ClinVar Miner

Variants in gene MSH6 with conflicting interpretations

See also:
Y axis minimum submission review status: Y axis collection method:
X axis minimum submission review status: X axis collection method:
Minimum conflict level:
Gene type:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
2058 1293 33 174 233 0 35 403

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

pathogenic likely pathogenic uncertain significance likely benign benign
pathogenic 0 68 13 1 1
likely pathogenic 68 0 30 0 0
uncertain significance 13 30 9 231 46
likely benign 1 0 231 0 106
benign 1 0 46 106 25

All variants with conflicting interpretations #

Total variants: 403
Download table as spreadsheet
HGVS dbSNP
MHS6:c.3647-65_3647-61del rs3136363
MSH6:c.3647-51_3647-35del17 rs267607687
NM_000179.2(MSH6):c.*10A>G rs757778351
NM_000179.2(MSH6):c.*17G>A rs876661000
NM_000179.2(MSH6):c.*4_*7dupGACT rs765313977
NM_000179.2(MSH6):c.-159C>T rs41540312
NM_000179.2(MSH6):c.-16C>A rs1064794403
NM_000179.2(MSH6):c.-18G>T rs199913053
NM_000179.2(MSH6):c.-2G>T rs374748889
NM_000179.2(MSH6):c.-6G>C rs730881822
NM_000179.2(MSH6):c.-6G>T rs730881822
NM_000179.2(MSH6):c.-7T>A rs1057523142
NM_000179.2(MSH6):c.-8C>T rs565211544
NM_000179.2(MSH6):c.1019T>C (p.Phe340Ser) rs61753793
NM_000179.2(MSH6):c.102C>A (p.Ala34=) rs201132087
NM_000179.2(MSH6):c.102C>T (p.Ala34=) rs201132087
NM_000179.2(MSH6):c.1037C>T (p.Ser346Phe) rs567785169
NM_000179.2(MSH6):c.1049C>T (p.Ala350Val) rs587782331
NM_000179.2(MSH6):c.1050C>T (p.Ala350=) rs730881802
NM_000179.2(MSH6):c.1054G>A (p.Val352Ile) rs730881787
NM_000179.2(MSH6):c.105C>T (p.Ala35=) rs998365223
NM_000179.2(MSH6):c.1063G>A (p.Gly355Ser) rs587778531
NM_000179.2(MSH6):c.1065T>C (p.Gly355=) rs984907158
NM_000179.2(MSH6):c.1068T>C (p.Gly356=) rs749752524
NM_000179.2(MSH6):c.107C>T (p.Ala36Val) rs61756469
NM_000179.2(MSH6):c.1081C>T (p.Arg361Cys) rs587782651
NM_000179.2(MSH6):c.10C>T (p.Gln4Ter) rs786201042
NM_000179.2(MSH6):c.1109T>C (p.Leu370Ser) rs587779204
NM_000179.2(MSH6):c.1128_1132delAAAGA (p.Arg379Terfs) rs1114167801
NM_000179.2(MSH6):c.1132A>C (p.Arg378=) rs781572949
NM_000179.2(MSH6):c.1135_1139delAGAGA (p.Arg379Terfs) rs267608077
NM_000179.2(MSH6):c.1144C>T (p.His382Tyr) rs587779207
NM_000179.2(MSH6):c.115G>C (p.Gly39Arg) rs751838296
NM_000179.2(MSH6):c.1164C>T (p.His388=) rs55708305
NM_000179.2(MSH6):c.1167C>T (p.Pro389=) rs1042819
NM_000179.2(MSH6):c.1168G>A (p.Asp390Asn) rs147737737
NM_000179.2(MSH6):c.1168_1170delGATinsAA (p.Asp390Asnfs) rs863225398
NM_000179.2(MSH6):c.116G>A (p.Gly39Glu) rs1042821
NM_000179.2(MSH6):c.1170T>C (p.Asp390=) rs55882234
NM_000179.2(MSH6):c.1176T>C (p.Asp392=) rs587779912
NM_000179.2(MSH6):c.117G>A (p.Gly39=) rs756673077
