ClinVar Miner

Variants in gene MYBPC3 with conflicting interpretations

Y axis minimum submission review status: Y axis collection method:
X axis minimum submission review status: X axis collection method:
Minimum conflict level:
Gene type:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
808 360 0 167 72 0 76 281

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

pathogenic likely pathogenic uncertain significance likely benign benign
pathogenic 0 101 25 2 1
likely pathogenic 101 0 66 1 0
uncertain significance 25 66 0 67 20
likely benign 2 1 67 0 66
benign 1 0 20 66 0

All variants with conflicting interpretations #

Total variants: 281
Download table as spreadsheet
HGVS dbSNP
NM_000256.3(MYBPC3):c.1000G>A (p.Glu334Lys) rs573916965
NM_000256.3(MYBPC3):c.1015C>T (p.Gln339Ter) rs730880631
NM_000256.3(MYBPC3):c.1038C>T (p.Arg346=) rs758016271
NM_000256.3(MYBPC3):c.1039G>A (p.Gly347Ser) rs397515884
NM_000256.3(MYBPC3):c.1070G>A (p.Arg357His) rs199741162
NM_000256.3(MYBPC3):c.1084dupA (p.Ser362Lysfs) rs730880723
NM_000256.3(MYBPC3):c.108A>G (p.Ala36=) rs754870909
NM_000256.3(MYBPC3):c.1090G>A (p.Ala364Thr) rs794727046
NM_000256.3(MYBPC3):c.1144C>T (p.Arg382Trp) rs11570076
NM_000256.3(MYBPC3):c.1153_1168delGTGGAACTGGCTGACC (p.Val385Metfs) rs869025465
NM_000256.3(MYBPC3):c.1223+1G>A rs730880639
NM_000256.3(MYBPC3):c.1224-19G>A rs587776699
NM_000256.3(MYBPC3):c.1224-2A>G rs397515891
NM_000256.3(MYBPC3):c.1227-10C>T rs374673836
NM_000256.3(MYBPC3):c.1227-13G>A rs397515893
NM_000256.3(MYBPC3):c.1227-2A>G rs730880531
NM_000256.3(MYBPC3):c.1238A>G (p.Glu413Gly) rs730880532
NM_000256.3(MYBPC3):c.1286C>T (p.Ala429Val) rs370412052
NM_000256.3(MYBPC3):c.12G>A (p.Pro4=) rs377292092
NM_000256.3(MYBPC3):c.1320C>T (p.Gly440=) rs368192024
NM_000256.3(MYBPC3):c.1351+1G>A rs727503204
NM_000256.3(MYBPC3):c.1358dupC (p.Val454Cysfs) rs727503203
NM_000256.3(MYBPC3):c.1370C>T (p.Thr457Met) rs370538243
NM_000256.3(MYBPC3):c.1371G>A (p.Thr457=)
NM_000256.3(MYBPC3):c.13G>C (p.Gly5Arg) rs201278114
NM_000256.3(MYBPC3):c.1404delG (p.Gln469Serfs) rs886037900
NM_000256.3(MYBPC3):c.1418T>C (p.Phe473Ser) rs397515900
NM_000256.3(MYBPC3):c.1458-6G>A rs375347534
NM_000256.3(MYBPC3):c.1458-7C>T rs397515904
NM_000256.3(MYBPC3):c.1467C>T (p.Asp489=) rs35690719
NM_000256.3(MYBPC3):c.1468G>A (p.Gly490Arg) rs200625851
NM_000256.3(MYBPC3):c.1483C>G (p.Arg495Gly) rs397515905
NM_000256.3(MYBPC3):c.1483C>T (p.Arg495Trp) rs397515905
NM_000256.3(MYBPC3):c.1484G>A (p.Arg495Gln) rs200411226
NM_000256.3(MYBPC3):c.148A>G (p.Ser50Gly) rs373164247
NM_000256.3(MYBPC3):c.1504C>T (p.Arg502Trp) rs375882485
NM_000256.3(MYBPC3):c.1505G>A (p.Arg502Gln) rs397515907
