ClinVar Miner

Variants from Genetic Services Laboratory, University of Chicago with conflicting interpretations

Location: United States — Primary collection method: clinical testing
Minimum review status of the submission from Genetic Services Laboratory, University of Chicago: Collection method of the submission from Genetic Services Laboratory, University of Chicago:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
5662 2640 104 4867 2495 53 339 7010

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
Genetic Services Laboratory, University of Chicago pathogenic likely pathogenic uncertain significance likely benign benign affects association drug response protective risk factor other
pathogenic 73 219 65 6 5 0 1 3 1 18 4
likely pathogenic 137 4 93 12 8 0 0 0 0 0 1
uncertain significance 74 60 8 1334 738 0 0 0 0 3 1
likely benign 29 10 722 12 3523 0 0 5 4 6 3
benign 12 4 198 988 7 1 0 1 0 2 1
other 4 3 2 2 3 2 3 3 0 1 0

Submitter to submitter summary #

Total submitters: 194
Download table as spreadsheet
Submitter Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
Invitae 0 2235 0 2444 1352 4 70 3864
GeneDx 0 2077 0 1722 629 0 48 2398
Illumina Clinical Services Laboratory,Illumina 0 1872 0 1177 594 2 30 1801
EGL Genetic Diagnostics,Eurofins Clinical Diagnostics 0 1563 0 1087 475 10 32 1602
PreventionGenetics,PreventionGenetics 0 1103 0 1414 126 3 4 1544
Ambry Genetics 0 1139 0 844 333 1 12 1186
Athena Diagnostics Inc 0 670 0 805 150 0 15 968
Laboratory for Molecular Medicine, Partners HealthCare Personalized Medicine 0 496 0 505 94 1 3 601
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories 0 273 0 287 56 1 6 350
Integrated Genetics/Laboratory Corporation of America 0 248 1 183 56 1 2 242
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 0 311 0 169 67 0 2 237
Diagnostic Laboratory, Department of Genetics,University Medical Center Groningen 0 156 0 211 15 0 0 226
CeGaT Praxis fuer Humangenetik Tuebingen 0 269 0 35 149 1 25 210
Mendelics 0 219 0 131 58 3 17 207
Mayo Clinic Genetic Testing Laboratories,Mayo Clinic 0 125 0 175 16 0 5 196
Color 0 169 0 100 69 0 2 171
Biesecker Lab/Clinical Genomics Section,National Institutes of Health 0 98 19 83 59 0 0 161
OMIM 0 287 0 60 13 37 50 158
GeneReviews 0 84 75 42 9 2 19 145
DNA and Cytogenetics Diagnostics Unit,Erasmus Medical Center 0 104 0 110 19 0 1 130
Counsyl 0 228 0 84 30 1 10 125
Genome Diagnostics Laboratory,University Medical Center Utrecht 0 58 0 72 10 0 0 82
CHEO Genetics Diagnostic Laboratory,Children's Hospital of Eastern Ontario 0 67 0 61 16 0 0 77
Division of Genomic Diagnostics,The Children's Hospital of Philadelphia 0 109 0 44 24 0 3 71
Quest Diagnostics Nichols Institute San Juan Capistrano 0 72 0 44 25 0 1 70
Department of Pathology and Laboratory Medicine,Sinai Health System 0 31 0 46 8 0 0 54
Center for Advanced Laboratory Medicine, UC San Diego Health,University of California San Diego 0 11 0 15 30 0 0 45
Baylor Genetics 0 96 0 26 10 0 8 44
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) 0 27 0 39 2 0 0 41
Center for Human Genetics, Inc 0 36 0 18 19 0 2 39
Genome Diagnostics Laboratory,VU University Medical Center Amsterdam 0 30 0 32 6 0 0 38
Fulgent Genetics,Fulgent Genetics 0 388 0 31 4 0 1 36
Breast Cancer Information Core (BIC) (BRCA2) 0 12 0 8 23 0 1 32
Sharing Clinical Reports Project (SCRP) 0 24 0 21 7 0 0 28
SIB Swiss Institute of Bioinformatics 0 19 0 24 1 0 2 27
Personalized Diabetes Medicine Program,University of Maryland School of Medicine 0 24 0 11 13 0 2 26
Michigan Medical Genetics Laboratories,University of Michigan 0 16 0 23 1 0 0 24
RettBASE 0 95 0 18 1 0 5 24
CSER _CC_NCGL, University of Washington 0 35 0 3 16 0 4 23
