ClinVar Miner

Variants in gene USH1C with conflicting interpretations

Y axis minimum submission review status: Y axis collection method:
X axis minimum submission review status: X axis collection method:
Minimum conflict level:
Gene type:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
175 70 4 18 21 0 5 39

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

pathogenic likely pathogenic uncertain significance likely benign benign
pathogenic 2 2 3 1 1
likely pathogenic 2 0 2 0 0
uncertain significance 3 2 1 14 12
likely benign 1 0 14 0 16
benign 1 0 12 16 1

All variants with conflicting interpretations #

Total variants: 39
Download table as spreadsheet
HGVS dbSNP
NM_005709.3(USH1C):c.101A>G (p.His34Arg) rs75157409
NM_005709.3(USH1C):c.1086-12G>A rs11024318
NM_005709.3(USH1C):c.1086-13G>T rs200490320
NM_005709.3(USH1C):c.114C>T (p.Asp38=) rs137962152
NM_005709.3(USH1C):c.1243G>A (p.Ala415Thr) rs116996553
NM_005709.3(USH1C):c.1261G>A (p.Gly421Ser) rs115931035
NM_005709.3(USH1C):c.1266G>A (p.Thr422=) rs35188020
NM_005709.3(USH1C):c.1285-7567C>T rs727505247
NM_005709.3(USH1C):c.1326+12C>T rs17703528
NM_005709.3(USH1C):c.1480+1G>C rs1060499916
NM_005709.3(USH1C):c.1543C>T (p.Leu515=) rs148477093
NM_005709.3(USH1C):c.1599C>T (p.Ile533=) rs34581703
NM_005709.3(USH1C):c.1646+1124C>T rs767767573
NM_005709.3(USH1C):c.1646+1145G>A rs56165709
NM_005709.3(USH1C):c.216G>A (p.Val72=) rs151045328
NM_005709.3(USH1C):c.225T>C (p.Asp75=) rs111033279
NM_005709.3(USH1C):c.238dupC (p.Arg80Profs) rs397515359
NM_005709.3(USH1C):c.381G>T (p.Gly127=) rs41282942
NM_005709.3(USH1C):c.388G>A (p.Val130Ile) rs55843567
NM_005709.3(USH1C):c.403G>A (p.Val135Ile) rs145013633
NM_005709.3(USH1C):c.497-4G>A rs397517881
NM_005709.3(USH1C):c.569C>T (p.Ser190Leu) rs200319849
NM_005709.3(USH1C):c.648G>A (p.Leu216=) rs77137413
NM_005709.3(USH1C):c.651A>G (p.Val217=) rs75977878
NM_005709.3(USH1C):c.674+4G>A rs202095395
NM_005709.3(USH1C):c.819+10G>C rs41282936
NM_005709.3(USH1C):c.921G>A (p.Ala307=) rs778447994
NM_005709.3(USH1C):c.946G>C (p.Glu316Gln) rs35336155
NM_153676.3(USH1C):c.*46T>C rs1055574
NM_153676.3(USH1C):c.1188A>G (p.Pro396=) rs2240487
NM_153676.3(USH1C):c.1823C>G (p.Pro608Arg) rs41282932
NM_153676.3(USH1C):c.1906C>T (p.Arg636Cys) rs149510892
NM_153676.3(USH1C):c.2124T>C (p.Ser708=) rs369021714
NM_153676.3(USH1C):c.2340C>T (p.Val780=) rs10832796
NM_153676.3(USH1C):c.2457G>C (p.Glu819Asp) rs1064074
NM_153676.3(USH1C):c.2490+12G>C rs2072232
NM_153676.3(USH1C):c.308G>A (p.Arg103His) rs397514500
NM_153676.3(USH1C):c.440A>G (p.His147Arg) rs777591673
NM_153676.3(USH1C):c.496+59_479-35GAGCAGGGCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGG[7]GAGCAGGTCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGG[2] rs55983148

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.