ClinVar Miner

Variants from Ambry Genetics with conflicting interpretations

Location: United States — Primary collection method: clinical testing
Minimum review status of the submission from Ambry Genetics: Collection method of the submission from Ambry Genetics:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
46832 18786 0 3982 2996 11 329 6737

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
Ambry Genetics pathogenic likely pathogenic uncertain significance likely benign benign drug response protective risk factor other
pathogenic 0 265 36 0 0 0 0 1 0
likely pathogenic 108 0 156 1 0 0 0 0 0
uncertain significance 26 92 0 872 108 0 0 0 0
likely benign 4 7 1829 0 1965 1 0 2 1
benign 3 7 233 1645 0 0 2 4 1

Submitter to submitter summary #

Total submitters: 86
Download table as spreadsheet
Submitter Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
Color Health, Inc 0 13517 0 637 1031 0 131 1799
GeneDx 0 4097 0 1201 472 0 78 1750
EGL Genetic Diagnostics, Eurofins Clinical Diagnostics 0 1621 0 447 623 1 16 1086
Genetic Services Laboratory, University of Chicago 0 829 0 699 205 0 1 905
Integrated Genetics/Laboratory Corporation of America 0 763 0 487 77 0 6 570
Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine 0 1883 0 271 223 0 14 508
Athena Diagnostics Inc 0 918 0 389 74 0 1 464
Invitae 0 1605 0 260 116 0 5 381
CeGaT Praxis fuer Humangenetik Tuebingen 0 613 0 71 273 0 13 357
ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories 0 826 0 210 77 0 4 291
True Health Diagnostics 0 279 0 185 45 1 1 232
Illumina Clinical Services Laboratory,Illumina 0 166 0 124 76 0 2 202
PreventionGenetics, PreventionGenetics 0 1150 0 180 7 0 0 187
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 0 173 0 134 25 0 4 163
Biesecker Lab/Clinical Genomics Section,National Institutes of Health 0 441 0 79 77 0 0 156
Stanford Center for Inherited Cardiovascular Disease, Stanford University 0 213 0 42 71 0 15 128
GeneKor MSA 0 259 0 19 87 1 3 110
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute 0 205 0 66 15 1 4 86
Institute for Biomarker Research,Medical Diagnostic Laboratories, L.L.C. 0 56 0 59 17 0 1 77
Fulgent Genetics,Fulgent Genetics 0 110 0 9 31 0 2 42
Vantari Genetics 0 45 0 28 13 0 0 41
Mayo Clinic Laboratories, Mayo Clinic 0 74 0 22 8 0 3 33
Blueprint Genetics 0 79 0 15 10 0 6 31
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics,Children's Hospital of Philadelphia 0 38 0 18 10 0 1 29
Department of Pathology and Laboratory Medicine,Sinai Health System 0 27 0 3 24 0 0 27
University of Washington Department of Laboratory Medicine, University of Washington 0 35 0 12 5 0 7 24
Mendelics 0 55 0 5 15 0 3 23
OMIM 0 17 0 2 6 8 5 20
Academic Department of Medical Genetics, University of Cambridge 0 18 0 13 0 0 2 15
RettBASE 0 23 0 11 1 0 0 12
Department of Vascular Biology,Beijing Anzhen Hospital 0 5 0 5 2 0 3 10
Forensic Genetics Laboratory,Harris County Institute of Forensic Sciences 0 0 0 1 0 0 8 9
Gharavi Laboratory,Columbia University 0 11 0 1 6 0 1 8
Department of Pediatric Oncology, Hematology and Clinical Immunology,University Clinics Duesseldorf 0 5 0 0 2 0 6 8
Clinical Molecular Genetics Laboratory,Johns Hopkins All Children's Hospital 0 10 0 2 5 0 0 7
Genomic Research Center, Shahid Beheshti University of Medical Sciences 0 5 0 1 3 0 2 6
Center for Advanced Laboratory Medicine, UC San Diego Health,University of California San Diego 0 6 0 5 1 0 0 6
Quest Diagnostics Nichols Institute San Juan Capistrano 0 1 0 4 1 0 0 5
Centre for Mendelian Genomics,University Medical Centre Ljubljana 0 8 0 1 3 0 1 5
New York Genome Center 0 11 0 0 5 0 0 5
Practice for Gait Abnormalities, David Pomarino,Competency Network Toe Walking c/o Practice Pomarino 0 3 0 0 5 0 0 5
Ambry Genetics 72212 139 0 1 3 0 0 4
CSER _CC_NCGL, University of Washington 0 10 0 3 0 0 1 4
Clinical Genetics Karolinska University Hospital,Karolinska University Hospital 0 13 0 2 0 0 2 4
Knight Diagnostic Laboratories, Oregon Health and Sciences University 0 21 0 4 0 0 0 4
Lupski Lab, Baylor-Hopkins CMG, Baylor College of Medicine 0 0 0 0 0 0 4 4
Institute for Genomic Medicine (IGM) Clinical Laboratory,Nationwide Children's Hospital 0 15 0 4 0 0 0 4
Agnes Ginges Centre for Molecular Cardiology,Centenary Institute 0 6 0 3 0 0 0 3
University of Washington Center for Mendelian Genomics, University of Washington 0 4 0 1 2 0 0 3
CHEO Genetics Diagnostic Laboratory,Children's Hospital of Eastern Ontario 0 8 0 2 0 0 0 2
Claritas Genomics 0 8 0 2 0 0 0 2
Elsea Laboratory,Baylor College of Medicine 0 0 0 0 0 0 2 2
Counsyl 0 22 0 1 1 0 0 2
GeneReviews 0 4 0 1 1 0 0 2
UniProtKB/Swiss-Prot 0 5 0 1 1 0 0 2
Eye Genetics Research Group,Children's Medical Research Institute 0 0 0 0 2 0 0 2
Department of Ophthalmology and Visual Sciences Kyoto University 0 0 0 2 0 0 0 2
Division of Human Genetics,Children's Hospital of Philadelphia 0 2 0 1 1 0 0 2
NIHR Bioresource Rare Diseases, University of Cambridge 0 3 0 2 0 0 0 2
Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago 0 6 0 0 2 0 0 2
Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen 0 34 0 1 0 0 1 2
Inherited Neuropathy Consortium 0 0 0 0 1 0 1 2
GeneID Lab - Advanced Molecular Diagnostics 0 3 0 0 2 0 0 2
Johns Hopkins Genomics, Johns Hopkins University 0 1 0 2 0 0 0 2
Greenwood Genetic Center Diagnostic Laboratories,Greenwood Genetic Center 0 7 0 0 1 0 0 1
Center for Human Genetics, Inc,Center for Human Genetics, Inc 0 0 0 0 1 0 0 1
Molecular Diagnostics Lab,Nemours Alfred I. duPont Hospital for Children 0 3 0 0 0 0 1 1
Molecular Genetics Laboratory,BC Children's and BC Women's Hospitals 0 0 0 1 0 0 0 1
Developmental Genetics Unit,King Faisal Specialist Hospital & Research Centre 0 1 0 0 0 0 1 1
GenMed Metabolism Lab 0 0 0 0 0 0 1 1
Nyegaard lab; Aarhus University 0 0 0 1 0 0 0 1
Molecular Genetics and Enzymology, National Research Centre 0 0 0 0 0 0 1 1
Congenital Heart Disease Genetic Program Lab,American University of Beirut 0 0 0 0 1 0 0 1
Génétique et pathophysiologie de maladies neurodéveloppementales et épileptogènes, Institut de génétique et de biologie moléculaire et cellulaire 0 0 0 1 0 0 0 1
Dobyns Lab,Seattle Children's Research Institute 0 0 0 0 0 0 1 1
Albrecht-Kossel-Institute,Medical University Rostock 0 0 0 0 0 1 0 1
Laboratory of Genetics and Molecular Cardiology, University of São Paulo 0 0 0 1 0 0 0 1
Center of Medical Genetics and Primary Health Care 0 2 0 0 1 0 0 1
Laboratoire de Génétique Moléculaire, CHU Bordeaux 0 2 0 0 0 0 1 1
Barrett Group,Wellcome Trust Sanger Institute 0 0 0 0 0 0 1 1
Genetics Laboratory,Facudade de Medicina de Sao Jose do Rio Preto 0 0 0 0 1 0 0 1
Institute for Genomic Medicine, Nationwide Children's Hospital 0 0 0 1 0 0 0 1
Broad Institute Rare Disease Group, Broad Institute 0 6 0 1 0 0 0 1
Department of Molecular Diagnostics, Institute of Oncology Ljubljana 0 1 0 1 0 0 0 1
Department of Rehabilitation Medicine, Incheon St. Mary’s Hospital,College of Medicine, The Catholic University of Korea 0 0 0 1 0 0 0 1
NxGen MDx 0 0 0 1 0 0 0 1

All variants with conflicting interpretations #

Total variants: 6737
Download table as spreadsheet
HGVS dbSNP
NM_000033.4(ABCD1):c.1455A>C (p.Ser485=) rs150878397
NM_000033.4(ABCD1):c.1748T>A (p.Val583Glu) rs79383557
NM_000033.4(ABCD1):c.258C>T (p.Val86=) rs200660869
NM_000033.4(ABCD1):c.707G>A (p.Arg236His) rs201455322
NM_000033.4(ABCD1):c.757C>G (p.Leu253Val) rs150151955
NM_000033.4(ABCD1):c.838C>T (p.Arg280Cys) rs193922098
NM_000038.6(APC):c.1005A>G (p.Leu335=) rs3797704
NM_000038.6(APC):c.120G>A (p.Glu40=) rs142720069
NM_000038.6(APC):c.1240C>T (p.Arg414Cys) rs137854567
NM_000038.6(APC):c.1276G>T (p.Ala426Ser) rs200598389
NM_000038.6(APC):c.1408+3A>G rs534358523
NM_000038.6(APC):c.1488A>T (p.Thr496=) rs9282599
NM_000038.6(APC):c.1554G>A (p.Thr518=) rs546568052
NM_000038.6(APC):c.1589T>C (p.Val530Ala) rs202199891
NM_000038.6(APC):c.1606G>A (p.Glu536Lys) rs138098808
NM_000038.6(APC):c.1626+4C>A rs1202435147
NM_000038.6(APC):c.1631T>C (p.Ile544Thr) rs144056494
NM_000038.6(APC):c.1695A>G (p.Glu565=) rs77921116
NM_000038.6(APC):c.181G>A (p.Ala61Thr) rs786201989
NM_000038.6(APC):c.1958+1_1958+4dup rs1060503356
NM_000038.6(APC):c.1959G>A (p.Arg653=) rs72541809
NM_000038.6(APC):c.1984C>A (p.Leu662Ile) rs756859993
NM_000038.6(APC):c.220+4G>A rs973491846
NM_000038.6(APC):c.2204C>T (p.Ala735Val) rs147655929
NM_000038.6(APC):c.221-2A>G rs786201291
NM_000038.6(APC):c.2222A>G (p.Asn741Ser) rs150209825
NM_000038.6(APC):c.2262T>G (p.Val754=) rs148987776
NM_000038.6(APC):c.2444A>C (p.Asn815Thr) rs762990578
NM_000038.6(APC):c.2476T>G (p.Leu826Val) rs145245264
NM_000038.6(APC):c.2593C>T (p.Pro865Ser) rs192620988
NM_000038.6(APC):c.259C>T (p.Leu87=) rs569640184
NM_000038.6(APC):c.2608C>T (p.Pro870Ser) rs33974176
NM_000038.6(APC):c.2627G>A (p.Arg876Gln) rs373428732
NM_000038.6(APC):c.277C>G (p.Leu93Val) rs201567345
NM_000038.6(APC):c.3165A>T (p.Ile1055=) rs61734287
NM_000038.6(APC):c.3173A>G (p.Asp1058Gly) rs148725540
NM_000038.6(APC):c.3245C>G (p.Thr1082Ser) rs730881244
NM_000038.6(APC):c.3352A>G (p.Asn1118Asp) rs140493115
NM_000038.6(APC):c.3386T>C (p.Leu1129Ser) rs143638171
NM_000038.6(APC):c.3462AGA[2] (p.Glu1157del) rs386833391
NM_000038.6(APC):c.3471G>A (p.Glu1157=) rs143927847
NM_000038.6(APC):c.3479C>A (p.Thr1160Lys) rs201004111
NM_000038.6(APC):c.3625G>A (p.Glu1209Lys) rs201185479
NM_000038.6(APC):c.3650A>C (p.Asn1217Thr) rs138933660
NM_000038.6(APC):c.3691C>G (p.Leu1231Val) rs573020080
NM_000038.6(APC):c.3732A>G (p.Gln1244=) rs74380081
NM_000038.6(APC):c.3868A>G (p.Asn1290Asp) rs752977559
NM_000038.6(APC):c.3910A>G (p.Ile1304Val) rs770157475
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000038.6(APC):c.3932T>G (p.Ile1311Ser) rs876659190
NM_000038.6(APC):c.3949G>C (p.Glu1317Gln) rs1801166
NM_000038.6(APC):c.4072G>A (p.Ala1358Thr) rs139618756
NM_000038.6(APC):c.423-3T>A rs587782293
NM_000038.6(APC):c.423-3_423-2del rs863225354
NM_000038.6(APC):c.423-4del rs730881230
NM_000038.6(APC):c.4333A>G (p.Thr1445Ala) rs587780597
NM_000038.6(APC):c.4336G>A (p.Ala1446Thr) rs146572883
NM_000038.6(APC):c.4349G>A (p.Arg1450Gln) rs587782678
NM_000038.6(APC):c.4395T>A (p.Ser1465Arg) rs779898882
NM_000038.6(APC):c.450A>G (p.Lys150=) rs116020626
NM_000038.6(APC):c.4702GAT[3] (p.Asp1571del) rs587782888
NM_000038.6(APC):c.4765C>G (p.Arg1589Gly) rs72541813
NM_000038.6(APC):c.4765C>T (p.Arg1589Cys) rs72541813
NM_000038.6(APC):c.4893T>C (p.Ser1631=) rs35634377
NM_000038.6(APC):c.4913T>C (p.Met1638Thr) rs201797422
NM_000038.6(APC):c.4919G>A (p.Arg1640Gln) rs529480958
NM_000038.6(APC):c.5017G>A (p.Glu1673Lys) rs587779796
NM_000038.6(APC):c.5179T>C (p.Cys1727Arg) rs758815860
NM_000038.6(APC):c.5216A>G (p.Lys1739Arg) rs769558291
NM_000038.6(APC):c.5265G>A (p.Ala1755=) rs34506289
NM_000038.6(APC):c.5274T>A (p.Ser1758=) rs199600387
NM_000038.6(APC):c.5337A>G (p.Ile1779Met) rs748063409
NM_000038.6(APC):c.5372A>G (p.Lys1791Arg) rs775740112
NM_000038.6(APC):c.5421CAA[1] (p.Asn1808del) rs587782002
NM_000038.6(APC):c.5506G>A (p.Gly1836Arg) rs766739164
NM_000038.6(APC):c.5635G>T (p.Ala1879Ser) rs587779799
NM_000038.6(APC):c.5690A>C (p.His1897Pro) rs112610898
NM_000038.6(APC):c.5737A>G (p.Ile1913Val) rs1554086935
NM_000038.6(APC):c.573T>C (p.Tyr191=) rs185154886
NM_000038.6(APC):c.5752A>G (p.Ile1918Val) rs776966222
NM_000038.6(APC):c.5774C>A (p.Pro1925His) rs762682111
NM_000038.6(APC):c.5790A>G (p.Gln1930=) rs141152252
NM_000038.6(APC):c.5801C>T (p.Pro1934Leu) rs587780600
NM_000038.6(APC):c.5894A>G (p.His1965Arg) rs773776516
NM_000038.6(APC):c.5931A>G (p.Gln1977=) rs975299630
NM_000038.6(APC):c.5957C>T (p.Pro1986Leu) rs756266694
NM_000038.6(APC):c.5981A>T (p.Asp1994Val) rs774815653
NM_000038.6(APC):c.607C>G (p.Gln203Glu) rs141576417
NM_000038.6(APC):c.6387G>A (p.Ser2129=) rs374310157
NM_000038.6(APC):c.647G>A (p.Arg216Gln) rs76685252
NM_000038.6(APC):c.6554G>A (p.Ser2185Asn) rs764255983
NM_000038.6(APC):c.6639G>A (p.Met2213Ile) rs35540155
NM_000038.6(APC):c.6669A>G (p.Ser2223=) rs372680843
NM_000038.6(APC):c.6679G>T (p.Gly2227Cys) rs367905430
NM_000038.6(APC):c.669A>C (p.Gln223His) rs769482880
NM_000038.6(APC):c.6724A>G (p.Ser2242Gly) rs201375478
NM_000038.6(APC):c.6782C>T (p.Pro2261Leu) rs376494248
NM_000038.6(APC):c.6821C>T (p.Ala2274Val) rs34919187
NM_000038.6(APC):c.6857C>T (p.Ala2286Val) rs200587641
NM_000038.6(APC):c.6873A>T (p.Gln2291His) rs148878262
NM_000038.6(APC):c.6921G>A (p.Ser2307=) rs2229993
NM_000038.6(APC):c.6965A>G (p.Gln2322Arg) rs1057517549
NM_000038.6(APC):c.705A>G (p.Leu235=) rs147036141
NM_000038.6(APC):c.7174C>A (p.Pro2392Thr) rs730881257
NM_000038.6(APC):c.7201C>T (p.Leu2401=) rs2229994
NM_000038.6(APC):c.730-3C>T rs786203125
NM_000038.6(APC):c.7399C>A (p.Pro2467Thr) rs372305287
NM_000038.6(APC):c.7415C>T (p.Ala2472Val) rs200399245
NM_000038.6(APC):c.7543A>G (p.Ile2515Val) rs554356011
NM_000038.6(APC):c.7574G>A (p.Arg2525His) rs762034315
NM_000038.6(APC):c.757G>A (p.Gly253Ser) rs772806807
NM_000038.6(APC):c.7645C>T (p.Arg2549Cys) rs199539353
NM_000038.6(APC):c.768T>G (p.Asp256Glu) rs764268036
NM_000038.6(APC):c.7704A>G (p.Gly2568=) rs35043160
NM_000038.6(APC):c.7717A>G (p.Ile2573Val) rs145444830
NM_000038.6(APC):c.7781C>G (p.Ser2594Cys) rs543396310
NM_000038.6(APC):c.7821C>T (p.Ser2607=) rs532235331
NM_000038.6(APC):c.7822G>A (p.Ala2608Thr) rs878853471
NM_000038.6(APC):c.7858T>A (p.Phe2620Ile) rs587781816
NM_000038.6(APC):c.7862C>G (p.Ser2621Cys) rs72541816
NM_000038.6(APC):c.8043G>C (p.Pro2681=) rs149347068
NM_000038.6(APC):c.8057T>C (p.Val2686Ala) rs757901425
NM_000038.6(APC):c.8068G>A (p.Ala2690Thr) rs140868933
NM_000038.6(APC):c.8141G>A (p.Arg2714His) rs747362422
NM_000038.6(APC):c.8261G>A (p.Ser2754Asn) rs369721828
NM_000038.6(APC):c.8332G>T (p.Ala2778Ser) rs587778046
NM_000038.6(APC):c.835-3T>C rs372090940
NM_000038.6(APC):c.8383G>A (p.Ala2795Thr) rs369264968
NM_000038.6(APC):c.8411A>G (p.Gln2804Arg) rs1475247315
NM_000038.6(APC):c.841A>G (p.Thr281Ala) rs769727966
NM_000038.6(APC):c.8429A>G (p.Asn2810Ser) rs758044862
NM_000038.6(APC):c.95A>G (p.Asn32Ser) rs539108537
NM_000038.6(APC):c.995G>A (p.Arg332Gln) rs377665107
NM_000051.3(ATM):c.1138T>A (p.Tyr380Asn) rs34083085
NM_000051.3(ATM):c.1176C>G (p.Gly392=) rs1800727
NM_000051.3(ATM):c.118A>G (p.Ile40Val) rs1064796002
NM_000051.3(ATM):c.1229T>C (p.Val410Ala) rs56128736
NM_000051.3(ATM):c.1236-3dup rs34325032
NM_000051.3(ATM):c.1254A>G (p.Gln418=) rs4987943
NM_000051.3(ATM):c.1464G>T (p.Trp488Cys) rs377597949
NM_000051.3(ATM):c.162T>C (p.Tyr54=) rs3218690
NM_000051.3(ATM):c.1695A>G (p.Glu565=) rs780932013
NM_000051.3(ATM):c.1744T>C (p.Phe582Leu) rs2235006
NM_000051.3(ATM):c.1855A>C (p.Asn619His) rs140882609
NM_000051.3(ATM):c.1888G>A (p.Val630Met) rs148191382
NM_000051.3(ATM):c.1898+1G>T rs758325274
NM_000051.3(ATM):c.1960C>A (p.Gln654Lys) rs528165789
NM_000051.3(ATM):c.2019G>A (p.Lys673=) rs786203021
NM_000051.3(ATM):c.202A>G (p.Ile68Val) rs35389822
NM_000051.3(ATM):c.2074C>T (p.Arg692Cys) rs765965513
NM_000051.3(ATM):c.2096A>G (p.Glu699Gly) rs147934285
NM_000051.3(ATM):c.2098C>T (p.Gln700Ter) rs786202743
NM_000051.3(ATM):c.2119T>C (p.Ser707Pro) rs4986761
NM_000051.3(ATM):c.2127T>C (p.Ile709=) rs56252953
NM_000051.3(ATM):c.2127T>G (p.Ile709Met) rs56252953
NM_000051.3(ATM):c.2193C>T (p.Tyr731=) rs2229019
NM_000051.3(ATM):c.2250G>A (p.Lys750=) rs1137887
NM_000051.3(ATM):c.2251-10T>G rs730881346
NM_000051.3(ATM):c.2251-4A>G rs786202935
NM_000051.3(ATM):c.2362A>C (p.Ser788Arg) rs641252
NM_000051.3(ATM):c.2396C>T (p.Ala799Val) rs199954262
NM_000051.3(ATM):c.2442C>A (p.Asp814Glu) rs3218695
NM_000051.3(ATM):c.2446_2447delinsCT (p.Ala816Leu) rs587781956
NM_000051.3(ATM):c.2476A>C (p.Ile826Leu) rs587782397
NM_000051.3(ATM):c.2495G>T (p.Arg832Leu) rs199875915
NM_000051.3(ATM):c.2567A>G (p.Asn856Ser) rs1555082253
NM_000051.3(ATM):c.2572T>C (p.Phe858Leu) rs1800056
NM_000051.3(ATM):c.2614C>T (p.Pro872Ser) rs3218673
NM_000051.3(ATM):c.2630G>C (p.Ser877Thr) rs370269552
NM_000051.3(ATM):c.2638+3A>G rs876660552
NM_000051.3(ATM):c.2685A>G (p.Leu895=) rs3218687
NM_000051.3(ATM):c.275A>C (p.Lys92Thr) rs200151849