NM_000179.2(MSH6):c.1186C>G (p.Leu396Val) rs2020908
NM_000179.2(MSH6):c.1191T>C (p.Tyr397=) rs786201269
NM_000179.2(MSH6):c.124C>T (p.Pro42Ser) rs34014629
NM_000179.2(MSH6):c.1255_1268delCAGAACTTTGATCT (p.Gln419Cysfs) rs876661251
NM_000179.2(MSH6):c.1272C>G (p.Val424=) rs63751452
NM_000179.2(MSH6):c.1295T>C (p.Phe432Ser) rs750528093
NM_000179.2(MSH6):c.1296T>G (p.Phe432Leu) rs863224614
NM_000179.2(MSH6):c.1304T>C (p.Leu435Pro) rs63751405
NM_000179.2(MSH6):c.131C>T (p.Pro44Leu) rs863224615
NM_000179.2(MSH6):c.1346T>C (p.Leu449Pro) rs63750741
NM_000179.2(MSH6):c.1352delT (p.Phe451Serfs) rs869312769
NM_000179.2(MSH6):c.1364A>C (p.Asn455Thr) rs200938360
NM_000179.2(MSH6):c.1390A>T (p.Ile464Phe) rs201892477
NM_000179.2(MSH6):c.1403G>A (p.Arg468His) rs41295268
NM_000179.2(MSH6):c.1449G>T (p.Val483=) rs35590297
NM_000179.2(MSH6):c.1474A>G (p.Met492Val) rs61754783
NM_000179.2(MSH6):c.1483C>T (p.Arg495Ter) rs587779212
NM_000179.2(MSH6):c.1487G>A (p.Cys496Tyr) rs764593111
NM_000179.2(MSH6):c.1508C>G (p.Ser503Cys) rs63750897
NM_000179.2(MSH6):c.1509C>T (p.Ser503=) rs545020313
NM_000179.2(MSH6):c.1526T>C (p.Val509Ala) rs63751005
NM_000179.2(MSH6):c.1565A>G (p.Gln522Arg) rs63751009
NM_000179.2(MSH6):c.1569T>G (p.Thr523=) rs587779214
NM_000179.2(MSH6):c.1610_1613delAGTA (p.Lys537Ilefs) rs771764652
NM_000179.2(MSH6):c.1618C>A (p.Leu540Ile) rs201996928
NM_000179.2(MSH6):c.1618_1620delCTT (p.Leu540del) rs1064793600
NM_000179.2(MSH6):c.161G>C (p.Gly54Ala) rs63751098
NM_000179.2(MSH6):c.1634_1635delAA (p.Lys545Argfs) rs267608064
NM_000179.2(MSH6):c.1665A>G (p.Ala555=) rs146785465
NM_000179.2(MSH6):c.1668T>C (p.Tyr556=) rs730882130
NM_000179.2(MSH6):c.1677C>T (p.Cys559=) rs63749893
NM_000179.2(MSH6):c.1691C>A (p.Ser564Ter) rs864622153
NM_000179.2(MSH6):c.1696G>A (p.Gly566Arg) rs63749973
NM_000179.2(MSH6):c.1740G>A (p.Ser580=) rs762089407
NM_000179.2(MSH6):c.1746T>G (p.Phe582Leu) rs201518545
NM_000179.2(MSH6):c.1754T>C (p.Leu585Pro) rs587779220
NM_000179.2(MSH6):c.1776A>T (p.Val592=) rs56132616
NM_000179.2(MSH6):c.178T>C (p.Leu60=) rs35819209
NM_000179.2(MSH6):c.1794A>G (p.Lys598=) rs786201210
NM_000179.2(MSH6):c.1809G>A (p.Lys603=) rs876660790
NM_000179.2(MSH6):c.1822A>G (p.Ile608Val) rs201613780
NM_000179.2(MSH6):c.1844G>C (p.Cys615Ser) rs730881793
NM_000179.2(MSH6):c.1847C>G (p.Ser616Cys) rs772363120
NM_000179.2(MSH6):c.184C>A (p.Arg62Ser) rs876659508
NM_000179.2(MSH6):c.1867C>G (p.Pro623Ala) rs3136334
NM_000179.2(MSH6):c.1869C>T (p.Pro623=) rs141242295
NM_000179.2(MSH6):c.186C>A (p.Arg62=) rs1042820
NM_000179.2(MSH6):c.1870G>A (p.Gly624Ser) rs868760377
NM_000179.2(MSH6):c.1875C>T (p.Ser625=) rs63749886
NM_000179.2(MSH6):c.187T>C (p.Ser63Pro) rs763702846
NM_000179.2(MSH6):c.1883G>A (p.Trp628Ter) rs863225401