True Health Diagnostics 0 63 0 15 8 0 0 23
Genomic Research Center, Shahid Beheshti University of Medical Sciences 0 31 0 6 5 1 9 21
Wong Mito Lab, Molecular and Human Genetics, Baylor College of Medicine 0 8 0 11 6 0 2 19
Centre for Mendelian Genomics,University Medical Centre Ljubljana 0 32 0 7 2 1 7 17
Bioinformatics Core,Luxembourg Center for Systems Biomedicine 0 0 0 0 0 0 17 17
Clinical Molecular Genetics Laboratory,Johns Hopkins All Children's Hospital 0 45 0 6 7 0 3 16
Claritas Genomics 0 8 0 14 2 0 0 16
International Society for Gastrointestinal Hereditary Tumours (InSiGHT) 0 8 1 9 4 0 0 14
Juha Muilu Group; Institute for Molecular Medicine Finland (FIMM) 0 0 4 9 0 0 0 13
Cancer Genetics and Genomics Laboratory,British Columbia Cancer Agency 0 4 0 12 1 0 0 13
Breast Cancer Information Core (BIC) (BRCA1) 0 18 0 2 10 0 0 12
Pathway Genomics 0 15 0 11 1 0 0 12
Foulkes Cancer Genetics LDI, Lady Davis Institute for Medical Research 0 7 0 3 7 0 1 11
GeneKor MSA 0 32 0 6 4 0 1 11
Lupski Lab, Baylor-Hopkins CMG, Baylor College of Medicine 0 4 0 1 4 0 6 11
Molecular Diagnostics Lab,Nemours Alfred I. duPont Hospital for Children 0 8 0 6 1 0 2 9
Developmental Genetics Unit,King Faisal Specialist Hospital & Research Centre 0 3 0 6 0 0 3 9
UCLA Clinical Genomics Center, UCLA 0 1 0 8 0 0 1 9
Knight Diagnostic Laboratories,Oregon Health and Sciences University 0 15 0 4 4 1 0 9
Vantari Genetics 0 20 0 8 1 0 0 9
Institute for Biomarker Research,Medical Diagnostic Laboratories, L.L.C. 0 40 0 6 2 0 1 9
Equipe Genetique des Anomalies du Developpement,Université de Bourgogne 0 12 0 4 2 0 3 9
Research Molecular Genetics Laboratory,Women's College Hospital, University of Toronto 0 15 0 7 2 0 0 9
Biochemical Molecular Genetic Laboratory,King Abdulaziz Medical City 0 11 0 5 0 0 4 9
University of Washington Department of Laboratory Medicine, University of Washington 0 13 0 3 6 0 0 9
Genetic Services Laboratory, University of Chicago 15287 17 0 0 7 0 1 8
Institute of Human Genetics,Klinikum rechts der Isar 0 34 0 5 0 0 3 8
Institute of Human Genetics,Friedrich-Alexander-Universität Erlangen-Nürnberg 0 18 0 7 0 0 1 8
Division of Human Genetics,Children's Hospital of Philadelphia 0 15 0 4 1 0 3 8
Laboratory of Genetics and Molecular Cardiology, University of São Paulo 0 3 0 7 1 0 0 8
NeuroMeGen,Hospital Clinico Santiago de Compostela 0 0 0 6 0 0 2 8
Cardiovascular Research Group,Instituto Nacional de Saude Doutor Ricardo Jorge 0 3 0 7 1 0 0 8
NIHR Bioresource Rare Diseases, University of Cambridge 0 9 0 6 0 0 2 8
ClinGen Inherited Cardiomyopathy Variant Curation Expert Panel, 0 11 0 8 0 0 0 8
Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago 0 17 0 0 8 0 0 8
Institute for Genomic Medicine (IGM) Clinical Laboratory,Nationwide Children's Hospital 0 9 0 5 3 0 0 8
Blueprint Genetics 0 14 0 1 5 0 1 7
Génétique des Maladies du Développement, Hospices Civils de Lyon 0 6 0 5 0 0 2 7
PharmGKB 0 0 0 0 0 6 0 6
Center for Genetic Medicine Research,Children's National Medical Center 0 4 0 4 2 0 0 6
Foundation for Research in Genetics and Endocrinology, FRIGE's Institute of Human Genetics 0 7 0 2 2 0 2 6
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute 0 7 0 2 4 0 0 6
Database of Curated Mutations (DoCM) 0 2 0 5 0 0 1 6
Phosphorus, Inc. 0 10 0 4 2 0 0 6
Broad Institute Rare Disease Group,Broad Institute 0 13 0 3 0 1 2 6
HudsonAlpha Institute for Biotechnology, HudsonAlpha Institute for Biotechnology 0 28 0 4 1 0 0 5
Soonchunhyang University Bucheon Hospital,Soonchunhyang University Medical Center 0 8 0 1 3 0 1 5
Department of Ophthalmology and Visual Sciences Kyoto University 0 0 3 0 1 0 0 4
Stanford Center for Inherited Cardiovascular Disease, Stanford University 0 7 0 3 1 0 0 4