NM_000256.3(MYBPC3):c.1513_1515delAAG (p.Lys505del) rs727504287
NM_000256.3(MYBPC3):c.1519G>A (p.Gly507Arg) rs35736435
NM_000256.3(MYBPC3):c.1522C>T (p.Gln508Ter) rs730880544
NM_000256.3(MYBPC3):c.1544A>G (p.Asn515Ser) rs181834806
NM_000256.3(MYBPC3):c.1564G>A (p.Ala522Thr) rs11570082
NM_000256.3(MYBPC3):c.1566G>A (p.Ala522=) rs376041792
NM_000256.3(MYBPC3):c.1575T>G (p.Tyr525Ter) rs397515910
NM_000256.3(MYBPC3):c.1577_1580dupCACT (p.Cys528Thrfs) rs730880712
NM_000256.3(MYBPC3):c.1591G>A (p.Gly531Arg) rs397515912
NM_000256.3(MYBPC3):c.1591G>C (p.Gly531Arg) rs397515912
NM_000256.3(MYBPC3):c.1602G>A (p.Ala534=) rs370945942
NM_000256.3(MYBPC3):c.1608T>A (p.Ala536=) rs200224422
NM_000256.3(MYBPC3):c.1622dup (p.Glu542Glyfs) rs1555122143
NM_000256.3(MYBPC3):c.1624+2T>C rs111437311
NM_000256.3(MYBPC3):c.1624+4A>T rs397515916
NM_000256.3(MYBPC3):c.1624G>C (p.Glu542Gln) rs121909374
NM_000256.3(MYBPC3):c.1641_1642delGT (p.Tyr548Profs) rs398123279
NM_000256.3(MYBPC3):c.1654G>T (p.Ala552Ser) rs727504887
NM_000256.3(MYBPC3):c.166G>A (p.Gly56Ser) rs397515918
NM_000256.3(MYBPC3):c.1720C>A (p.Arg574=) rs61897383
NM_000256.3(MYBPC3):c.1720C>T (p.Arg574Trp) rs61897383
NM_000256.3(MYBPC3):c.1786G>A (p.Gly596Arg) rs199728019
NM_000256.3(MYBPC3):c.1790+7G>A rs374852831
NM_000256.3(MYBPC3):c.1790G>A (p.Arg597Gln) rs727503195
NM_000256.3(MYBPC3):c.1812C>T (p.Asp604=) rs397515929
NM_000256.3(MYBPC3):c.1813G>A (p.Asp605Asn) rs376736293
NM_000256.3(MYBPC3):c.1826C>T (p.Ala609Val) rs730880553
NM_000256.3(MYBPC3):c.1827C>G (p.Ala609=) rs535853707
NM_000256.3(MYBPC3):c.1828G>A (p.Asp610Asn) rs371564200
NM_000256.3(MYBPC3):c.1828G>C (p.Asp610His) rs371564200
NM_000256.3(MYBPC3):c.1829A>T (p.Asp610Val) rs730880554
NM_000256.3(MYBPC3):c.1831G>A (p.Glu611Lys) rs730880555
NM_000256.3(MYBPC3):c.1838dupA (p.Asp613Glufs) rs730880649
NM_000256.3(MYBPC3):c.1841A>G (p.Tyr614Cys) rs727503194
NM_000256.3(MYBPC3):c.1855G>A (p.Glu619Lys) rs200352299
NM_000256.3(MYBPC3):c.1863C>T (p.Phe621=) rs193922378
NM_000256.3(MYBPC3):c.1869C>A (p.Cys623Ter) rs397515932
NM_000256.3(MYBPC3):c.1869C>T (p.Cys623=) rs397515932
NM_000256.3(MYBPC3):c.1898-1G>A rs730880558
NM_000256.3(MYBPC3):c.1934C>T (p.Pro645Leu) rs397515938
NM_000256.3(MYBPC3):c.1989T>A (p.Ala663=) rs375467797
NM_000256.3(MYBPC3):c.2003G>A (p.Arg668His) rs727503191
NM_000256.3(MYBPC3):c.2048G>A (p.Trp683Ter) rs397515942
NM_000256.3(MYBPC3):c.2065C>T (p.Gln689Ter) rs863224483
NM_000256.3(MYBPC3):c.206G>A (p.Arg69Gln) rs397515945
NM_000256.3(MYBPC3):c.2148+6_2148+9delTGAG rs397515949
NM_000256.3(MYBPC3):c.2149-5C>T rs36211722
NM_000256.3(MYBPC3):c.2149-8C>G rs397515950
NM_000256.3(MYBPC3):c.2179G>A (p.Val727Met) rs564378953