NM_000179.2(MSH6):c.1917G>A (p.Glu639=) rs368059229
NM_000179.2(MSH6):c.1932G>C (p.Arg644Ser) rs34938432
NM_000179.2(MSH6):c.1937A>G (p.Lys646Arg) rs201096652
NM_000179.2(MSH6):c.194C>T (p.Ser65Leu) rs41294984
NM_000179.2(MSH6):c.1974G>A (p.Val658=) rs372916347
NM_000179.2(MSH6):c.2006T>C (p.Ile669Thr) rs555209664
NM_000179.2(MSH6):c.2027A>G (p.Lys676Arg) rs143643688
NM_000179.2(MSH6):c.2030G>C (p.Ser677Thr) rs587779224
NM_000179.2(MSH6):c.2057G>A (p.Gly686Asp) rs587779227
NM_000179.2(MSH6):c.2061T>A (p.Cys687Ter) rs267608068
NM_000179.2(MSH6):c.2141C>G (p.Ser714Cys) rs730881796
NM_000179.2(MSH6):c.2147C>T (p.Thr716Ile) rs587782805
NM_000179.2(MSH6):c.2161A>C (p.Arg721=) rs537604099
NM_000179.2(MSH6):c.2171C>G (p.Ala724Gly) rs587779922
NM_000179.2(MSH6):c.2173A>G (p.Ile725Val) rs148898662
NM_000179.2(MSH6):c.2175C>G (p.Ile725Met) rs63750304
NM_000179.2(MSH6):c.2187C>A (p.Ala729=) rs375610656
NM_000179.2(MSH6):c.2194C>A (p.Arg732=) rs63751127
NM_000179.2(MSH6):c.2230dupG (p.Glu744Glyfs) rs786201050
NM_000179.2(MSH6):c.2239C>T (p.Leu747=) rs63751305
NM_000179.2(MSH6):c.2241G>C (p.Leu747=) rs377722465
NM_000179.2(MSH6):c.2249C>A (p.Thr750Lys) rs730881817
NM_000179.2(MSH6):c.2253T>C (p.Asn751=) rs2020913
NM_000179.2(MSH6):c.2271C>T (p.Thr757=) rs142172006
NM_000179.2(MSH6):c.2272C>T (p.Leu758=) rs56371757
NM_000179.2(MSH6):c.2300C>T (p.Thr767Ile) rs587781462
NM_000179.2(MSH6):c.2302_2304delCCT (p.Pro768del) rs63750647
NM_000179.2(MSH6):c.2314C>A (p.Arg772=) rs63750138
NM_000179.2(MSH6):c.2314C>T (p.Arg772Trp) rs63750138
NM_000179.2(MSH6):c.2319C>T (p.Leu773=) rs63749895
NM_000179.2(MSH6):c.2342C>T (p.Pro781Leu) rs1553413710
NM_000179.2(MSH6):c.234A>G (p.Arg78=) rs1553408414
NM_000179.2(MSH6):c.2384T>C (p.Ile795Thr) rs202127474
NM_000179.2(MSH6):c.2398G>C (p.Val800Leu) rs61748083
NM_000179.2(MSH6):c.2400T>C (p.Val800=) rs267608071
NM_000179.2(MSH6):c.240A>G (p.Val80=) rs864622281
NM_000179.2(MSH6):c.2412A>G (p.Lys804=) rs201460265
NM_000179.2(MSH6):c.2413A>G (p.Ile805Val) rs928923556
NM_000179.2(MSH6):c.2418C>T (p.Ser806=) rs770992427
NM_000179.2(MSH6):c.241G>A (p.Ala81Thr) rs587779239
NM_000179.2(MSH6):c.242C>T (p.Ala81Val) rs587779924
NM_000179.2(MSH6):c.2479A>G (p.Asn827Asp) rs878853716
NM_000179.2(MSH6):c.249T>G (p.Ala83=) rs876658308
NM_000179.2(MSH6):c.251C>T (p.Ala84Val) rs878853717
NM_000179.2(MSH6):c.2520C>T (p.Ser840=) rs781241667
NM_000179.2(MSH6):c.2535dupT (p.Glu846Terfs) rs587779241
NM_000179.2(MSH6):c.255C>A (p.Pro85=) rs587779242
NM_000179.2(MSH6):c.2561A>T (p.Lys854Met) rs34374438
NM_000179.2(MSH6):c.2561_2562delAGinsTT (p.Lys854Ile) rs587780673
NM_000179.2(MSH6):c.2562G>T (p.Lys854Asn) rs759048538
NM_000179.2(MSH6):c.257C>T (p.Thr86Ile) rs768444916
