ClinVar Miner

Variants in gene RB1 with conflicting interpretations

See also:
Y axis minimum submission review status: Y axis collection method:
X axis minimum submission review status: X axis collection method:
Minimum conflict level:
Gene type:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
513 58 3 40 24 0 4 63

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

pathogenic likely pathogenic uncertain significance likely benign benign
pathogenic 0 15 3 1 0
likely pathogenic 15 0 1 0 0
uncertain significance 3 1 3 12 16
likely benign 1 0 12 0 25
benign 0 0 16 25 0

All variants with conflicting interpretations #

Total variants: 63
Download table as spreadsheet
HGVS dbSNP
NM_000321.2(RB1):c.1049+1G>A rs587776782
NM_000321.2(RB1):c.1072C>T (p.Arg358Ter) rs121913301
NM_000321.2(RB1):c.1129A>T (p.Thr377Ser) rs146897002
NM_000321.2(RB1):c.113G>A (p.Gly38Asp) rs766529534
NM_000321.2(RB1):c.1140C>T (p.Asn380=) rs117865557
NM_000321.2(RB1):c.1156A>G (p.Met386Val) rs564780653
NM_000321.2(RB1):c.1216-29A>G rs3092886
NM_000321.2(RB1):c.1306C>A (p.Gln436Lys) rs4151534
NM_000321.2(RB1):c.1318G>A (p.Glu440Lys) rs1060503078
NM_000321.2(RB1):c.1363C>T (p.Arg455Ter) rs121913302
NM_000321.2(RB1):c.1390-11A>G rs200658795
NM_000321.2(RB1):c.1390-14A>T rs9535023
NM_000321.2(RB1):c.1390-2A>G rs1555286568
NM_000321.2(RB1):c.1410T>C (p.Ile470=) rs578226820
NM_000321.2(RB1):c.1421+12_1421+32delACTTTTAGTAAAAAATTTTTT rs587781256
NM_000321.2(RB1):c.1439_1441delACA (p.Asn480del) rs587776788
NM_000321.2(RB1):c.1472T>C (p.Leu491Pro) rs587778848
NM_000321.2(RB1):c.1491A>T (p.Thr497=) rs150115447
NM_000321.2(RB1):c.1574C>G (p.Ala525Gly) rs4151539
NM_000321.2(RB1):c.1632A>G (p.Arg544=) rs143948310
NM_000321.2(RB1):c.1654C>T (p.Arg552Ter) rs121913303
NM_000321.2(RB1):c.1666C>T (p.Arg556Ter) rs121913304
NM_000321.2(RB1):c.1707A>G (p.Leu569=) rs3092895
NM_000321.2(RB1):c.1735C>T (p.Arg579Ter) rs121913305
NM_000321.2(RB1):c.1764T>A (p.Ser588=) rs542783532
NM_000321.2(RB1):c.1770T>C (p.Cys590=) rs145310579
NM_000321.2(RB1):c.1861C>A (p.Arg621Ser) rs367578442
NM_000321.2(RB1):c.1861C>T (p.Arg621Cys) rs367578442
NM_000321.2(RB1):c.1960+5G>A rs587778871
NM_000321.2(RB1):c.1960G>A (p.Val654Met) rs483352690
NM_000321.2(RB1):c.1961-12T>C rs201697122
NM_000321.2(RB1):c.1966C>T (p.Arg656Trp) rs142509759
NM_000321.2(RB1):c.1981C>T (p.Arg661Trp) rs137853294
NM_000321.2(RB1):c.2003G>A (p.Arg668His) rs551747882
NM_000321.2(RB1):c.2091C>G (p.Asp697Glu) rs3092903
NM_000321.2(RB1):c.2106+8A>G rs750581965
NM_000321.2(RB1):c.2134T>C (p.Cys712Arg) rs137853296
NM_000321.2(RB1):c.2212-16T>A rs201258424
NM_000321.2(RB1):c.2242G>T (p.Glu748Ter) rs121913297
NM_000321.2(RB1):c.2325+5G>A rs886042249
NM_000321.2(RB1):c.2356C>T (p.Pro786Ser) rs754507551
NM_000321.2(RB1):c.2360G>A (p.Arg787Gln) rs748094394
NM_000321.2(RB1):c.2392C>T (p.Arg798Trp) rs187912365
NM_000321.2(RB1):c.2455C>G (p.Leu819Val) rs375751988
NM_000321.2(RB1):c.2455C>T (p.Leu819=) rs375751988
NM_000321.2(RB1):c.2521-11G>A rs4151624
NM_000321.2(RB1):c.2566G>A (p.Asp856Asn) rs149359120
NM_000321.2(RB1):c.2570G>A (p.Arg857His) rs144668210
NM_000321.2(RB1):c.2652A>C (p.Glu884Asp) rs765537411
NM_000321.2(RB1):c.367A>G (p.Asn123Asp) rs149800437
NM_000321.2(RB1):c.380+10C>G rs187110786
NM_000321.2(RB1):c.380+12T>C rs3092881
NM_000321.2(RB1):c.409G>T (p.Glu137Ter) rs121913296
NM_000321.2(RB1):c.411A>T (p.Glu137Asp) rs3092902
NM_000321.2(RB1):c.42C>T (p.Ala14=) rs148980395
NM_000321.2(RB1):c.52G>T (p.Ala18Ser) rs528218090
NM_000321.2(RB1):c.59C>T (p.Pro20Leu) rs587778637
NM_000321.2(RB1):c.608-4delT rs762805947
NM_000321.2(RB1):c.628G>T (p.Asp210Tyr) rs148992508
NM_000321.2(RB1):c.78_80delGCC (p.Pro29del) rs587778823
NM_000321.2(RB1):c.920C>T (p.Thr307Ile) rs183898408
NM_000321.2(RB1):c.929G>A (p.Gly310Glu) rs200844292
NM_000321.2(RB1):c.958C>T (p.Arg320Ter) rs121913300

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.