NM_000256.3(MYBPC3):c.2234A>G (p.Asp745Gly) rs727503190
NM_000256.3(MYBPC3):c.223G>A (p.Asp75Asn) rs375471260
NM_000256.3(MYBPC3):c.2274C>T (p.Gly758=) rs397515957
NM_000256.3(MYBPC3):c.2308+12C>T rs727505335
NM_000256.3(MYBPC3):c.2308G>A (p.Asp770Asn) rs36211723
NM_000256.3(MYBPC3):c.2311G>A (p.Val771Met) rs371488302
NM_000256.3(MYBPC3):c.2371C>T (p.Gln791Ter) rs863225106
NM_000256.3(MYBPC3):c.2374T>C (p.Trp792Arg) rs187830361
NM_000256.3(MYBPC3):c.2381C>T (p.Pro794Leu) rs730880565
NM_000256.3(MYBPC3):c.2394dupT (p.Gly799Trpfs) rs730880341
NM_000256.3(MYBPC3):c.2397C>T (p.Gly799=) rs756512665
NM_000256.3(MYBPC3):c.2429G>A (p.Arg810His) rs375675796
NM_000256.3(MYBPC3):c.2429G>T (p.Arg810Leu) rs375675796
NM_000256.3(MYBPC3):c.2441_2443delAGA (p.Lys814del) rs727504288
NM_000256.3(MYBPC3):c.2449C>T (p.Arg817Trp) rs727503188
NM_000256.3(MYBPC3):c.2450G>A (p.Arg817Gln) rs397515964
NM_000256.3(MYBPC3):c.2458C>T (p.Arg820Trp) rs775404728
NM_000256.3(MYBPC3):c.2459G>A (p.Arg820Gln) rs2856655
NM_000256.3(MYBPC3):c.2460G>A (p.Arg820=) rs532996422
NM_000256.3(MYBPC3):c.246T>C (p.Ile82=) rs372502369
NM_000256.3(MYBPC3):c.2487G>T (p.Leu829=) rs201040413
NM_000256.3(MYBPC3):c.2490dupT (p.His831Serfs) rs397515966
NM_000256.3(MYBPC3):c.2497G>A (p.Ala833Thr) rs199865688
NM_000256.3(MYBPC3):c.2498C>T (p.Ala833Val) rs3729952
NM_000256.3(MYBPC3):c.2511delC (p.Ile837Metfs) rs730880653
NM_000256.3(MYBPC3):c.2534G>A (p.Arg845His) rs730880568
NM_000256.3(MYBPC3):c.2541C>G (p.Tyr847Ter) rs397515974
NM_000256.3(MYBPC3):c.2547C>T (p.Val849=) rs3729953
NM_000256.3(MYBPC3):c.26-2A>G rs376395543
NM_000256.3(MYBPC3):c.2601C>T (p.Ile867=) rs11570097
NM_000256.3(MYBPC3):c.2603-1G>C rs977277400
NM_000256.3(MYBPC3):c.2610delC (p.Ser871Alafs) rs397515979
NM_000256.3(MYBPC3):c.2610dupC (p.Ser871Glnfs) rs397515979
NM_000256.3(MYBPC3):c.2614G>A (p.Glu872Lys) rs190765116
NM_000256.3(MYBPC3):c.2618C>A (p.Pro873His) rs371401403
NM_000256.3(MYBPC3):c.2618C>T (p.Pro873Leu) rs371401403
NM_000256.3(MYBPC3):c.2640C>T (p.Asp880=) rs397515980
NM_000256.3(MYBPC3):c.2670G>A (p.Trp890Ter) rs397515982
NM_000256.3(MYBPC3):c.2671C>T (p.Arg891Trp) rs727504418
NM_000256.3(MYBPC3):c.2686G>A (p.Val896Met) rs35078470
NM_000256.3(MYBPC3):c.2737+12C>T rs3729936
NM_000256.3(MYBPC3):c.2737+5G>A rs398123280
NM_000256.3(MYBPC3):c.2792dupT (p.Lys932Glufs) rs730880716
NM_000256.3(MYBPC3):c.2800C>T (p.Leu934=) rs367980215
NM_000256.3(MYBPC3):c.2808G>A (p.Thr936=) rs370530334
NM_000256.3(MYBPC3):c.2833_2834delCG (p.Arg945Glyfs) rs397515987
NM_000256.3(MYBPC3):c.284T>C (p.Ile95Thr) rs727504945
NM_000256.3(MYBPC3):c.2864_2865delCT (p.Pro955Argfs) rs397515990