NM_000179.2(MSH6):c.260+10T>G rs193922342
NM_000179.2(MSH6):c.260+22C>G rs55927047
NM_000179.2(MSH6):c.260+2_260+3delTAinsAG rs1064794075
NM_000179.2(MSH6):c.260+4_260+5delGCinsTT rs1064795936
NM_000179.2(MSH6):c.2604G>A (p.Met868Ile) rs749508276
NM_000179.2(MSH6):c.261-14C>A rs369366445
NM_000179.2(MSH6):c.261-1G>C rs863225402
NM_000179.2(MSH6):c.261-36A>G rs1800931
NM_000179.2(MSH6):c.2633T>C (p.Val878Ala) rs2020912
NM_000179.2(MSH6):c.2646T>C (p.Phe882=) rs1190330045
NM_000179.2(MSH6):c.2667G>T (p.Gln889His) rs149945495
NM_000179.2(MSH6):c.267C>T (p.Asp89=) rs762818044
NM_000179.2(MSH6):c.2724A>G (p.Glu908=) rs35389622
NM_000179.2(MSH6):c.2725T>C (p.Leu909=) rs876659785
NM_000179.2(MSH6):c.2765G>A (p.Arg922Gln) rs752839086
NM_000179.2(MSH6):c.276A>G (p.Pro92=) rs1800932
NM_000179.2(MSH6):c.2775A>C (p.Gly925=) rs587779248
NM_000179.2(MSH6):c.2780T>C (p.Ile927Thr) rs587779926
NM_000179.2(MSH6):c.2796C>T (p.Gly932=) rs774105284
NM_000179.2(MSH6):c.2805_2806delTG (p.Asp936Leufs) rs863225403
NM_000179.2(MSH6):c.2857G>A (p.Glu953Lys) rs753034685
NM_000179.2(MSH6):c.2904C>G (p.Val968=) rs150683226
NM_000179.2(MSH6):c.2906A>G (p.Tyr969Cys) rs63749919
NM_000179.2(MSH6):c.2925C>T (p.Asn975=) rs139026662
NM_000179.2(MSH6):c.2926C>T (p.Arg976Cys) rs587782386
NM_000179.2(MSH6):c.2927G>A (p.Arg976His) rs63751113
NM_000179.2(MSH6):c.2932C>T (p.Gln978Ter) rs587781372
NM_000179.2(MSH6):c.2934G>A (p.Gln978=) rs751780309
NM_000179.2(MSH6):c.2940A>G (p.Glu980=) rs730881818
NM_000179.2(MSH6):c.2958C>T (p.Thr986=) rs757866392
NM_000179.2(MSH6):c.2964C>A (p.Arg988=) rs144288981
NM_000179.2(MSH6):c.2979A>G (p.Glu993=) rs370462886
NM_000179.2(MSH6):c.2983G>T (p.Glu995Ter) rs63750258
NM_000179.2(MSH6):c.3015A>G (p.Arg1005=) rs990650403
NM_000179.2(MSH6):c.3018C>A (p.Tyr1006Ter) rs1553414395
NM_000179.2(MSH6):c.3024C>T (p.Thr1008=) rs587780675
NM_000179.2(MSH6):c.3029C>T (p.Thr1010Ile) rs768925694
NM_000179.2(MSH6):c.3037_3041delAAGAA (p.Lys1013Valfs) rs587782712
NM_000179.2(MSH6):c.303G>A (p.Glu101=) rs1057521533
NM_000179.2(MSH6):c.3079G>C (p.Val1027Leu) rs876658397
NM_000179.2(MSH6):c.3098T>A (p.Met1033Lys) rs751035257
NM_000179.2(MSH6):c.3108_3109delGT (p.Phe1037Leufs) rs1553414519
NM_000179.2(MSH6):c.3151G>A (p.Val1051Ile) rs576269342
NM_000179.2(MSH6):c.3160A>T (p.Ile1054Phe) rs267608075
NM_000179.2(MSH6):c.3162C>T (p.Ile1054=) rs149605979
NM_000179.2(MSH6):c.3163G>C (p.Ala1055Pro) rs587779254
NM_000179.2(MSH6):c.3172+171C>T rs3136337
NM_000179.2(MSH6):c.3172+1G>T rs587779255
NM_000179.2(MSH6):c.3172G>C (p.Asp1058His) rs863225404
NM_000179.2(MSH6):c.3173-101G>C rs2072447
NM_000179.2(MSH6):c.3173-10C>A rs587780559
NM_000179.2(MSH6):c.3173-10C>T rs587780559
