ClinVar Miner

Variants in gene USH1C with conflicting interpretations

Y axis minimum submission review status: Y axis collection method:
X axis minimum submission review status: X axis collection method:
Minimum conflict level:
Gene type:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
456 64 3 22 28 0 2 47

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

pathogenic likely pathogenic uncertain significance likely benign benign
pathogenic 2 3 0 0 1
likely pathogenic 3 0 1 0 1
uncertain significance 0 1 1 22 11
likely benign 0 0 22 0 19
benign 1 1 11 19 0

All variants with conflicting interpretations #

Total variants: 47
Download table as spreadsheet
HGVS dbSNP
NM_005709.3(USH1C):c.238dupC (p.Arg80Profs) rs397515359
NM_153676.4(USH1C):c.101A>G (p.His34Arg) rs75157409
NM_153676.4(USH1C):c.1039C>T (p.Gln347Ter) rs762551629
NM_153676.4(USH1C):c.1211-1129G>A rs35188020
NM_153676.4(USH1C):c.1211-1175G>A rs143923730
NM_153676.4(USH1C):c.1234G>A (p.Asp412Asn) rs727503712
NM_153676.4(USH1C):c.1430G>A (p.Arg477Gln) rs146333270
NM_153676.4(USH1C):c.1597G>A (p.Ala533Thr) rs201104489
NM_153676.4(USH1C):c.1678G>C (p.Ala560Pro) rs367952604
NM_153676.4(USH1C):c.1703C>T (p.Pro568Leu) rs747675437
NM_153676.4(USH1C):c.1740T>C (p.Pro580=) rs200085788
NM_153676.4(USH1C):c.1801C>A (p.Pro601Thr) rs727503710
NM_153676.4(USH1C):c.1823C>G (p.Pro608Arg) rs41282932
NM_153676.4(USH1C):c.1858C>T (p.Arg620Cys) rs143160805
NM_153676.4(USH1C):c.186T>C (p.Ile62=) rs200239508
NM_153676.4(USH1C):c.1906C>T (p.Arg636Cys) rs149510892
NM_153676.4(USH1C):c.2004C>A (p.Pro668=) rs201586291
NM_153676.4(USH1C):c.2014-1G>A rs150567427
NM_153676.4(USH1C):c.2124T>C (p.Ser708=) rs369021714
NM_153676.4(USH1C):c.2167C>T (p.Gln723Ter) rs146451547
NM_153676.4(USH1C):c.216G>A (p.Val72=) rs151045328
NM_153676.4(USH1C):c.2184+10T>C rs200889109
NM_153676.4(USH1C):c.2265C>T (p.Leu755=) rs151251262
NM_153676.4(USH1C):c.2410G>A (p.Ala804Thr) rs150593932
NM_153676.4(USH1C):c.2443C>T (p.Leu815=) rs148477093
NM_153676.4(USH1C):c.248+7_248+20del rs749047869
NM_153676.4(USH1C):c.2499C>T (p.Ile833=) rs34581703
NM_153676.4(USH1C):c.2547-8A>G rs78509055
NM_153676.4(USH1C):c.2551T>G (p.Ser851Ala) rs200779709
NM_153676.4(USH1C):c.2590C>T (p.Arg864Ter) rs767767573
NM_153676.4(USH1C):c.2591G>A (p.Arg864Gln) rs374696855
NM_153676.4(USH1C):c.307C>T (p.Arg103Cys) rs397517880
NM_153676.4(USH1C):c.308G>A (p.Arg103His) rs397514500
NM_153676.4(USH1C):c.360C>T (p.Gly120=) rs140869579
NM_153676.4(USH1C):c.381G>T (p.Gly127=) rs41282942
NM_153676.4(USH1C):c.388G>A (p.Val130Ile) rs55843567
NM_153676.4(USH1C):c.403G>A (p.Val135Ile) rs145013633
NM_153676.4(USH1C):c.496+21GCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGGGAGCAGG[9] rs55983148
NM_153676.4(USH1C):c.513C>T (p.Pro171=) rs199739341
NM_153676.4(USH1C):c.569C>T (p.Ser190Leu) rs200319849
NM_153676.4(USH1C):c.587G>A (p.Arg196Gln) rs397517883
NM_153676.4(USH1C):c.648G>A (p.Leu216=) rs77137413
NM_153676.4(USH1C):c.669C>A (p.Gly223=) rs144761543
NM_153676.4(USH1C):c.674+4G>A rs202095395
NM_153676.4(USH1C):c.790G>A (p.Val264Ile) rs79875849
NM_153676.4(USH1C):c.819+10G>C rs41282936
NM_153676.4(USH1C):c.946G>C (p.Glu316Gln) rs35336155

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.