NM_000051.3(ATM):c.2836A>G (p.Met946Val) rs587781992
NM_000051.3(ATM):c.2839-4T>C rs1057522619
NM_000051.3(ATM):c.2873A>G (p.Glu958Gly) rs587778069
NM_000051.3(ATM):c.2887A>G (p.Met963Val) rs374353016
NM_000051.3(ATM):c.2921+1G>C rs587781558
NM_000051.3(ATM):c.2921+1G>T rs587781558
NM_000051.3(ATM):c.2937G>T (p.Leu979Phe) rs1166904824
NM_000051.3(ATM):c.2989G>A (p.Val997Ile) rs1487902875
NM_000051.3(ATM):c.3014A>G (p.Asn1005Ser) rs146531614
NM_000051.3(ATM):c.3016A>G (p.Met1006Val) rs139893395
NM_000051.3(ATM):c.3078-1G>A rs750663117
NM_000051.3(ATM):c.3118A>G (p.Met1040Val) rs3092857
NM_000051.3(ATM):c.3190A>G (p.Met1064Val) rs79431304
NM_000051.3(ATM):c.3242A>G (p.Asn1081Ser) rs368111672
NM_000051.3(ATM):c.3285-5T>C rs876659715
NM_000051.3(ATM):c.3295G>A (p.Asp1099Asn) rs372966951
NM_000051.3(ATM):c.331+1G>A rs1555055356
NM_000051.3(ATM):c.3341A>G (p.Lys1114Arg) rs777705500
NM_000051.3(ATM):c.3342G>A (p.Lys1114=) rs138393322
NM_000051.3(ATM):c.3352A>G (p.Thr1118Ala) rs572564322
NM_000051.3(ATM):c.3383A>G (p.Gln1128Arg) rs2229020
NM_000051.3(ATM):c.3478G>C (p.Val1160Leu) rs567344545
NM_000051.3(ATM):c.3614G>A (p.Arg1205His) rs769106895
NM_000051.3(ATM):c.378T>A (p.Asp126Glu) rs2234997
NM_000051.3(ATM):c.3806A>G (p.Lys1269Arg) rs146017595
NM_000051.3(ATM):c.3919G>A (p.Gly1307Arg) rs568451087
NM_000051.3(ATM):c.3964C>A (p.Leu1322Ile) rs144535256
NM_000051.3(ATM):c.3993+1G>A rs200196781
NM_000051.3(ATM):c.3993+5G>T rs3092842
NM_000051.3(ATM):c.3994-2A>G rs587782276
NM_000051.3(ATM):c.4109+4T>C rs754706599
NM_000051.3(ATM):c.4110-1G>A rs1060501692
NM_000051.3(ATM):c.4110-9C>G rs730881367
NM_000051.3(ATM):c.4138C>T (p.His1380Tyr) rs3092856
NM_000051.3(ATM):c.4167A>G (p.Thr1389=) rs183214437
NM_000051.3(ATM):c.4258C>T (p.Leu1420Phe) rs1800058
NM_000051.3(ATM):c.4279G>A (p.Ala1427Thr) rs2229021
NM_000051.3(ATM):c.4324T>C (p.Tyr1442His) rs201666889
NM_000051.3(ATM):c.4362A>C (p.Lys1454Asn) rs148993589
NM_000051.3(ATM):c.4365T>A (p.Ser1455Arg) rs527471560
NM_000051.3(ATM):c.4396C>G (p.Arg1466Gly) rs730881369
NM_000051.3(ATM):c.4437-1G>C rs759520465
NM_000051.3(ATM):c.4473C>T (p.Phe1491=) rs4988008
NM_000051.3(ATM):c.4576C>T (p.Pro1526Ser) rs748898098
NM_000051.3(ATM):c.4612-4T>G rs569983068
NM_000051.3(ATM):c.4703A>G (p.His1568Arg) rs368830730
NM_000051.3(ATM):c.4735C>T (p.Gln1579Ter) rs869312755
NM_000051.3(ATM):c.4776+1G>T rs771117943
NM_000051.3(ATM):c.4776+2T>A rs587781927
NM_000051.3(ATM):c.4853G>A (p.Arg1618Gln) rs765759912
NM_000051.3(ATM):c.4910-4C>T rs786202493
NM_000051.3(ATM):c.4910A>G (p.Asp1637Gly) rs763457172
NM_000051.3(ATM):c.4949A>G (p.Asn1650Ser) rs55870064
NM_000051.3(ATM):c.497-4T>A rs876659621
NM_000051.3(ATM):c.5080G>A (p.Ala1694Thr) rs756197350
NM_000051.3(ATM):c.5089A>G (p.Thr1697Ala) rs142455912
NM_000051.3(ATM):c.5178-4dup rs747750958
NM_000051.3(ATM):c.5319+3C>A rs371640963
NM_000051.3(ATM):c.5320-4C>G rs1316146972
NM_000051.3(ATM):c.5375T>C (p.Ile1792Thr) rs776309355
NM_000051.3(ATM):c.544G>C (p.Val182Leu) rs3218707
NM_000051.3(ATM):c.5497-2A>G rs786203796
NM_000051.3(ATM):c.5497-8T>C rs3092829
NM_000051.3(ATM):c.5558A>T (p.Asp1853Val) rs1801673
NM_000051.3(ATM):c.5596G>A (p.Val1866Ile) rs1468995507
NM_000051.3(ATM):c.5618G>A (p.Cys1873Tyr) rs587782239
NM_000051.3(ATM):c.5630T>C (p.Phe1877Ser) rs202028401
NM_000051.3(ATM):c.5675-4T>A rs56075338
NM_000051.3(ATM):c.5693G>A (p.Arg1898Gln) rs370680798
NM_000051.3(ATM):c.5762+1G>T rs869312756
NM_000051.3(ATM):c.5763A>G (p.Arg1921=) rs1057523784
NM_000051.3(ATM):c.5825C>T (p.Ala1942Val) rs730881394
NM_000051.3(ATM):c.5858C>T (p.Thr1953Ile) rs587781963
NM_000051.3(ATM):c.6056A>G (p.Tyr2019Cys) rs876658415
NM_000051.3(ATM):c.6088A>G (p.Ile2030Val) rs145847315
NM_000051.3(ATM):c.6095+5A>G rs757328753
NM_000051.3(ATM):c.6095+5del rs1555113628
NM_000051.3(ATM):c.609C>T (p.Asp203=) rs144709948
NM_000051.3(ATM):c.6100C>T (p.Arg2034Ter) rs532480170
NM_000051.3(ATM):c.6154G>A (p.Glu2052Lys) rs202206540
NM_000051.3(ATM):c.6179G>A (p.Arg2060His) rs376521407
NM_000051.3(ATM):c.6198+5A>G rs771047560
NM_000051.3(ATM):c.6200C>A (p.Ala2067Asp) rs397514577
NM_000051.3(ATM):c.6338C>G (p.Thr2113Ser) rs573290117
NM_000051.3(ATM):c.6443A>G (p.Lys2148Arg) rs730881382
NM_000051.3(ATM):c.657T>C (p.Cys219=) rs2235003
NM_000051.3(ATM):c.6652A>C (p.Ser2218Arg) rs749261367
NM_000051.3(ATM):c.6807G>A (p.Gln2269=) rs587780638
NM_000051.3(ATM):c.6891A>G (p.Gln2297=) rs773545588
NM_000051.3(ATM):c.6919C>T (p.Leu2307Phe) rs56009889
NM_000051.3(ATM):c.6975+2T>C rs879254199
NM_000051.3(ATM):c.6995T>C (p.Leu2332Pro) rs4988111
NM_000051.3(ATM):c.6998C>A (p.Thr2333Lys) rs150503164
NM_000051.3(ATM):c.712A>G (p.Ile238Val) rs754275014
NM_000051.3(ATM):c.7307G>A (p.Arg2436Lys) rs786203394
NM_000051.3(ATM):c.735C>T (p.Val245=) rs3218674
NM_000051.3(ATM):c.7566A>G (p.Gln2522=) rs775621333
NM_000051.3(ATM):c.7618G>A (p.Val2540Ile) rs35203200
NM_000051.3(ATM):c.7630-3C>T rs587782448
NM_000051.3(ATM):c.7775C>G (p.Ser2592Cys) rs755009196
NM_000051.3(ATM):c.7778A>G (p.Gln2593Arg) rs587779867
NM_000051.3(ATM):c.7788G>A (p.Glu2596=) rs587780639
NM_000051.3(ATM):c.7927+13dup rs587781324
NM_000051.3(ATM):c.7988T>C (p.Val2663Ala) rs377648506
NM_000051.3(ATM):c.8122G>A (p.Asp2708Asn) rs587782719
NM_000051.3(ATM):c.8187A>G (p.Gln2729=) rs587781946
NM_000051.3(ATM):c.8353G>A (p.Asp2785Asn) rs587782417
NM_000051.3(ATM):c.8419-19A>G rs12279930
NM_000051.3(ATM):c.8530A>G (p.Ile2844Val) rs756230327
NM_000051.3(ATM):c.8732C>T (p.Thr2911Ile) rs794728018
NM_000051.3(ATM):c.8786+1G>T rs17174393
NM_000051.3(ATM):c.8786+8A>C rs4986839
NM_000051.3(ATM):c.8787-5T>C rs1479499265
NM_000051.3(ATM):c.8850+4A>C rs587782335
NM_000051.3(ATM):c.8850+5A>C rs1057522186
NM_000051.3(ATM):c.8851-3T>G rs748874219
NM_000051.3(ATM):c.8921C>T (p.Pro2974Leu) rs139379666
NM_000051.3(ATM):c.8944C>T (p.Pro2982Ser) rs1485620194
NM_000051.3(ATM):c.8988-1G>C rs730881386
NM_000051.3(ATM):c.8988-2A>G rs786202087
NM_000051.3(ATM):c.8993T>C (p.Ile2998Thr) rs778670498
NM_000051.3(ATM):c.9006C>T (p.Phe3002=) rs540172506
NM_000051.3(ATM):c.901+1G>T rs748840480
NM_000051.3(ATM):c.9079dup (p.Ser3027fs) rs587780645
NM_000051.3(ATM):c.95G>A (p.Arg32His) rs368161489
NM_000051.3(ATM):c.967A>G (p.Ile323Val) rs587781511
NM_000051.4(ATM):c.1010G>A (p.Arg337His) rs202160435
NM_000051.4(ATM):c.103C>T (p.Arg35Ter) rs55861249
NM_000051.4(ATM):c.1066-6T>G rs201686625
NM_000051.4(ATM):c.1444A>C (p.Lys482Gln) rs202173660
NM_000051.4(ATM):c.146C>G rs1800054
NM_000051.4(ATM):c.1595G>A (p.Cys532Tyr) rs35963548
NM_000051.4(ATM):c.1703G>T (p.Arg568Ile) rs200381392
NM_000051.4(ATM):c.2021A>G (p.His674Arg) rs201762714
NM_000051.4(ATM):c.2289T>A (p.Phe763Leu) rs34231402
NM_000051.4(ATM):c.2606C>G (p.Ala869Gly) rs145513717
NM_000051.4(ATM):c.2735A>G (p.Gln912Arg) rs730881353
NM_000051.4(ATM):c.2927T>C (p.Val976Ala) rs146145357
NM_000051.4(ATM):c.2932T>C (p.Ser978Pro) rs139552233
NM_000051.4(ATM):c.295A>G (p.Ser99Gly) rs137882485
NM_000051.4(ATM):c.320G>A (p.Cys107Tyr) rs142358238
NM_000051.4(ATM):c.3299C>T (p.Thr1100Met) rs189445371
NM_000051.4(ATM):c.334G>A (p.Ala112Thr) rs146382972
NM_000051.4(ATM):c.3712_3716del (p.Leu1238fs) rs786201675
NM_000051.4(ATM):c.3925G>A (p.Ala1309Thr) rs149711770
NM_000051.4(ATM):c.4060C>A (p.Pro1354Thr) rs145119475
NM_000051.4(ATM):c.4388T>G (p.Phe1463Cys) rs138327406
NM_000051.4(ATM):c.4402G>A (p.Val1468Ile) rs369903995
NM_000051.4(ATM):c.4578C>T (p.Pro1526=) rs1800889
NM_000051.4(ATM):c.4709T>C (p.Val1570Ala) rs140856217
NM_000051.4(ATM):c.496+4T>C rs587781375
NM_000051.4(ATM):c.5071A>C (p.Ser1691Arg) rs1800059
NM_000051.4(ATM):c.5185G>C (p.Val1729Leu) rs3092907
NM_000051.4(ATM):c.5793T>C (p.Ala1931=) rs3092910
NM_000051.4(ATM):c.5821G>C (p.Val1941Leu) rs147187700
NM_000051.4(ATM):c.5975A>C (p.Lys1992Thr) rs150757822
NM_000051.4(ATM):c.6067G>A (p.Gly2023Arg) rs11212587
NM_000051.4(ATM):c.6198+1G>A rs778031266
NM_000051.4(ATM):c.6975G>A (p.Ala2325=) rs556778314
NM_000051.4(ATM):c.7092A>G (p.Ala2364=) rs1591150359
NM_000051.4(ATM):c.7187C>G (p.Thr2396Ser) rs370559102
NM_000051.4(ATM):c.7313C>T (p.Thr2438Ile) rs147604227
NM_000051.4(ATM):c.749G>A (p.Arg250Gln) rs56123940
NM_000051.4(ATM):c.7740A>C (p.Arg2580Ser) rs199915459
NM_000051.4(ATM):c.7789-3T>G rs864622185
NM_000051.4(ATM):c.8151G>A (p.Lys2717=) rs1591192550
NM_000051.4(ATM):c.8584+2T>C rs730881326
NM_000051.4(ATM):c.9086G>A (p.Gly3029Asp) rs201199629
NM_000051.4(ATM):c.9166G>T (p.Val3056Leu) rs371767164
NM_000052.7(ATP7A):c.1516A>G (p.Ile506Val) rs143907597
NM_000052.7(ATP7A):c.1955G>A (p.Arg652Gln) rs143214563
NM_000052.7(ATP7A):c.2070A>G (p.Glu690=) rs146692150
NM_000052.7(ATP7A):c.3589A>G (p.Asn1197Asp) rs148765730
NM_000052.7(ATP7A):c.3883C>T (p.Arg1295Trp) rs372489000
NM_000052.7(ATP7A):c.4006A>G (p.Asn1336Asp) rs146651049
NM_000052.7(ATP7A):c.4389T>C (p.Ser1463=) rs371939448
NM_000057.4(BLM):c.191A>T (p.Asp64Val) rs140382474
NM_000057.4(BLM):c.3879A>G (p.Glu1293=) rs28377085
NM_000059.3(BRCA2):c.-11C>T rs76874770
NM_000059.3(BRCA2):c.10024G>A (p.Glu3342Lys) rs28897761
NM_000059.3(BRCA2):c.10070C>T (p.Thr3357Ile) rs80358388
NM_000059.3(BRCA2):c.10076A>G (p.Glu3359Gly) rs80358389
NM_000059.3(BRCA2):c.10082A>C (p.Gln3361Pro) rs751250810
NM_000059.3(BRCA2):c.10089A>G (p.Ile3363Met) rs80358390
NM_000059.3(BRCA2):c.10111A>G (p.Thr3371Ala) rs80358393
NM_000059.3(BRCA2):c.10120A>G (p.Thr3374Ala) rs80358395
NM_000059.3(BRCA2):c.10160C>G (p.Thr3387Ser) rs863224584
NM_000059.3(BRCA2):c.10189T>A (p.Ser3397Thr) rs876660044
NM_000059.3(BRCA2):c.10238C>A (p.Thr3413Lys) rs730881584
NM_000059.3(BRCA2):c.10240A>G (p.Thr3414Ala) rs80358405
NM_000059.3(BRCA2):c.10249T>C (p.Tyr3417His) rs535952730
NM_000059.3(BRCA2):c.1040A>G (p.Gln347Arg) rs55800493
NM_000059.3(BRCA2):c.1054T>C (p.Tyr352His) rs542343726
NM_000059.3(BRCA2):c.1124C>T (p.Pro375Leu) rs80358409
NM_000059.3(BRCA2):c.1141G>A (p.Asp381Asn) rs398122723
NM_000059.3(BRCA2):c.1166C>A (p.Pro389Gln) rs397507263
NM_000059.3(BRCA2):c.1166C>T (p.Pro389Leu) rs397507263
NM_000059.3(BRCA2):c.1167G>A (p.Pro389=) rs148607710
NM_000059.3(BRCA2):c.1225G>A (p.Glu409Lys) rs80358416
NM_000059.3(BRCA2):c.122C>T (p.Pro41Leu) rs786201716
NM_000059.3(BRCA2):c.1232T>C (p.Ile411Thr) rs79597821
NM_000059.3(BRCA2):c.1244A>G (p.His415Arg) rs80358417
NM_000059.3(BRCA2):c.1275A>G (p.Glu425=) rs34355306
NM_000059.3(BRCA2):c.1342C>T (p.Arg448Cys) rs80358422
NM_000059.3(BRCA2):c.1343G>A (p.Arg448His) rs80358423
NM_000059.3(BRCA2):c.136C>T (p.Pro46Ser) rs80358425
NM_000059.3(BRCA2):c.1427C>G (p.Ser476Cys) rs80358431
NM_000059.3(BRCA2):c.1441A>G (p.Ile481Val) rs760559435
NM_000059.3(BRCA2):c.1460C>A (p.Ala487Glu) rs56390402
NM_000059.3(BRCA2):c.1462A>G (p.Ile488Val) rs864622352
NM_000059.3(BRCA2):c.1466C>G (p.Ser489Cys) rs587782535
NM_000059.3(BRCA2):c.1591A>G (p.Lys531Glu) rs876659050
NM_000059.3(BRCA2):c.1624A>G (p.Ile542Val) rs730881511
NM_000059.3(BRCA2):c.1630A>G (p.Thr544Ala) rs80358447
NM_000059.3(BRCA2):c.1631C>T (p.Thr544Ile) rs80358448
NM_000059.3(BRCA2):c.1644G>A (p.Gln548=) rs55986646
NM_000059.3(BRCA2):c.1666A>G (p.Asn556Asp) rs587781794
NM_000059.3(BRCA2):c.167A>C (p.Asn56Thr) rs80358454
NM_000059.3(BRCA2):c.1763A>G (p.Asn588Ser) rs373400041
NM_000059.3(BRCA2):c.1788T>C (p.Asp596=) rs11571642
NM_000059.3(BRCA2):c.1813dupA (p.Ile605Asnfs) rs80359306
NM_000059.3(BRCA2):c.182T>C (p.Leu61Pro) rs1555280374
NM_000059.3(BRCA2):c.1838T>G (p.Leu613Arg) rs587780646
NM_000059.3(BRCA2):c.1889C>T (p.Thr630Ile) rs80358479
NM_000059.3(BRCA2):c.1911T>C (p.Gly637=) rs11571652
NM_000059.3(BRCA2):c.1951G>T (p.Asp651Tyr) rs80358482
NM_000059.3(BRCA2):c.2014A>G (p.Arg672Gly) rs587781647
NM_000059.3(BRCA2):c.2044A>T (p.Ile682Phe) rs398122738
NM_000059.3(BRCA2):c.2125C>G (p.Leu709Val) rs80358489
NM_000059.3(BRCA2):c.2145A>G (p.Gly715=) rs112566179
NM_000059.3(BRCA2):c.2148G>C (p.Gln716His) rs876659550
NM_000059.3(BRCA2):c.215A>G (p.Asn72Ser) rs276174818
NM_000059.3(BRCA2):c.2320A>G (p.Thr774Ala) rs55968715
NM_000059.3(BRCA2):c.2332G>A (p.Val778Ile) rs587779360
NM_000059.3(BRCA2):c.2348T>G (p.Val783Gly) rs768143929
NM_000059.3(BRCA2):c.235A>G (p.Ile79Val) rs80358502
NM_000059.3(BRCA2):c.2461G>A (p.Val821Ile) rs756411508
NM_000059.3(BRCA2):c.2484T>C (p.Tyr828=) rs45619134
NM_000059.3(BRCA2):c.2490C>A (p.Asn830Lys) rs56331088
NM_000059.3(BRCA2):c.2492T>C (p.Val831Ala) rs779520270
NM_000059.3(BRCA2):c.2524G>C (p.Val842Leu) rs587782454
NM_000059.3(BRCA2):c.257T>C (p.Leu86Pro) rs572782576
NM_000059.3(BRCA2):c.2667T>C (p.Asn889=) rs587782469
NM_000059.3(BRCA2):c.2679A>G (p.Gln893=) rs786203640
NM_000059.3(BRCA2):c.2683G>A (p.Ala895Thr) rs786203045
NM_000059.3(BRCA2):c.2771A>T (p.Asn924Ile) rs80358530
NM_000059.3(BRCA2):c.2803G>C (p.Asp935His) rs28897716
NM_000059.3(BRCA2):c.2813C>A (p.Ala938Glu) rs55773834
NM_000059.3(BRCA2):c.2817C>T (p.Thr939=) rs367921107
NM_000059.3(BRCA2):c.2837A>G (p.Asp946Gly) rs55972907
NM_000059.3(BRCA2):c.2849T>A (p.Val950Asp) rs80358535
NM_000059.3(BRCA2):c.28A>G (p.Thr10Ala) rs786203080
NM_000059.3(BRCA2):c.2926T>A (p.Ser976Thr) rs144862123
NM_000059.3(BRCA2):c.2927C>T (p.Ser976Phe) rs11571656
NM_000059.3(BRCA2):c.2944A>C (p.Ile982Leu) rs28897717
NM_000059.3(BRCA2):c.3032C>G (p.Thr1011Arg) rs80358548
NM_000059.3(BRCA2):c.3211C>T (p.His1071Tyr) rs80358564
NM_000059.3(BRCA2):c.3262C>T (p.Pro1088Ser) rs80358572
NM_000059.3(BRCA2):c.3304A>T (p.Asn1102Tyr) rs28897719
NM_000059.3(BRCA2):c.338G>A (p.Arg113Lys) rs876659161
NM_000059.3(BRCA2):c.341A>G (p.His114Arg) rs80358586
NM_000059.3(BRCA2):c.3420T>C (p.Ser1140=) rs118093942
NM_000059.3(BRCA2):c.3431T>G (p.Val1144Gly) rs80358587
NM_000059.3(BRCA2):c.343A>G (p.Lys115Glu) rs56242644
NM_000059.3(BRCA2):c.3451A>G (p.Ile1151Val) rs80358591
NM_000059.3(BRCA2):c.3458A>G (p.Lys1153Arg) rs80358594
NM_000059.3(BRCA2):c.3479G>A (p.Arg1160Lys) rs183920365
NM_000059.3(BRCA2):c.3485C>T (p.Ala1162Val) rs587778122
NM_000059.3(BRCA2):c.3494A>G (p.His1165Arg) rs587782201
NM_000059.3(BRCA2):c.3539A>G (p.Lys1180Arg) rs28897720
NM_000059.3(BRCA2):c.3562A>G (p.Ile1188Val) rs202230438
NM_000059.3(BRCA2):c.3568C>T (p.Arg1190Trp) rs80358604
NM_000059.3(BRCA2):c.3644G>A (p.Gly1215Glu) rs773442698
NM_000059.3(BRCA2):c.3682A>G (p.Asn1228Asp) rs28897722
NM_000059.3(BRCA2):c.3749A>G (p.Glu1250Gly) rs56400215
NM_000059.3(BRCA2):c.3767A>G (p.His1256Arg) rs80358618
NM_000059.3(BRCA2):c.3814A>G (p.Met1272Val) rs80358624
NM_000059.3(BRCA2):c.4046T>C (p.Ile1349Thr) rs80358654
NM_000059.3(BRCA2):c.4061C>T (p.Thr1354Met) rs80358656
NM_000059.3(BRCA2):c.4090A>C (p.Ile1364Leu) rs56248502
NM_000059.3(BRCA2):c.4178C>T (p.Ala1393Val) rs398122776
NM_000059.3(BRCA2):c.4241C>T (p.Thr1414Met) rs70953664
NM_000059.3(BRCA2):c.4268C>T (p.Thr1423Ile) rs1593901864
NM_000059.3(BRCA2):c.4277C>T (p.Thr1426Ile) rs748591104
NM_000059.3(BRCA2):c.4315G>A (p.Ala1439Thr) rs80358666
NM_000059.3(BRCA2):c.4316C>A (p.Ala1439Asp) rs80358667
NM_000059.3(BRCA2):c.4376A>G (p.Asn1459Ser) rs117187202
NM_000059.3(BRCA2):c.4535G>A (p.Arg1512His) rs80358685
NM_000059.3(BRCA2):c.4570T>G (p.Phe1524Val) rs56386506
NM_000059.3(BRCA2):c.4599A>C (p.Lys1533Asn) rs80358694
NM_000059.3(BRCA2):c.4672A>C (p.Ser1558Arg) rs587782822
NM_000059.3(BRCA2):c.4681C>A (p.His1561Asn) rs2219594
NM_000059.3(BRCA2):c.4686A>G (p.Gln1562=) rs28897730
NM_000059.3(BRCA2):c.4703A>G (p.Lys1568Arg) rs80358699
NM_000059.3(BRCA2):c.475+1G>T rs81002797
NM_000059.3(BRCA2):c.4759G>A (p.Ala1587Thr) rs56137239
NM_000059.3(BRCA2):c.475G>A (p.Val159Met) rs80358702
NM_000059.3(BRCA2):c.4828G>A (p.Val1610Met) rs80358705
NM_000059.3(BRCA2):c.4901T>C (p.Phe1634Ser) rs80358715
NM_000059.3(BRCA2):c.4915G>A (p.Val1639Ile) rs80358716
NM_000059.3(BRCA2):c.4977C>T (p.Ser1659=) rs45484897
NM_000059.3(BRCA2):c.497A>T (p.His166Leu) rs876658364
NM_000059.3(BRCA2):c.4988T>C (p.Val1663Ala) rs1060502436
NM_000059.3(BRCA2):c.5020A>G (p.Ser1674Gly) rs80358725
NM_000059.3(BRCA2):c.502C>A (p.Pro168Thr) rs80358726
NM_000059.3(BRCA2):c.5153A>G (p.Asn1718Ser) rs80358739
NM_000059.3(BRCA2):c.5165G>A (p.Ser1722Asn) rs773707172
NM_000059.3(BRCA2):c.5170A>G (p.Ile1724Val) rs35335654
NM_000059.3(BRCA2):c.5200G>A (p.Glu1734Lys) rs786202543
NM_000059.3(BRCA2):c.521G>A (p.Arg174His) rs80358747
