ClinVar Miner

Variants in gene SON with conflicting interpretations

See also:
Y axis minimum submission review status: Y axis collection method:
X axis minimum submission review status: X axis collection method:
Minimum conflict level:
Gene type:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
1122 92 0 42 15 0 0 57

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

pathogenic likely pathogenic uncertain significance likely benign benign
pathogenic 0 7 0 0 0
likely pathogenic 7 0 0 0 0
uncertain significance 0 0 0 14 1
likely benign 0 0 14 0 35
benign 0 0 1 35 0

All variants with conflicting interpretations #

Total variants: 57
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_138927.4(SON):c.636A>G (p.Ala212=) rs79746820 0.01978
NM_138927.4(SON):c.5931C>G (p.Arg1977=) rs150856507 0.00720
NM_138927.4(SON):c.2364T>C (p.Thr788=) rs140574025 0.00332
NM_138927.4(SON):c.2271G>A (p.Ala757=) rs147224438 0.00303
NM_138927.4(SON):c.5754T>C (p.Val1918=) rs150122403 0.00291
NM_138927.4(SON):c.5280T>C (p.Asp1760=) rs77137462 0.00278
NM_138927.4(SON):c.2080A>G (p.Thr694Ala) rs141608426 0.00272
NM_138927.4(SON):c.2814T>G (p.Gly938=) rs139823990 0.00240
NM_138927.4(SON):c.3326C>T (p.Ala1109Val) rs144188863 0.00203
NM_138927.4(SON):c.1664C>T (p.Thr555Met) rs13049658 0.00135
NM_138927.4(SON):c.978G>A (p.Met326Ile) rs138817883 0.00123
NM_138927.4(SON):c.3726A>G (p.Ser1242=) rs148591619 0.00109
NM_138927.4(SON):c.3447G>A (p.Leu1149=) rs148064125 0.00107
NM_138927.4(SON):c.4399A>G (p.Ile1467Val) rs142751481 0.00095
NM_138927.4(SON):c.4851A>G (p.Ala1617=) rs146914239 0.00089
NM_138927.4(SON):c.3012T>C (p.Ala1004=) rs148794591 0.00088
NM_138927.4(SON):c.5964T>C (p.Pro1988=) rs139304331 0.00070
NM_138927.4(SON):c.497C>T (p.Ala166Val) rs140389869 0.00068
NM_138927.4(SON):c.4037C>T (p.Pro1346Leu) rs144767307 0.00041
NM_138927.4(SON):c.2661G>A (p.Ala887=) rs117188819 0.00036
NM_138927.4(SON):c.2659G>A (p.Ala887Thr) rs370344763 0.00026
NM_138927.4(SON):c.4228G>A (p.Val1410Ile) rs144716297 0.00020
NM_138927.4(SON):c.788T>C (p.Val263Ala) rs201714133 0.00015
NM_138927.4(SON):c.2210C>T (p.Ala737Val) rs143709811 0.00011
NM_138927.4(SON):c.1705G>T (p.Val569Leu) rs778563835 0.00009
NM_138927.4(SON):c.2550C>A (p.Thr850=) rs73900349 0.00009
NM_138927.4(SON):c.1414C>T (p.Pro472Ser) rs767649909 0.00007
NM_138927.4(SON):c.6657+147C>T rs756936782 0.00006
NM_138927.4(SON):c.4878T>C (p.Tyr1626=) rs367641702 0.00004
NM_138927.4(SON):c.955G>C (p.Glu319Gln) rs767401593 0.00004
NM_138927.4(SON):c.5170A>G (p.Asn1724Asp) rs372853725 0.00003
NM_138927.4(SON):c.1390G>A (p.Glu464Lys) rs763404313 0.00002
NM_138927.4(SON):c.1526C>T (p.Thr509Met) rs749384711 0.00002
NM_138927.4(SON):c.3247A>G (p.Met1083Val) rs371537268 0.00002
NM_138927.4(SON):c.2713A>G (p.Met905Val) rs763563040 0.00001
NM_138927.4(SON):c.5950C>T (p.Arg1984Trp) rs1312220322 0.00001
NM_138927.4(SON):c.77+6C>G rs201422694 0.00001
NM_138927.4(SON):c.1106C>T (p.Ala369Val)
NM_138927.4(SON):c.1361C>G (p.Pro454Arg)
NM_138927.4(SON):c.2098T>C (p.Ser700Pro)
NM_138927.4(SON):c.2281A>G (p.Met761Val)
NM_138927.4(SON):c.3105AGCCTACGAGCGCTCTATGATGTC[1] (p.1036AYERSMMS[1]) rs746317953
NM_138927.4(SON):c.3334C>T (p.Arg1112Ter) rs1064796472
NM_138927.4(SON):c.3662C>T (p.Ser1221Leu)
NM_138927.4(SON):c.3852_3856del (p.Met1284fs) rs1114167303
NM_138927.4(SON):c.4090_4113del (p.Ala1364_Ser1371del) rs779275354
NM_138927.4(SON):c.4119_4142del (p.1370SSTVTVLE[1])
NM_138927.4(SON):c.4151_4174del (p.Leu1384_Val1391del) rs769691894
NM_138927.4(SON):c.4216C>G (p.Pro1406Ala)
NM_138927.4(SON):c.4640del (p.His1547fs) rs886039776
NM_138927.4(SON):c.498G>A (p.Ala166=)
NM_138927.4(SON):c.5549_5550del (p.Arg1850fs) rs886039774
NM_138927.4(SON):c.5753_5756del (p.Val1918fs) rs886039773
NM_138927.4(SON):c.5868CAGCCGCACCCCCAGCCGCCG[3] (p.1957SRTPSRR[5]) rs1462103775
NM_138927.4(SON):c.5943_5963del (p.1957SRTPSRR[5]) rs766784590
NM_138927.4(SON):c.6002_6003insCC (p.Arg2002fs) rs886039775
NM_138927.4(SON):c.78-9C>T

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.