University of Washington Center for Mendelian Genomics,University of Washington 0 1 0 4 0 0 0 4
Department of Medical Genetics,University Hospital of North Norway 0 2 0 2 2 0 0 4
Gharavi Laboratory,Columbia University 0 3 0 2 1 0 1 4
Johns Hopkins Genomics,Johns Hopkins University 0 5 0 1 2 0 1 4
Pharmacogenomics Lab,Chungbuk National University 0 0 0 0 0 4 0 4
Difficult and Complicated Liver Diseases and Artificial Liver Center,Beijing You An Hospital, Capital Medical University 0 1 0 1 1 1 1 4
UW Hindbrain Malformation Research Program,University of Washington 0 13 0 1 0 0 2 3
Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde,Academisch Medisch Centrum 0 0 0 3 0 0 0 3
Molecular Diagnostics Laboratory,M Health: University of Minnesota 0 8 0 3 0 0 0 3
Genetic Testing Center for Deafness, Department of Otolaryngology Head & Neck Surgery,Institute of Otolaryngology, Chinese PLA General Hospital 0 4 0 3 0 0 1 3
Reproductive Health Research and Development,BGI Genomics 0 10 0 3 0 0 0 3
ClinGen TP53 Variant Curation Expert Panel,ClinGen 0 1 0 0 3 0 0 3
Elsea Laboratory,Baylor College of Medicine 0 0 0 0 0 0 2 2
Institute of Human Genetics,Cologne University 0 0 0 1 0 0 1 2
Molecular Genetics Laboratory,BC Children's and BC Women's Hospitals 0 6 0 1 1 0 0 2
Shaikh Laboratory, University of Colorado 0 0 0 2 0 0 0 2
Agnes Ginges Centre for Molecular Cardiology,Centenary Institute 0 1 0 0 2 0 0 2
Department of Genetics, Reproduction and Fetal Medicine.,Institute of Biomedicine of Seville (IBIS), University Hospital Virgen del Rocío/CSIC/University of Seville. 0 0 0 0 1 0 1 2
Dobyns Lab,Seattle Children's Research Institute 0 1 0 1 0 0 1 2
Diagnostics Division,Centre for DNA Fingerprinting and Diagnostics 0 0 0 1 0 0 1 2
Clinical Genetics, Erasmus University Medical Center 0 0 0 0 1 0 1 2
Cancer Genetics Laboratory,Peter MacCallum Cancer Centre 0 2 0 0 2 0 0 2
Robarts Research Institute,Western University 0 0 0 1 1 0 0 2
Neurogenetics Laboratory - MEYER,AOU Meyer 0 7 0 1 0 0 1 2
Research and Development, ARUP Laboratories 0 5 0 0 0 0 2 2
Unit for Genetic & Epidemiological Research on Neurological Disorders,Instituto de Investigação e Inovação em Saúde 0 1 0 1 1 0 0 2
Department of Pathology and Molecular Medicine,Queen's University 0 7 0 1 1 0 0 2
Tolun Lab, Human Genetics Laboratory,Bogazici University 0 0 0 0 2 0 0 2
Inherited Neuropathy Consortium 0 2 0 1 0 0 1 2
Laboratory of Molecular Neuropathology,The University of Texas Health Science Center at Houston 0 0 0 0 1 0 1 2
SingHealth Duke-NUS Institute of Precision Medicine 0 0 0 0 1 0 1 2
Center for Precision Medicine,Vanderbilt University Medical Center 0 0 0 0 1 0 1 2
Medical Genetics Summaries 0 0 0 0 0 2 0 2
ClinGen Hearing Loss Variant Curation Expert Panel, 0 6 0 1 0 0 1 2
ClinGen CDH1 Variant Curation Expert Panel 0 1 0 2 0 0 0 2
Clinical Genetics,University of Leipzig 0 0 0 1 0 0 1 2
Wessex Regional Genetics Laboratory,Salisbury District Hospital 0 8 0 2 0 0 0 2
ClinGen Myeloid Malignancy Variant Curation Expert Panel 0 4 0 0 0 0 2 2
Medical Genetics Laboratory, Kennedy Center,Juliane Marie Center, Rigshospitalet 0 4 0 0 0 0 1 1
Molecular Genetics Laboratory,Children's Mercy Hospital and Clinics 0 12 0 1 0 0 0 1
MVZ Dortmund,Dr. Eberhard & Partner 0 0 0 0 1 0 0 1
MyeliNeuroGene Lab,McGill University Health Center Research Institute 0 0 0 0 0 0 1 1
Courtagen Diagnostics Laboratory,Courtagen Life Sciences 0 16 0 0 0 0 1 1
UniProtKB/Swiss-Prot 0 19 1 0 0 0 0 1
ClinVar Staff, National Center for Biotechnology Information (NCBI) 0 1 0 1 0 0 0 1
Eye Genetics Research Group,Children's Medical Research Institute 0 0 0 0 1 0 0 1
Human Genome Sequencing Center Clinical Lab,Baylor College of Medicine 0 10 0 1 0 0 0 1