NM_000059.3(BRCA2):c.5365A>G (p.Lys1789Glu) rs587782240
NM_000059.3(BRCA2):c.5378A>G (p.Asn1793Ser) rs80358759
NM_000059.3(BRCA2):c.53G>A (p.Arg18His) rs80358762
NM_000059.3(BRCA2):c.5414A>G (p.Asn1805Ser) rs80358765
NM_000059.3(BRCA2):c.5427C>T (p.Cys1809=) rs80359791
NM_000059.3(BRCA2):c.5428G>A (p.Val1810Ile) rs80358766
NM_000059.3(BRCA2):c.5455C>T (p.Pro1819Ser) rs80358768
NM_000059.3(BRCA2):c.5474C>T (p.Ala1825Val) rs397507352
NM_000059.3(BRCA2):c.5529A>C (p.Ala1843=) rs372951842
NM_000059.3(BRCA2):c.5535G>C (p.Arg1845Ser) rs786201997
NM_000059.3(BRCA2):c.5552T>G (p.Ile1851Ser) rs80358776
NM_000059.3(BRCA2):c.5606G>A (p.Ser1869Asn) rs1555284296
NM_000059.3(BRCA2):c.5651T>C (p.Ile1884Thr) rs80358788
NM_000059.3(BRCA2):c.5659A>G (p.Thr1887Ala) rs786202618
NM_000059.3(BRCA2):c.5663A>G (p.Lys1888Arg) rs80358791
NM_000059.3(BRCA2):c.5681dupA (p.Tyr1894Terfs) rs80359527
NM_000059.3(BRCA2):c.5695G>A (p.Asp1899Asn) rs371189402
NM_000059.3(BRCA2):c.5704G>A (p.Asp1902Asn) rs4987048
NM_000059.3(BRCA2):c.5714A>G (p.His1905Arg) rs80358796
NM_000059.3(BRCA2):c.5723T>C (p.Leu1908Pro) rs80358797
NM_000059.3(BRCA2):c.5728_5730del (p.Asn1910del) rs28897736
NM_000059.3(BRCA2):c.5733T>G (p.Asp1911Glu) rs367823201
NM_000059.3(BRCA2):c.5737T>C (p.Cys1913Arg) rs80358799
NM_000059.3(BRCA2):c.5808G>A (p.Met1936Ile) rs759138390
NM_000059.3(BRCA2):c.5836T>C (p.Ser1946Pro) rs80358811
NM_000059.3(BRCA2):c.5882G>A (p.Ser1961Asn) rs80358820
NM_000059.3(BRCA2):c.5893C>T (p.Leu1965Phe) rs398122542
NM_000059.3(BRCA2):c.5921C>T (p.Thr1974Ile) rs55730620
NM_000059.3(BRCA2):c.5975C>T (p.Ser1992Leu) rs80358830
NM_000059.3(BRCA2):c.599C>T (p.Thr200Ile) rs587781402
NM_000059.3(BRCA2):c.59A>G (p.Asn20Ser) rs398122544
NM_000059.3(BRCA2):c.6101G>A (p.Arg2034His) rs80358849
NM_000059.3(BRCA2):c.6131G>T (p.Gly2044Val) rs56191579
NM_000059.3(BRCA2):c.6225A>C (p.Lys2075Asn) rs80358863
NM_000059.3(BRCA2):c.6269A>G (p.His2090Arg) rs397507366
NM_000059.3(BRCA2):c.6293C>T (p.Ser2098Phe) rs80358867
NM_000059.3(BRCA2):c.632-3C>A rs568027879
NM_000059.3(BRCA2):c.6323G>T (p.Arg2108Leu) rs35029074
NM_000059.3(BRCA2):c.6338A>G (p.Asn2113Ser) rs80358874
NM_000059.3(BRCA2):c.6399_6401del (p.Asn2135del) rs80359581
NM_000059.3(BRCA2):c.6412G>T (p.Val2138Phe) rs11571659
NM_000059.3(BRCA2):c.6458C>T (p.Pro2153Leu) rs276174873
NM_000059.3(BRCA2):c.6461A>C (p.Tyr2154Ser) rs80358882
NM_000059.3(BRCA2):c.6475C>G (p.Gln2159Glu) rs398122558
NM_000059.3(BRCA2):c.6479A>G (p.Gln2160Arg) rs587781610
NM_000059.3(BRCA2):c.6482A>G (p.Asp2161Gly) rs786201744
NM_000059.3(BRCA2):c.6523G>C (p.Glu2175Gln) rs876658412
NM_000059.3(BRCA2):c.6541G>C (p.Gly2181Arg) rs371067421
NM_000059.3(BRCA2):c.6550C>G (p.Gln2184Glu) rs80358887
NM_000059.3(BRCA2):c.6568G>A (p.Val2190Ile) rs80358888
NM_000059.3(BRCA2):c.6613G>A (p.Val2205Met) rs80358889
NM_000059.3(BRCA2):c.6626T>C (p.Ile2209Thr) rs431825344
NM_000059.3(BRCA2):c.6691G>A (p.Ala2231Thr) rs758379999
NM_000059.3(BRCA2):c.67+4T>C rs373546450
NM_000059.3(BRCA2):c.6714T>G (p.Asp2238Glu) rs28897742
NM_000059.3(BRCA2):c.6739A>G (p.Ser2247Gly) rs80358896
NM_000059.3(BRCA2):c.6785T>G (p.Met2262Arg) rs80358904
NM_000059.3(BRCA2):c.68-1G>A rs1060502376
NM_000059.3(BRCA2):c.68-1G>T rs1060502376
NM_000059.3(BRCA2):c.6803G>A (p.Arg2268Lys) rs80358906
NM_000059.3(BRCA2):c.6821G>T (p.Gly2274Val) rs55712212
NM_000059.3(BRCA2):c.6832A>G (p.Ile2278Val) rs772645059
NM_000059.3(BRCA2):c.6886A>C (p.Ile2296Leu) rs576279166
NM_000059.3(BRCA2):c.6892G>A (p.Glu2298Lys) rs80358914
NM_000059.3(BRCA2):c.6935A>T (p.Asp2312Val) rs80358916
NM_000059.3(BRCA2):c.6938-15A>G rs587782358
NM_000059.3(BRCA2):c.7008-2A>T rs81002823
NM_000059.3(BRCA2):c.7051G>A (p.Ala2351Thr) rs80358930
NM_000059.3(BRCA2):c.7052C>G (p.Ala2351Gly) rs80358932
NM_000059.3(BRCA2):c.7121A>G (p.Asn2374Ser) rs1379054137
NM_000059.3(BRCA2):c.7163C>T (p.Thr2388Ile) rs1555286026
NM_000059.3(BRCA2):c.7188G>T (p.Leu2396Phe) rs587780871
NM_000059.3(BRCA2):c.7222C>T (p.Pro2408Ser) rs398122577
NM_000059.3(BRCA2):c.7232A>C (p.Lys2411Thr) rs80358950
NM_000059.3(BRCA2):c.7241C>T (p.Ser2414Leu) rs80358951
NM_000059.3(BRCA2):c.7241_7242inv (p.Ser2414Leu)
NM_000059.3(BRCA2):c.7252A>G (p.Arg2418Gly) rs80358953
NM_000059.3(BRCA2):c.7313A>G (p.Asp2438Gly) rs80358957
NM_000059.3(BRCA2):c.7354A>G (p.Asn2452Asp) rs398122580
NM_000059.3(BRCA2):c.7402G>A (p.Val2468Ile) rs730881553
NM_000059.3(BRCA2):c.7415A>C (p.Lys2472Thr) rs80358963
NM_000059.3(BRCA2):c.7418G>A (p.Cys2473Tyr) rs55924966
NM_000059.3(BRCA2):c.7462A>G (p.Arg2488Gly) rs746057464
NM_000059.3(BRCA2):c.7464A>C (p.Arg2488Ser) rs80358969
NM_000059.3(BRCA2):c.7507G>A (p.Val2503Ile) rs587782191
NM_000059.3(BRCA2):c.750G>A (p.Val250=) rs143214959
NM_000059.3(BRCA2):c.7522G>A (p.Gly2508Ser) rs80358978
NM_000059.3(BRCA2):c.7534C>T (p.Leu2512Phe) rs80358980
NM_000059.3(BRCA2):c.7559G>T (p.Arg2520Leu) rs80358982
NM_000059.3(BRCA2):c.7580T>C (p.Val2527Ala) rs587782676
NM_000059.3(BRCA2):c.7598C>G (p.Ser2533Cys) rs80358987
NM_000059.3(BRCA2):c.7601C>T (p.Ala2534Val) rs74047012
NM_000059.3(BRCA2):c.7618-2A>G rs886040940
NM_000059.3(BRCA2):c.7625C>T (p.Thr2542Met) rs80358989
NM_000059.3(BRCA2):c.7651A>C (p.Lys2551Gln) rs398122587
NM_000059.3(BRCA2):c.7759C>T (p.Leu2587Phe) rs56335340
NM_000059.3(BRCA2):c.7766C>A (p.Pro2589His) rs80359005
NM_000059.3(BRCA2):c.7786G>A (p.Gly2596Arg) rs398122591
NM_000059.3(BRCA2):c.7822C>G (p.Pro2608Ala) rs879255308
NM_000059.3(BRCA2):c.7857G>C (p.Trp2619Cys) rs80359011
NM_000059.3(BRCA2):c.7915C>G (p.Pro2639Ala) rs80359017
NM_000059.3(BRCA2):c.793G>A (p.Gly265Arg) rs1403242422
NM_000059.3(BRCA2):c.7940T>C (p.Leu2647Pro) rs80359021
NM_000059.3(BRCA2):c.7958T>C (p.Leu2653Pro) rs80359022
NM_000059.3(BRCA2):c.7964A>G (p.Gln2655Arg) rs80359024
NM_000059.3(BRCA2):c.7985C>T (p.Thr2662Met) rs431825362
NM_000059.3(BRCA2):c.7993G>T (p.Asp2665Tyr) rs921017191
NM_000059.3(BRCA2):c.79A>G (p.Ile27Val) rs80359034
NM_000059.3(BRCA2):c.8007A>T (p.Arg2669Ser) rs143999963
NM_000059.3(BRCA2):c.8011G>T (p.Ala2671Ser) rs786201976
NM_000059.3(BRCA2):c.8027T>C (p.Met2676Thr) rs80359038
NM_000059.3(BRCA2):c.8036A>G (p.Asp2679Gly) rs80359041
NM_000059.3(BRCA2):c.8057T>C (p.Leu2686Pro) rs28897746
NM_000059.3(BRCA2):c.8063T>C (p.Leu2688Pro) rs80359045
NM_000059.3(BRCA2):c.8084C>T (p.Ser2695Leu) rs80359048
NM_000059.3(BRCA2):c.8111C>T (p.Ser2704Phe) rs80359054
NM_000059.3(BRCA2):c.8113A>G (p.Ser2705Gly) rs756105620
NM_000059.3(BRCA2):c.8115C>G (p.Ser2705Arg) rs587781889
NM_000059.3(BRCA2):c.8162T>A (p.Leu2721His) rs80359061
NM_000059.3(BRCA2):c.8165C>G (p.Thr2722Arg) rs80359062
NM_000059.3(BRCA2):c.8169T>A (p.Asp2723Glu) rs1060502432
NM_000059.3(BRCA2):c.8182G>C (p.Val2728Leu) rs28897749
NM_000059.3(BRCA2):c.8192A>G (p.Gln2731Arg) rs753837544
NM_000059.3(BRCA2):c.8233C>G (p.Leu2745Val) rs786201752
NM_000059.3(BRCA2):c.8299C>T (p.Pro2767Ser) rs587782619
NM_000059.3(BRCA2):c.8303T>A (p.Leu2768His) rs587782732
NM_000059.3(BRCA2):c.8309C>A (p.Ala2770Asp) rs28897750
NM_000059.3(BRCA2):c.8342A>T (p.Asn2781Ile) rs1434821822
NM_000059.3(BRCA2):c.8350C>T (p.Arg2784Trp) rs80359075
NM_000059.3(BRCA2):c.8351G>T (p.Arg2784Leu) rs80359076
NM_000059.3(BRCA2):c.8359C>T (p.Arg2787Cys) rs41293517
NM_000059.3(BRCA2):c.8360G>A (p.Arg2787His) rs80359078
NM_000059.3(BRCA2):c.8378G>A (p.Gly2793Glu) rs80359083
NM_000059.3(BRCA2):c.8382C>G (p.Phe2794Leu) rs80359084
NM_000059.3(BRCA2):c.8386C>T (p.Pro2796Ser) rs146120136
NM_000059.3(BRCA2):c.8417C>T (p.Ser2806Leu) rs587782785
NM_000059.3(BRCA2):c.8420C>T (p.Ser2807Leu) rs55763607
NM_000059.3(BRCA2):c.8435G>A (p.Gly2812Glu) rs80359091
NM_000059.3(BRCA2):c.8447G>A (p.Gly2816Asp) rs56096120
NM_000059.3(BRCA2):c.8450G>T (p.Cys2817Phe) rs786201992
NM_000059.3(BRCA2):c.847A>G (p.Ile283Val) rs80359097
NM_000059.3(BRCA2):c.8487+3A>G rs81002806
NM_000059.3(BRCA2):c.8525G>T (p.Arg2842Leu) rs80359105
NM_000059.3(BRCA2):c.8539G>A (p.Glu2847Lys) rs80359108
NM_000059.3(BRCA2):c.8545A>G (p.Lys2849Glu) rs80359109
NM_000059.3(BRCA2):c.8554G>A (p.Ala2852Thr) rs1555287769
NM_000059.3(BRCA2):c.865A>G (p.Asn289Asp) rs766173
NM_000059.3(BRCA2):c.8687G>A (p.Arg2896His) rs80359128
NM_000059.3(BRCA2):c.8702G>A (p.Gly2901Asp) rs80359129
NM_000059.3(BRCA2):c.8775G>C (p.Gln2925His) rs80359136
NM_000059.3(BRCA2):c.8854A>G (p.Met2952Val) rs397508016
NM_000059.3(BRCA2):c.8866G>C (p.Glu2956Gln) rs142040996
NM_000059.3(BRCA2):c.8893G>C (p.Asp2965His) rs80359141
NM_000059.3(BRCA2):c.8897T>C (p.Val2966Ala) rs876658955
NM_000059.3(BRCA2):c.8954-3C>G rs81002844
NM_000059.3(BRCA2):c.905C>T (p.Thr302Ile) rs80359158
NM_000059.3(BRCA2):c.9082G>C (p.Ala3028Pro) rs80359161
NM_000059.3(BRCA2):c.9085G>A (p.Ala3029Thr) rs56179254
NM_000059.3(BRCA2):c.9098C>T (p.Thr3033Ile) rs431825374
NM_000059.3(BRCA2):c.9104A>G (p.Tyr3035Cys) rs80359165
NM_000059.3(BRCA2):c.9190G>A (p.Asp3064Asn) rs80359177
NM_000059.3(BRCA2):c.9205T>C (p.Cys3069Arg) rs398122611
NM_000059.3(BRCA2):c.9234C>T (p.Val3078=) rs587782428
NM_000059.3(BRCA2):c.9302T>G (p.Leu3101Arg) rs28897758
NM_000059.3(BRCA2):c.9383G>A (p.Arg3128Gln) rs397507427
NM_000059.3(BRCA2):c.9433G>A (p.Val3145Met) rs587776476
NM_000059.3(BRCA2):c.9433G>C (p.Val3145Leu) rs587776476
NM_000059.3(BRCA2):c.943T>A (p.Cys315Ser) rs79483201
NM_000059.3(BRCA2):c.9477C>A (p.Phe3159Leu) rs80359221
NM_000059.3(BRCA2):c.9496G>A (p.Val3166Ile) rs398122615
NM_000059.3(BRCA2):c.9509A>G (p.Asp3170Gly) rs80359224
NM_000059.3(BRCA2):c.9547A>G (p.Ile3183Val) rs377123889
NM_000059.3(BRCA2):c.956A>C (p.Asn319Thr) rs55939572
NM_000059.3(BRCA2):c.9583A>G (p.Thr3195Ala) rs80359227
NM_000059.3(BRCA2):c.9592T>C (p.Cys3198Arg) rs80359229
NM_000059.3(BRCA2):c.9605C>T (p.Pro3202Leu) rs397507432
NM_000059.3(BRCA2):c.9606G>C (p.Pro3202=) rs755890067
NM_000059.3(BRCA2):c.9616C>G (p.Gln3206Glu) rs80359233
NM_000059.3(BRCA2):c.9632C>A (p.Thr3211Lys) rs730881583
NM_000059.3(BRCA2):c.9647T>C (p.Leu3216Pro) rs431825377
NM_000059.3(BRCA2):c.9651G>A (p.Met3217Ile) rs431825379
NM_000059.3(BRCA2):c.9672dup (p.Tyr3225fs) rs80359773
NM_000059.3(BRCA2):c.971G>A (p.Arg324Lys) rs397507435
NM_000059.3(BRCA2):c.9770A>G (p.Lys3257Arg) rs55847618
NM_000059.3(BRCA2):c.9808del (p.Ala3270fs) rs398122622
NM_000059.3(BRCA2):c.9838C>T (p.Pro3280Ser) rs55835607
NM_000059.3(BRCA2):c.9839C>A (p.Pro3280His) rs80359246
NM_000059.3(BRCA2):c.9872C>G (p.Ser3291Cys) rs200210279
NM_000059.3(BRCA2):c.9924C>T (p.Tyr3308=) rs4987049
NM_000059.3(BRCA2):c.9934A>G (p.Ile3312Val) rs80359254
NM_000059.3(BRCA2):c.9952A>C (p.Asn3318His) rs80359256
NM_000059.4(BRCA2):c.10045A>G (p.Thr3349Ala) rs80358387
NM_000059.4(BRCA2):c.10095delinsGAATTATATCT (p.Ser3366fs) rs276174803
NM_000059.4(BRCA2):c.10110G>A (p.Arg3370=) rs28897762
NM_000059.4(BRCA2):c.10121C>T (p.Thr3374Ile) rs56309455
NM_000059.4(BRCA2):c.1012G>A (p.Ala338Thr) rs80358396
NM_000059.4(BRCA2):c.10154G>A (p.Arg3385His) rs80358398
NM_000059.4(BRCA2):c.10202C>T (p.Thr3401Met) rs55853199
NM_000059.4(BRCA2):c.1151C>T (p.Ser384Phe) rs41293475
NM_000059.4(BRCA2):c.125A>G (p.Tyr42Cys) rs4987046
NM_000059.4(BRCA2):c.1385A>G (p.Glu462Gly) rs56403624
NM_000059.4(BRCA2):c.1395A>C (p.Val465=) rs11571641
NM_000059.4(BRCA2):c.1504A>C (p.Lys502Gln) rs276174809
NM_000059.4(BRCA2):c.1514T>C (p.Ile505Thr) rs28897708
NM_000059.4(BRCA2):c.1538A>G (p.Lys513Arg) rs28897709
NM_000059.4(BRCA2):c.1564G>C (p.Gly522Arg) rs80358442
NM_000059.4(BRCA2):c.162CAA[1] (p.Asn56del) rs11571587
NM_000059.4(BRCA2):c.1662T>G (p.Cys554Trp) rs80358451
NM_000059.4(BRCA2):c.1744A>C (p.Thr582Pro) rs80358457
NM_000059.4(BRCA2):c.175C>G (p.Pro59Ala) rs56091799
NM_000059.4(BRCA2):c.1786G>C (p.Asp596His) rs56328701
NM_000059.4(BRCA2):c.1792A>G (p.Thr598Ala) rs28897710
NM_000059.4(BRCA2):c.1798T>C (p.Tyr600His) rs75419644
NM_000059.4(BRCA2):c.179A>G (p.Asn60Ser) rs80358463
NM_000059.4(BRCA2):c.1804G>A (p.Gly602Arg) rs80358466
NM_000059.4(BRCA2):c.1938C>T (p.Ser646=) rs28897711
NM_000059.4(BRCA2):c.1964C>G (p.Pro655Arg) rs28897712
NM_000059.4(BRCA2):c.2123C>A (p.Ser708Tyr) rs1593896146
NM_000059.4(BRCA2):c.2150G>A (p.Cys717Tyr) rs1184992634
NM_000059.4(BRCA2):c.2233A>G (p.Lys745Glu) rs374691587
NM_000059.4(BRCA2):c.223G>C (p.Ala75Pro) rs28897701
NM_000059.4(BRCA2):c.2274T>G (p.Ser758Arg) rs142243359
NM_000059.4(BRCA2):c.2287C>G (p.His763Asp) rs863224585
NM_000059.4(BRCA2):c.2350A>G (p.Met784Val) rs11571653
NM_000059.4(BRCA2):c.241T>A (p.Phe81Ile) rs80358507
NM_000059.4(BRCA2):c.2538A>C (p.Ser846=) rs11571654
NM_000059.4(BRCA2):c.2716A>G (p.Thr906Ala) rs80358528
NM_000059.4(BRCA2):c.2803G>A (p.Asp935Asn) rs28897716
NM_000059.4(BRCA2):c.2857GAG[1] (p.Glu954del) rs80359360
NM_000059.4(BRCA2):c.2883G>A (p.Gln961=) rs11571655
NM_000059.4(BRCA2):c.2918C>T (p.Ser973Leu) rs397507296
NM_000059.4(BRCA2):c.2926_2927delinsAT (p.Ser976Ile) rs276174831
NM_000059.4(BRCA2):c.2957A>G (p.Asn986Ser) rs28897718
NM_000059.4(BRCA2):c.2999T>C (p.Ile1000Thr) rs374769365
NM_000059.4(BRCA2):c.3055C>G (p.Leu1019Val) rs55638633
NM_000059.4(BRCA2):c.3073A>G (p.Lys1025Glu) rs80358550
NM_000059.4(BRCA2):c.3256A>G (p.Ile1086Val) rs80358571
NM_000059.4(BRCA2):c.3264T>C (p.Pro1088=) rs36060526
NM_000059.4(BRCA2):c.3509C>T (p.Ala1170Val) rs80358599
NM_000059.4(BRCA2):c.3516G>A (p.Ser1172=) rs1799952
NM_000059.4(BRCA2):c.3861TAA[1] (p.Asn1288del) rs276174837
NM_000059.4(BRCA2):c.3869G>A (p.Cys1290Tyr) rs41293485
NM_000059.4(BRCA2):c.3910A>G (p.Thr1304Ala) rs28897723
NM_000059.4(BRCA2):c.4068G>A (p.Leu1356=) rs28897724
NM_000059.4(BRCA2):c.4143AGA[1] (p.Glu1382del) rs80359432
NM_000059.4(BRCA2):c.4187A>G (p.Gln1396Arg) rs55969723
NM_000059.4(BRCA2):c.4258G>T (p.Asp1420Tyr) rs28897727
NM_000059.4(BRCA2):c.430GTT[1] (p.Val145del) rs80359442
NM_000059.4(BRCA2):c.440A>G (p.Gln147Arg) rs80358674
NM_000059.4(BRCA2):c.4436G>C (p.Ser1479Thr) rs80358678
NM_000059.4(BRCA2):c.4585G>A (p.Gly1529Arg) rs28897728
NM_000059.4(BRCA2):c.4614T>C (p.Ser1538=) rs45520945
NM_000059.4(BRCA2):c.4795AAT[1] (p.Asn1600del) rs276174851
NM_000059.4(BRCA2):c.4928T>C (p.Val1643Ala) rs28897731
NM_000059.4(BRCA2):c.5070A>C (p.Lys1690Asn) rs56087561
NM_000059.4(BRCA2):c.517-2A>G rs81002858
NM_000059.4(BRCA2):c.5198C>T (p.Ser1733Phe) rs55639415
NM_000059.4(BRCA2):c.5199C>T (p.Ser1733=) rs28897734
NM_000059.4(BRCA2):c.5312G>A (p.Gly1771Asp) rs80358755
NM_000059.4(BRCA2):c.5635G>A (p.Glu1879Lys) rs55996097
NM_000059.4(BRCA2):c.5640T>G (p.Asn1880Lys) rs11571657
NM_000059.4(BRCA2):c.5729A>G (p.Asn1910Ser) rs276174863
NM_000059.4(BRCA2):c.5744C>T (p.Thr1915Met) rs4987117
NM_000059.4(BRCA2):c.5869A>G (p.Ile1957Val) rs80358817
NM_000059.4(BRCA2):c.5885T>C (p.Ile1962Thr) rs1060502377
NM_000059.4(BRCA2):c.5897A>G (p.His1966Arg) rs80358823
NM_000059.4(BRCA2):c.5986G>A (p.Ala1996Thr) rs80358833
NM_000059.4(BRCA2):c.6095C>T (p.Ala2032Val) rs786202701
NM_000059.4(BRCA2):c.6100C>T (p.Arg2034Cys) rs1799954
NM_000059.4(BRCA2):c.6131G>C (p.Gly2044Ala) rs56191579
NM_000059.4(BRCA2):c.6275_6276del rs11571658
NM_000059.4(BRCA2):c.627C>A (p.Leu209=) rs28897704
NM_000059.4(BRCA2):c.62A>G (p.Lys21Arg) rs397507367
NM_000059.4(BRCA2):c.6322C>T (p.Arg2108Cys) rs55794205
NM_000059.4(BRCA2):c.6323G>A (p.Arg2108His) rs35029074
NM_000059.4(BRCA2):c.6347A>G (p.His2116Arg) rs55953736
NM_000059.4(BRCA2):c.6405_6409del (p.Asn2135fs) rs80359584
NM_000059.4(BRCA2):c.6535_6536insA (p.Val2179fs) rs80359601
NM_000059.4(BRCA2):c.6665A>G (p.Tyr2222Cys) rs397507875
NM_000059.4(BRCA2):c.6748A>G (p.Thr2250Ala) rs80358899
NM_000059.4(BRCA2):c.676A>G (p.Thr226Ala) rs80358902
NM_000059.4(BRCA2):c.68-2A>G rs769152395
NM_000059.4(BRCA2):c.7017G>C (p.Lys2339Asn) rs45574331
NM_000059.4(BRCA2):c.7319A>G (p.His2440Arg) rs4986860
NM_000059.4(BRCA2):c.7436-4A>G rs81002904
NM_000059.4(BRCA2):c.7448G>A (p.Ser2483Asn) rs80358967
NM_000059.4(BRCA2):c.7484T>C (p.Ile2495Thr) rs80358974
NM_000059.4(BRCA2):c.7504C>T (p.Arg2502Cys) rs55716624
NM_000059.4(BRCA2):c.7544C>T (p.Thr2515Ile) rs28897744
NM_000059.4(BRCA2):c.7712A>G (p.Glu2571Gly) rs55689095
NM_000059.4(BRCA2):c.7868A>G (p.His2623Arg) rs80359012
NM_000059.4(BRCA2):c.7878G>C (p.Trp2626Cys) rs80359013
NM_000059.4(BRCA2):c.7879A>T (p.Ile2627Phe) rs80359014
NM_000059.4(BRCA2):c.7976+5G>A rs786201180
NM_000059.4(BRCA2):c.7994A>G (p.Asp2665Gly) rs28897745