NM_000179.2(MSH6):c.3173-10_3173-6delCTTTT rs781520783
NM_000179.2(MSH6):c.3173-18T>A rs189672273
NM_000179.2(MSH6):c.3173-18T>C rs189672273
NM_000179.2(MSH6):c.3173-1G>C rs397515875
NM_000179.2(MSH6):c.3173-1_3173delGA rs587779256
NM_000179.2(MSH6):c.3188T>G (p.Leu1063Arg) rs1060502901
NM_000179.2(MSH6):c.3198T>C (p.Tyr1066=) rs199643502
NM_000179.2(MSH6):c.3203G>A (p.Arg1068Gln) rs398123230
NM_000179.2(MSH6):c.3217C>T (p.Pro1073Ser) rs142254875
NM_000179.2(MSH6):c.321T>C (p.Pro107=) rs730881823
NM_000179.2(MSH6):c.3226C>G (p.Arg1076Gly) rs63750617
NM_000179.2(MSH6):c.3226C>T (p.Arg1076Cys) rs63750617
NM_000179.2(MSH6):c.3238_3239delCT (p.Leu1080Valfs) rs863225406
NM_000179.2(MSH6):c.3245C>T (p.Pro1082Leu) rs191109849
NM_000179.2(MSH6):c.3246G>A (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3246G>C (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3246G>T (p.Pro1082=) rs3136351
NM_000179.2(MSH6):c.3259C>A (p.Pro1087Thr) rs63750998
NM_000179.2(MSH6):c.3259C>G (p.Pro1087Ala) rs63750998
NM_000179.2(MSH6):c.3259C>T (p.Pro1087Ser) rs63750998
NM_000179.2(MSH6):c.3260C>G (p.Pro1087Arg) rs63750753
NM_000179.2(MSH6):c.3261dupC (p.Phe1088Leufs) rs267608078
NM_000179.2(MSH6):c.3264C>T (p.Phe1088=) rs35621414
NM_000179.2(MSH6):c.3265T>C (p.Leu1089=) rs34490141
NM_000179.2(MSH6):c.3283C>T (p.Arg1095Cys) rs376243329
NM_000179.2(MSH6):c.3284G>A (p.Arg1095His) rs63750253
NM_000179.2(MSH6):c.3299C>G (p.Thr1100Arg) rs63750442
NM_000179.2(MSH6):c.3300G>A (p.Thr1100=) rs540252208
NM_000179.2(MSH6):c.3306T>A (p.Thr1102=) rs2020910
NM_000179.2(MSH6):c.3334G>A (p.Asp1112Asn) rs773955368
NM_000179.2(MSH6):c.333C>T (p.Tyr111=) rs786202772
NM_000179.2(MSH6):c.3354G>A (p.Glu1118=) rs35642130
NM_000179.2(MSH6):c.3384T>C (p.Tyr1128=) rs544518097
NM_000179.2(MSH6):c.3386_3388delGTG (p.Cys1129_Val1130delinsLeu) rs587776705
NM_000179.2(MSH6):c.3399T>C (p.Thr1133=) rs61748084
NM_000179.2(MSH6):c.339C>T (p.His113=) rs886056141
NM_000179.2(MSH6):c.33C>G (p.Phe11Leu) rs747802641
NM_000179.2(MSH6):c.3400G>C (p.Gly1134Arg) rs1114167697
NM_000179.2(MSH6):c.3426G>A (p.Thr1142=) rs747771350
NM_000179.2(MSH6):c.3431T>G (p.Met1144Arg) rs864622607
NM_000179.2(MSH6):c.3438+11_3438+14delCTTA rs377746844
NM_000179.2(MSH6):c.3438+13dupT rs267608097
NM_000179.2(MSH6):c.3438+14A>T rs2020911
NM_000179.2(MSH6):c.3438+17G>C rs759737239
NM_000179.2(MSH6):c.3438+6T>C rs370170322
NM_000179.2(MSH6):c.3439-10T>A rs730881819
NM_000179.2(MSH6):c.3439-16C>T rs192614006
NM_000179.2(MSH6):c.3439-1G>T rs587779263
NM_000179.2(MSH6):c.3439-2A>G rs267608098
NM_000179.2(MSH6):c.3463C>T (p.Gln1155Ter) rs1553332166
NM_000179.2(MSH6):c.3476dupA (p.Tyr1159Terfs) rs587782111
NM_000179.2(MSH6):c.3477C>A (p.Tyr1159Ter) rs398123231