PALB2 database 0 7 0 0 1 0 0 1
Department of Genetics,Robert DEBRE University Hospital 0 0 0 1 0 0 0 1
Wellcome Centre for Mitochondrial Research,Newcastle University 0 1 0 0 0 0 1 1
TilsonLab,Columbia University 0 0 0 0 0 0 1 1
CHU Sainte-Justine Research Center,University of Montreal 0 2 0 1 0 0 0 1
Institute for Integrative and Experimental Genomics,University of Luebeck 0 1 0 0 1 0 0 1
Génétique et pathophysiologie de maladies neurodéveloppementales et épileptogènes, Institut de génétique et de biologie moléculaire et cellulaire 0 0 0 1 0 0 0 1
Department of Neurology, University Hospital of Strasbourg 0 0 0 0 0 0 1 1
Endocrine Unit 2,University Hospital of Pisa 0 0 0 0 1 0 0 1
Neurogenetics of motion laboratory,Montreal Neurological Institute 0 2 0 1 0 0 0 1
Hadassah Hebrew University Medical Center 0 0 0 1 0 0 0 1
Center of Genomic medicine, Geneva,University Hospital of Geneva 0 7 0 0 1 0 0 1
Laboratory of Molecular Genetics (Pr. Bezieau's lab), CHU de Nantes 0 10 0 1 0 0 0 1
Centre for Genomic and Experimental Medicine,University of Edinburgh 0 1 0 0 0 0 1 1
UCL Genetics Institute,UCL 0 0 0 0 0 1 0 1
McDonnell Genome Institute,Washington University in St. Louis 0 0 0 0 0 0 1 1
Oxford Medical Genetics Laboratories,Oxford University Hospitals NHS Foundation Trust 0 1 0 1 0 0 0 1
Center for Human Genetics,University of Leuven 0 0 0 1 0 0 0 1
Medical Research Institute,Tokyo Medical and Dental University 0 0 0 1 0 0 0 1
Leeds Amelogenesis Imperfecta Research Group, University of Leeds 0 0 0 0 0 0 1 1
Baylor-Hopkins Center for Mendelian Genomics,Johns Hopkins University 0 1 0 1 0 0 0 1
Laboratory of Molecular Genetics,CHU RENNES 0 0 0 0 0 0 1 1
Diagnostic Laboratory,Strasbourg University Hospital 0 3 0 1 0 0 0 1
Translational Genomics Laboratory,University of Maryland School of Medicine 0 2 0 1 0 0 0 1
University of Arizona Genetics Core,University of Arizona 0 0 0 0 0 0 1 1
GenePathDx,Causeway Health Care Private Ltd 0 0 0 1 0 0 0 1
Daryl Scott Lab,Baylor College of Medicine 0 0 0 0 0 1 0 1
A.C.Camargo Cancer Center / LGBM, A.C.Camargo Cancer Center 0 5 0 0 1 0 0 1
Groupe Hospitalier Pitie Salpetriere, UF Genomique du Developpement,Assistance Publique Hopitaux de Paris 0 0 0 0 0 0 1 1
Endocrine oncology group,Uppsala University 0 0 0 1 0 0 0 1
Yale Center for Mendelian Genomics,Yale University 0 0 0 0 0 0 1 1
Fundacion Hipercolesterolemia Familiar 0 0 0 1 0 0 0 1
Iberoamerican FH Network 0 0 0 1 0 0 0 1
Section on Medical Neuroendocrinolgy,National Institutes of Health 0 0 0 1 0 0 0 1
Rare Disease Group, Clinical Genetics,Karolinska Institutet 0 0 0 0 0 0 1 1
Snyder Lab, Genetics Department,Stanford University 0 1 0 0 0 0 1 1
Kariminejad - Najmabadi Pathology & Genetics Center 0 1 0 1 0 0 0 1
Sharon lab,Hadassah-Hebrew University Medical Center 0 3 0 0 0 0 1 1
Cirak Lab,University Hospital Cologne 0 2 0 0 0 0 1 1
Dan Cohn Lab,University Of California Los Angeles 0 0 0 0 0 0 1 1
Translational Research Program on Neuronal Ceroid Lipofuscinosis,Center for the Study of Inborn Errors of Metabolism 0 0 0 0 0 0 1 1
ClinGen RASopathy Variant Curation Expert Panel 0 3 0 1 0 0 0 1
Reproductive Development, Murdoch Childrens Research Institute 0 0 0 0 0 0 1 1
Tampere Brain Tumor Research Consortium,University of Tampere 0 0 0 0 0 0 1 1
Laboratory of Medical Genetics, INSERM 0 2 0 0 0 0 1 1
GeneID Lab - Advanced Molecular Diagnostics 0 1 0 0 0 0 1 1
Carola Vinuesa Lab,John Curtin School of Medical Research 0 0 0 0 0 0 1 1
Raymond Lab,University of Cambridge 0 0 0 1 0 0 0 1
Genomic Medicine Theme, NIHR Oxford Biomedical Research Centre,University of Oxford 0 0 0 0 1 0 0 1
Department of Genetics,Sultan Qaboos University Hospital, Oman 0 5 0 1 0 0 0 1