NM_000256.3(MYBPC3):c.2870C>G (p.Thr957Ser) rs193922380
NM_000256.3(MYBPC3):c.2873C>T (p.Thr958Ile) rs376504548
NM_000256.3(MYBPC3):c.2877G>A (p.Thr959=) rs727503181
NM_000256.3(MYBPC3):c.2904G>C (p.Leu968=) rs747974933
NM_000256.3(MYBPC3):c.2905+1G>A rs397515991
NM_000256.3(MYBPC3):c.2905+5G>T rs193922381
NM_000256.3(MYBPC3):c.290C>T (p.Ala97Val) rs397515993
NM_000256.3(MYBPC3):c.2942A>C (p.Gln981Pro) rs730880582
NM_000256.3(MYBPC3):c.2961C>T (p.Val987=) rs761700877
NM_000256.3(MYBPC3):c.2992C>G (p.Gln998Glu) rs11570112
NM_000256.3(MYBPC3):c.2994G>A (p.Gln998=) rs1555120639
NM_000256.3(MYBPC3):c.2995-5C>G rs376083315
NM_000256.3(MYBPC3):c.2997C>T (p.Gly999=) rs377283955
NM_000256.3(MYBPC3):c.299_308delCAGAGCCCAT (p.Ala100Glyfs)
NM_000256.3(MYBPC3):c.3004C>T (p.Arg1002Trp) rs3729799
NM_000256.3(MYBPC3):c.3005G>A (p.Arg1002Gln) rs727504235
NM_000256.3(MYBPC3):c.3019T>C (p.Trp1007Arg) rs730880585
NM_000256.3(MYBPC3):c.3048C>T (p.Gly1016=) rs397515998
NM_000256.3(MYBPC3):c.3049G>A (p.Glu1017Lys) rs368180702
NM_000256.3(MYBPC3):c.305_308dup (p.Met103Ilefs) rs1555123633
NM_000256.3(MYBPC3):c.3065G>C (p.Arg1022Pro) rs397516000
NM_000256.3(MYBPC3):c.3083C>T (p.Thr1028Ile) rs397516002
NM_000256.3(MYBPC3):c.3102C>T (p.Ala1034=) rs200663253
NM_000256.3(MYBPC3):c.3106C>T (p.Arg1036Cys) rs61729664
NM_000256.3(MYBPC3):c.3107G>A (p.Arg1036His) rs374255381
NM_000256.3(MYBPC3):c.3137C>T (p.Thr1046Met) rs371061770
NM_000256.3(MYBPC3):c.3138G>A (p.Thr1046=) rs762154672
NM_000256.3(MYBPC3):c.3190+5G>A rs587782958
NM_000256.3(MYBPC3):c.3191-7C>T rs373012629
NM_000256.3(MYBPC3):c.3217dupC (p.Arg1073Profs) rs730880668
NM_000256.3(MYBPC3):c.3229G>A (p.Ala1077Thr) rs397516009
NM_000256.3(MYBPC3):c.3253G>T (p.Glu1085Ter) rs397516010
NM_000256.3(MYBPC3):c.3276C>T (p.Val1092=) rs376344765
NM_000256.3(MYBPC3):c.3279C>T (p.Gly1093=) rs36212064
NM_000256.3(MYBPC3):c.3285G>A (p.Thr1095=) rs367927327
NM_000256.3(MYBPC3):c.3286G>T (p.Glu1096Ter) rs121909377
NM_000256.3(MYBPC3):c.3288G>A (p.Glu1096=) rs1052373
NM_000256.3(MYBPC3):c.3297dupG (p.Tyr1100Valfs) rs397516014
NM_000256.3(MYBPC3):c.3315C>A (p.Ala1105=) rs200372325
NM_000256.3(MYBPC3):c.3315C>T (p.Ala1105=) rs200372325
NM_000256.3(MYBPC3):c.3326C>T (p.Thr1109Ile) rs397516016
NM_000256.3(MYBPC3):c.332C>T (p.Ala111Val) rs730880530
NM_000256.3(MYBPC3):c.3330+2T>G rs387906397
NM_000256.3(MYBPC3):c.3330+5G>C rs373746463
NM_000256.3(MYBPC3):c.3330+5G>T rs373746463
NM_000256.3(MYBPC3):c.3331-2A>C rs869025469
NM_000256.3(MYBPC3):c.3332_3335dupAGTG (p.Trp1112Terfs) rs730880337
NM_000256.3(MYBPC3):c.3362G>A (p.Arg1121His) rs397516018
NM_000256.3(MYBPC3):c.3373G>A (p.Val1125Met) rs121909378