NM_000059.4(BRCA2):c.8007A>G (p.Arg2669=) rs143999963
NM_000059.4(BRCA2):c.8009C>T (p.Ser2670Leu) rs80359035
NM_000059.4(BRCA2):c.8010G>A (p.Ser2670=) rs146430937
NM_000059.4(BRCA2):c.8117A>G (p.Asn2706Ser) rs80359055
NM_000059.4(BRCA2):c.8149G>T (p.Ala2717Ser) rs28897747
NM_000059.4(BRCA2):c.8182G>A (p.Val2728Ile) rs28897749
NM_000059.4(BRCA2):c.8243G>A (p.Gly2748Asp) rs80359071
NM_000059.4(BRCA2):c.8331+2T>C rs398122602
NM_000059.4(BRCA2):c.8432A>G (p.Asp2811Gly) rs80359090
NM_000059.4(BRCA2):c.8488-1G>A rs397507404
NM_000059.4(BRCA2):c.8503T>C (p.Ser2835Pro) rs11571746
NM_000059.4(BRCA2):c.8524C>T (p.Arg2842Cys) rs80359104
NM_000059.4(BRCA2):c.8525G>A (p.Arg2842His) rs80359105
NM_000059.4(BRCA2):c.8567A>C (p.Glu2856Ala) rs11571747
NM_000059.4(BRCA2):c.8647C>T (p.Pro2883Ser) rs80359122
NM_000059.4(BRCA2):c.8739C>G (p.Asp2913Glu) rs786201996
NM_000059.4(BRCA2):c.8755-1G>A rs81002812
NM_000059.4(BRCA2):c.8850G>T (p.Lys2950Asn) rs28897754
NM_000059.4(BRCA2):c.8905G>A (p.Val2969Met) rs59004709
NM_000059.4(BRCA2):c.8941G>A (p.Glu2981Lys) rs139052578
NM_000059.4(BRCA2):c.9004G>A (p.Glu3002Lys) rs80359152
NM_000059.4(BRCA2):c.9038C>T (p.Thr3013Ile) rs28897755
NM_000059.4(BRCA2):c.9086C>T (p.Ala3029Val) rs80359162
NM_000059.4(BRCA2):c.9116C>T (p.Pro3039Leu) rs80359167
NM_000059.4(BRCA2):c.9271G>A (p.Val3091Ile) rs80359194
NM_000059.4(BRCA2):c.9292T>C (p.Tyr3098His) rs41293521
NM_000059.4(BRCA2):c.9353T>C (p.Met3118Thr) rs56204128
NM_000059.4(BRCA2):c.9442G>T (p.Ala3148Ser) rs949790323
NM_000059.4(BRCA2):c.9458G>C (p.Gly3153Ala) rs80359220
NM_000059.4(BRCA2):c.9472A>G (p.Thr3158Ala) rs786204284
NM_000059.4(BRCA2):c.9501+3A>T rs61757642
NM_000059.4(BRCA2):c.9502-12T>G rs81002803
NM_000059.4(BRCA2):c.964A>C (p.Lys322Gln) rs11571640
NM_000059.4(BRCA2):c.9677A>G (p.Tyr3226Cys) rs80359237
NM_000059.4(BRCA2):c.9699_9702del rs80359775
NM_000059.4(BRCA2):c.9730G>A (p.Val3244Ile) rs11571831
NM_000059.4(BRCA2):c.978C>A (p.Ser326Arg) rs28897706
NM_000059.4(BRCA2):c.9875C>T (p.Pro3292Leu) rs56121817
NM_000071.2(CBS):c.1059G>A (p.Thr353=) rs61735859
NM_000071.2(CBS):c.146C>T (p.Pro49Leu) rs148865119
NM_000071.2(CBS):c.1479G>A (p.Thr493=) rs143225442
NM_000071.2(CBS):c.1539C>T (p.His513=) rs187828882
NM_000071.2(CBS):c.1632C>T (p.Ala544=) rs566810122
NM_000071.2(CBS):c.215A>T (p.Lys72Ile) rs192232907
NM_000071.2(CBS):c.502G>A (p.Val168Met) rs121964970
NM_000071.2(CBS):c.52C>T (p.Arg18Cys) rs201827340
NM_000071.2(CBS):c.675C>T (p.Asn225=) rs145303290
NM_000071.2(CBS):c.939G>A (p.Thr313=) rs2228298
NM_000071.3(CBS):c.1080C>T (p.Ala360=) rs1801181
NM_000071.3(CBS):c.573G>A (p.Thr191=) rs73906420
NM_000075.4(CDK4):c.625C>T (p.Arg209Cys) rs140644696
NM_000077.4(CDKN2A):c.104G>C (p.Gly35Ala) rs746834149
NM_000077.4(CDKN2A):c.146T>C (p.Ile49Thr) rs199907548
NM_000077.4(CDKN2A):c.149A>G (p.Gln50Arg) rs587778189
NM_000077.4(CDKN2A):c.151-4G>C rs529380972
NM_000077.4(CDKN2A):c.168C>T (p.Ser56=) rs771138120
NM_000077.4(CDKN2A):c.170C>T (p.Ala57Val) rs372266620
NM_000077.4(CDKN2A):c.194T>C (p.Leu65Pro) rs1587332314
NM_000077.4(CDKN2A):c.197A>G (p.His66Arg) rs756750256
NM_000077.4(CDKN2A):c.203C>T (p.Ala68Val) rs1060501260
NM_000077.4(CDKN2A):c.206A>G (p.Glu69Gly) rs372670098
NM_000077.4(CDKN2A):c.225C>G (p.Pro75=) rs762397298
NM_000077.4(CDKN2A):c.250G>T (p.Asp84Tyr) rs11552822
NM_000077.4(CDKN2A):c.266G>A (p.Gly89Asp) rs137854599
NM_000077.4(CDKN2A):c.298G>T (p.Ala100Ser) rs200863613
NM_000077.4(CDKN2A):c.315C>A (p.Asp105Glu) rs763269347
NM_000077.4(CDKN2A):c.318G>A (p.Val106=) rs199888003
NM_000077.4(CDKN2A):c.320G>A (p.Arg107His) rs370823171
NM_000077.4(CDKN2A):c.322G>A (p.Asp108Asn) rs121913381
NM_000077.4(CDKN2A):c.339G>A (p.Leu113=) rs575031539
NM_000077.4(CDKN2A):c.370C>T (p.Arg124Cys) rs34170727
NM_000077.4(CDKN2A):c.379G>C (p.Ala127Pro) rs6413464
NM_000077.4(CDKN2A):c.430C>T (p.Arg144Cys) rs116150891
NM_000077.4(CDKN2A):c.434T>C (p.Ile145Thr) rs730881680
NM_000077.4(CDKN2A):c.47T>G (p.Leu16Arg) rs864622263
NM_000077.4(CDKN2A):c.51C>A (p.Ala17=) rs764362225
NM_000077.4(CDKN2A):c.67G>T (p.Gly23Cys) rs1131691186
NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) rs587780668
NM_000086.2(CLN3):c.1210C>A (p.His404Asn) rs146610181
NM_000086.2(CLN3):c.1211A>G (p.His404Arg) rs77595156
NM_000086.2(CLN3):c.174C>T (p.Ala58=) rs138433617
NM_000086.2(CLN3):c.313A>G (p.Ile105Val) rs11552531
NM_000086.2(CLN3):c.318C>T (p.Leu106=) rs148248159
NM_000086.2(CLN3):c.418G>A (p.Val140Ile) rs373034150
NM_000086.2(CLN3):c.831G>A (p.Val277=) rs1142183
NM_000089.3(COL1A2):c.1576G>A (p.Gly526Arg) rs72658129
NM_000090.3(COL3A1):c.114C>G (p.Ser38=) rs141241764
NM_000090.3(COL3A1):c.1188C>T (p.Gly396=) rs745743884
NM_000090.3(COL3A1):c.1232G>A (p.Gly411Glu) rs886038816
NM_000090.3(COL3A1):c.130G>A (p.Val44Ile) rs79632685
NM_000090.3(COL3A1):c.1424C>T (p.Ala475Val) rs770168441
NM_000090.3(COL3A1):c.1476A>C (p.Gly492=) rs111683983
NM_000090.3(COL3A1):c.1804C>A (p.Pro602Thr) rs35795890
NM_000090.3(COL3A1):c.1815+5G>A rs146652498
NM_000090.3(COL3A1):c.1864C>T (p.Pro622Ser) rs772638774
NM_000090.3(COL3A1):c.1927T>C (p.Leu643=) rs41263757
NM_000090.3(COL3A1):c.2002C>T (p.Pro668Ser) rs1801183
NM_000090.3(COL3A1):c.2035G>A (p.Ala679Thr) rs41263773
NM_000090.3(COL3A1):c.2056C>G (p.Pro686Ala) rs41263775
NM_000090.3(COL3A1):c.226A>G (p.Asn76Asp) rs142045411
NM_000090.3(COL3A1):c.2445T>G (p.Pro815=) rs199727625
NM_000090.3(COL3A1):c.2498A>G (p.Lys833Arg) rs371344739
NM_000090.3(COL3A1):c.2607T>A (p.Pro869=) rs376643618
NM_000090.3(COL3A1):c.2805T>C (p.Pro935=) rs111567071
NM_000090.3(COL3A1):c.3019G>A (p.Ala1007Thr) rs201220788
NM_000090.3(COL3A1):c.3228C>T (p.Pro1076=) rs200917999
NM_000090.3(COL3A1):c.3642C>A (p.Gly1214=) rs184402915
NM_000090.3(COL3A1):c.3777T>C (p.Ala1259=) rs34781844
NM_000090.3(COL3A1):c.3818A>G (p.Lys1273Arg) rs144614075
NM_000090.3(COL3A1):c.4086C>T (p.Ser1362=) rs779774302
NM_000090.3(COL3A1):c.674G>C (p.Gly225Ala) rs587779533
NM_000090.3(COL3A1):c.812G>A (p.Arg271Gln) rs112185887
NM_000090.3(COL3A1):c.873C>T (p.Gly291=) rs138569287
NM_000090.4(COL3A1):c.2002C>A (p.Pro668Thr) rs1801183
NM_000090.4(COL3A1):c.3133G>A (p.Ala1045Thr) rs149722210
NM_000090.4(COL3A1):c.3325C>T rs112371422
NM_000090.4(COL3A1):c.3938A>G (p.Lys1313Arg) rs111840783
NM_000093.5(COL5A1):c.1588G>A (p.Gly530Ser) rs61735045
NM_000093.5(COL5A1):c.67CTG[7] (p.Leu28dup) rs773994971
NM_000100.3(CSTB):c.15G>T (p.Ala5=) rs4533
NM_000100.3(CSTB):c.67-3T>C rs6383
NM_000109.4(DMD):c.7547G>A (p.Arg2516His) rs151244052
NM_000116.5(TAFAZZIN):c.873G>A (p.Gly291=) rs35902788
NM_000117.3(EMD):c.144C>T (p.Leu48=) rs200537612
NM_000117.3(EMD):c.396C>T (p.His132=) rs145985318
NM_000138.4(FBN1):c.1027G>A (p.Gly343Arg) rs146726731
NM_000138.4(FBN1):c.1090C>T (p.Arg364Ter) rs794728165
NM_000138.4(FBN1):c.1323A>G (p.Pro441=) rs202030761
NM_000138.4(FBN1):c.1530G>T (p.Ser510=) rs147511977
NM_000138.4(FBN1):c.1A>C (p.Met1Leu) rs730880097
NM_000138.4(FBN1):c.2093C>T (p.Pro698Leu) rs764827921
NM_000138.4(FBN1):c.2127A>C (p.Ala709=) rs886038990
NM_000138.4(FBN1):c.2148A>G (p.Gly716=) rs141039922
NM_000138.4(FBN1):c.2287T>C (p.Cys763Arg) rs1555399361
NM_000138.4(FBN1):c.2581C>T (p.Arg861Ter) rs140583
NM_000138.4(FBN1):c.2639G>A (p.Gly880Asp) rs886038953
NM_000138.4(FBN1):c.266G>A (p.Cys89Tyr) rs112660651
NM_000138.4(FBN1):c.2678-3C>G rs747274959
NM_000138.4(FBN1):c.2723G>A (p.Cys908Tyr) rs1057523406
NM_000138.4(FBN1):c.287G>C (p.Arg96Thr) rs794728291
NM_000138.4(FBN1):c.2934C>G (p.Asp978Glu) rs138438849
NM_000138.4(FBN1):c.3089A>G (p.Asn1030Ser) rs375996640
NM_000138.4(FBN1):c.3344A>G (p.Asp1115Gly) rs794728203
NM_000138.4(FBN1):c.3890A>G (p.Glu1297Gly) rs200342067
NM_000138.4(FBN1):c.4095C>T (p.Asp1365=) rs375402043
NM_000138.4(FBN1):c.4443C>T (p.Ser1481=) rs145040593
NM_000138.4(FBN1):c.4562del (p.Pro1521fs) rs886039035
NM_000138.4(FBN1):c.4930C>T (p.Arg1644Ter) rs140630
NM_000138.4(FBN1):c.4935G>A (p.Val1645=) rs886038897
NM_000138.4(FBN1):c.4998C>G (p.Thr1666=) rs141925790
NM_000138.4(FBN1):c.4998C>T (p.Thr1666=) rs141925790
NM_000138.4(FBN1):c.5371T>C (p.Cys1791Arg) rs1555396427
NM_000138.4(FBN1):c.5372G>A (p.Cys1791Tyr) rs886038848
NM_000138.4(FBN1):c.5423-4G>A rs377036485
NM_000138.4(FBN1):c.5726T>C (p.Ile1909Thr) rs794728333
NM_000138.4(FBN1):c.5964C>T (p.Thr1988=) rs113022801
NM_000138.4(FBN1):c.6032G>A (p.Cys2011Tyr) rs886038967
NM_000138.4(FBN1):c.6164-3C>T rs571365493
NM_000138.4(FBN1):c.6189G>A (p.Ala2063=) rs375624881
NM_000138.4(FBN1):c.6302C>T (p.Thr2101Met) rs200816828
NM_000138.4(FBN1):c.6388G>A (p.Glu2130Lys) rs794728334
NM_000138.4(FBN1):c.6403G>A (p.Asp2135Asn) rs746167150
NM_000138.4(FBN1):c.6904T>A (p.Cys2302Ser) rs886039092
NM_000138.4(FBN1):c.6932G>A (p.Arg2311His) rs141868829
NM_000138.4(FBN1):c.6942C>T (p.Tyr2314=) rs372967546
NM_000138.4(FBN1):c.6987C>G (p.Asp2329Glu) rs363831
NM_000138.4(FBN1):c.7056C>T (p.Ser2352=) rs149697299
NM_000138.4(FBN1):c.7617C>T (p.Gly2539=) rs1388794275
NM_000138.4(FBN1):c.7708G>A (p.Glu2570Lys) rs886038786
NM_000138.4(FBN1):c.7828G>A (p.Glu2610Lys) rs111984349
NM_000138.4(FBN1):c.7902C>T (p.Pro2634=) rs138621371
NM_000138.4(FBN1):c.8326C>T (p.Arg2776Ter) rs137854466
NM_000138.4(FBN1):c.8363C>T (p.Thr2788Met) rs143007898
NM_000138.4(FBN1):c.902G>T (p.Gly301Val) rs142888621
NM_000138.5(FBN1):c.1746C>T (p.Cys582=) rs112366266
NM_000138.5(FBN1):c.1846G>A (p.Glu616Lys) rs397515764
NM_000138.5(FBN1):c.184C>T (p.Arg62Cys) rs25403
NM_000138.5(FBN1):c.2175T>C (p.Asn725=) rs140606
NM_000138.5(FBN1):c.2645C>T rs794728195
NM_000138.5(FBN1):c.2895G>A (p.Glu965=) rs140591
NM_000138.5(FBN1):c.2956G>A (p.Ala986Thr) rs112287730
NM_000138.5(FBN1):c.3058A>G (p.Thr1020Ala) rs111801777
NM_000138.5(FBN1):c.306C>T (p.Cys102=) rs25388
NM_000138.5(FBN1):c.3294C>T (p.Asp1098=) rs140587
NM_000138.5(FBN1):c.3422C>T (p.Pro1141Leu) rs2228241
NM_000138.5(FBN1):c.3423G>A (p.Pro1141=) rs140396599
NM_000138.5(FBN1):c.3509G>A (p.Arg1170His) rs137854475
NM_000138.5(FBN1):c.4270C>G (p.Pro1424Ala) rs201273753
NM_000138.5(FBN1):c.4306G>A (p.Val1436Met) rs377338217
NM_000138.5(FBN1):c.4441A>G (p.Ser1481Gly) rs61730054
NM_000138.5(FBN1):c.4683C>T (p.Ser1561=) rs148024160
NM_000138.5(FBN1):c.4750G>A (p.Glu1584Lys) rs148888513
NM_000138.5(FBN1):c.4905C>G (p.Thr1635=) rs113115949
NM_000138.5(FBN1):c.510C>T (p.Tyr170=) rs111671429
NM_000138.5(FBN1):c.5343G>A (p.Val1781=) rs140649
NM_000138.5(FBN1):c.5959G>C (p.Gly1987Arg) rs727504642
NM_000138.5(FBN1):c.6354C>T (p.Ile2118=) rs112989722
NM_000138.5(FBN1):c.6446A>G (p.Tyr2149Cys) rs113080385
NM_000138.5(FBN1):c.6594C>T (p.Pro2198=) rs111844882
NM_000138.5(FBN1):c.6681A>C (p.Ser2227=) rs363824
NM_000138.5(FBN1):c.6700G>A (p.Val2234Met) rs112084407
NM_000138.5(FBN1):c.6806T>C (p.Ile2269Thr) rs193922228
NM_000138.5(FBN1):c.7039_7040del (p.Met2347fs) rs794728319
NM_000138.5(FBN1):c.7379A>G (p.Lys2460Arg) rs144189837
NM_000138.5(FBN1):c.7540G>A (p.Gly2514Arg) rs363811
NM_000138.5(FBN1):c.7754T>C (p.Ile2585Thr) rs727503054
NM_000138.5(FBN1):c.7950T>C (p.Asn2650=) rs143055643
NM_000138.5(FBN1):c.79G>A (p.Ala27Thr) rs25397
NM_000138.5(FBN1):c.8385C>T (p.Ile2795=) rs138574576
NM_000138.5(FBN1):c.8502T>C (p.Thr2834=) rs363847
NM_000143.3(FH):c.320A>C (p.Asn107Thr) rs121913121
NM_000143.3(FH):c.521C>G (p.Pro174Arg) rs199822819
NM_000144.5(FXN):c.118C>T (p.Arg40Cys) rs145854903
NM_000144.5(FXN):c.179G>A (p.Arg60His) rs141858334
NM_000144.5(FXN):c.226A>G (p.Met76Val) rs59907886
NM_000144.5(FXN):c.54A>G (p.Pro18=) rs2481598
NM_000144.5(FXN):c.626A>G (p.Asp209Gly) rs74621026
NM_000156.6(GAMT):c.189G>C (p.Arg63=) rs568392459
NM_000156.6(GAMT):c.279C>T (p.Asp93=) rs144630886
NM_000156.6(GAMT):c.507_521dup (p.Cys169_Ser173dup) rs779931959
NM_000156.6(GAMT):c.581T>C (p.Val194Ala) rs147739199
NM_000156.6(GAMT):c.626C>T (p.Thr209Met) rs17851582
NM_000156.6(GAMT):c.655G>A (p.Asp219Asn) rs753228876
NM_000156.6(GAMT):c.79T>C (p.Tyr27His) rs200833152
NM_000166.6(GJB1):c.235C>T (p.Leu79=) rs144717157
NM_000167.5(GK):c.1095G>A (p.Ser365=) rs139652893
NM_000167.5(GK):c.730-5A>T rs186543786
NM_000169.2(GLA):c.123C>T (p.Thr41=) rs137902198
NM_000169.3(GLA):c.129C>T (p.Gly43=) rs146177035
NM_000169.3(GLA):c.352C>T (p.Arg118Cys) rs148158093
NM_000169.3(GLA):c.376A>G (p.Ser126Gly) rs149391489
NM_000169.3(GLA):c.427G>A (p.Ala143Thr) rs104894845
NM_000169.3(GLA):c.8T>C (p.Leu3Pro) rs150547672
NM_000169.3(GLA):c.937G>T (p.Asp313Tyr) rs28935490
NM_000169.3(GLA):c.978G>A (p.Lys326=) rs151195362
NM_000179.2(MSH6):c.-8C>T rs565211544
NM_000179.2(MSH6):c.1049C>T (p.Ala350Val) rs587782331
NM_000179.2(MSH6):c.1050C>T (p.Ala350=) rs730881802
NM_000179.2(MSH6):c.1063G>A (p.Gly355Ser) rs587778531
NM_000179.2(MSH6):c.1144C>T (p.His382Tyr) rs587779207
NM_000179.2(MSH6):c.115G>A (p.Gly39Arg) rs751838296
NM_000179.2(MSH6):c.1168G>A (p.Asp390Asn) rs147737737
NM_000179.2(MSH6):c.131C>T (p.Pro44Leu) rs863224615
NM_000179.2(MSH6):c.1364A>C (p.Asn455Thr) rs200938360
NM_000179.2(MSH6):c.1403G>A (p.Arg468His) rs41295268
NM_000179.2(MSH6):c.1508C>G (p.Ser503Cys) rs63750897
NM_000179.2(MSH6):c.1565A>G (p.Gln522Arg) rs63751009
NM_000179.2(MSH6):c.161G>C (p.Gly54Ala) rs63751098
NM_000179.2(MSH6):c.1740G>T (p.Ser580=) rs762089407
NM_000179.2(MSH6):c.1746T>G (p.Phe582Leu) rs201518545
NM_000179.2(MSH6):c.182C>T (p.Ala61Val) rs572336612
NM_000179.2(MSH6):c.1847C>G (p.Ser616Cys) rs772363120
NM_000179.2(MSH6):c.1870G>A (p.Gly624Ser) rs868760377
NM_000179.2(MSH6):c.187T>C (p.Ser63Pro) rs763702846
NM_000179.2(MSH6):c.1937A>G (p.Lys646Arg) rs201096652
NM_000179.2(MSH6):c.194C>T (p.Ser65Leu) rs41294984
NM_000179.2(MSH6):c.2141C>G (p.Ser714Cys) rs730881796
NM_000179.2(MSH6):c.2147C>T (p.Thr716Ile) rs587782805
NM_000179.2(MSH6):c.2171C>G (p.Ala724Gly) rs587779922
NM_000179.2(MSH6):c.2175C>G (p.Ile725Met) rs63750304
NM_000179.2(MSH6):c.2249C>A (p.Thr750Lys) rs730881817
NM_000179.2(MSH6):c.2314C>T (p.Arg772Trp) rs63750138
NM_000179.2(MSH6):c.2319C>T (p.Leu773=) rs63749895
NM_000179.2(MSH6):c.2384T>C (p.Ile795Thr) rs202127474
NM_000179.2(MSH6):c.2413A>G (p.Ile805Val) rs928923556
NM_000179.2(MSH6):c.241G>A (p.Ala81Thr) rs587779239
NM_000179.2(MSH6):c.242C>T (p.Ala81Val) rs587779924
NM_000179.2(MSH6):c.2479A>G (p.Asn827Asp) rs878853716
NM_000179.2(MSH6):c.251C>T (p.Ala84Val) rs878853717
NM_000179.2(MSH6):c.257C>T (p.Thr86Ile) rs768444916
NM_000179.2(MSH6):c.2600T>G (p.Val867Gly) rs139598980
NM_000179.2(MSH6):c.2661T>G (p.Leu887=) rs267608069
NM_000179.2(MSH6):c.2724A>G (p.Glu908=) rs35389622
NM_000179.2(MSH6):c.2780T>C (p.Ile927Thr) rs587779926
NM_000179.2(MSH6):c.2827G>T (p.Asp943Tyr) rs143520357
NM_000179.2(MSH6):c.2857G>A (p.Glu953Lys) rs753034685
NM_000179.2(MSH6):c.3079G>C (p.Val1027Leu) rs876658397
NM_000179.2(MSH6):c.3151G>A (p.Val1051Ile) rs576269342
NM_000179.2(MSH6):c.3172+1G>T rs587779255
NM_000179.2(MSH6):c.3173-10C>T rs587780559
NM_000179.2(MSH6):c.3203G>A (p.Arg1068Gln) rs398123230
NM_000179.2(MSH6):c.3226C>G (p.Arg1076Gly) rs63750617
NM_000179.2(MSH6):c.3227G>A (p.Arg1076His) rs779617676
NM_000179.2(MSH6):c.3265T>C (p.Leu1089=) rs34490141
NM_000179.2(MSH6):c.3283C>T (p.Arg1095Cys) rs376243329
NM_000179.2(MSH6):c.3306T>A (p.Thr1102=) rs2020910
NM_000179.2(MSH6):c.3354G>A (p.Glu1118=) rs35642130
NM_000179.2(MSH6):c.3364C>G (p.Gln1122Glu) rs1060502892
NM_000179.2(MSH6):c.3379_3438+5del rs1553331676
NM_000179.2(MSH6):c.3469G>T (p.Gly1157Cys) rs587779264
NM_000179.2(MSH6):c.3537C>G (p.Ala1179=) rs200120044
NM_000179.2(MSH6):c.3557-4del rs267608102
NM_000179.2(MSH6):c.3557-4dup rs267608102
NM_000179.2(MSH6):c.3605T>C (p.Met1202Thr) rs587779273
NM_000179.2(MSH6):c.364G>A (p.Glu122Lys) rs143036974
NM_000179.2(MSH6):c.3725G>A (p.Arg1242His) rs63750119
NM_000179.2(MSH6):c.3727A>T (p.Thr1243Ser) rs147453999
NM_000179.2(MSH6):c.3729A>G (p.Thr1243=) rs773807182
NM_000179.2(MSH6):c.3832C>A (p.Pro1278Thr) rs587782109
NM_000179.2(MSH6):c.3911G>A (p.Arg1304Lys) rs34625968
NM_000179.2(MSH6):c.3992G>A (p.Arg1331Gln) rs184131049
NM_000179.2(MSH6):c.4053_4081dup (p.Ter1361Leufs)
NM_000179.2(MSH6):c.476C>T (p.Ala159Val) rs587778528
NM_000179.2(MSH6):c.532C>T (p.Arg178Cys) rs730881813
NM_000179.2(MSH6):c.643G>A (p.Val215Ile) rs145959653