Laboratory of Medical Genetics, National & Kapodistrian University of Athens 0 6 0 0 0 0 1 1
Clinical Genomics Lab,St. Jude Children's Research Hospital 0 4 0 0 1 0 0 1
ClinGen PTEN Variant Curation Expert Panel 0 2 0 0 1 0 0 1
Hereditary Cancer Genetics group,Vall d'Hebron Institute of Oncology 0 0 0 1 0 0 0 1
Biochemistry Laboratory of CDMU,Chengde Medical University 0 1 0 1 0 0 0 1
Bioinformatics Institute,Agency for Science, Technology and Research 0 0 0 0 0 1 0 1
Molecular Diagnostics, Microbiology, Virology, Parasitology and Genetics,Sofia University, St. Kliment Ohridski 0 0 0 0 0 0 1 1
Xiao lab, Department of Pathology, Memorial Sloan Kettering Cancer Center 0 0 0 0 0 0 1 1
Center for Computational Genomics and Data Science,University of Alabama 0 0 0 0 0 1 0 1

All variants with conflicting interpretations #

Total variants: 7010
Download table as spreadsheet
HGVS dbSNP
NM_000018.4(ACADVL):c.848T>C (p.Val283Ala) rs113994167
NM_000022.4(ADA):c.606+10G>A rs201045221
NM_000023.4(SGCA):c.528C>T (p.Thr176=) rs1801190
NM_000023.4(SGCA):c.933C>T (p.Val311=) rs1801191
NM_000026.4(ADSL):c.124C>T (p.Leu42=) rs2228415
NM_000026.4(ADSL):c.358-4G>A rs113199851
NM_000026.4(ADSL):c.440A>T (p.Lys147Met) rs11089991
NM_000026.4(ADSL):c.953C>T (p.Pro318Leu) rs202064195
NM_000032.5(ALAS2):c.1560C>A (p.Pro520=) rs150055592
NM_000032.5(ALAS2):c.1676G>A (p.Arg559His) rs145704441
NM_000038.6(APC):c.1959G>A (p.Arg653=) rs72541809
NM_000038.6(APC):c.6921G>A (p.Ser2307=) rs2229993
NM_000038.6(APC):c.7415C>T (p.Ala2472Val) rs200399245
NM_000038.6(APC):c.7862C>G (p.Ser2621Cys) rs72541816
NM_000043.6(FAS):c.103T>C (p.Leu35=) rs9333296
NM_000043.6(FAS):c.369G>A (p.Gln123=) rs28362318
NM_000044.6(AR):c.1174C>T (p.Pro392Ser) rs201934623
NM_000044.6(AR):c.1370_1372GCG[14] (p.Gly471_Gly473del) rs746853821
NM_000044.6(AR):c.171_173GCA[20] (p.Gln78_Gln80del) rs3032358
NM_000044.6(AR):c.171_173GCA[24] (p.Gln80dup) rs3032358
NM_000047.2(ARSL):c.36G>C (p.Arg12Ser) rs122460151
NM_000048.4(ASL):c.1164C>T (p.His388=) rs75300185
NM_000048.4(ASL):c.35G>A (p.Arg12Gln) rs145138923
NM_000051.3(ATM):c.103C>T (p.Arg35Ter) rs55861249
NM_000051.3(ATM):c.1066-6T>G rs201686625
NM_000051.3(ATM):c.1073A>G (p.Asn358Ser) rs149636614
NM_000051.3(ATM):c.1229T>C (p.Val410Ala) rs56128736
NM_000051.3(ATM):c.1380G>C (p.Thr460=) rs145333518
NM_000051.3(ATM):c.146C>G (p.Ser49Cys) rs1800054
NM_000051.3(ATM):c.162T>C (p.Tyr54=) rs3218690
NM_000051.3(ATM):c.1744T>C (p.Phe582Leu) rs2235006
NM_000051.3(ATM):c.1810C>T (p.Pro604Ser) rs2227922
NM_000051.3(ATM):c.2119T>C (p.Ser707Pro) rs4986761
NM_000051.3(ATM):c.2362A>C (p.Ser788Arg) rs641252
NM_000051.3(ATM):c.2494C>T (p.Arg832Cys) rs2229022
NM_000051.3(ATM):c.2922-8T>A rs545892367
NM_000051.3(ATM):c.3014A>G (p.Asn1005Ser) rs146531614
NM_000051.3(ATM):c.3118A>G (p.Met1040Val) rs3092857
NM_000051.3(ATM):c.334G>A (p.Ala112Thr) rs146382972
NM_000051.3(ATM):c.3517T>C (p.Leu1173=) rs141460670
NM_000051.3(ATM):c.378T>A (p.Asp126Glu) rs2234997
NM_000051.3(ATM):c.3925G>A (p.Ala1309Thr) rs149711770
NM_000051.3(ATM):c.3927A>G (p.Ala1309=) rs1555093665
NM_000051.3(ATM):c.3993+5G>T rs3092842
NM_000051.3(ATM):c.4060C>A (p.Pro1354Thr) rs145119475
NM_000051.3(ATM):c.4066A>G (p.Asn1356Asp) rs147600485
NM_000051.3(ATM):c.4258C>T (p.Leu1420Phe) rs1800058
NM_000051.3(ATM):c.4388T>G (p.Phe1463Cys) rs138327406
NM_000051.3(ATM):c.4578C>T (p.Pro1526=) rs1800889
NM_000051.3(ATM):c.4709T>C (p.Val1570Ala) rs140856217
NM_000051.3(ATM):c.5005+7_5005+8del rs587780626
NM_000051.3(ATM):c.5190A>G (p.Arg1730=) rs786201609
NM_000051.3(ATM):c.5557G>A (p.Asp1853Asn) rs1801516
NM_000051.3(ATM):c.5558A>T (p.Asp1853Val) rs1801673
NM_000051.3(ATM):c.5793T>C (p.Ala1931=) rs3092910