NM_000256.3(MYBPC3):c.3407_3409delACT (p.Tyr1136del) rs730880674
NM_000256.3(MYBPC3):c.3413G>A (p.Arg1138His) rs187705120
NM_000256.3(MYBPC3):c.3472G>A (p.Val1158Ile) rs542350927
NM_000256.3(MYBPC3):c.3490+1G>T rs397516020
NM_000256.3(MYBPC3):c.3491-2A>T rs397516022
NM_000256.3(MYBPC3):c.3491-3C>G rs730880592
NM_000256.3(MYBPC3):c.3535G>A (p.Glu1179Lys) rs199669878
NM_000256.3(MYBPC3):c.357delA (p.Ala120Profs) rs869025463
NM_000256.3(MYBPC3):c.3581C>T (p.Ala1194Val) rs730880594
NM_000256.3(MYBPC3):c.3584G>T (p.Gly1195Val) rs730880595
NM_000256.3(MYBPC3):c.3599T>C (p.Leu1200Pro) rs397516028
NM_000256.3(MYBPC3):c.3613C>T (p.Arg1205Trp) rs727503171
NM_000256.3(MYBPC3):c.3624dupC (p.Lys1209Glnfs) rs397516029
NM_000256.3(MYBPC3):c.3627G>A (p.Lys1209=) rs1555120261
NM_000256.3(MYBPC3):c.3628-41_3628-17delAGCCTGGATGGCTTCCCTCCCTCTC rs36212066
NM_000256.3(MYBPC3):c.3628-6T>C rs1057520329
NM_000256.3(MYBPC3):c.362C>T (p.Pro121Leu) rs551888783
NM_000256.3(MYBPC3):c.3642G>A (p.Trp1214Ter) rs368765949
NM_000256.3(MYBPC3):c.3672C>T (p.Asp1224=) rs368221517
NM_000256.3(MYBPC3):c.3682C>T (p.Arg1228Cys) rs201312636
NM_000256.3(MYBPC3):c.3697C>T (p.Gln1233Ter) rs397516037
NM_000256.3(MYBPC3):c.3699G>A (p.Gln1233=) rs200162906
NM_000256.3(MYBPC3):c.3732C>A (p.Cys1244Ter) rs730880600
NM_000256.3(MYBPC3):c.3735delC (p.Phe1246Leufs) rs397516038
NM_000256.3(MYBPC3):c.373_374delGC (p.Ala125Terfs) rs1057517767
NM_000256.3(MYBPC3):c.3741C>T (p.Asp1247=) rs543376073
NM_000256.3(MYBPC3):c.3742_3759dup18 (p.Cys1253_Arg1254insGlyGlyIleTyrValCys) rs193922384
NM_000256.3(MYBPC3):c.3746G>T (p.Gly1249Val) rs727504259
NM_000256.3(MYBPC3):c.3763G>A (p.Ala1255Thr) rs727503167
NM_000256.3(MYBPC3):c.3771C>A (p.Asn1257Lys) rs730880603
NM_000256.3(MYBPC3):c.3773T>G (p.Leu1258Ter) rs730880604
NM_000256.3(MYBPC3):c.3776delA (p.Gln1259Argfs) rs727503166
NM_000256.3(MYBPC3):c.3791G>T (p.Cys1264Phe) rs397514751
NM_000256.3(MYBPC3):c.3797G>A (p.Cys1266Tyr) rs397516041
NM_000256.3(MYBPC3):c.3811C>T (p.Arg1271Ter) rs397516042
NM_000256.3(MYBPC3):c.3815-10T>G rs397516043
NM_000256.3(MYBPC3):c.3815-1G>A rs397516044
NM_000256.3(MYBPC3):c.3825A>G (p.Ter1275Trp) rs727504380
NM_000256.3(MYBPC3):c.3G>C (p.Met1Ile) rs397516045
NM_000256.3(MYBPC3):c.405A>G (p.Lys135=) rs727504318
NM_000256.3(MYBPC3):c.442G>A (p.Gly148Arg) rs397516050
NM_000256.3(MYBPC3):c.450C>T (p.Pro150=) rs377520770
NM_000256.3(MYBPC3):c.459delC (p.Ile154Leufs) rs397516052
NM_000256.3(MYBPC3):c.46C>T (p.Pro16Ser) rs730880573
NM_000256.3(MYBPC3):c.471C>T (p.Phe157=) rs150291001
NM_000256.3(MYBPC3):c.472G>A (p.Val158Met) rs3729986
NM_000256.3(MYBPC3):c.478C>T (p.Arg160Trp) rs193068692