NM_000179.2(MSH6):c.3477C>T (p.Tyr1159=) rs398123231
NM_000179.2(MSH6):c.3478G>A (p.Val1160Ile) rs376799914
NM_000179.2(MSH6):c.3485_3487delCTG (p.Ala1162del) rs63751427
NM_000179.2(MSH6):c.3488A>T (p.Glu1163Val) rs63750252
NM_000179.2(MSH6):c.3513T>C (p.Asp1171=) rs63749834
NM_000179.2(MSH6):c.3528_3532delACTTG (p.Leu1177Cysfs) rs863225408
NM_000179.2(MSH6):c.3537C>G (p.Ala1179=) rs200120044
NM_000179.2(MSH6):c.3556+1delG rs1064793489
NM_000179.2(MSH6):c.3556+36_3556+39delGTCA rs55684722
NM_000179.2(MSH6):c.3557-17delA rs778393939
NM_000179.2(MSH6):c.3557-2dup rs587779271
NM_000179.2(MSH6):c.3557-3A>T rs41295274
NM_000179.2(MSH6):c.3557-40T>A rs189436849
NM_000179.2(MSH6):c.3557-4T>A rs1553332598
NM_000179.2(MSH6):c.3557-4delT rs267608102
NM_000179.2(MSH6):c.3557-4dupT rs267608102
NM_000179.2(MSH6):c.3557-7_3557-4delTTTT rs267608102
NM_000179.2(MSH6):c.3574delG (p.Val1192Leufs) rs1553332671
NM_000179.2(MSH6):c.3577G>A (p.Glu1193Lys) rs63751328
NM_000179.2(MSH6):c.359T>C (p.Ile120Thr) rs775971872
NM_000179.2(MSH6):c.3601C>G (p.Leu1201Val) rs182024561
NM_000179.2(MSH6):c.3605T>C (p.Met1202Thr) rs587779273
NM_000179.2(MSH6):c.3632T>C (p.Leu1211Pro) rs864622041
NM_000179.2(MSH6):c.3636G>T (p.Val1212=) rs1363247790
NM_000179.2(MSH6):c.363C>T (p.Arg121=) rs587779276
NM_000179.2(MSH6):c.3646+35_3646+38delATCT rs1805181
NM_000179.2(MSH6):c.3646+91T>C rs3136359
NM_000179.2(MSH6):c.3647-51_3647-35dup rs267607687
NM_000179.2(MSH6):c.3647-6T>A rs182871847
NM_000179.2(MSH6):c.3647-6T>C rs182871847
NM_000179.2(MSH6):c.364G>A (p.Glu122Lys) rs143036974
NM_000179.2(MSH6):c.3656C>T (p.Thr1219Ile) rs63750949
NM_000179.2(MSH6):c.3660_3663dup (p.Phe1222Asnfs) rs752404604
NM_000179.2(MSH6):c.3675G>A (p.Thr1225=) rs730881820
NM_000179.2(MSH6):c.3699_3702dupAGAA (p.Leu1235Argfs) rs193922343
NM_000179.2(MSH6):c.3705T>C (p.Leu1235=) rs545552712
NM_000179.2(MSH6):c.3716_3717delTA (p.Ile1239Lysfs) rs1064794384
NM_000179.2(MSH6):c.3722G>A (p.Cys1241Tyr) rs1021631442
NM_000179.2(MSH6):c.3724C>A (p.Arg1242Ser) rs587779285
NM_000179.2(MSH6):c.3724_3726delCGT (p.Arg1242del) rs63749942
NM_000179.2(MSH6):c.3725G>A (p.Arg1242His) rs63750119
NM_000179.2(MSH6):c.3727A>T (p.Thr1243Ser) rs147453999
NM_000179.2(MSH6):c.3729A>G (p.Thr1243=) rs773807182
NM_000179.2(MSH6):c.3744_3773del30 (p.His1248_Ser1257del) rs863225412
NM_000179.2(MSH6):c.3753_3756dupATTA (p.Val1253Ilefs) rs876661222
NM_000179.2(MSH6):c.3762A>T (p.Glu1254Asp) rs375459388
NM_000179.2(MSH6):c.3786G>A (p.Val1262=) rs760771483
NM_000179.2(MSH6):c.3787C>T (p.Arg1263Cys) rs367912290
NM_000179.2(MSH6):c.3798_3801+9delTATGGTATGTGCA rs1553333168
NM_000179.2(MSH6):c.3799_3800delAT (p.Met1267Glyfs) rs267608114
NM_000179.2(MSH6):c.3801+14G>T rs755626529