NM_000051.3(ATM):c.6088A>G (p.Ile2030Val) rs145847315
NM_000051.3(ATM):c.6176C>T (p.Thr2059Ile) rs144761622
NM_000051.3(ATM):c.6235G>A (p.Val2079Ile) rs1800060
NM_000051.3(ATM):c.6437G>C (p.Ser2146Thr) rs56815840
NM_000051.3(ATM):c.657T>C (p.Cys219=) rs2235003
NM_000051.3(ATM):c.6795C>T (p.Phe2265=) rs3218699
NM_000051.3(ATM):c.6919C>T (p.Leu2307Phe) rs56009889
NM_000051.3(ATM):c.7271T>G (p.Val2424Gly) rs28904921
NM_000051.3(ATM):c.7928-10T>C rs188404773
NM_000052.7(ATP7A):c.1516A>G (p.Ile506Val) rs143907597
NM_000052.7(ATP7A):c.1707+6T>A rs797045334
NM_000052.7(ATP7A):c.2070A>G (p.Glu690=) rs146692150
NM_000052.7(ATP7A):c.2452A>G (p.Thr818Ala) rs201788154
NM_000052.7(ATP7A):c.2903A>G (p.Glu968Gly) rs138958687
NM_000052.7(ATP7A):c.3002C>T (p.Pro1001Leu) rs797045365
NM_000052.7(ATP7A):c.3449T>C (p.Ile1150Thr) rs201225704
NM_000052.7(ATP7A):c.3931A>G (p.Met1311Val) rs139781067
NM_000052.7(ATP7A):c.4226+11T>C rs200009243
NM_000053.4(ATP7B):c.1216T>G (p.Ser406Ala) rs1801243
NM_000053.4(ATP7B):c.1366G>C (p.Val456Leu) rs1801244
NM_000053.4(ATP7B):c.1877G>C (p.Gly626Ala) rs587783299
NM_000053.4(ATP7B):c.1878C>T (p.Gly626=) rs587783300
NM_000053.4(ATP7B):c.1934T>G (p.Met645Arg) rs121907998
NM_000053.4(ATP7B):c.1969A>C (p.Ser657Arg) rs372436901
NM_000053.4(ATP7B):c.1995G>A (p.Met665Ile) rs72552259
NM_000053.4(ATP7B):c.2002A>G (p.Met668Val) rs587783301
NM_000053.4(ATP7B):c.2122-8T>G rs193922102
NM_000053.4(ATP7B):c.2175G>A (p.Arg725=) rs61733684
NM_000053.4(ATP7B):c.2292C>T (p.Phe764=) rs372979339
NM_000053.4(ATP7B):c.2293G>A (p.Asp765Asn) rs28942075
NM_000053.4(ATP7B):c.2305A>G (p.Met769Val) rs193922103
NM_000053.4(ATP7B):c.2310C>G (p.Leu770=) rs398123136
NM_000053.4(ATP7B):c.2355+13T>G rs139211339
NM_000053.4(ATP7B):c.2605G>A (p.Gly869Arg) rs191312027
NM_000053.4(ATP7B):c.2855G>A (p.Arg952Lys) rs732774
NM_000053.4(ATP7B):c.2865+1G>A rs587783306
NM_000053.4(ATP7B):c.2866-13G>C rs7325983
NM_000053.4(ATP7B):c.2973G>A (p.Thr991=) rs1801246
NM_000053.4(ATP7B):c.3009G>A (p.Ala1003=) rs1801247
NM_000053.4(ATP7B):c.3045G>A (p.Leu1015=) rs1801248
NM_000053.4(ATP7B):c.3188C>T (p.Ala1063Val) rs587783309
NM_000053.4(ATP7B):c.3207C>A (p.His1069Gln) rs76151636
NM_000053.4(ATP7B):c.3324C>T (p.Asn1108=) rs372456815
NM_000053.4(ATP7B):c.3419T>C (p.Val1140Ala) rs1801249
NM_000053.4(ATP7B):c.3498T>C (p.Ser1166=) rs587783314
NM_000053.4(ATP7B):c.3548C>G (p.Ala1183Gly) rs587783315
NM_000053.4(ATP7B):c.3620A>G (p.His1207Arg) rs7334118
NM_000053.4(ATP7B):c.3889G>A (p.Val1297Ile) rs148399850
NM_000053.4(ATP7B):c.3891C>T (p.Val1297=) rs114771537
NM_000053.4(ATP7B):c.3903+6C>T rs2282057
NM_000053.4(ATP7B):c.4135C>T (p.Pro1379Ser) rs181250704
NM_000053.4(ATP7B):c.4311G>A (p.Lys1437=) rs73202048
NM_000057.4(BLM):c.11T>C (p.Val4Ala) rs144706057
NM_000057.4(BLM):c.1928G>A (p.Arg643His) rs12720097
NM_000057.4(BLM):c.2075-12G>T rs28385027
NM_000057.4(BLM):c.2263A>G (p.Lys755Glu) rs142551229
NM_000057.4(BLM):c.2333C>G (p.Ser778Cys) rs139610577
NM_000057.4(BLM):c.2555+7T>C rs3815003
NM_000057.4(BLM):c.2603C>T (p.Pro868Leu) rs2227935
NM_000057.4(BLM):c.3102G>A (p.Thr1034=) rs2227933
NM_000057.4(BLM):c.3128C>A (p.Ala1043Asp) rs2229035
NM_000057.4(BLM):c.3531C>A (p.Ala1177=) rs2227934
NM_000057.4(BLM):c.3625T>A (p.Ser1209Thr) rs1801256
NM_000057.4(BLM):c.3798T>G (p.Val1266=) rs138831180
NM_000057.4(BLM):c.3945C>T (p.Leu1315=) rs1063147
NM_000057.4(BLM):c.3961G>A (p.Val1321Ile) rs7167216
NM_000057.4(BLM):c.4076+4T>G rs183176301
NM_000057.4(BLM):c.615G>A (p.Lys205=) rs28903082
NM_000059.3(BRCA2):c.-11C>T rs76874770
NM_000059.3(BRCA2):c.-175C>T rs55880202
NM_000059.3(BRCA2):c.-59_-57del rs545321666
NM_000059.3(BRCA2):c.10110G>A (p.Arg3370=) rs28897762
