robert Debré 0 0 0 0 0 0 1 1
Vavilov Institute of General Genetics RAS, Laboratory of Evolutional Genomics 0 0 0 0 0 1 0 1
HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology 0 0 0 0 0 0 1 1
Genome Sciences Centre,British Columbia Cancer Agency 0 0 0 0 0 0 1 1
Diagnostics Division,Centre for DNA Fingerprinting and Diagnostics 0 0 0 1 0 0 0 1
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 0 4 0 1 0 0 0 1
Pediatric Highly Intensive Care Unit,Fondazione IRCCS Ca' Granda Ospedale Maggiore Policlinico 0 0 0 0 0 0 1 1
Daryl Scott Lab,Baylor College of Medicine 0 0 0 0 0 0 1 1
Neurogenetics Laboratory - MEYER,AOU Meyer 0 0 0 0 0 0 1 1
NIHR Bioresource Rare Diseases, University of Cambridge 0 0 0 0 0 0 1 1
Undiagnosed Diseases Network,NIH 0 0 0 0 0 0 1 1
Equipe Genetique des Anomalies du Developpement, Université de Bourgogne 0 1 0 0 0 0 1 1
Muenke lab,National Institutes of Health 0 0 0 0 0 0 1 1
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego 0 0 0 0 0 0 1 1
Geisinger Autism and Developmental Medicine Institute,Geisinger Health System 0 1 0 1 1 0 1 1
Rare Disease Group, Clinical Genetics,Karolinska Institutet 0 0 0 0 1 0 1 1
Institute of Cellular and Molecular Medicine,Copenhagen University 0 0 0 0 0 0 1 1
Flegel Lab,National Institutes of Health 0 0 0 0 0 0 1 1
Biochemical Molecular Genetic Laboratory,King Abdulaziz Medical City 0 1 0 0 0 0 1 1
Medical Genetics Lab,Policlinico S. Orsola.Malpighi 0 0 0 0 0 0 1 1
Medical Cytogenetics and Molecular Genetics Laboratory,IRCCS Istituto Auxologico Italiano 0 0 0 0 1 0 0 1
Molecular Pathology Diagnostics Labratory,University of Iowa Hospitals & Clinics 0 0 0 0 0 0 1 1
Klaassen Lab,Charite University Medicine Berlin 0 0 0 1 0 0 0 1
Department of Genetics, Rouen University Hospital, Normandy Center for Genomic and Personalized Medicine 0 0 0 0 1 0 0 1
Biochemistry Laboratory of CDMU,Chengde Medical University 0 0 0 0 0 0 1 1
UT Southwestern Medical Center, UT Southwestern Medical Center 0 0 0 0 0 1 0 1
Institut de Recherche Interdisciplinaire en Biologie Humaine et Moleculaire,Universite Libre de Bruxelles 0 0 0 0 0 0 1 1
Central Laboratory,The First Hospital of Lanzhou University 0 0 0 0 0 0 1 1
Suna and Inan Kirac Foundation Neurodegeneration Research Laboratory, Koc University 0 0 0 0 0 0 1 1
Genetics and Prenatal Diagnosis Center,The First Affiliated Hospital of Zhengzhou University 0 0 0 0 0 0 1 1
Dept. Genetics and Cancer, Menzies Institute for Medical Research,University of Tasmania 0 0 0 0 1 0 0 1
Wilkie Group, Clinical Genetics Lab, WIMM,University of Oxford 0 0 0 0 0 0 1 1