NM_000179.2(MSH6):c.660A>C (p.Glu220Asp) rs1800938
NM_000179.2(MSH6):c.905G>A (p.Arg302Lys) rs587781510
NM_000179.2(MSH6):c.926C>G (p.Ser309Cys) rs544222338
NM_000179.2(MSH6):c.942C>G (p.Ser314Arg) rs150440246
NM_000179.2(MSH6):c.956C>T (p.Thr319Met) rs188252826
NM_000179.2(MSH6):c.984C>T (p.Ser328=) rs138143769
NM_000179.3(MSH6):c.1019T>C (p.Phe340Ser) rs61753793
NM_000179.3(MSH6):c.1037C>T (p.Ser346Phe) rs567785169
NM_000179.3(MSH6):c.107C>T (p.Ala36Val) rs61756469
NM_000179.3(MSH6):c.1164C>T (p.His388=) rs55708305
NM_000179.3(MSH6):c.1346T>C (p.Leu449Pro) rs63750741
NM_000179.3(MSH6):c.1474A>G (p.Met492Val) rs61754783
NM_000179.3(MSH6):c.1526T>C (p.Val509Ala) rs63751005
NM_000179.3(MSH6):c.1615CTT[1] (p.Leu540del) rs1064793600
NM_000179.3(MSH6):c.1844G>C (p.Cys615Ser) rs730881793
NM_000179.3(MSH6):c.1875C>T (p.Ser625=) rs63749886
NM_000179.3(MSH6):c.2272C>T (p.Leu758=) rs56371757
NM_000179.3(MSH6):c.2398G>C (p.Val800Leu) rs61748083
NM_000179.3(MSH6):c.2561A>T (p.Lys854Met) rs34374438
NM_000179.3(MSH6):c.3037AAG[1] (p.Lys1014del) rs267608073
NM_000179.3(MSH6):c.3160A>T (p.Ile1054Phe) rs267608075
NM_000179.3(MSH6):c.3246G>T (p.Pro1082=) rs3136351
NM_000179.3(MSH6):c.3259C>T (p.Pro1087Ser) rs63750998
NM_000179.3(MSH6):c.3260C>G (p.Pro1087Arg) rs63750753
NM_000179.3(MSH6):c.3334G>A (p.Asp1112Asn) rs773955368
NM_000179.3(MSH6):c.3482CTG[1] (p.Ala1162del) rs63751427
NM_000179.3(MSH6):c.3804A>G (p.Ala1268=) rs1572746044
NM_000179.3(MSH6):c.3961A>G (p.Arg1321Gly) rs41295278
NM_000179.3(MSH6):c.3999dup (p.Arg1334fs) rs863225418
NM_000179.3(MSH6):c.4001+2TAAC[2] rs267608132
NM_000179.3(MSH6):c.4001+2TAAC[4] rs267608132
NM_000179.3(MSH6):c.4001+4_4001+8dup rs587782853
NM_000179.3(MSH6):c.4001G>A (p.Arg1334Gln) rs267608122
NM_000179.3(MSH6):c.4002-4T>C rs370428032
NM_000179.3(MSH6):c.4068_4071dup (p.Lys1358delinsAspTer) rs55740729
NM_000179.3(MSH6):c.431G>T (p.Ser144Ile) rs3211299
NM_000179.3(MSH6):c.503C>G (p.Ala168Gly) rs774162322
NM_000179.3(MSH6):c.650A>G (p.Asp217Gly) rs554012110
NM_000179.3(MSH6):c.663A>C (p.Glu221Asp) rs41557217
NM_000179.3(MSH6):c.998C>T (p.Thr333Ile) rs587781983
NM_000192.3(TBX5):c.1234G>A (p.Val412Ile) rs114124210
NM_000192.3(TBX5):c.316A>G (p.Ile106Val) rs147710408
NM_000192.3(TBX5):c.331G>T (p.Asp111Tyr) rs77357563
NM_000192.3(TBX5):c.55G>T (p.Ala19Ser) rs200461617
NM_000192.3(TBX5):c.787G>A (p.Val263Met) rs147405081
NM_000192.3(TBX5):c.804C>G (p.Ala268=) rs35110399
NM_000192.3(TBX5):c.827G>A (p.Ser276Asn) rs147977741
NM_000192.3(TBX5):c.836G>A (p.Arg279Gln) rs115178276
NM_000202.8(IDS):c.1074C>G (p.Pro358=) rs61736891
NM_000202.8(IDS):c.123C>G (p.Leu41=) rs146904022
NM_000202.8(IDS):c.754G>A (p.Asp252Asn) rs146458524
NM_000202.8(IDS):c.925A>G (p.Thr309Ala) rs145807417
NM_000214.3(JAG1):c.1146C>T (p.Asn382=) rs200133928
NM_000214.3(JAG1):c.133G>T (p.Val45Leu) rs183974372
NM_000214.3(JAG1):c.1866G>A (p.Thr622=) rs140624746
NM_000214.3(JAG1):c.2043G>A (p.Thr681=) rs151291264
NM_000214.3(JAG1):c.2231G>A (p.Arg744Gln) rs147809756
NM_000214.3(JAG1):c.2286C>T (p.Asn762=) rs144190443
NM_000214.3(JAG1):c.2778C>T (p.Phe926=) rs147793030
NM_000214.3(JAG1):c.2810G>A (p.Arg937Gln) rs145895196
NM_000214.3(JAG1):c.294C>T (p.Ser98=) rs79338570
NM_000214.3(JAG1):c.3555C>T (p.Pro1185=) rs142017684
NM_000214.3(JAG1):c.588C>T (p.Cys196=) rs1801138
NM_000214.3(JAG1):c.765C>T (p.Tyr255=) rs1131695
NM_000214.3(JAG1):c.909T>C (p.His303=) rs139574260
NM_000218.2(KCNQ1):c.160_168dup (p.Ile54_Pro56dup) rs397515877
NM_000218.2(KCNQ1):c.31G>A (p.Glu11Lys) rs959449103
NM_000218.3(KCNQ1):c.-5T>C rs532941548
NM_000218.3(KCNQ1):c.1096C>T (p.Arg366Trp) rs199473411
NM_000218.3(KCNQ1):c.1343C>G (p.Pro448Arg) rs12720449
NM_000218.3(KCNQ1):c.1781G>A (p.Arg594Gln) rs199472815
NM_000218.3(KCNQ1):c.1800G>A (p.Thr600=) rs147091980
NM_000218.3(KCNQ1):c.1860C>T (p.His620=) rs139893266
NM_000218.3(KCNQ1):c.1942G>A (p.Val648Ile) rs34150427
NM_000218.3(KCNQ1):c.1986C>T (p.Tyr662=) rs11601907
NM_000218.3(KCNQ1):c.207G>T (p.Ala69=) rs587781009
NM_000218.3(KCNQ1):c.225T>C (p.Val75=) rs367817352
NM_000218.3(KCNQ1):c.447C>T (p.Ala149=) rs146436765
NM_000218.3(KCNQ1):c.459G>A (p.Thr153=) rs148121889
NM_000218.3(KCNQ1):c.513C>T (p.Tyr171=) rs139042529
NM_000218.3(KCNQ1):c.573_577del (p.Arg192fs) rs397508118
NM_000218.3(KCNQ1):c.811C>T (p.Leu271=) rs189991547
NM_000219.6(KCNE1):c.162C>T (p.Phe54=) rs17173508
NM_000219.6(KCNE1):c.199C>T (p.Arg67Cys) rs199473645
NM_000219.6(KCNE1):c.226G>A (p.Asp76Asn) rs74315445
NM_000219.6(KCNE1):c.253G>A (p.Asp85Asn) rs1805128
NM_000219.6(KCNE1):c.292C>T (p.Arg98Trp) rs199473362
NM_000219.6(KCNE1):c.29C>T (p.Thr10Met) rs144917638
NM_000219.6(KCNE1):c.30G>A (p.Thr10=) rs187686559
NM_000219.6(KCNE1):c.315G>A (p.Ser105=) rs563859144
NM_000219.6(KCNE1):c.374C>T (p.Thr125Met) rs142511345
NM_000219.6(KCNE1):c.84G>A (p.Ser28=) rs17173510
NM_000238.3(KCNH2):c.3125T>C (p.Leu1042Pro) rs886039064
NM_000238.3(KCNH2):c.3140G>T (p.Arg1047Leu) rs36210421
NM_000238.3(KCNH2):c.3153-4C>T rs181119727
NM_000238.3(KCNH2):c.3164G>A (p.Arg1055Gln) rs41307270
NM_000238.4(KCNH2):c.1039C>T (p.Pro347Ser) rs138776684
NM_000238.4(KCNH2):c.1563C>T (p.Ile521=) rs143011005
NM_000238.4(KCNH2):c.1750G>A (p.Gly584Ser) rs199473428
NM_000238.4(KCNH2):c.2254C>T (p.Arg752Trp) rs199472990
NM_000238.4(KCNH2):c.2414T>G (p.Phe805Cys) rs199472999
NM_000238.4(KCNH2):c.2454G>A (p.Ser818=) rs72549418
NM_000238.4(KCNH2):c.2467C>T (p.Arg823Trp) rs199473538
NM_000238.4(KCNH2):c.2674C>T (p.Arg892Cys) rs201627778
NM_000238.4(KCNH2):c.2738C>T (p.Ala913Val) rs77331749
NM_000238.4(KCNH2):c.2771G>A (p.Gly924Glu) rs199473009
NM_000238.4(KCNH2):c.2860C>T (p.Arg954Cys) rs141401803
NM_000238.4(KCNH2):c.2904G>A (p.Pro968=) rs75005975
NM_000238.4(KCNH2):c.3111C>T (p.Asp1037=) rs200799870
NM_000238.4(KCNH2):c.422C>T (p.Pro141Leu) rs199472864
NM_000238.4(KCNH2):c.442C>T (p.Arg148Trp) rs139544114
NM_000238.4(KCNH2):c.551GCGCGGGCG[1] (p.184GAG[1]) rs551056698
NM_000240.3(MAOA):c.1410T>C (p.Asp470=) rs1137070
NM_000240.3(MAOA):c.385A>C (p.Arg129=) rs1800464
NM_000240.3(MAOA):c.825G>A (p.Pro275=) rs138703731
NM_000240.3(MAOA):c.891G>T (p.Arg297=) rs6323
NM_000244.3(MEN1):c.1449C>T (p.Gly483=) rs200280309
NM_000245.4(MET):c.2975C>T (p.Thr992Ile) rs56391007
NM_000245.4(MET):c.71G>A (p.Gly24Glu) rs180985111
NM_000245.4(MET):c.959C>T (p.Ala320Val) rs35776110
NM_000249.3(MLH1):c.1024_1038+1del rs1553648201
NM_000249.3(MLH1):c.1039-6dup rs1553650466
NM_000249.3(MLH1):c.1103C>T (p.Ser368Leu) rs201673334
NM_000249.3(MLH1):c.1136A>C (p.Tyr379Ser) rs143009528
NM_000249.3(MLH1):c.1136A>G (p.Tyr379Cys) rs143009528
NM_000249.3(MLH1):c.1266C>T (p.Gly422=) rs63750791
NM_000249.3(MLH1):c.1318G>A (p.Val440Met) rs864622250
NM_000249.3(MLH1):c.1359G>C (p.Lys453Asn) rs756099600
NM_000249.3(MLH1):c.1410-4G>T rs1057520517
NM_000249.3(MLH1):c.1421G>A (p.Arg474Gln) rs63751083
NM_000249.3(MLH1):c.1460G>A (p.Arg487Gln) rs587778917
NM_000249.3(MLH1):c.1558+4C>T rs531873434
NM_000249.3(MLH1):c.1558+5G>A rs199935667
NM_000249.3(MLH1):c.1569G>T (p.Glu523Asp) rs63751680
NM_000249.3(MLH1):c.1577A>G (p.His526Arg) rs1304802474
NM_000249.3(MLH1):c.1652A>C (p.Asn551Thr) rs63750271
NM_000249.3(MLH1):c.1667+1G>A rs1434898623
NM_000249.3(MLH1):c.1667+4A>G rs983986337
NM_000249.3(MLH1):c.1667G>C (p.Ser556Thr) rs63751596
NM_000249.3(MLH1):c.1709A>G (p.Asn570Ser) rs375853155
NM_000249.3(MLH1):c.1730C>T (p.Ser577Leu) rs56185292
NM_000249.3(MLH1):c.187G>A (p.Asp63Asn) rs63750850
NM_000249.3(MLH1):c.1897-2A>G rs267607871
NM_000249.3(MLH1):c.1963A>G (p.Ile655Val) rs55907433
NM_000249.3(MLH1):c.1964T>C (p.Ile655Thr) rs63751225
NM_000249.3(MLH1):c.1976G>T (p.Arg659Leu) rs63749900
NM_000249.3(MLH1):c.198C>T (p.Thr66=) rs61751642
NM_000249.3(MLH1):c.1990-1G>C rs267607884
NM_000249.3(MLH1):c.207+1G>A rs267607718
NM_000249.3(MLH1):c.208-3C>G rs267607720
NM_000249.3(MLH1):c.2101C>A (p.Gln701Lys) rs63750114
NM_000249.3(MLH1):c.2174G>A (p.Arg725His) rs566928243
NM_000249.3(MLH1):c.2210A>T (p.Asp737Val) rs267607885
NM_000249.3(MLH1):c.2252A>G (p.Lys751Arg) rs140195825
NM_000249.3(MLH1):c.245C>T (p.Thr82Ile) rs63750005
NM_000249.3(MLH1):c.306+3A>G rs267607731
NM_000249.3(MLH1):c.306G>T (p.Glu102Asp) rs63751665
NM_000249.3(MLH1):c.344T>A (p.Ile115Asn) rs764120517
NM_000249.3(MLH1):c.375A>G (p.Ala125=) rs1800144
NM_000249.3(MLH1):c.479C>T (p.Ala160Val) rs63749924
NM_000249.3(MLH1):c.52C>T (p.Arg18Cys) rs367654552
NM_000249.3(MLH1):c.595G>C (p.Glu199Gln) rs63749887
NM_000249.3(MLH1):c.678-2A>G rs587779035
NM_000249.3(MLH1):c.778C>T (p.Leu260Phe) rs63750642
NM_000249.3(MLH1):c.791-2A>G rs267607794
NM_000249.3(MLH1):c.80G>A (p.Arg27Gln) rs138705565
NM_000249.3(MLH1):c.885-5G>T rs267607802
NM_000249.3(MLH1):c.925C>T (p.Pro309Ser) rs267607808
NM_000249.3(MLH1):c.955G>A (p.Glu319Lys) rs63750796
NM_000249.4(MLH1):c.1013A>G (p.Asn338Ser) rs63751467
NM_000249.4(MLH1):c.1039-8T>A rs193922367
NM_000249.4(MLH1):c.1040C>A (p.Thr347Asn) rs201541505
NM_000249.4(MLH1):c.1151T>A (p.Val384Asp) rs63750447
NM_000249.4(MLH1):c.1154G>A (p.Arg385His) rs63750430
NM_000249.4(MLH1):c.1166G>A (p.Arg389Gln) rs63750361
NM_000249.4(MLH1):c.1217G>A (p.Ser406Asn) rs41294980
NM_000249.4(MLH1):c.1268G>A (p.Arg423Lys) rs370687064
NM_000249.4(MLH1):c.1270G>A (p.Ala424Thr) rs377433038
NM_000249.4(MLH1):c.1321G>A (p.Ala441Thr) rs63750365
NM_000249.4(MLH1):c.1360G>C (p.Gly454Arg) rs63750527
NM_000249.4(MLH1):c.1668-1G>A rs267607845
NM_000249.4(MLH1):c.1742C>T (p.Pro581Leu) rs63751684
NM_000249.4(MLH1):c.1852A>G (p.Lys618Glu) rs35001569
NM_000249.4(MLH1):c.1943C>T rs63750610
NM_000249.4(MLH1):c.1959G>T (p.Leu653=) rs1800146
NM_000249.4(MLH1):c.1976G>A (p.Arg659Gln) rs63749900
NM_000249.4(MLH1):c.199G>A (p.Gly67Arg) rs63750206
NM_000249.4(MLH1):c.2059C>T rs63751275
NM_000249.4(MLH1):c.649C>T (p.Arg217Cys) rs4986984
NM_000249.4(MLH1):c.65G>C (p.Gly22Ala) rs41295280
NM_000249.4(MLH1):c.677G>T (p.Arg226Leu) rs63751711
NM_000249.4(MLH1):c.794G>A (p.Arg265His) rs63751448
NM_000249.4(MLH1):c.885-21TC[2] rs267607804
NM_000249.4(MLH1):c.94A>G (p.Ile32Val) rs2020872
NM_000251.2(MSH2):c.1077-1G>C rs267607944
NM_000251.2(MSH2):c.1087G>T (p.Val363Leu) rs377345366
NM_000251.2(MSH2):c.1099G>A (p.Val367Ile) rs80285180
NM_000251.2(MSH2):c.1189C>G (p.Gln397Glu) rs63750611
NM_000251.2(MSH2):c.118G>A (p.Gly40Ser) rs63751260
NM_000251.2(MSH2):c.1217G>A (p.Arg406Gln) rs146567853
NM_000251.2(MSH2):c.1270C>T (p.His424Tyr) rs587782278
NM_000251.2(MSH2):c.1276+1G>A rs267607950
NM_000251.2(MSH2):c.1277-8T>C rs145400590
NM_000251.2(MSH2):c.1319T>C (p.Leu440Pro) rs587779084
NM_000251.2(MSH2):c.1321A>C (p.Thr441Pro) rs587779086
NM_000251.2(MSH2):c.1360A>G (p.Ile454Val) rs587781627
NM_000251.2(MSH2):c.1387-5T>C rs757458333
NM_000251.2(MSH2):c.1461C>G (p.Asp487Glu) rs35107951
NM_000251.2(MSH2):c.1462T>G (p.Leu488Val) rs587781314
NM_000251.2(MSH2):c.1483A>G (p.Thr495Ala) rs730881757
NM_000251.2(MSH2):c.1489A>G (p.Ile497Val) rs755501968
NM_000251.2(MSH2):c.1549G>A (p.Ala517Thr) rs1553366545
NM_000251.2(MSH2):c.1659C>T (p.Asn553=) rs869312796
NM_000251.2(MSH2):c.1666T>C (p.Leu556=) rs61756466
NM_000251.2(MSH2):c.1680T>C (p.Asn560=) rs200056411
NM_000251.2(MSH2):c.1737A>G (p.Lys579=) rs61756467
NM_000251.2(MSH2):c.1748A>G (p.Asn583Ser) rs201118107
NM_000251.2(MSH2):c.1759+1G>A rs587779108
NM_000251.2(MSH2):c.1760-1G>A rs587779110
NM_000251.2(MSH2):c.1760-4A>G rs1060504409
NM_000251.2(MSH2):c.1761C>G (p.Gly587=) rs920449426
NM_000251.2(MSH2):c.182A>C (p.Gln61Pro) rs587779113
NM_000251.2(MSH2):c.1837A>C (p.Asn613His) rs200147804
NM_000251.2(MSH2):c.1871T>G (p.Ile624Ser) rs1114167870
NM_000251.2(MSH2):c.1898T>C (p.Ile633Thr) rs864622093
NM_000251.2(MSH2):c.1945G>A (p.Ala649Thr) rs786201822
NM_000251.2(MSH2):c.1963G>A (p.Val655Ile) rs549467183
NM_000251.2(MSH2):c.1979A>G (p.Asp660Gly) rs1085308057
NM_000251.2(MSH2):c.1A>C (p.Met1Leu) rs267607911
NM_000251.2(MSH2):c.2005+8dup rs267607992
NM_000251.2(MSH2):c.2005G>T (p.Gly669Cys) rs63751668
NM_000251.2(MSH2):c.2060T>C (p.Leu687Pro) rs587779133
NM_000251.2(MSH2):c.2074G>A (p.Gly692Arg) rs63750232
NM_000251.2(MSH2):c.2074G>C (p.Gly692Arg) rs63750232
NM_000251.2(MSH2):c.2105T>A (p.Val702Glu) rs587779137
NM_000251.2(MSH2):c.211G>C (p.Gly71Arg) rs587782659
NM_000251.2(MSH2):c.2154A>G (p.Gln718=) rs63750810
NM_000251.2(MSH2):c.2205C>T (p.Ile735=) rs533553381
NM_000251.2(MSH2):c.2211-10T>A rs267608006
NM_000251.2(MSH2):c.2308A>G (p.Ile770Val) rs63750684
NM_000251.2(MSH2):c.23C>T (p.Thr8Met) rs17217716
NM_000251.2(MSH2):c.2437A>G (p.Met813Val) rs63749841
NM_000251.2(MSH2):c.2439G>A (p.Met813Ile) rs587781678
NM_000251.2(MSH2):c.2457A>G (p.Lys819=) rs774152293
NM_000251.2(MSH2):c.2458+1G>A rs267608010
NM_000251.2(MSH2):c.2516A>G (p.His839Arg) rs63750027
NM_000251.2(MSH2):c.2517T>A (p.His839Gln) rs267608016
NM_000251.2(MSH2):c.2528G>A (p.Cys843Tyr) rs747700106
NM_000251.2(MSH2):c.2615A>G (p.Lys872Arg) rs587780686
NM_000251.2(MSH2):c.2680dup (p.Met894fs) rs876658211
NM_000251.2(MSH2):c.2714C>G (p.Thr905Arg) rs267608022
NM_000251.2(MSH2):c.2714C>T (p.Thr905Ile) rs267608022
NM_000251.2(MSH2):c.2766T>C (p.Phe922=) rs55859129
NM_000251.2(MSH2):c.2801C>A (p.Thr934Lys) rs587779969
NM_000251.2(MSH2):c.2801C>T (p.Thr934Met) rs587779969
NM_000251.2(MSH2):c.317G>C (p.Arg106Thr) rs41295286
NM_000251.2(MSH2):c.366+1G>A rs267607924
NM_000251.2(MSH2):c.409G>C (p.Gly137Arg) rs587781795
NM_000251.2(MSH2):c.499G>C (p.Asp167His) rs63750255
NM_000251.2(MSH2):c.512G>A (p.Arg171Lys) rs63750902
NM_000251.2(MSH2):c.51C>A (p.Val17=) rs397515879
NM_000251.2(MSH2):c.557A>G (p.Asn186Ser) rs151129360
NM_000251.2(MSH2):c.560T>C (p.Leu187Pro) rs63751444
NM_000251.2(MSH2):c.766G>A (p.Ala256Thr) rs377403073
NM_000251.2(MSH2):c.793-1G>A rs863225397
NM_000251.2(MSH2):c.817G>A (p.Val273Ile) rs530814648
NM_000251.2(MSH2):c.835C>G (p.Leu279Val) rs375351205
NM_000251.2(MSH2):c.885C>G (p.Asp295Glu) rs201334592
NM_000251.2(MSH2):c.942+1G>T rs587779193
NM_000251.2(MSH2):c.942+2T>A rs587779195
NM_000251.2(MSH2):c.942+3A>G rs193922376
NM_000251.2(MSH2):c.944G>T (p.Gly315Val) rs202026056
NM_000251.2(MSH2):c.972G>A (p.Gln324=) rs63750505
NM_000251.2(MSH2):c.984C>T (p.Ala328=) rs4987189
NM_000251.3(MSH2):c.1045C>G (p.Pro349Ala) rs267607939
NM_000251.3(MSH2):c.128A>G (p.Tyr43Cys) rs17217723
NM_000251.3(MSH2):c.1313CTC[1] (p.Pro439del) rs587779082
NM_000251.3(MSH2):c.138C>G (p.His46Gln) rs33946261
NM_000251.3(MSH2):c.1774A>G (p.Met592Val) rs371614039
NM_000251.3(MSH2):c.1787A>G (p.Asn596Ser) rs41295288
NM_000251.3(MSH2):c.1847C>G (p.Pro616Arg) rs587779965
NM_000251.3(MSH2):c.2354A>C (p.His785Pro) rs200252727
NM_000251.3(MSH2):c.2503A>C (p.Asn835His) rs41295296
NM_000251.3(MSH2):c.2537A>G (p.Gln846Arg) rs140754514
NM_000251.3(MSH2):c.2579C>T (p.Ser860Leu) rs63750849
NM_000251.3(MSH2):c.382C>G (p.Leu128Val) rs145649774
NM_000251.3(MSH2):c.435T>G (p.Ile145Met) rs63750124
NM_000251.3(MSH2):c.471C>A (p.Gly157=) rs61756463
NM_000251.3(MSH2):c.645+3A>G rs587779168
NM_000256.3(MYBPC3):c.1144C>T (p.Arg382Trp) rs11570076
NM_000256.3(MYBPC3):c.1286C>T (p.Ala429Val) rs370412052
NM_000256.3(MYBPC3):c.1321G>A (p.Glu441Lys) rs193922377
NM_000256.3(MYBPC3):c.13G>C (p.Gly5Arg) rs201278114
NM_000256.3(MYBPC3):c.1484G>A (p.Arg495Gln) rs200411226
NM_000256.3(MYBPC3):c.1504C>T (p.Arg502Trp) rs375882485
NM_000256.3(MYBPC3):c.1519G>A (p.Gly507Arg) rs35736435
NM_000256.3(MYBPC3):c.1564G>A (p.Ala522Thr) rs11570082
NM_000256.3(MYBPC3):c.1591G>A (p.Gly531Arg) rs397515912
NM_000256.3(MYBPC3):c.1602G>A (p.Ala534=) rs370945942
NM_000256.3(MYBPC3):c.1624+4A>T rs397515916
NM_000256.3(MYBPC3):c.1624G>C (p.Glu542Gln) rs121909374
NM_000256.3(MYBPC3):c.1812C>T (p.Asp604=) rs397515929
NM_000256.3(MYBPC3):c.1813G>A (p.Asp605Asn) rs376736293
NM_000256.3(MYBPC3):c.1829A>T (p.Asp610Val) rs730880554
NM_000256.3(MYBPC3):c.1831G>A (p.Glu611Lys) rs730880555
NM_000256.3(MYBPC3):c.2003G>A (p.Arg668His) rs727503191
NM_000256.3(MYBPC3):c.2179G>A (p.Val727Met) rs564378953
NM_000256.3(MYBPC3):c.2429G>A (p.Arg810His) rs375675796
NM_000256.3(MYBPC3):c.2487G>T (p.Leu829=) rs201040413
NM_000256.3(MYBPC3):c.2497G>A (p.Ala833Thr) rs199865688
NM_000256.3(MYBPC3):c.2686G>A (p.Val896Met) rs35078470