NM_000059.3(BRCA2):c.1151C>T (p.Ser384Phe) rs41293475
NM_000059.3(BRCA2):c.125A>G (p.Tyr42Cys) rs4987046
NM_000059.3(BRCA2):c.1275A>G (p.Glu425=) rs34355306
NM_000059.3(BRCA2):c.1362A>G (p.Lys454=) rs55919657
NM_000059.3(BRCA2):c.1514T>C (p.Ile505Thr) rs28897708
NM_000059.3(BRCA2):c.1798T>C (p.Tyr600His) rs75419644
NM_000059.3(BRCA2):c.1889C>T (p.Thr630Ile) rs80358479
NM_000059.3(BRCA2):c.1909+9_1909+10del rs527732001
NM_000059.3(BRCA2):c.1938C>T (p.Ser646=) rs28897711
NM_000059.3(BRCA2):c.1964C>G (p.Pro655Arg) rs28897712
NM_000059.3(BRCA2):c.2524G>C (p.Val842Leu) rs587782454
NM_000059.3(BRCA2):c.2883G>A (p.Gln961=) rs11571655
NM_000059.3(BRCA2):c.2926T>A (p.Ser976Thr) rs144862123
NM_000059.3(BRCA2):c.2927C>T (p.Ser976Phe) rs11571656
NM_000059.3(BRCA2):c.3516G>A (p.Ser1172=) rs1799952
NM_000059.3(BRCA2):c.3869G>A (p.Cys1290Tyr) rs41293485
NM_000059.3(BRCA2):c.4061C>T (p.Thr1354Met) rs80358656
NM_000059.3(BRCA2):c.4068G>A (p.Leu1356=) rs28897724
NM_000059.3(BRCA2):c.4090A>C (p.Ile1364Leu) rs56248502
NM_000059.3(BRCA2):c.4241C>T (p.Thr1414Met) rs70953664
NM_000059.3(BRCA2):c.5070A>C (p.Lys1690Asn) rs56087561
NM_000059.3(BRCA2):c.5198C>T (p.Ser1733Phe) rs55639415
NM_000059.3(BRCA2):c.5640T>G (p.Asn1880Lys) rs11571657
NM_000059.3(BRCA2):c.5704G>A (p.Asp1902Asn) rs4987048
NM_000059.3(BRCA2):c.5710C>G (p.Leu1904Val) rs55875643
NM_000059.3(BRCA2):c.5752C>T (p.His1918Tyr) rs80358803
NM_000059.3(BRCA2):c.5785A>G (p.Ile1929Val) rs79538375
NM_000059.3(BRCA2):c.5885T>C (p.Ile1962Thr) rs1060502377
NM_000059.3(BRCA2):c.5946del (p.Ser1982fs) rs80359550
NM_000059.3(BRCA2):c.6100C>T (p.Arg2034Cys) rs1799954
NM_000059.3(BRCA2):c.6131G>T (p.Gly2044Val) rs56191579
NM_000059.3(BRCA2):c.6323G>A (p.Arg2108His) rs35029074
NM_000059.3(BRCA2):c.6347A>G (p.His2116Arg) rs55953736
NM_000059.3(BRCA2):c.6531T>A (p.Ile2177=) rs587780658
NM_000059.3(BRCA2):c.6540G>C (p.Leu2180Phe) rs398122560
NM_000059.3(BRCA2):c.6748A>G (p.Thr2250Ala) rs80358899
NM_000059.3(BRCA2):c.68-7T>A rs81002830
NM_000059.3(BRCA2):c.6937+565T>C rs11571675
NM_000059.3(BRCA2):c.7008-62A>G rs76584943
NM_000059.3(BRCA2):c.708T>C (p.His236=) rs185506536
NM_000059.3(BRCA2):c.7435+6G>A rs81002852
NM_000059.3(BRCA2):c.7504C>T (p.Arg2502Cys) rs55716624
NM_000059.3(BRCA2):c.8182G>A (p.Val2728Ile) rs28897749
NM_000059.3(BRCA2):c.8355T>C (p.Pro2785=) rs1057524419
NM_000059.3(BRCA2):c.8488-5T>C rs533806629
NM_000059.3(BRCA2):c.8850G>T (p.Lys2950Asn) rs28897754
NM_000059.3(BRCA2):c.9116C>T (p.Pro3039Leu) rs80359167
NM_000059.3(BRCA2):c.9371A>T (p.Asn3124Ile) rs28897759
NM_000059.3(BRCA2):c.9396A>G (p.Lys3132=) rs201172050
NM_000059.3(BRCA2):c.956A>C (p.Asn319Thr) rs55939572
NM_000070.3(CAPN3):c.1029+3A>G rs28364442
NM_000070.3(CAPN3):c.1355-6G>A rs28364485
NM_000070.3(CAPN3):c.1557C>T (p.His519=) rs368385372
NM_000070.3(CAPN3):c.1830C>T (p.Asn610=) rs202019404
NM_000070.3(CAPN3):c.2205_2206CA[1] (p.Thr736fs) rs587780289
NM_000070.3(CAPN3):c.2243G>A (p.Arg748Gln) rs587780290
NM_000070.3(CAPN3):c.2332G>A (p.Asp778Asn) rs115311625
NM_000070.3(CAPN3):c.2362_2363delinsTCATCT (p.Arg788fs) rs1555423217
NM_000070.3(CAPN3):c.327_328dup (p.Arg110fs) rs797045427
NM_000070.3(CAPN3):c.371G>C (p.Gly124Ala) rs587780291
NM_000070.3(CAPN3):c.479C>G (p.Ala160Gly) rs17592
NM_000070.3(CAPN3):c.551C>T (p.Thr184Met) rs35889956
NM_000070.3(CAPN3):c.606T>C (p.Ser202=) rs17593
NM_000070.3(CAPN3):c.62G>A (p.Gly21Glu) rs28364364
NM_000070.3(CAPN3):c.78G>A (p.Pro26=) rs62642519
NM_000070.3(CAPN3):c.939G>A (p.Pro313=) rs78369269
NM_000070.3(CAPN3):c.96T>C (p.Thr32=) rs1801496
NM_000076.2(CDKN1C):c.528G>C (p.Ala176=) rs533485167
NM_000076.2(CDKN1C):c.555T>C (p.Ala185=) rs191294997
NM_000076.2(CDKN1C):c.708G>A (p.Glu236=) rs3741341
NM_000080.4(CHRNE):c.1017C>G (p.Ser339=) rs114454383