All variants with conflicting interpretations #

Total variants: 76
Download table as spreadsheet
HGVS dbSNP
NM_000257.4(MYH7):c.1573G>A (p.Glu525Lys) rs606231324
NM_000260.4(MYO7A):c.689C>T (p.Ala230Val) rs797044512
NM_000263.4(NAGLU):c.934G>A (p.Asp312Asn) rs1052471595
NM_000277.3(PAH):c.1024G>A (p.Ala342Thr) rs62507282
NM_000277.3(PAH):c.842+3G>C rs62507324
NM_000286.3(PEX12):c.681-2A>C rs187526749
NM_000310.3(PPT1):c.451C>T (p.Arg151Ter) rs137852700
NM_000383.4(AIRE):c.1322C>T (p.Thr441Met) rs72650677
NM_000426.3(LAMA2):c.1303C>T (p.Arg435Ter) rs773209126
NM_000543.5(SMPD1):c.689G>A (p.Arg230His) rs141387770
NM_000744.7(CHRNA4):c.1538G>A (p.Arg513His) rs868845088
NM_001033855.3(DCLRE1C):c.457G>A (p.Gly153Arg) rs41297018
NM_001110792.2(MECP2):c.1108G>A (p.Ala370Thr) rs147017239
NM_001128849.2(SMARCA4):c.3557C>T (p.Ala1186Val) rs1600388982
NM_001130438.3(SPTAN1):c.701A>G (p.Asn234Ser) rs752578570
NM_001134407.3(GRIN2A):c.3211C>T (p.His1071Tyr) rs1555482611
NM_001160301.1(DPYD):c.220C>T (p.Arg74Ter) rs189768576
NM_001163435.3(TBCK):c.376C>T (p.Arg126Ter) rs575822089
NM_001165963.4(SCN1A):c.5951C>A (p.Pro1984His) rs146733308
NM_001193466.2(KANSL1):c.3019C>T (p.Arg1007Trp) rs1057522661
NM_001244008.2(KIF1A):c.4648C>T (p.Arg1550Trp)
NM_001256012.3(MYH10):c.5681G>A (p.Arg1894Gln)
NM_001271.4(CHD2):c.3802C>T (p.Arg1268Cys)
NM_001276345.2(TNNT2):c.650AGA[3] (p.Lys220del) rs45578238
NM_001329943.3(KIAA0586):c.94dup (p.His32fs) rs555421894
NM_001330260.2(SCN8A):c.4441A>G (p.Met1481Val) rs886041670
NM_001330504.1(ALG1):c.493C>T (p.Arg165Trp) rs151173406
NM_001365999.1(SZT2):c.4727G>A (p.Arg1576His) rs143935839
NM_001365999.1(SZT2):c.6343C>G (p.Pro2115Ala) rs147309177
NM_001366722.1(GRIP1):c.160G>A (p.Val54Ile) rs199768740
NM_001374828.1(ARID1B):c.506ACCACCACCATGCCCACCACC[1] (p.169HHHHAHH[1]) rs767952510
NM_001609.3(ACADSB):c.1159G>A (p.Glu387Lys) rs188094280
NM_001846.4(COL4A2):c.4096G>A (p.Asp1366Asn) rs558814304
NM_001953.5(TYMP):c.1160-1G>A rs797044455
NM_002225.5(IVD):c.550+1G>A rs377147994
NM_002693.2(POLG):c.1402A>G (p.Asn468Asp) rs145843073
NM_002693.2(POLG):c.1837C>T (p.His613Tyr) rs147407423
NM_002693.2(POLG):c.2246T>C (p.Phe749Ser) rs202037973
NM_003000.2(SDHB):c.640C>T (p.Gln214Ter) rs876658461
NM_003705.5(SLC25A12):c.2015del (p.Ala672fs) rs780650245
NM_004004.6(GJB2):c.35G>T (p.Gly12Val) rs1801002
NM_004380.3(CREBBP):c.3779+1G>C
NM_004525.3(LRP2):c.11663G>A (p.Arg3888His) rs77686710
NM_004525.3(LRP2):c.13921A>T (p.Thr4641Ser) rs79179577
NM_004525.3(LRP2):c.4928G>A (p.Arg1643Gln) rs147688332
NM_004782.4(SNAP29):c.354dup (p.Leu119fs) rs751575036
NM_004958.4(MTOR):c.4128T>G (p.Asp1376Glu) rs975577894
NM_004975.4(KCNB1):c.2442T>G (p.Ile814Met) rs565025643
NM_005188.3(CBL):c.1942A>C (p.Ser648Arg) rs143264567
NM_005881.4(BCKDK):c.1066A>T (p.Ser356Cys) rs142542453
NM_005883.2(APC2):c.3656C>T (p.Ala1219Val) rs137877386
NM_006231.4(POLE):c.4337_4338dup (p.Val1447fs) rs758487568
NM_006922.4(SCN3A):c.560G>A (p.Arg187His)
NM_014141.6(CNTNAP2):c.2609T>C (p.Val870Ala) rs138481453
NM_016284.5(CNOT1):c.1603C>T (p.Arg535Cys) rs1567417422
NM_017547.4(FOXRED1):c.612_615dup (p.Ala206fs) rs398124308
NM_017613.4(DONSON):c.1466A>C (p.Lys489Thr) rs146664036
NM_017890.4(VPS13B):c.2074C>T (p.Arg692Ter) rs180177356
NM_018136.5(ASPM):c.4195dup (p.Thr1399fs) rs199422163
NM_018328.4(MBD5):c.1234G>A (p.Val412Ile) rs761118931
NM_018941.3(CLN8):c.11C>T (p.Ala4Val) rs147181589
NM_018941.3(CLN8):c.374A>G (p.Asn125Ser) rs142269885
NM_019066.5(MAGEL2):c.1175C>T (p.Thr392Met) rs781777662
NM_020732.3(ARID1B):c.1088C>T (p.Ala363Val) rs748273011
NM_020987.5(ANK3):c.11678G>C (p.Ser3893Thr) rs12260663
NM_024570.4(RNASEH2B):c.529G>A (p.Ala177Thr) rs75184679
NM_032119.4(ADGRV1):c.1855T>G (p.Leu619Val) rs202064612
NM_032667.6(BSCL2):c.839C>T (p.Ser280Phe) rs140676897
NM_032730.5(RTN4IP1):c.5A>C (p.Glu2Ala)
NM_133259.4(LRPPRC):c.1295A>G (p.Glu432Gly) rs144732922
NM_144670.6(A2ML1):c.3967A>C (p.Asn1323His) rs200176373
NM_144773.3(PROKR2):c.253C>G (p.Arg85Gly) rs141090506
NM_145207.3(SPATA5):c.637G>A (p.Asp213Asn) rs139066705
NM_152743.4(BRAT1):c.638dup (p.Val214fs) rs730880324
NM_153747.2(PIGC):c.61C>T (p.Arg21Ter) rs115209243
Single allele

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.