NM_000256.3(MYBPC3):c.2737+5G>A rs398123280
NM_000256.3(MYBPC3):c.2870C>G (p.Thr957Ser) rs193922380
NM_000256.3(MYBPC3):c.2873C>T (p.Thr958Ile) rs376504548
NM_000256.3(MYBPC3):c.2905+1G>A rs397515991
NM_000256.3(MYBPC3):c.2961C>T (p.Val987=) rs761700877
NM_000256.3(MYBPC3):c.2992C>G (p.Gln998Glu) rs11570112
NM_000256.3(MYBPC3):c.2997C>T (p.Gly999=) rs377283955
NM_000256.3(MYBPC3):c.3004C>T (p.Arg1002Trp) rs3729799
NM_000256.3(MYBPC3):c.3102C>T (p.Ala1034=) rs200663253
NM_000256.3(MYBPC3):c.3106C>T (p.Arg1036Cys) rs61729664
NM_000256.3(MYBPC3):c.3190+5G>A rs587782958
NM_000256.3(MYBPC3):c.3276C>T (p.Val1092=) rs376344765
NM_000256.3(MYBPC3):c.3279C>T (p.Gly1093=) rs36212064
NM_000256.3(MYBPC3):c.3285G>A (p.Thr1095=) rs367927327
NM_000256.3(MYBPC3):c.3330+5G>C rs373746463
NM_000256.3(MYBPC3):c.3330+5G>T rs373746463
NM_000256.3(MYBPC3):c.3392T>C (p.Ile1131Thr) rs370890951
NM_000256.3(MYBPC3):c.3657G>T (p.Leu1219=) rs770157084
NM_000256.3(MYBPC3):c.3682C>T (p.Arg1228Cys) rs201312636
NM_000256.3(MYBPC3):c.3699G>A (p.Gln1233=) rs200162906
NM_000256.3(MYBPC3):c.373_374del (p.Ala124_Ala125insTer) rs1057517767
NM_000256.3(MYBPC3):c.3742_3759dup (p.Gly1248_Cys1253dup) rs193922384
NM_000256.3(MYBPC3):c.3815-1G>A rs397516044
NM_000256.3(MYBPC3):c.450C>T (p.Pro150=) rs377520770
NM_000256.3(MYBPC3):c.471C>T (p.Phe157=) rs150291001
NM_000256.3(MYBPC3):c.478C>T (p.Arg160Trp) rs193068692
NM_000256.3(MYBPC3):c.481C>A (p.Pro161Thr) rs397516053
NM_000256.3(MYBPC3):c.530G>A (p.Arg177His) rs201012766
NM_000256.3(MYBPC3):c.531C>T (p.Arg177=) rs368035400
NM_000256.3(MYBPC3):c.604A>C (p.Lys202Gln) rs730880623
NM_000256.3(MYBPC3):c.646G>A (p.Ala216Thr) rs201098973
NM_000256.3(MYBPC3):c.649A>G (p.Ser217Gly) rs138753870
NM_000256.3(MYBPC3):c.655G>C (p.Val219Leu) rs397516068
NM_000256.3(MYBPC3):c.709T>C (p.Tyr237His) rs730880624
NM_000256.3(MYBPC3):c.721G>C (p.Val241Leu) rs886039000
NM_000256.3(MYBPC3):c.799C>G (p.Leu267Val) rs370941975
NM_000256.3(MYBPC3):c.821+1G>A rs397516073
NM_000256.3(MYBPC3):c.833del (p.Gly278fs) rs727503212
NM_000256.3(MYBPC3):c.933G>C (p.Ser311=) rs374326087
NM_000256.3(MYBPC3):c.977G>A (p.Arg326Gln) rs34580776
NM_000256.3(MYBPC3):c.999C>T (p.Tyr333=) rs367947846
NM_000257.4(MYH7):c.1002C>T (p.Asn334=) rs34803781
NM_000257.4(MYH7):c.1062C>T (p.Gly354=) rs735712
NM_000257.4(MYH7):c.1119G>A (p.Ala373=) rs572672362
NM_000257.4(MYH7):c.1191G>A (p.Lys397=) rs139506719
NM_000257.4(MYH7):c.1230C>T (p.Tyr410=) rs150885220
NM_000257.4(MYH7):c.1231G>A (p.Val411Ile) rs730880868
NM_000257.4(MYH7):c.1301G>A (p.Arg434Lys) rs786205356
NM_000257.4(MYH7):c.1324C>T (p.Arg442Cys) rs148808089
NM_000257.4(MYH7):c.1370T>C (p.Ile457Thr) rs397516103
NM_000257.4(MYH7):c.153C>T (p.Ile51=) rs373145667
NM_000257.4(MYH7):c.1632C>T (p.Thr544=) rs587781089
NM_000257.4(MYH7):c.1681G>A (p.Ala561Thr) rs730880878
NM_000257.4(MYH7):c.1750G>A (p.Gly584Ser) rs121913626
NM_000257.4(MYH7):c.1767C>T (p.Asn589=) rs3729816
NM_000257.4(MYH7):c.189C>T (p.Thr63=) rs2069540
NM_000257.4(MYH7):c.2011C>T (p.Arg671Cys) rs727503263
NM_000257.4(MYH7):c.2080C>T (p.Arg694Cys) rs727504240
NM_000257.4(MYH7):c.2091T>C (p.Gly697=) rs140380523
NM_000257.4(MYH7):c.2156G>A (p.Arg719Gln) rs121913641
NM_000257.4(MYH7):c.2162+4G>A rs145738465
NM_000257.4(MYH7):c.2207T>C (p.Ile736Thr) rs727503261
NM_000257.4(MYH7):c.2221G>T (p.Gly741Trp) rs121913632
NM_000257.4(MYH7):c.2302G>A (p.Gly768Arg) rs727503260
NM_000257.4(MYH7):c.2332G>A (p.Asp778Asn) rs730880895
NM_000257.4(MYH7):c.2334C>T (p.Asp778=) rs2069544
NM_000257.4(MYH7):c.2348G>A (p.Arg783His) rs397516142
NM_000257.4(MYH7):c.2358G>T (p.Thr786=) rs36211714
NM_000257.4(MYH7):c.2360G>A (p.Arg787His) rs376754645
NM_000257.4(MYH7):c.2526T>C (p.Ser842=) rs554560162
NM_000257.4(MYH7):c.2536G>C (p.Glu846Gln) rs730880748
NM_000257.4(MYH7):c.2602G>C (p.Ala868Pro) rs727504356
NM_000257.4(MYH7):c.261C>T (p.Ile87=) rs148560996
NM_000257.4(MYH7):c.2681A>G (p.Glu894Gly) rs397516161
NM_000257.4(MYH7):c.2769C>T (p.Asn923=) rs36211716
NM_000257.4(MYH7):c.2770G>A (p.Glu924Lys) rs121913628
NM_000257.4(MYH7):c.2782G>A (p.Asp928Asn) rs727503252
NM_000257.4(MYH7):c.2788G>A (p.Glu930Lys) rs397516171
NM_000257.4(MYH7):c.2890G>C (p.Val964Leu) rs45496496
NM_000257.4(MYH7):c.2907C>T (p.His969=) rs142573531
NM_000257.4(MYH7):c.2967T>C (p.Ile989=) rs7157716
NM_000257.4(MYH7):c.3020T>C (p.Leu1007Pro) rs730880763
NM_000257.4(MYH7):c.3036C>T (p.Ala1012=) rs145379951
NM_000257.4(MYH7):c.3153G>A (p.Ala1051=) rs45540831
NM_000257.4(MYH7):c.3158G>A (p.Arg1053Gln) rs587782962
NM_000257.4(MYH7):c.327C>T (p.Tyr109=) rs36211408
NM_000257.4(MYH7):c.3337-4dup rs45504498
NM_000257.4(MYH7):c.3351G>A (p.Glu1117=) rs45554236
NM_000257.4(MYH7):c.3621C>G (p.Ile1207Met) rs529700838
NM_000257.4(MYH7):c.3682C>T (p.Leu1228=) rs560995739
NM_000257.4(MYH7):c.3770A>G (p.Asn1257Ser) rs574005462
NM_000257.4(MYH7):c.3918C>T (p.Leu1306=) rs144420313
NM_000257.4(MYH7):c.3981C>A (p.Asn1327Lys) rs141764279
NM_000257.4(MYH7):c.4005G>A (p.Ser1335=) rs144465613
NM_000257.4(MYH7):c.4066G>A (p.Glu1356Lys) rs727503246
NM_000257.4(MYH7):c.4130C>T (p.Thr1377Met) rs397516201
NM_000257.4(MYH7):c.4145G>A (p.Arg1382Gln) rs727504325
NM_000257.4(MYH7):c.4158C>T (p.Leu1386=) rs886050418
NM_000257.4(MYH7):c.4188G>A (p.Arg1396=) rs200852418
NM_000257.4(MYH7):c.4239G>A (p.Ser1413=) rs3729821
NM_000257.4(MYH7):c.4276G>A (p.Glu1426Lys) rs397516208
NM_000257.4(MYH7):c.4377G>T (p.Lys1459Asn) rs201307101
NM_000257.4(MYH7):c.4402G>A (p.Glu1468Lys) rs876657884
NM_000257.4(MYH7):c.4472C>G (p.Ser1491Cys) rs3729823
NM_000257.4(MYH7):c.4499G>A (p.Arg1500Gln) rs121913647
NM_000257.4(MYH7):c.4566T>C (p.Thr1522=) rs2754155
NM_000257.4(MYH7):c.4588C>T (p.Arg1530Ter) rs397516225
NM_000257.4(MYH7):c.4716C>T (p.Ile1572=) rs7140196
NM_000257.4(MYH7):c.4806C>T (p.Asp1602=) rs142034311
NM_000257.4(MYH7):c.4909G>A (p.Ala1637Thr) rs141122361
NM_000257.4(MYH7):c.5135G>A (p.Arg1712Gln) rs193922390
NM_000257.4(MYH7):c.5139G>A (p.Val1713=) rs369562442
NM_000257.4(MYH7):c.540C>A (p.Ser180=) rs369490861
NM_000257.4(MYH7):c.5562G>A (p.Thr1854=) rs368706722
NM_000257.4(MYH7):c.5736C>T (p.Ile1912=) rs200728597
NM_000257.4(MYH7):c.597A>G (p.Ala199=) rs2069541
NM_000257.4(MYH7):c.709C>T (p.Arg237Trp) rs45516091
NM_000257.4(MYH7):c.714C>T (p.Asn238=) rs202141819
NM_000257.4(MYH7):c.732C>T (p.Phe244=) rs2069542
NM_000257.4(MYH7):c.740T>G (p.Phe247Cys) rs730880922
NM_000257.4(MYH7):c.758G>T (p.Gly253Val) rs730880853
NM_000257.4(MYH7):c.77C>T (p.Ala26Val) rs186964570
NM_000257.4(MYH7):c.930T>C (p.Tyr310=) rs111626355
NM_000257.4(MYH7):c.957C>T (p.Thr319=) rs368699342
NM_000257.4(MYH7):c.975C>T (p.Asp325=) rs2231124
NM_000258.3(MYL3):c.170C>A (p.Ala57Asp) rs139794067
NM_000258.3(MYL3):c.170C>G (p.Ala57Gly) rs139794067
NM_000258.3(MYL3):c.427G>A (p.Glu143Lys) rs104893750
NM_000258.3(MYL3):c.477G>T (p.Thr159=) rs148365503
NM_000258.3(MYL3):c.81T>C (p.Pro27=) rs147584015
NM_000266.4(NDP):c.101C>T (p.Ser34Leu) rs144031424
NM_000267.3(NF1):c.1166A>G (p.His389Arg) rs149739570
NM_000276.4(OCRL):c.105G>A (p.Arg35=) rs142321728
NM_000276.4(OCRL):c.41C>T (p.Thr14Ile) rs61752970
NM_000276.4(OCRL):c.439+3A>G rs61752971
NM_000284.4(PDHA1):c.795A>G (p.Ala265=) rs1126565
NM_000284.4(PDHA1):c.97G>C (p.Asp33His) rs150318528
NM_000302.4(PLOD1):c.1098-3C>T rs541901674
NM_000302.4(PLOD1):c.1203-3C>T rs376288573
NM_000302.4(PLOD1):c.1495C>T (p.Arg499Trp) rs149124387
NM_000302.4(PLOD1):c.1534C>T (p.Arg512Cys) rs138490756
NM_000302.4(PLOD1):c.1927G>A (p.Val643Ile) rs149425237
NM_000302.4(PLOD1):c.509A>T (p.Glu170Val) rs554232128
NM_000302.4(PLOD1):c.555G>T (p.Lys185Asn) rs142978362
NM_000310.3(PPT1):c.401T>C (p.Ile134Thr) rs1800205
NM_000310.3(PPT1):c.627+4A>G rs572153728
NM_000310.3(PPT1):c.837G>C (p.Gln279His) rs72937434
NM_000310.3(PPT1):c.904A>G (p.Ile302Val) rs146902902
NM_000310.4(PPT1):c.363-4G>A rs117284255
NM_000314.7(PTEN):c.1027-2A>G rs1085308041
NM_000314.7(PTEN):c.253+4_253+7del rs876659695
NM_000314.8(PTEN):c.235G>A (p.Ala79Thr) rs202004587
NM_000314.8(PTEN):c.389G>T rs121909229
NM_000335.4(SCN5A):c.1714_1715delinsTT (p.Ala572Phe) rs730880211
NM_000335.4(SCN5A):c.2533del (p.Val845fs) rs794728912
NM_000335.4(SCN5A):c.3919C>T (p.Leu1307Phe) rs41313031
NM_000335.4(SCN5A):c.5461_5464del (p.Glu1822fs) rs794728924
NM_000335.4(SCN5A):c.673C>T (p.Arg225Trp) rs199473072
NM_000335.4(SCN5A):c.694G>A (p.Val232Ile) rs45471994
NM_000335.5(SCN5A):c.1044C>T (p.Pro348=) rs370346797
NM_000335.5(SCN5A):c.1068T>C (p.Asp356=) rs41313703
NM_000335.5(SCN5A):c.1236C>T (p.Val412=) rs45565936
NM_000335.5(SCN5A):c.1336G>A (p.Glu446Lys) rs199473339
NM_000335.5(SCN5A):c.1441C>T (p.Arg481Trp) rs144511230
NM_000335.5(SCN5A):c.1569T>A (p.Arg523=) rs41313693
NM_000335.5(SCN5A):c.1587T>C (p.Ile529=) rs45624133
NM_000335.5(SCN5A):c.1681C>T (p.Leu561=) rs45522138
NM_000335.5(SCN5A):c.1715C>A (p.Ala572Asp) rs36210423
NM_000335.5(SCN5A):c.1743G>A (p.Ser581=) rs41313687
NM_000335.5(SCN5A):c.1844G>A (p.Gly615Glu) rs12720452
NM_000335.5(SCN5A):c.1852C>T (p.Leu618Phe) rs45488304
NM_000335.5(SCN5A):c.1890G>A (p.Thr630=) rs1204915217
NM_000335.5(SCN5A):c.2013C>T (p.Ser671=) rs751050999
NM_000335.5(SCN5A):c.2074C>A (p.Gln692Lys) rs45553235
NM_000335.5(SCN5A):c.2437-5C>A rs72549411
NM_000335.5(SCN5A):c.2441G>A (p.Arg814Gln) rs199473584
NM_000335.5(SCN5A):c.3246C>T (p.Ser1082=) rs111422496
NM_000335.5(SCN5A):c.3266C>T (p.Pro1089Leu) rs1805125
NM_000335.5(SCN5A):c.3305C>A (p.Ser1102Tyr) rs7626962
NM_000335.5(SCN5A):c.3360G>A (p.Ala1120=) rs9858585
NM_000335.5(SCN5A):c.3575G>A (p.Arg1192Gln) rs41261344
NM_000335.5(SCN5A):c.3618C>T (p.Phe1206=) rs184934308
NM_000335.5(SCN5A):c.3748G>A (p.Val1250Met) rs199473600
NM_000335.5(SCN5A):c.3870G>A (p.Leu1290=) rs41313033
NM_000335.5(SCN5A):c.4215G>A (p.Gly1405=) rs41311123
NM_000335.5(SCN5A):c.4299T>C (p.Tyr1433=) rs200556220
NM_000335.5(SCN5A):c.4506C>T (p.Ser1502=) rs45548237
NM_000335.5(SCN5A):c.486C>T (p.Tyr162=) rs45489099
NM_000335.5(SCN5A):c.5199C>T (p.Asn1733=) rs368980118
NM_000335.5(SCN5A):c.52C>T (p.Arg18Trp) rs199473044
NM_000335.5(SCN5A):c.5357G>A (p.Ser1786Asn) rs199473316
NM_000335.5(SCN5A):c.5708C>T (p.Ser1903Leu) rs150264233
NM_000335.5(SCN5A):c.5793G>A (p.Ala1931=) rs200594132
NM_000335.5(SCN5A):c.5799C>T (p.Ser1933=) rs375254452
NM_000335.5(SCN5A):c.5848G>T (p.Val1950Leu) rs41315493
NM_000335.5(SCN5A):c.5882C>T (p.Pro1961Leu) rs199473638
NM_000335.5(SCN5A):c.6007T>C (p.Phe2003Leu) rs41311117
NM_000335.5(SCN5A):c.6013C>G (p.Pro2005Ala) rs45489199
NM_000335.5(SCN5A):c.630G>A (p.Val210=) rs193922727
NM_000335.5(SCN5A):c.647C>T (p.Ser216Leu) rs41276525
NM_000335.5(SCN5A):c.659C>T (p.Thr220Ile) rs45620037
NM_000335.5(SCN5A):c.717C>T (p.Ile239=) rs41285129
NM_000335.5(SCN5A):c.856G>T (p.Ala286Ser) rs61746118
NM_000337.5(SGCD):c.290G>A (p.Arg97Gln) rs45559835
NM_000337.5(SGCD):c.402T>C (p.Ala134=) rs190935424
NM_000337.5(SGCD):c.507G>A (p.Ala169=) rs10071079
NM_000337.5(SGCD):c.510G>A (p.Glu170=) rs368838376
NM_000363.5(TNNI3):c.198G>A (p.Glu66=) rs3729710
NM_000363.5(TNNI3):c.235C>T (p.Arg79Cys) rs3729712
NM_000363.5(TNNI3):c.244C>T (p.Pro82Ser) rs77615401
NM_000363.5(TNNI3):c.25-4C>T rs202086705
NM_000363.5(TNNI3):c.434G>A (p.Arg145Gln) rs397516349
NM_000363.5(TNNI3):c.485G>A (p.Arg162Gln) rs397516354
NM_000363.5(TNNI3):c.523C>T (p.Gln175Ter) rs876661394
NM_000368.4(TSC1):c.1218C>T (p.Tyr406=) rs373465241
NM_000368.4(TSC1):c.2115G>A (p.Glu705=) rs142662480
NM_000368.4(TSC1):c.2932C>G (p.Leu978Val) rs397514859
NM_000368.4(TSC1):c.782A>G (p.Lys261Arg) rs371225009
NM_000371.3(TTR):c.437A>G (p.Lys146Arg) rs536294863
NM_000371.4(TTR):c.14G>A (p.Arg5His) rs138657343
NM_000371.4(TTR):c.328C>A (p.His110Asn) rs121918074
NM_000371.4(TTR):c.354C>T (p.Asn118=) rs11541797
NM_000371.4(TTR):c.371G>A (p.Arg124His) rs121918095
NM_000371.4(TTR):c.416C>T (p.Thr139Met) rs28933981
NM_000371.4(TTR):c.417G>A (p.Thr139=) rs2276382
NM_000381.4(MID1):c.1230C>T (p.Ser410=) rs16986145
NM_000381.4(MID1):c.1698A>G (p.Glu566=) rs34554583
NM_000381.4(MID1):c.250G>A (p.Asp84Asn) rs374851071
NM_000381.4(MID1):c.588C>G (p.Ala196=) rs41303167
NM_000391.4(TPP1):c.1015C>T (p.Arg339Trp) rs750428882
NM_000391.4(TPP1):c.1044C>T (p.Ala348=) rs35706972
NM_000391.4(TPP1):c.1058C>A (p.Thr353Asn) rs145966505
NM_000391.4(TPP1):c.122C>T (p.Ala41Val) rs768795654
NM_000391.4(TPP1):c.1253G>A (p.Arg418Gln) rs138744051
NM_000391.4(TPP1):c.1266+5G>A rs1800753
NM_000391.4(TPP1):c.1494C>T (p.Pro498=) rs117942457
NM_000391.4(TPP1):c.1497T>C (p.Pro499=) rs142672910
NM_000391.4(TPP1):c.14C>A (p.Ala5Asp) rs138976576
NM_000391.4(TPP1):c.1542A>T (p.Gly514=) rs1128396
NM_000391.4(TPP1):c.260A>G (p.Asp87Gly) rs148064565
NM_000391.4(TPP1):c.293C>T (p.Thr98Met) rs140726254
NM_000391.4(TPP1):c.299A>G (p.Gln100Arg) rs1800746
NM_000391.4(TPP1):c.441A>G (p.Glu147=) rs2555170
NM_000391.4(TPP1):c.542C>T (p.Ser181Phe) rs139059149
NM_000391.4(TPP1):c.83G>A (p.Arg28Gln) rs369126677
NM_000391.4(TPP1):c.840G>C (p.Leu280=) rs140349036
NM_000393.5(COL5A2):c.1017A>C (p.Gly339=) rs140609193
NM_000393.5(COL5A2):c.1035G>C (p.Gly345=) rs148786600
NM_000393.5(COL5A2):c.1081A>C (p.Met361Leu) rs76148000
NM_000393.5(COL5A2):c.1182G>A (p.Ala394=) rs148229627
NM_000393.5(COL5A2):c.1301C>T (p.Thr434Met) rs145850743
NM_000393.5(COL5A2):c.1378C>T (p.Pro460Ser) rs35830636
NM_000393.5(COL5A2):c.1400C>T (p.Pro467Leu) rs115570272
NM_000393.5(COL5A2):c.1535T>C (p.Val512Ala) rs35852101
NM_000393.5(COL5A2):c.1976C>T (p.Pro659Leu) rs145404046
NM_000393.5(COL5A2):c.198T>C (p.Asn66=) rs76511879
NM_000393.5(COL5A2):c.2291C>G (p.Pro764Arg) rs150260969
NM_000393.5(COL5A2):c.2392-4A>G rs758314268
NM_000393.5(COL5A2):c.2492G>C (p.Gly831Ala) rs141210030
NM_000393.5(COL5A2):c.2498C>T (p.Pro833Leu) rs116298748
NM_000393.5(COL5A2):c.249C>T (p.Ala83=) rs142388534
NM_000393.5(COL5A2):c.2544C>T (p.Ala848=) rs370774253
NM_000393.5(COL5A2):c.2562C>T (p.Asp854=) rs148430780
NM_000393.5(COL5A2):c.261G>A (p.Thr87=) rs142044596
NM_000393.5(COL5A2):c.2884C>A (p.Pro962Thr) rs754018138
NM_000393.5(COL5A2):c.2988C>T (p.Gly996=) rs201299226
NM_000393.5(COL5A2):c.3098C>T (p.Pro1033Leu) rs75542756
NM_000393.5(COL5A2):c.3316C>T (p.Arg1106Trp) rs146789395
NM_000393.5(COL5A2):c.33C>T (p.Leu11=) rs140108893
NM_000393.5(COL5A2):c.3689C>G (p.Thr1230Arg) rs62184175
NM_000393.5(COL5A2):c.3690A>C (p.Thr1230=) rs10197596
NM_000393.5(COL5A2):c.3720T>C (p.Tyr1240=) rs10208525
NM_000393.5(COL5A2):c.3837T>C (p.Ile1279=) rs148795690
NM_000393.5(COL5A2):c.403-3T>C rs369733690
NM_000393.5(COL5A2):c.4173C>G (p.Arg1391=) rs148590409
NM_000393.5(COL5A2):c.4197G>A (p.Gln1399=) rs78870279
NM_000393.5(COL5A2):c.4240G>A (p.Asp1414Asn) rs139229616
NM_000393.5(COL5A2):c.4389A>G (p.Glu1463=) rs146100075
NM_000393.5(COL5A2):c.4392T>C (p.Tyr1464=) rs142544320
NM_000393.5(COL5A2):c.4449C>T (p.Gly1483=) rs78905646
NM_000393.5(COL5A2):c.4450G>A (p.Gly1484Ser) rs147420365
NM_000393.5(COL5A2):c.4495G>T (p.Val1499Leu) rs527433112
NM_000393.5(COL5A2):c.75A>G (p.Lys25=) rs549894501
NM_000393.5(COL5A2):c.975C>T (p.Pro325=) rs144344474
NM_000432.4(MYL2):c.141C>A (p.Asn47Lys) rs199474808
NM_000432.4(MYL2):c.173G>A (p.Arg58Gln) rs104894369
NM_000432.4(MYL2):c.243G>T (p.Val81=) rs368851472
NM_000432.4(MYL2):c.279G>A (p.Ala93=) rs28645088
NM_000432.4(MYL2):c.36C>T (p.Gly12=) rs139794370
NM_000432.4(MYL2):c.37G>A (p.Ala13Thr) rs104894363
NM_000432.4(MYL2):c.401A>C (p.Glu134Ala) rs143139258
NM_000455.4(STK11):c.*8C>T rs587782259
NM_000455.4(STK11):c.-1C>T rs759284466
NM_000455.4(STK11):c.1045G>A (p.Glu349Lys) rs553752236
NM_000455.4(STK11):c.1108+3G>A rs755746417
NM_000455.4(STK11):c.1109-4C>T rs1407794756
NM_000455.4(STK11):c.1109-5C>T rs587782020
NM_000455.4(STK11):c.1150C>T (p.Arg384Trp) rs752015385
NM_000455.4(STK11):c.1229C>T (p.Ala410Val) rs372329880
NM_000455.4(STK11):c.1245C>T (p.Arg415=) rs878853985
NM_000455.4(STK11):c.369G>A (p.Gln123=) rs140112347
NM_000455.4(STK11):c.464+3G>A rs1060499956
NM_000455.4(STK11):c.464+4C>T rs373167735
NM_000455.4(STK11):c.464+9G>A rs376313955
NM_000455.4(STK11):c.598-8C>T rs373610101
NM_000455.4(STK11):c.617C>T (p.Ala206Val) rs764244639
NM_000455.4(STK11):c.666C>T (p.Pro222=) rs542189325
NM_000455.4(STK11):c.735-6_735-2del rs759090799