NM_000179.2(MSH6):c.3801+17T>C rs3136365
NM_000179.2(MSH6):c.3801+4T>C rs758830540
NM_000179.2(MSH6):c.3801+5G>A rs201080919
NM_000179.2(MSH6):c.3802-40C>G rs3136367
NM_000179.2(MSH6):c.3802-43dupT rs34154602
NM_000179.2(MSH6):c.3802-6_3802-4delCTT rs587781932
NM_000179.2(MSH6):c.3802-7_3802-4delTCTT rs876661171
NM_000179.2(MSH6):c.3807C>T (p.Cys1269=) rs747924946
NM_000179.2(MSH6):c.3814_3827dup (p.Asp1277Lysfs)
NM_000179.2(MSH6):c.3832C>A (p.Pro1278Thr) rs587782109
NM_000179.2(MSH6):c.3833C>G (p.Pro1278Arg) rs201191389
NM_000179.2(MSH6):c.3840_3846delGGAGACT (p.Glu1281Leufs) rs63751319
NM_000179.2(MSH6):c.3841_3847dup (p.Ile1283Argfs) rs1114167720
NM_000179.2(MSH6):c.3850dup (p.Thr1284Asnfs) rs1553333421
NM_000179.2(MSH6):c.3851C>T (p.Thr1284Met) rs63750836
NM_000179.2(MSH6):c.3852G>A (p.Thr1284=) rs2229018
NM_000179.2(MSH6):c.3852G>T (p.Thr1284=) rs2229018
NM_000179.2(MSH6):c.3878_3881dupCTTG (p.Pro1295Leufs) rs1553333500
NM_000179.2(MSH6):c.3879T>C (p.Ala1293=) rs752369374
NM_000179.2(MSH6):c.38A>G (p.Lys13Arg) rs41294988
NM_000179.2(MSH6):c.3911G>A (p.Arg1304Lys) rs34625968
NM_000179.2(MSH6):c.3922_3944dup (p.Lys1315Asnfs) rs1553333599
NM_000179.2(MSH6):c.3930G>A (p.Glu1310=)
NM_000179.2(MSH6):c.3935_3954dup (p.Lys1319Leufs) rs1553333644
NM_000179.2(MSH6):c.3936T>C (p.Val1312=) rs61753796
NM_000179.2(MSH6):c.3939_3940dupTC (p.Gln1314Leufs) rs730881830
NM_000179.2(MSH6):c.393A>C (p.Val131=) rs752488540
NM_000179.2(MSH6):c.3951T>C (p.His1317=) rs764786814
NM_000179.2(MSH6):c.3960A>G (p.Ala1320=) rs373425206
NM_000179.2(MSH6):c.3961A>G (p.Arg1321Gly) rs41295278
NM_000179.2(MSH6):c.3980_3983dupATCA (p.Leu1330Valfs) rs1553333738
NM_000179.2(MSH6):c.3986C>T (p.Ser1329Leu) rs199594809
NM_000179.2(MSH6):c.3988C>T (p.Leu1330=) rs768944975
NM_000179.2(MSH6):c.3991C>T (p.Arg1331Ter) rs267608094
NM_000179.2(MSH6):c.3999dupT (p.Arg1334Serfs) rs863225418
NM_000179.2(MSH6):c.3G>T (p.Met1Ile) rs876660095
NM_000179.2(MSH6):c.4001+11_4001+15dupAACTA rs587779302
NM_000179.2(MSH6):c.4001+11_4001+35delAACTATAATGGAATTATAACTAACT rs878853743
NM_000179.2(MSH6):c.4001+12_4001+15dupACTA rs267608132
NM_000179.2(MSH6):c.4001+2_4001+5delTAAC rs267608132
NM_000179.2(MSH6):c.4001+32_4001+35dup rs267608136
NM_000179.2(MSH6):c.4001+4_4001+8dupACTAA rs587782853
NM_000179.2(MSH6):c.4001+5C>G rs786202305
NM_000179.2(MSH6):c.4001G>A (p.Arg1334Gln) rs267608122
NM_000179.2(MSH6):c.4001G>C (p.Arg1334Pro) rs267608122
NM_000179.2(MSH6):c.4002-10T>A rs545466048
NM_000179.2(MSH6):c.4002-10T>G rs545466048
NM_000179.2(MSH6):c.4002-10delT rs59056100
NM_000179.2(MSH6):c.4002-14T>C rs587781041
NM_000179.2(MSH6):c.4002-19T>C rs730881821
NM_000179.2(MSH6):c.4002-4T>C rs370428032
NM_000179.2(MSH6):c.4002-8dupA rs267608139