NM_000256.3(MYBPC3):c.481C>A (p.Pro161Thr) rs397516053
NM_000256.3(MYBPC3):c.492C>T (p.Gly164=) rs3218719
NM_000256.3(MYBPC3):c.501C>T (p.Thr167=) rs397516054
NM_000256.3(MYBPC3):c.503T>C (p.Val168Ala) rs727505267
NM_000256.3(MYBPC3):c.505+1G>A rs730880620
NM_000256.3(MYBPC3):c.505+5G>C rs727503219
NM_000256.3(MYBPC3):c.506-12delC rs11570050
NM_000256.3(MYBPC3):c.506-17C>T rs561595897
NM_000256.3(MYBPC3):c.530G>A (p.Arg177His) rs201012766
NM_000256.3(MYBPC3):c.531C>T (p.Arg177=) rs368035400
NM_000256.3(MYBPC3):c.537C>T (p.Ala179=) rs11570051
NM_000256.3(MYBPC3):c.551dupT (p.Lys185Glufs) rs397516059
NM_000256.3(MYBPC3):c.558G>T (p.Pro186=) rs370962887
NM_000256.3(MYBPC3):c.565G>A (p.Val189Ile) rs11570052
NM_000256.3(MYBPC3):c.604A>C (p.Lys202Gln) rs730880623
NM_000256.3(MYBPC3):c.624G>C (p.Gln208His) rs202139499
NM_000256.3(MYBPC3):c.640G>A (p.Asp214Asn) rs769167548
NM_000256.3(MYBPC3):c.643C>T (p.Arg215Cys) rs397516063
NM_000256.3(MYBPC3):c.646G>A (p.Ala216Thr) rs201098973
NM_000256.3(MYBPC3):c.649A>G (p.Ser217Gly) rs138753870
NM_000256.3(MYBPC3):c.655G>C (p.Val219Leu) rs397516068
NM_000256.3(MYBPC3):c.706A>G (p.Ser236Gly) rs3729989
NM_000256.3(MYBPC3):c.709T>C (p.Tyr237His) rs730880624
NM_000256.3(MYBPC3):c.710A>C (p.Tyr237Ser) rs397516070
NM_000256.3(MYBPC3):c.721G>C (p.Val241Leu) rs886039000
NM_000256.3(MYBPC3):c.747C>A (p.Cys249Ter) rs771929829
NM_000256.3(MYBPC3):c.772+10C>T rs375525278
NM_000256.3(MYBPC3):c.772+1G>A rs397516072
NM_000256.3(MYBPC3):c.772G>A (p.Glu258Lys) rs397516074
NM_000256.3(MYBPC3):c.786C>T (p.Thr262=) rs11570058
NM_000256.3(MYBPC3):c.799C>G (p.Leu267Val) rs370941975
NM_000256.3(MYBPC3):c.821+1G>A rs397516073
NM_000256.3(MYBPC3):c.821+5G>A rs397516077
NM_000256.3(MYBPC3):c.82G>A (p.Val28Met) rs776834755
NM_000256.3(MYBPC3):c.833delG (p.Gly278Glufs) rs727503212
NM_000256.3(MYBPC3):c.841C>A (p.Arg281=) rs371711564
NM_000256.3(MYBPC3):c.852-10C>G rs750425291
NM_000256.3(MYBPC3):c.852-2A>G
NM_000256.3(MYBPC3):c.897delG (p.Lys301Argfs) rs1555122928
NM_000256.3(MYBPC3):c.906-7G>T rs397516079
NM_000256.3(MYBPC3):c.909C>T (p.Asp303=) rs200713257
NM_000256.3(MYBPC3):c.913_914delTT (p.Phe305Profs) rs397516080
NM_000256.3(MYBPC3):c.926+8C>T rs377595584
NM_000256.3(MYBPC3):c.927-10C>T rs201078659
NM_000256.3(MYBPC3):c.927-9G>A rs397516083
NM_000256.3(MYBPC3):c.932C>A (p.Ser311Ter) rs193922386
NM_000256.3(MYBPC3):c.933G>C (p.Ser311=) rs374326087
NM_000256.3(MYBPC3):c.93C>T (p.Ala31=) rs397516085
NM_000256.3(MYBPC3):c.94G>A (p.Glu32Lys) rs730880575
NM_000256.3(MYBPC3):c.977G>A (p.Arg326Gln) rs34580776
NM_000256.3(MYBPC3):c.999C>T (p.Tyr333=) rs367947846

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.