NM_000455.4(STK11):c.816C>T (p.Tyr272=) rs9282859
NM_000455.4(STK11):c.825G>A (p.Pro275=) rs202011521
NM_000455.4(STK11):c.827G>T (p.Gly276Val) rs749927908
NM_000455.4(STK11):c.902G>A (p.Arg301Gln) rs370222210
NM_000455.4(STK11):c.96C>G (p.Thr32=) rs79175212
NM_000455.4(STK11):c.992G>A (p.Arg331Gln) rs371264852
NM_000455.5(STK11):c.1062C>G (p.Phe354Leu) rs59912467
NM_000455.5(STK11):c.1071G>T rs556651007
NM_000455.5(STK11):c.1225C>T (p.Arg409Trp) rs368466538
NM_000455.5(STK11):c.1226G>A (p.Arg409Gln) rs587782364
NM_000455.5(STK11):c.1261_1262inv (p.Ser421Leu)
NM_000455.5(STK11):c.264C>A rs56354945
NM_000455.5(STK11):c.542A>G (p.Asn181Ser) rs886037859
NM_000455.5(STK11):c.613G>A (p.Ala205Thr) rs730881981
NM_000455.5(STK11):c.842C>T (p.Pro281Leu) rs121913322
NM_000455.5(STK11):c.863-5_863-3del rs764739106
NM_000455.5(STK11):c.920+5G>A rs587780013
NM_000465.3(BARD1):c.1518_1519invTG (p.Val507Met)
NM_000465.4(BARD1):c.-4G>A rs761863671
NM_000465.4(BARD1):c.1028C>T (p.Thr343Ile) rs201032007
NM_000465.4(BARD1):c.1070T>C (p.Ile357Thr) rs587781555
NM_000465.4(BARD1):c.1127C>T (p.Ser376Leu) rs587782333
NM_000465.4(BARD1):c.1147A>T (p.Met383Leu) rs761516178
NM_000465.4(BARD1):c.1395+4G>T rs1025329798
NM_000465.4(BARD1):c.1448A>G (p.His483Arg) rs587781874
NM_000465.4(BARD1):c.144G>A (p.Leu48=) rs151168457
NM_000465.4(BARD1):c.1568T>C (p.Val523Ala) rs587780017
NM_000465.4(BARD1):c.160A>G (p.Thr54Ala) rs200254470
NM_000465.4(BARD1):c.1678A>G (p.Met560Val) rs587780020
NM_000465.4(BARD1):c.1694G>A (p.Arg565His) rs146946984
NM_000465.4(BARD1):c.1822G>A (p.Val608Ile) rs778987552
NM_000465.4(BARD1):c.1877A>G (p.Asn626Ser) rs587781443
NM_000465.4(BARD1):c.1904-5G>A rs376639978
NM_000465.4(BARD1):c.1932_1933del (p.Val644_Cys645insTer) rs587782504
NM_000465.4(BARD1):c.1977A>G (p.Arg659=) rs147215925
NM_000465.4(BARD1):c.2075T>C (p.Ile692Thr) rs587782555
NM_000465.4(BARD1):c.2179G>A (p.Asp727Asn) rs730881424
NM_000465.4(BARD1):c.2191C>G (p.Arg731Gly) rs76744638
NM_000465.4(BARD1):c.2229dup (p.Asn744Ter) rs1259296823
NM_000465.4(BARD1):c.2282G>A (p.Ser761Asn) rs142155101
NM_000465.4(BARD1):c.2300_2301del (p.Val767fs) rs750413473
NM_000465.4(BARD1):c.335G>A (p.Arg112Gln) rs587781591
NM_000465.4(BARD1):c.353A>G (p.Asn118Ser) rs142864491
NM_000465.4(BARD1):c.382C>T (p.Pro128Ser) rs878854011
NM_000465.4(BARD1):c.44G>T (p.Arg15Leu) rs545107676
NM_000465.4(BARD1):c.521G>A (p.Ser174Asn) rs1277839212
NM_000465.4(BARD1):c.556A>G (p.Ser186Gly) rs16852741
NM_000465.4(BARD1):c.581G>A (p.Arg194Lys) rs181748854
NM_000465.4(BARD1):c.659T>C (p.Leu220Ser) rs138593305
NM_000465.4(BARD1):c.684A>G (p.Glu228=) rs780627045
NM_000465.4(BARD1):c.716T>A (p.Leu239Gln) rs200359745
NM_000465.4(BARD1):c.73G>C (p.Ala25Pro) rs751646468
NM_000465.4(BARD1):c.773T>C (p.Ile258Thr) rs146223579
NM_000465.4(BARD1):c.79G>C (p.Glu27Gln) rs587780037
NM_000465.4(BARD1):c.835T>C (p.Ser279Pro) rs587781456
NM_000465.4(BARD1):c.86A>C (p.Asp29Ala) rs777491507
NM_000465.4(BARD1):c.90T>A (p.Gly30=) rs150354152
NM_000489.5(ATRX):c.228G>A (p.Ser76=) rs5959371
NM_000489.5(ATRX):c.2785= (p.Glu929=) rs3088074
NM_000489.5(ATRX):c.3395T>C (p.Ile1132Thr) rs587780285
NM_000489.5(ATRX):c.3541G>C (p.Val1181Leu) rs61758732
NM_000489.5(ATRX):c.4035G>A (p.Leu1345=) rs111725949
NM_000489.5(ATRX):c.4130A>G (p.Glu1377Gly) rs782553301
NM_000489.5(ATRX):c.4239A>G (p.Glu1413=) rs141974120
NM_000489.5(ATRX):c.4659T>C (p.His1553=) rs25641
NM_000489.5(ATRX):c.4810-3T>C rs370596323
NM_000489.5(ATRX):c.570T>G (p.Pro190=) rs188831993
NM_000489.5(ATRX):c.6149T>C (p.Ile2050Thr) rs122445110
NM_000489.5(ATRX):c.6640T>G (p.Leu2214Val) rs782396522
NM_000489.5(ATRX):c.846C>T (p.Ser282=) rs148015780
NM_000489.6(ATRX):c.4365GGA[4] (p.Glu1464del) rs398123423
NM_000492.3(CFTR):c.91C>T (p.Arg31Cys) rs1800073
NM_000492.4(CFTR):c.1865G>A (p.Gly622Asp) rs121908759
NM_000531.6(OTC):c.137A>G (p.Lys46Arg) rs1800321
NM_000531.6(OTC):c.298+5G>C rs72554348
NM_000531.6(OTC):c.751T>C (p.Leu251=) rs36005267
NM_000531.6(OTC):c.809A>G (p.Gln270Arg) rs1800328
NM_000533.5(PLP1):c.168A>G (p.Gln56=) rs2233697
NM_000533.5(PLP1):c.609T>C (p.Asp203=) rs1126707
NM_000535.7(PMS2):c.-1C>A rs369681753
NM_000535.7(PMS2):c.-2C>T rs876658209
NM_000535.7(PMS2):c.-4A>G rs544503598
NM_000535.7(PMS2):c.-5C>A rs786202272
NM_000535.7(PMS2):c.-7T>C rs199660792
NM_000535.7(PMS2):c.1004A>G (p.Asn335Ser) rs200513014
NM_000535.7(PMS2):c.1080A>G (p.Ile360Met) rs567102013
NM_000535.7(PMS2):c.1096G>C (p.Asp366His) rs141769057
NM_000535.7(PMS2):c.1099G>A (p.Val367Ile) rs746889239
NM_000535.7(PMS2):c.1169C>T (p.Ala390Val) rs587780039
NM_000535.7(PMS2):c.11C>G (p.Ala4Gly) rs745361721
NM_000535.7(PMS2):c.123_131del (p.Leu42_Glu44del) rs863224676
NM_000535.7(PMS2):c.1266G>A (p.Glu422=) rs138049175
NM_000535.7(PMS2):c.1280G>A (p.Arg427His) rs112902065
NM_000535.7(PMS2):c.1288A>G (p.Thr430Ala) rs587781382
NM_000535.7(PMS2):c.1357A>G (p.Met453Val) rs587780722
NM_000535.7(PMS2):c.1361T>C (p.Leu454Pro) rs772659239
NM_000535.7(PMS2):c.1394A>G (p.Lys465Arg) rs141084758
NM_000535.7(PMS2):c.1399G>A (p.Val467Ile) rs373611083
NM_000535.7(PMS2):c.1420G>T (p.Ala474Ser) rs373114291
NM_000535.7(PMS2):c.1435C>G (p.His479Asp) rs376344586
NM_000535.7(PMS2):c.1438G>A (p.Gly480Arg) rs146848345
NM_000535.7(PMS2):c.1454C>T (p.Thr485Met) rs1805323
NM_000535.7(PMS2):c.1463C>T (p.Ala488Val) rs587779328
NM_000535.7(PMS2):c.1488C>T (p.His496=) rs1805320
NM_000535.7(PMS2):c.1490G>A (p.Gly497Asp) rs199739859
NM_000535.7(PMS2):c.1501G>A (p.Val501Met) rs540287433
NM_000535.7(PMS2):c.1510G>C (p.Glu504Gln) rs368516768
NM_000535.7(PMS2):c.1531A>G (p.Thr511Ala) rs2228007
NM_000535.7(PMS2):c.1532C>T (p.Thr511Met) rs74902811
NM_000535.7(PMS2):c.1552G>A (p.Glu518Lys) rs376142390
NM_000535.7(PMS2):c.1555T>C (p.Tyr519His) rs370236216
NM_000535.7(PMS2):c.1556A>G (p.Tyr519Cys) rs63750649
NM_000535.7(PMS2):c.1557T>C (p.Tyr519=) rs6972869
NM_000535.7(PMS2):c.1559C>T (p.Ala520Val) rs63751300
NM_000535.7(PMS2):c.1567T>A (p.Ser523Thr) rs63751132
NM_000535.7(PMS2):c.1569C>G (p.Ser523=) rs141458772
NM_000535.7(PMS2):c.1577A>G (p.Asp526Gly) rs143235330
NM_000535.7(PMS2):c.1679G>A (p.Cys560Tyr) rs757989905
NM_000535.7(PMS2):c.1688G>A (p.Arg563Gln) rs63750668
NM_000535.7(PMS2):c.1688G>T (p.Arg563Leu) rs63750668
NM_000535.7(PMS2):c.1688_1689delinsAG (p.Arg563Gln) rs587780725
NM_000535.7(PMS2):c.1711C>A (p.Leu571Ile) rs63750055
NM_000535.7(PMS2):c.1717A>T (p.Thr573Ser) rs63751211
NM_000535.7(PMS2):c.1720C>T (p.Pro574Ser) rs758018736
NM_000535.7(PMS2):c.1723A>G (p.Asn575Asp) rs142506484
NM_000535.7(PMS2):c.1733G>A (p.Arg578His) rs63750770
NM_000535.7(PMS2):c.1753C>A (p.Leu585Ile) rs63750947
NM_000535.7(PMS2):c.1765G>C (p.Asp589His) rs749727182
NM_000535.7(PMS2):c.1768A>G (p.Ile590Val) rs63750476
NM_000535.7(PMS2):c.1798A>G (p.Met600Val) rs1304634005
NM_000535.7(PMS2):c.180C>G (p.Asp60Glu) rs200313585
NM_000535.7(PMS2):c.1828A>G (p.Lys610Glu) rs199700509
NM_000535.7(PMS2):c.1866G>A (p.Met622Ile) rs1805324
NM_000535.7(PMS2):c.1883G>A (p.Arg628Gln) rs587780044
NM_000535.7(PMS2):c.1906G>A (p.Ala636Thr) rs876658863
NM_000535.7(PMS2):c.1928A>G (p.Gln643Arg) rs760629688
NM_000535.7(PMS2):c.2012C>T (p.Thr671Met) rs587780046
NM_000535.7(PMS2):c.2149G>A (p.Val717Met) rs201671325
NM_000535.7(PMS2):c.23+10G>C rs192027828
NM_000535.7(PMS2):c.2324A>G (p.Asn775Ser) rs17420802
NM_000535.7(PMS2):c.2340C>T (p.Pro780=) rs142230276
NM_000535.7(PMS2):c.2350G>A (p.Asp784Asn) rs143340522
NM_000535.7(PMS2):c.2356C>A (p.Leu786Met) rs576055272
NM_000535.7(PMS2):c.2395C>T (p.Arg799Trp) rs149202766
NM_000535.7(PMS2):c.24-3T>C rs749485884
NM_000535.7(PMS2):c.24-4C>G rs2345056
NM_000535.7(PMS2):c.2444C>T (p.Ser815Leu) rs587779338
NM_000535.7(PMS2):c.251-20T>G rs149343081
NM_000535.7(PMS2):c.251-2A>C rs587779340
NM_000535.7(PMS2):c.319C>T (p.Arg107Trp) rs188006077
NM_000535.7(PMS2):c.354-3C>T rs587782632
NM_000535.7(PMS2):c.384G>A (p.Ser128=) rs371342884
NM_000535.7(PMS2):c.433C>A (p.Gln145Lys) rs786204133
NM_000535.7(PMS2):c.52A>G (p.Ile18Val) rs63750123
NM_000535.7(PMS2):c.538-2A>G rs758304323
NM_000535.7(PMS2):c.53T>C (p.Ile18Thr) rs201343342
NM_000535.7(PMS2):c.591C>T (p.Gly197=) rs748518694
NM_000535.7(PMS2):c.614A>C (p.Gln205Pro) rs587779342
NM_000535.7(PMS2):c.620G>A (p.Gly207Glu) rs374704824
NM_000535.7(PMS2):c.652G>A (p.Gly218Ser) rs878854055
NM_000535.7(PMS2):c.682G>A (p.Gly228Ser) rs376258383
NM_000535.7(PMS2):c.708G>T (p.Leu236Phe) rs201395630
NM_000535.7(PMS2):c.830C>A (p.Thr277Lys) rs1805322
NM_000535.7(PMS2):c.89A>G (p.Gln30Arg) rs56203955
NM_000535.7(PMS2):c.903+4T>C rs753803330
NM_000535.7(PMS2):c.904-2A>G rs587781339
NM_000535.7(PMS2):c.935T>C (p.Met312Thr) rs530021751
NM_000535.7(PMS2):c.961G>A (p.Val321Ile) rs377043696
NM_000535.7(PMS2):c.988+4A>G rs763959308
NM_000546.5(TP53):c.*1175A>C rs78378222
NM_000546.5(TP53):c.1000G>C (p.Gly334Arg) rs730882028
NM_000546.5(TP53):c.1009C>T (p.Arg337Cys) rs587782529
NM_000546.5(TP53):c.100C>A (p.Pro34Thr) rs786201968
NM_000546.5(TP53):c.105G>C (p.Leu35Phe) rs121912661
NM_000546.5(TP53):c.1073A>T (p.Glu358Val) rs773553186
NM_000546.5(TP53):c.1079G>C (p.Gly360Ala) rs35993958
NM_000546.5(TP53):c.107C>A (p.Pro36Gln) rs587781866
NM_000546.5(TP53):c.108G>A (p.Pro36=) rs1800370
NM_000546.5(TP53):c.1120G>A (p.Gly374Ser) rs587781858
NM_000546.5(TP53):c.1120G>C (p.Gly374Arg) rs587781858
NM_000546.5(TP53):c.144C>A (p.Asp48Glu) rs587781460
NM_000546.5(TP53):c.145G>A (p.Asp49Asn) rs587780728
NM_000546.5(TP53):c.217G>A (p.Val73Met) rs587782423
NM_000546.5(TP53):c.245C>T (p.Pro82Leu) rs534447939
NM_000546.5(TP53):c.248C>T (p.Ala83Val) rs201717599
NM_000546.5(TP53):c.256G>A (p.Ala86Thr) rs587782148
NM_000546.5(TP53):c.28G>C (p.Val10Leu) rs535274413
NM_000546.5(TP53):c.31G>A (p.Glu11Lys) rs201382018
NM_000546.5(TP53):c.385G>A (p.Ala129Thr) rs1438095083
NM_000546.5(TP53):c.404G>A (p.Cys135Tyr) rs587781991
NM_000546.5(TP53):c.434T>A (p.Leu145Gln) rs587782197
NM_000546.5(TP53):c.466C>T (p.Arg156Cys) rs563378859
NM_000546.5(TP53):c.472C>T (p.Arg158Cys) rs587780068
NM_000546.5(TP53):c.481G>A (p.Ala161Thr) rs193920817
NM_000546.5(TP53):c.536A>G (p.His179Arg) rs1057519991
NM_000546.5(TP53):c.541C>T (p.Arg181Cys) rs587782596
NM_000546.5(TP53):c.566C>T (p.Ala189Val) rs121912665
NM_000546.5(TP53):c.587G>C (p.Arg196Pro) rs483352697
NM_000546.5(TP53):c.604C>G (p.Arg202Gly) rs587780072
NM_000546.5(TP53):c.604C>T (p.Arg202Cys) rs587780072
NM_000546.5(TP53):c.605G>A (p.Arg202His) rs587778719
NM_000546.5(TP53):c.613T>C (p.Tyr205His) rs1057520008
NM_000546.5(TP53):c.643A>G (p.Ser215Gly) rs886039484
NM_000546.5(TP53):c.665C>T (p.Pro222Leu) rs146340390
NM_000546.5(TP53):c.666G>T (p.Pro222=) rs72661118
NM_000546.5(TP53):c.704A>G (p.Asn235Ser) rs144340710
NM_000546.5(TP53):c.713G>A (p.Cys238Tyr) rs730882005
NM_000546.5(TP53):c.824G>A (p.Cys275Tyr) rs863224451
NM_000546.5(TP53):c.824G>C (p.Cys275Ser) rs863224451
NM_000546.5(TP53):c.868C>T (p.Arg290Cys) rs770374782
NM_000546.5(TP53):c.884C>T (p.Pro295Leu) rs751713111
NM_000546.5(TP53):c.892G>A (p.Glu298Lys) rs201744589
NM_000546.5(TP53):c.907A>G (p.Ser303Gly) rs587782391
NM_000546.5(TP53):c.919+3A>G rs876659784
NM_000546.5(TP53):c.943T>A (p.Ser315Thr) rs762620193
NM_000546.5(TP53):c.949C>A (p.Gln317Lys) rs764735889
NM_000546.5(TP53):c.974G>A (p.Gly325Glu) rs121912659
NM_000546.5(TP53):c.993+12T>C rs1800899
NM_000546.6(TP53):c.1093C>T (p.His365Tyr) rs267605075
NM_000546.6(TP53):c.1163A>C (p.Glu388Ala) rs587781736
NM_000546.6(TP53):c.140C>G (p.Pro47Arg) rs1597375038
NM_000546.6(TP53):c.473G>A (p.Arg158His) rs587782144
NM_000546.6(TP53):c.523C>T (p.Arg175Cys) rs138729528
NM_000546.6(TP53):c.639A>G (p.Arg213=) rs1800372
NM_000546.6(TP53):c.66A>G (p.Leu22=) rs748527030
NM_000546.6(TP53):c.743G>A (p.Arg248Gln) rs11540652
NM_000546.6(TP53):c.818G>A (p.Arg273His) rs28934576
NM_000546.6(TP53):c.844C>T (p.Arg282Trp) rs28934574
NM_000546.6(TP53):c.847C>T (p.Arg283Cys) rs149633775
NM_000546.6(TP53):c.869G>A (p.Arg290His) rs55819519
NM_000546.6(TP53):c.935C>G (p.Thr312Ser) rs145151284
NM_000548.5(TSC2):c.106A>G (p.Thr36Ala) rs757113497
NM_000548.5(TSC2):c.1258-5G>T rs925954967
NM_000548.5(TSC2):c.1303C>T (p.His435Tyr) rs760896048
NM_000548.5(TSC2):c.2295C>T (p.Ala765=) rs45509500
NM_000548.5(TSC2):c.3117G>A (p.Thr1039=) rs747104674
NM_000548.5(TSC2):c.3914C>T (p.Pro1305Leu) rs45517320
NM_000548.5(TSC2):c.3918C>T (p.Gly1306=) rs368712041
NM_000548.5(TSC2):c.4044C>T (p.His1348=) rs137854084
NM_000548.5(TSC2):c.4216G>A (p.Asp1406Asn) rs147719291
NM_000548.5(TSC2):c.4397C>T (p.Ser1466Leu) rs45517341
NM_000548.5(TSC2):c.618C>T (p.Cys206=) rs45498496
NM_000551.4(VHL):c.562C>G (p.Leu188Val) rs5030824
NM_000686.5(AGTR2):c.62G>T (p.Gly21Val) rs121917810
NM_000702.4(ATP1A2):c.1470C>T (p.Ile490=) rs111405592
NM_000702.4(ATP1A2):c.152G>A (p.Arg51His) rs144106169
NM_000702.4(ATP1A2):c.1710G>A (p.Thr570=) rs536168465
NM_000702.4(ATP1A2):c.1761T>C (p.Ser587=) rs199621678
NM_000702.4(ATP1A2):c.2273G>C (p.Gly758Ala) rs147183887
NM_000702.4(ATP1A2):c.25T>A (p.Tyr9Asn) rs55858252
NM_000702.4(ATP1A2):c.2967C>T (p.Phe989=) rs138826759
NM_000702.4(ATP1A2):c.339C>T (p.Tyr113=) rs148929192
NM_000702.4(ATP1A2):c.340G>A (p.Gly114Ser) rs116711766
NM_000702.4(ATP1A2):c.660G>A (p.Ser220=) rs564452950
NM_000702.4(ATP1A2):c.969C>T (p.Ile323=) rs28716941
NM_000719.7(CACNA1C):c.1074G>A (p.Gln358=) rs139842134
NM_000719.7(CACNA1C):c.109G>A (p.Gly37Arg) rs34534613
NM_000719.7(CACNA1C):c.1176G>T (p.Gly392=) rs1051360
NM_000719.7(CACNA1C):c.1359C>T (p.Asp453=) rs200330469
NM_000719.7(CACNA1C):c.1468G>A (p.Gly490Arg) rs121912775
NM_000719.7(CACNA1C):c.1486C>T (p.Arg496Trp) rs760888275
NM_000719.7(CACNA1C):c.1783G>A (p.Val595Ile) rs201392574
NM_000719.7(CACNA1C):c.1794C>T (p.Gly598=) rs116491041
NM_000719.7(CACNA1C):c.2280G>A (p.Glu760=) rs141633456
NM_000719.7(CACNA1C):c.2449C>T (p.Pro817Ser) rs112532048
NM_000719.7(CACNA1C):c.2542GAG[2] (p.Glu850del) rs575583988
NM_000719.7(CACNA1C):c.2766G>A (p.Pro922=) rs184684058
NM_000719.7(CACNA1C):c.3234C>T (p.Asp1078=) rs111606207
NM_000719.7(CACNA1C):c.3531C>T (p.Tyr1177=) rs754527651
NM_000719.7(CACNA1C):c.3567C>T (p.Cys1189=) rs202058956
NM_000719.7(CACNA1C):c.3642C>T (p.Tyr1214=) rs56394008
NM_000719.7(CACNA1C):c.375A>G (p.Pro125=) rs587780882
NM_000719.7(CACNA1C):c.3780C>A (p.Gly1260=) rs201258230
NM_000719.7(CACNA1C):c.3948C>T (p.Asn1316=) rs150092451
NM_000719.7(CACNA1C):c.4075-4C>A rs369044605
NM_000719.7(CACNA1C):c.4140+4G>A rs111442547
NM_000719.7(CACNA1C):c.4317C>T (p.Asn1439=) rs183192651
NM_000719.7(CACNA1C):c.4611C>T (p.Arg1537=) rs372702466
NM_000719.7(CACNA1C):c.4659C>T (p.Asp1553=) rs563090568
NM_000719.7(CACNA1C):c.5199G>A (p.Ala1733=) rs200638007
NM_000719.7(CACNA1C):c.5214C>A (p.Gly1738=) rs199538058
NM_000719.7(CACNA1C):c.5235C>T (p.His1745=) rs201861473
NM_000719.7(CACNA1C):c.5424G>A (p.Ala1808=) rs587780881
NM_000719.7(CACNA1C):c.5529T>C (p.His1843=) rs371831239
NM_000719.7(CACNA1C):c.5593G>A (p.Glu1865Lys) rs200231105
NM_000719.7(CACNA1C):c.5649G>A (p.Pro1883=) rs56270948
NM_000719.7(CACNA1C):c.5665C>T (p.Arg1889Cys) rs185788586
NM_000719.7(CACNA1C):c.5747A>G (p.Gln1916Arg) rs186867242
NM_000719.7(CACNA1C):c.5918G>A (p.Arg1973Gln) rs112414325
NM_000719.7(CACNA1C):c.6011G>T (p.Gly2004Val) rs374991642
NM_000719.7(CACNA1C):c.6344G>C (p.Gly2115Ala) rs199694744
NM_000719.7(CACNA1C):c.666C>T (p.Asn222=) rs527741368
NM_000719.7(CACNA1C):c.724C>T (p.Leu242=) rs200800133
NM_000719.7(CACNA1C):c.911T>C (p.Ile304Thr) rs201756421
NM_000719.7(CACNA1C):c.966C>T (p.His322=) rs112539787
NM_000722.4(CACNA2D1):c.1956-4del rs3083235
NM_000722.4(CACNA2D1):c.1983G>A (p.Ser661=) rs75158917
NM_000722.4(CACNA2D1):c.2264G>C (p.Ser755Thr) rs151327713
NM_000722.4(CACNA2D1):c.3134A>C (p.Asp1045Ala) rs35131433
NM_000742.4(CHRNA2):c.1324C>T (p.Leu442=) rs56298562
NM_000742.4(CHRNA2):c.1434C>A (p.Asp478Glu) rs56344740
NM_000742.4(CHRNA2):c.1500C>T (p.Ile500=) rs143223159
NM_000742.4(CHRNA2):c.1530C>T (p.Ile510=) rs149142237
NM_000742.4(CHRNA2):c.1568C>T (p.Pro523Leu) rs145238683
NM_000742.4(CHRNA2):c.202C>T (p.Arg68Trp) rs376970816
NM_000742.4(CHRNA2):c.351C>T (p.Asp117=) rs2565061