NM_000179.2(MSH6):c.4004_4007dupAAGT (p.Cys1337Serfs) rs876658497
NM_000179.2(MSH6):c.4028C>G (p.Ser1343Ter) rs863225420
NM_000179.2(MSH6):c.4068_4071dupGATT (p.Lys1358Aspfs) rs55740729
NM_000179.2(MSH6):c.4071_*4dup rs1491544951
NM_000179.2(MSH6):c.431G>T (p.Ser144Ile) rs3211299
NM_000179.2(MSH6):c.432C>T (p.Ser144=) rs1046304919
NM_000179.2(MSH6):c.457+13A>G rs1800933
NM_000179.2(MSH6):c.457+52T>A rs3136282
NM_000179.2(MSH6):c.457+7G>C rs781280171
NM_000179.2(MSH6):c.458-17A>G rs554847828
NM_000179.2(MSH6):c.475G>A (p.Ala159Thr) rs1553411396
NM_000179.2(MSH6):c.476C>T (p.Ala159Val) rs587778528
NM_000179.2(MSH6):c.483G>A (p.Lys161=) rs63751030
NM_000179.2(MSH6):c.491A>C (p.His164Pro) rs146469162
NM_000179.2(MSH6):c.498C>T (p.Tyr166=) rs587779313
NM_000179.2(MSH6):c.503C>G (p.Ala168Gly) rs774162322
NM_000179.2(MSH6):c.513A>G (p.Glu171=) rs786201116
NM_000179.2(MSH6):c.532C>T (p.Arg178Cys) rs730881813
NM_000179.2(MSH6):c.540T>C (p.Asp180=) rs1800935
NM_000179.2(MSH6):c.59C>T (p.Ala20Val) rs63750664
NM_000179.2(MSH6):c.603G>A (p.Glu201=) rs587779314
NM_000179.2(MSH6):c.615A>G (p.Glu205=) rs1334827373
NM_000179.2(MSH6):c.627+3G>A rs876659495
NM_000179.2(MSH6):c.628-17C>A rs369971640
NM_000179.2(MSH6):c.628-56C>T rs1800936
NM_000179.2(MSH6):c.628-7C>A rs373129248
NM_000179.2(MSH6):c.628-7C>T rs373129248
NM_000179.2(MSH6):c.628-8C>G rs767991179
NM_000179.2(MSH6):c.631G>A (p.Gly211Ser) rs786204153
NM_000179.2(MSH6):c.63C>G (p.Asn21Lys) rs876660097
NM_000179.2(MSH6):c.642C>T (p.Tyr214=) rs1800937
NM_000179.2(MSH6):c.643G>A (p.Val215Ile) rs145959653
NM_000179.2(MSH6):c.660A>C (p.Glu220Asp) rs1800938
NM_000179.2(MSH6):c.663A>C (p.Glu221Asp) rs41557217
NM_000179.2(MSH6):c.668A>G (p.Asn223Ser) rs587779316
NM_000179.2(MSH6):c.73G>T (p.Ala25Ser) rs267608026
NM_000179.2(MSH6):c.741dupA (p.Arg248Thrfs) rs267608041
NM_000179.2(MSH6):c.840T>C (p.Ser280=) rs767974147
NM_000179.2(MSH6):c.866_867delGCinsAA (p.Gly289Glu) rs267608079
NM_000179.2(MSH6):c.869T>C (p.Leu290Pro) rs751309721
NM_000179.2(MSH6):c.884A>G (p.Lys295Arg) rs267608051
NM_000179.2(MSH6):c.892C>T (p.Arg298Ter) rs146816935
NM_000179.2(MSH6):c.905G>A (p.Arg302Lys) rs587781510
NM_000179.2(MSH6):c.908dupT (p.Met303Ilefs) rs1057517551
NM_000179.2(MSH6):c.926C>G (p.Ser309Cys) rs544222338
NM_000179.2(MSH6):c.93C>T (p.Gly31=) rs370817805
NM_000179.2(MSH6):c.942C>G (p.Ser314Arg) rs150440246
NM_000179.2(MSH6):c.945T>G (p.Ser315=) rs761581941
NM_000179.2(MSH6):c.956C>T (p.Thr319Met) rs188252826
NM_000179.2(MSH6):c.957G>A (p.Thr319=) rs375210430
NM_000179.2(MSH6):c.957G>C (p.Thr319=) rs375210430
NM_000179.2(MSH6):c.984C>T (p.Ser328=) rs138143769
NM_000179.2(MSH6):c.998C>T (p.Thr333Ile) rs587781983

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.