NM_000742.4(CHRNA2):c.373A>G (p.Thr125Ala) rs891398
NM_000742.4(CHRNA2):c.383G>A (p.Gly128Asp) rs138682847
NM_000742.4(CHRNA2):c.401G>A (p.Arg134Lys) rs150112824
NM_000742.4(CHRNA2):c.489C>T (p.Ala163=) rs535699325
NM_000742.4(CHRNA2):c.65C>T (p.Thr22Ile) rs2472553
NM_000742.4(CHRNA2):c.771C>T (p.Tyr257=) rs56229264
NM_000742.4(CHRNA2):c.873C>T (p.Ser291=) rs76140563
NM_000742.4(CHRNA2):c.913C>T (p.Leu305=) rs114294066
NM_000744.6(CHRNA4):c.77-4G>A rs201123897
NM_000744.7(CHRNA4):c.1006C>T (p.Arg336Cys) rs56175056
NM_000744.7(CHRNA4):c.1047G>A (p.Leu349=) rs75593857
NM_000744.7(CHRNA4):c.1108C>T (p.Arg370Trp) rs76378652
NM_000744.7(CHRNA4):c.1143C>T (p.Ala381=) rs75221202
NM_000744.7(CHRNA4):c.1203G>C (p.Leu401=) rs56142348
NM_000744.7(CHRNA4):c.1209G>T (p.Pro403=) rs2229959
NM_000744.7(CHRNA4):c.1227T>C (p.Cys409=) rs2229960
NM_000744.7(CHRNA4):c.1228G>A (p.Val410Ile) rs121912272
NM_000744.7(CHRNA4):c.1352C>T (p.Pro451Leu) rs55915440
NM_000744.7(CHRNA4):c.1353G>A (p.Pro451=) rs113168860
NM_000744.7(CHRNA4):c.1360G>A (p.Gly454Ser) rs78306886
NM_000744.7(CHRNA4):c.1401C>T (p.Ser467=) rs45569837
NM_000744.7(CHRNA4):c.1415C>T (p.Ser472Phe) rs534477048
NM_000744.7(CHRNA4):c.1441G>A (p.Gly481Ser) rs111969225
NM_000744.7(CHRNA4):c.1454G>A (p.Arg485Gln) rs755416498
NM_000744.7(CHRNA4):c.1460G>A (p.Arg487Gln) rs121912280
NM_000744.7(CHRNA4):c.1538G>A (p.Arg513His) rs868845088
NM_000744.7(CHRNA4):c.1584G>A (p.Pro528=) rs199783192
NM_000744.7(CHRNA4):c.1629C>T (p.Ser543=) rs1044396
NM_000744.7(CHRNA4):c.1659G>A (p.Ala553=) rs1044397
NM_000744.7(CHRNA4):c.1662G>A (p.Pro554=) rs121912284
NM_000744.7(CHRNA4):c.189C>T (p.Leu63=) rs2273506
NM_000744.7(CHRNA4):c.225C>T (p.Asp75=) rs113080067
NM_000744.7(CHRNA4):c.24G>C (p.Ala8=) rs6089898
NM_000744.7(CHRNA4):c.258C>T (p.Asn86=) rs140239470
NM_000744.7(CHRNA4):c.274G>C (p.Glu92Gln) rs146651027
NM_000744.7(CHRNA4):c.38_49dup (p.Pro13_Leu16dup) rs1064794327
NM_000744.7(CHRNA4):c.402G>A (p.Ala134=) rs201488442
NM_000744.7(CHRNA4):c.51G>A (p.Leu17=) rs79739740
NM_000744.7(CHRNA4):c.639T>C (p.Asp213=) rs1044393
NM_000744.7(CHRNA4):c.678T>C (p.Cys226=) rs1044394
NM_000744.7(CHRNA4):c.681C>A (p.Ala227=) rs45588436
NM_000744.7(CHRNA4):c.978C>T (p.Phe326=) rs76270730
NM_000744.7(CHRNA4):c.9A>G (p.Leu3=) rs80075498
NM_000748.3(CHRNB2):c.1191G>C (p.Gln397His) rs55685423
NM_000748.3(CHRNB2):c.1233G>A (p.Ala411=) rs55857552
NM_000748.3(CHRNB2):c.1432T>C (p.Phe478Leu) rs79137415
NM_000748.3(CHRNB2):c.1482A>G (p.Ser494=) rs8192486
NM_000748.3(CHRNB2):c.1485C>T (p.Asp495=) rs144813907
NM_000748.3(CHRNB2):c.772C>T (p.Leu258=) rs201514209
NM_000748.3(CHRNB2):c.77C>T (p.Thr26Met) rs71651692
NM_000756.4(CRH):c.456G>A (p.Arg152=) rs144205489
NM_000756.4(CRH):c.89C>G (p.Pro30Arg) rs748404250
NM_000834.4(GRIN2B):c.1125+5G>A rs3751257
NM_000834.4(GRIN2B):c.1338A>G (p.Thr446=) rs141031272
NM_000834.4(GRIN2B):c.15G>A (p.Ala5=) rs34315573
NM_000834.4(GRIN2B):c.1665C>T (p.Ser555=) rs1805482
NM_000834.4(GRIN2B):c.1806C>T (p.Ile602=) rs1805522
NM_000834.4(GRIN2B):c.1851C>T (p.Ser617=) rs147373250
NM_000834.4(GRIN2B):c.2202A>G (p.Ala734=) rs148185805
NM_000834.4(GRIN2B):c.228C>T (p.Thr76=) rs77299791
NM_000834.4(GRIN2B):c.2514C>T (p.Cys838=) rs3026160
NM_000834.4(GRIN2B):c.2628G>A (p.Ala876=) rs199710029
NM_000834.4(GRIN2B):c.2691C>T (p.Asn897=) rs35125534
NM_000834.4(GRIN2B):c.2703G>A (p.Leu901=) rs145005918
NM_000834.4(GRIN2B):c.291G>A (p.Val97=) rs202223470
NM_000834.4(GRIN2B):c.3047G>A (p.Arg1016Lys) rs141109968
NM_000834.4(GRIN2B):c.3076G>A (p.Gly1026Ser) rs201963596
NM_000834.4(GRIN2B):c.3117C>T (p.Tyr1039=) rs147762014
NM_000834.4(GRIN2B):c.3534C>T (p.His1178=) rs1806191
NM_000834.4(GRIN2B):c.3552C>T (p.Gly1184=) rs141886903
NM_000834.4(GRIN2B):c.366C>G (p.Pro122=) rs7301328
NM_000834.4(GRIN2B):c.3747C>T (p.Gly1249=) rs138771137
NM_000834.4(GRIN2B):c.3837T>G (p.Thr1279=) rs1806200
NM_000834.4(GRIN2B):c.3993G>A (p.Met1331Ile) rs200035225
NM_000834.4(GRIN2B):c.4113C>T (p.Tyr1371=) rs146792012
NM_000834.4(GRIN2B):c.4197T>C (p.His1399=) rs1805247
NM_000834.4(GRIN2B):c.4240G>T (p.Ala1414Ser) rs140744818
NM_000834.4(GRIN2B):c.4311C>T (p.Ala1437=) rs112265127
NM_000834.4(GRIN2B):c.504C>A (p.Ile168=) rs36031537
NM_000834.4(GRIN2B):c.870C>T (p.Pro290=) rs1124894
NM_000834.5(GRIN2B):c.2664C>T (p.Thr888=) rs1806201
NM_000891.2(KCNJ2):c.-2C>T rs144760658
NM_000891.2(KCNJ2):c.1044C>T (p.Tyr348=) rs146330042
NM_000891.2(KCNJ2):c.1065T>G (p.Leu355=) rs139564374
NM_000891.2(KCNJ2):c.1200G>A (p.Thr400=) rs201253055
NM_000891.2(KCNJ2):c.1229A>G (p.Asn410Ser) rs141069645
NM_000891.2(KCNJ2):c.174C>T (p.Phe58=) rs587781006
NM_000891.2(KCNJ2):c.213C>T (p.Asp71=) rs150671256
NM_000891.2(KCNJ2):c.867C>T (p.Asn289=) rs201909993
NM_001003800.2(BICD2):c.1636_1638del (p.Asn546del) rs1064795760
NM_001005242.3(PKP2):c.1012A>G (p.Thr338Ala) rs139851304
NM_001005242.3(PKP2):c.1114G>C (p.Ala372Pro) rs200586695
NM_001005242.3(PKP2):c.1372A>G (p.Ile458Val) rs199571473
NM_001005242.3(PKP2):c.1378+1G>C rs397516994
NM_001005242.3(PKP2):c.1379-2019C>T rs149930872
NM_001005242.3(PKP2):c.1379-2067G>A rs138538072
NM_001005242.3(PKP2):c.1418A>G (p.Asn473Ser) rs144536197
NM_001005242.3(PKP2):c.1445C>T (p.Thr482Met) rs146882581
NM_001005242.3(PKP2):c.1460T>G (p.Ile487Ser) rs147240502
NM_001005242.3(PKP2):c.1509T>C (p.Asn503=) rs143782040
NM_001005242.3(PKP2):c.1627G>A (p.Val543Ile) rs146102241
NM_001005242.3(PKP2):c.195C>T (p.Ala65=) rs397517014
NM_001005242.3(PKP2):c.2018C>T (p.Pro673Leu) rs144018320
NM_001005242.3(PKP2):c.209G>T (p.Ser70Ile) rs75909145
NM_001005242.3(PKP2):c.2260A>G (p.Thr754Ala) rs112592855
NM_001005242.3(PKP2):c.2299C>A (p.Arg767Ser) rs139734328
NM_001005242.3(PKP2):c.302G>A (p.Arg101His) rs149542398
NM_001005242.3(PKP2):c.419C>T (p.Ser140Phe) rs150821281
NM_001005242.3(PKP2):c.505A>G (p.Ser169Gly) rs139139859
NM_001005242.3(PKP2):c.706G>T (p.Ala236Ser) rs62001015
NM_001005242.3(PKP2):c.725C>T (p.Thr242Met) rs201580443
NM_001005242.3(PKP2):c.76G>A (p.Asp26Asn) rs143004808
NM_001005242.3(PKP2):c.826C>T (p.Pro276Ser) rs201944276
NM_001008537.3(NEXMIF):c.151C>A (p.Pro51Thr) rs145018752
NM_001008537.3(NEXMIF):c.2373A>C (p.Thr791=) rs61742545
NM_001008537.3(NEXMIF):c.2598C>A (p.Ser866=) rs41298498
NM_001008537.3(NEXMIF):c.2951A>G (p.Asn984Ser) rs375623451
NM_001008537.3(NEXMIF):c.3555G>T (p.Gly1185=) rs142714242
NM_001008537.3(NEXMIF):c.3709A>T (p.Met1237Leu) rs61731613
NM_001008537.3(NEXMIF):c.4205A>G (p.Asn1402Ser) rs140532942
NM_001008537.3(NEXMIF):c.4406G>A (p.Arg1469Gln) rs151004644
NM_001015877.2(PHF6):c.729+4A>G rs188961105
NM_001015877.2(PHF6):c.927C>T (p.Asp309=) rs112199174
NM_001018005.2(TPM1):c.180C>T (p.Tyr60=) rs17850194
NM_001018005.2(TPM1):c.188C>T (p.Ala63Val) rs199476306
NM_001018005.2(TPM1):c.284T>C (p.Val95Ala) rs104894504
NM_001018005.2(TPM1):c.375-3C>T rs202228866
NM_001018005.2(TPM1):c.644C>T (p.Ser215Leu) rs199476316
NM_001018005.2(TPM1):c.64G>A (p.Ala22Thr) rs397516382
NM_001018005.2(TPM1):c.82G>C (p.Asp28His) rs397516391
NM_001018005.2(TPM1):c.842T>C (p.Met281Thr) rs199476321
NM_001018005.2(TPM1):c.845C>G (p.Thr282Ser) rs397516395
NM_001018113.3(FANCB):c.1769T>C (p.Phe590Ser) rs142959373
NM_001018113.3(FANCB):c.1996G>A (p.Gly666Ser) rs145110602
NM_001029896.2(WDR45):c.944A>C (p.Asn315Thr) rs782562675
NM_001032283.3(TMPO):c.565+1105C>T rs138790561
NM_001032283.3(TMPO):c.565+1240G>A rs139700737
NM_001032283.3(TMPO):c.565+1728G>C rs145703021
NM_001032283.3(TMPO):c.565+2368G>A rs138295270
NM_001035.3(RYR2):c.10017C>T (p.His3339=) rs376439588
NM_001035.3(RYR2):c.10035G>A (p.Arg3345=) rs754976419
NM_001035.3(RYR2):c.10231-4T>C rs117180147
NM_001035.3(RYR2):c.10254C>T (p.Asn3418=) rs138073811
NM_001035.3(RYR2):c.10324-4A>G rs72751287
NM_001035.3(RYR2):c.10381A>G (p.Met3461Val) rs147512481
NM_001035.3(RYR2):c.10941T>G (p.Pro3647=) rs370332882
NM_001035.3(RYR2):c.1134C>T (p.Asp378=) rs193922621
NM_001035.3(RYR2):c.1143C>T (p.Ser381=) rs368844286
NM_001035.3(RYR2):c.12159G>A (p.Glu4053=) rs41267517
NM_001035.3(RYR2):c.1240C>T (p.Arg414Cys) rs764698152
NM_001035.3(RYR2):c.12492G>A (p.Gln4164=) rs377293019
NM_001035.3(RYR2):c.1259G>A (p.Arg420Gln) rs794728721
NM_001035.3(RYR2):c.12648G>A (p.Ala4216=) rs781557399
NM_001035.3(RYR2):c.12705C>T (p.Phe4235=) rs373606009
NM_001035.3(RYR2):c.12919C>T (p.Arg4307Cys) rs200092869
NM_001035.3(RYR2):c.1296C>A (p.Gly432=) rs184176405
NM_001035.3(RYR2):c.13566C>T (p.Val4522=) rs57360419
NM_001035.3(RYR2):c.13672C>T (p.His4558Tyr) rs773264033
NM_001035.3(RYR2):c.13983C>T (p.Tyr4661=) rs138498780
NM_001035.3(RYR2):c.14251A>C (p.Lys4751Gln) rs794728802
NM_001035.3(RYR2):c.14484G>T (p.Gly4828=) rs370996795
NM_001035.3(RYR2):c.14703G>C (p.Val4901=) rs201371633
NM_001035.3(RYR2):c.1476+4C>T rs369442980
NM_001035.3(RYR2):c.1527C>T (p.Ser509=) rs886042568
NM_001035.3(RYR2):c.1548T>C (p.Asp516=) rs146129084
NM_001035.3(RYR2):c.2267G>A (p.Ser756Asn) rs193922623
NM_001035.3(RYR2):c.2301G>T (p.Ser767=) rs117588730
NM_001035.3(RYR2):c.2574G>A (p.Thr858=) rs367992907
NM_001035.3(RYR2):c.2760G>A (p.Glu920=) rs186181155
NM_001035.3(RYR2):c.2935G>T (p.Ala979Ser) rs202015519
NM_001035.3(RYR2):c.3038G>A (p.Arg1013Gln) rs149514924
NM_001035.3(RYR2):c.3054T>C (p.Tyr1018=) rs113422365
NM_001035.3(RYR2):c.3251G>A (p.Arg1084Lys) rs193922624
NM_001035.3(RYR2):c.3320C>T (p.Thr1107Met) rs200236750
NM_001035.3(RYR2):c.3372G>A (p.Pro1124=) rs368017980
NM_001035.3(RYR2):c.3407C>T (p.Ala1136Val) rs72549415
NM_001035.3(RYR2):c.3720C>T (p.Ala1240=) rs750335699
NM_001035.3(RYR2):c.3888C>T (p.Asn1296=) rs373721253
NM_001035.3(RYR2):c.4044G>A (p.Lys1348=) rs755391572
NM_001035.3(RYR2):c.4347T>C (p.Asp1449=) rs368930040
NM_001035.3(RYR2):c.4734C>T (p.Pro1578=) rs201880756
NM_001035.3(RYR2):c.4740G>A (p.Pro1580=) rs79811945
NM_001035.3(RYR2):c.5001T>C (p.Leu1667=) rs397516537
NM_001035.3(RYR2):c.5571G>A (p.Pro1857=) rs371934582
NM_001035.3(RYR2):c.5586C>T (p.Asp1862=) rs193922628
NM_001035.3(RYR2):c.5619A>G (p.Ala1873=) rs373282364
NM_001035.3(RYR2):c.6337G>A (p.Val2113Met) rs186906598
NM_001035.3(RYR2):c.649A>G (p.Ile217Val) rs200642525
NM_001035.3(RYR2):c.7161G>A (p.Ala2387=) rs371560909
NM_001035.3(RYR2):c.726C>T (p.Asp242=) rs76380341
NM_001035.3(RYR2):c.7365C>T (p.Asp2455=) rs72549416
NM_001035.3(RYR2):c.7542G>A (p.Leu2514=) rs371088367
NM_001035.3(RYR2):c.7619A>G (p.His2540Arg) rs200105499
NM_001035.3(RYR2):c.7925G>A (p.Arg2642Lys) rs377473366
NM_001035.3(RYR2):c.8145G>T (p.Glu2715Asp) rs200420897
NM_001035.3(RYR2):c.8162T>C (p.Ile2721Thr) rs201500134
NM_001035.3(RYR2):c.8209-3A>G rs376788358
NM_001035.3(RYR2):c.8209-4T>C rs371966353
NM_001035.3(RYR2):c.828A>G (p.Arg276=) rs180711819
NM_001035.3(RYR2):c.8367T>C (p.Ile2789=) rs563219502
NM_001035.3(RYR2):c.9450-3T>C rs188671846
NM_001035.3(RYR2):c.9519T>C (p.Thr3173=) rs371931287
NM_001035.3(RYR2):c.9619A>G (p.Asn3207Asp) rs372601642
NM_001035.3(RYR2):c.9672C>T (p.Ser3224=) rs370740528
NM_001037.5(SCN1B):c.267C>T (p.Arg89=) rs140949982
NM_001037.5(SCN1B):c.28G>A (p.Gly10Ser) rs72552027
NM_001037.5(SCN1B):c.351C>T (p.Gly117=) rs3746255
NM_001037.5(SCN1B):c.363C>G (p.Cys121Trp) rs104894718
NM_001037.5(SCN1B):c.412G>A (p.Val138Ile) rs72558029
NM_001037.5(SCN1B):c.448+321G>A rs72558028
NM_001037.5(SCN1B):c.457G>A (p.Asp153Asn) rs72550247
NM_001037.5(SCN1B):c.501T>C (p.Ile167=) rs16969930
NM_001037.5(SCN1B):c.632G>A (p.Cys211Tyr) rs150721582
NM_001037.5(SCN1B):c.640G>A (p.Val214Ile) rs77106213
NM_001040142.2(SCN2A):c.1269G>A (p.Val423=) rs139815570
NM_001040142.2(SCN2A):c.1376A>C (p.Glu459Ala) rs184769423
NM_001040142.2(SCN2A):c.1416A>G (p.Arg472=) rs200246820
NM_001040142.2(SCN2A):c.1725G>A (p.Ala575=) rs543538780
NM_001040142.2(SCN2A):c.2034A>G (p.Thr678=) rs147891446
NM_001040142.2(SCN2A):c.2050C>T (p.Arg684Trp) rs200783308
NM_001040142.2(SCN2A):c.24G>A (p.Pro8=) rs149534277
NM_001040142.2(SCN2A):c.2706C>G (p.Leu902=) rs192461273
NM_001040142.2(SCN2A):c.2723A>G (p.Lys908Arg) rs2228980
NM_001040142.2(SCN2A):c.3210C>T (p.Asp1070=) rs187731029
NM_001040142.2(SCN2A):c.3453C>T (p.Pro1151=) rs145662546
NM_001040142.2(SCN2A):c.3456C>T (p.Ala1152=) rs144325450
NM_001040142.2(SCN2A):c.3594G>A (p.Arg1198=) rs140194137
NM_001040142.2(SCN2A):c.4565G>C (p.Gly1522Ala) rs147522594
NM_001040142.2(SCN2A):c.4782G>C (p.Trp1594Cys) rs1057521747
NM_001040142.2(SCN2A):c.4989C>T (p.Ile1663=) rs373347369
NM_001040142.2(SCN2A):c.5229A>G (p.Lys1743=) rs2227898
NM_001040142.2(SCN2A):c.5446G>T (p.Ala1816Ser) rs147084515
NM_001040142.2(SCN2A):c.5468A>C (p.Asp1823Ala) rs138497939
NM_001040142.2(SCN2A):c.5517C>T (p.Leu1839=) rs148424455
NM_001040142.2(SCN2A):c.56G>A (p.Arg19Lys) rs17183814
NM_001040142.2(SCN2A):c.5752C>T (p.Arg1918Cys) rs139899756
NM_001040142.2(SCN2A):c.5919C>T (p.Pro1973=) rs73025979
NM_001040142.2(SCN2A):c.70G>A (p.Ala24Thr) rs527452801
NM_001040142.2(SCN2A):c.897A>G (p.Ser299=) rs143765389
NM_001040142.2(SCN2A):c.960T>C (p.Ile320=) rs185590667
NM_001040616.3(LINS1):c.1124C>T (p.Thr375Ile) rs143097819
NM_001040616.3(LINS1):c.1194A>G (p.Gln398=) rs138347314
NM_001040616.3(LINS1):c.1285C>T (p.Leu429=) rs141962847
NM_001040616.3(LINS1):c.1302G>A (p.Pro434=) rs148166631
NM_001040616.3(LINS1):c.1479T>C (p.Cys493=) rs144513217
NM_001040616.3(LINS1):c.1887C>T (p.Tyr629=) rs61999313
NM_001040616.3(LINS1):c.2027A>G (p.Glu676Gly) rs150348863
NM_001040616.3(LINS1):c.2119G>A (p.Gly707Arg) rs74039425
NM_001040616.3(LINS1):c.52G>A (p.Gly18Arg) rs141782332
NM_001040616.3(LINS1):c.615A>G (p.Ser205=) rs148622636
NM_001040616.3(LINS1):c.718C>T (p.Arg240Trp) rs145145735
NM_001042492.3(NF1):c.3436G>A (p.Val1146Ile) rs201047812
NM_001042492.3(NF1):c.3883A>G (p.Thr1295Ala) rs143836226
NM_001048171.1(MUTYH):c.1076C>T (p.Ala359Val) rs35352891
NM_001048171.1(MUTYH):c.1434+2C>T rs140288388
NM_001048171.1(MUTYH):c.1435G>T (p.Val479Phe) rs587782228
NM_001048171.1(MUTYH):c.1514G>A (p.Arg505Gln) rs369410616
NM_001048171.1(MUTYH):c.530G>A (p.Arg177Gln) rs369677603
NM_001048171.1(MUTYH):c.929C>T (p.Ser310Leu) rs558173961
NM_001048174.2(MUTYH):c.1103G>A (p.Gly368Asp) rs36053993
NM_001048174.2(MUTYH):c.1174C>A (p.Leu392Met) rs144079536
NM_001048174.2(MUTYH):c.1192C>T (p.Arg398Cys) rs150792276
NM_001048174.2(MUTYH):c.1347G>C (p.Thr449=) rs74318065
NM_001048174.2(MUTYH):c.1463C>T (p.Pro488Leu) rs587778542
NM_001048174.2(MUTYH):c.228C>T (p.Tyr76=) rs121908380
NM_001048174.2(MUTYH):c.305-1G>C rs372267274
NM_001048174.2(MUTYH):c.397G>C (p.Asp133His) rs564930066
NM_001048174.2(MUTYH):c.493-5A>G rs758377868
NM_001048174.2(MUTYH):c.616G>A (p.Val206Met) rs200165598
NM_001048174.2(MUTYH):c.637C>T (p.Arg213Trp) rs34126013
NM_001048174.2(MUTYH):c.652G>T (p.Val218Phe) rs587780749
NM_001048174.2(MUTYH):c.699G>C (p.Gln233His) rs765339120
NM_001048174.2(MUTYH):c.737G>A (p.Arg246Gln) rs149866955
NM_001048174.2(MUTYH):c.841C>T (p.Arg281Cys) rs138089183
NM_001048174.2(MUTYH):c.850-2A>G rs77542170
NM_001048174.2(MUTYH):c.901G>A (p.Val301Met) rs147718169
NM_001048174.2(MUTYH):c.954G>A (p.Ser318=) rs372673338
NM_001077653.2(TBX20):c.414G>A (p.Ser138=) rs144597480
NM_001079802.2(FKTN):c.1026C>A (p.Leu342=) rs17309806
NM_001079802.2(FKTN):c.1336A>G (p.Asn446Asp) rs41313301
NM_001079802.2(FKTN):c.166C>T (p.Arg56Cys) rs41277797
NM_001079802.2(FKTN):c.167G>A (p.Arg56His) rs146951171
NM_001079802.2(FKTN):c.608G>A (p.Arg203Gln) rs34787999
NM_001079802.2(FKTN):c.668C>T (p.Thr223Ile) rs116105846
NM_001079802.2(FKTN):c.681G>A (p.Leu227=) rs142604625
NM_001083962.2(TCF4):c.1299G>A (p.Leu433=) rs552340151
NM_001083962.2(TCF4):c.1419G>C (p.Pro473=) rs143944746
NM_001083962.2(TCF4):c.1486+4G>C rs201274415
NM_001083962.2(TCF4):c.1704G>A (p.Glu568=) rs144068462
NM_001083962.2(TCF4):c.1905G>A (p.Ala635=) rs151150677
NM_001083962.2(TCF4):c.1923G>A (p.Glu641=) rs76956936
NM_001083962.2(TCF4):c.269A>G (p.Asn90Ser) rs143244149
NM_001083962.2(TCF4):c.341G>A (p.Arg114Lys) rs139876825
NM_001083962.2(TCF4):c.413C>G (p.Thr138Ser) rs796053416
NM_001083962.2(TCF4):c.504A>G (p.Val168=) rs370160994
NM_001083962.2(TCF4):c.936C>T (p.Ser312=) rs368270265
NM_001083962.2(TCF4):c.944C>T (p.Ala315Val) rs147445499
NM_001099922.3(ALG13):c.104A>G (p.Asn35Ser) rs149808406
NM_001099922.3(ALG13):c.108A>G (p.Arg36=) rs769838471