NM_000080.4(CHRNE):c.1033-6C>T rs2075763
NM_000080.4(CHRNE):c.1305A>G (p.Arg435=) rs55681486
NM_000080.4(CHRNE):c.1402G>C (p.Val468Leu) rs139171143
NM_000080.4(CHRNE):c.45C>T (p.Leu15=) rs34563587
NM_000086.2(CLN3):c.1210C>A (p.His404Asn) rs146610181
NM_000086.2(CLN3):c.1211A>G (p.His404Arg) rs77595156
NM_000086.2(CLN3):c.313A>G (p.Ile105Val) rs11552531
NM_000086.2(CLN3):c.768C>T (p.Thr256=) rs145967477
NM_000096.4(CP):c.1099C>T (p.Arg367Cys) rs34624984
NM_000096.4(CP):c.1430C>T (p.Pro477Leu) rs35331711
NM_000096.4(CP):c.1493A>G (p.Gln498Arg) rs17847018
NM_000096.4(CP):c.1652C>T (p.Thr551Ile) rs61733458
NM_000096.4(CP):c.1948G>A (p.Gly650Arg) rs776936158
NM_000096.4(CP):c.1950A>C (p.Gly650=) rs1053709
NM_000096.4(CP):c.2522C>G (p.Thr841Arg) rs56033670
NM_000096.4(CP):c.2571C>T (p.Tyr857=) rs151304828
NM_000096.4(CP):c.2684G>C (p.Gly895Ala) rs139633388
NM_000096.4(CP):c.2793A>G (p.Leu931=) rs34987997
NM_000096.4(CP):c.2991T>C (p.His997=) rs34394958
NM_000096.4(CP):c.3182-4A>G rs34272112
NM_000096.4(CP):c.322C>T (p.His108Tyr) rs34386552
NM_000100.3(CSTB):c.15G>T (p.Ala5=) rs4533
NM_000100.3(CSTB):c.67-1G>C rs147484110
NM_000110.3(DPYD):c.1905+1G>A rs3918290
NM_000110.3(DPYD):c.2846A>T (p.Asp949Val) rs67376798
NM_000118.3(ENG):c.392C>T (p.Pro131Leu) rs139398993
NM_000123.3(ERCC5):c.138T>C (p.His46=) rs1047768
NM_000123.3(ERCC5):c.1586G>C (p.Cys529Ser) rs2227869
NM_000123.3(ERCC5):c.3310G>C (p.Asp1104His) rs17655
NM_000123.3(ERCC5):c.760A>G (p.Met254Val) rs1047769
NM_000124.4(ERCC6):c.1196G>A (p.Gly399Asp) rs2228528
NM_000124.4(ERCC6):c.135C>G (p.Leu45=) rs2228524
NM_000124.4(ERCC6):c.1996C>T (p.Arg666Cys) rs61760163
NM_000124.4(ERCC6):c.2551T>C (p.Trp851Arg) rs368728467
NM_000124.4(ERCC6):c.2751C>T (p.Gly917=) rs2229760
NM_000124.4(ERCC6):c.3122A>C (p.Gln1041Pro) rs139007661
NM_000124.4(ERCC6):c.3289A>G (p.Met1097Val) rs2228526
NM_000124.4(ERCC6):c.3637A>G (p.Arg1213Gly) rs2228527
NM_000124.4(ERCC6):c.3689G>C (p.Arg1230Pro) rs4253211
NM_000124.4(ERCC6):c.411G>A (p.Leu137=) rs4253013
NM_000124.4(ERCC6):c.4238A>G (p.Gln1413Arg) rs2228529
NM_000135.4(FANCA):c.1111_1114TTGG[1] (p.Val372fs) rs397507552
NM_000135.4(FANCA):c.115A>C (p.Arg39=) rs17232091
NM_000135.4(FANCA):c.1359+10C>T rs34159559
NM_000135.4(FANCA):c.1471-12A>G rs9282684
NM_000135.4(FANCA):c.1874G>C (p.Cys625Ser) rs139235751
NM_000135.4(FANCA):c.1928C>G (p.Pro643Arg) rs34592408
NM_000135.4(FANCA):c.1A>G (p.Met1Val) rs772751654
NM_000135.4(FANCA):c.2021C>T (p.Ser674Leu) rs17232973
NM_000135.4(FANCA):c.21G>T (p.Pro7=) rs115856189
NM_000135.4(FANCA):c.2222+7G>A rs374312736
NM_000135.4(FANCA):c.2398G>T (p.Glu800Ter) rs1555547474
NM_000135.4(FANCA):c.2574C>G (p.Ser858Arg) rs17233141
NM_000135.4(FANCA):c.2601+9A>T rs771837383
NM_000135.4(FANCA):c.3482C>T (p.Thr1161Met) rs142833057
NM_000135.4(FANCA):c.3538G>A (p.Val1180Met) rs372706571
NM_000135.4(FANCA):c.3624C>T (p.Ser1208=) rs149797103
NM_000135.4(FANCA):c.377C>G (p.Thr126Arg) rs139160837
NM_000135.4(FANCA):c.4249C>G (p.His1417Asp) rs17227403
NM_000135.4(FANCA):c.793-9T>C rs757500718
NM_000136.3(FANCC):c.*7C>T rs372511678
NM_000136.3(FANCC):c.-155A>C rs549658720
NM_000136.3(FANCC):c.1330-3C>T rs4647542
NM_000136.3(FANCC):c.1394A>G (p.Gln465Arg) rs1800368
NM_000136.3(FANCC):c.584A>T (p.Asp195Val) rs1800365
NM_000136.3(FANCC):c.77C>T (p.Ser26Phe) rs1800361
NM_000136.3(FANCC):c.816C>T (p.Ile272=) rs55719336
NM_000138.4(FBN1):c.6288C>T (p.Cys2096=) rs144822241
NM_000142.4(FGFR3):c.1172C>A (p.Ala391Glu) rs28931615
NM_000142.4(FGFR3):c.393G>A (p.Ser131=) rs55662109
NM_000143.3(FH):c.-11C>T rs200942733
NM_000144.5(FXN):c.179G>A (p.Arg60His) rs141858334
NM_000144.5(FXN):c.54A>G (p.Pro18=) rs2481598
NM_000146.4(FTL):c.*8C>T rs373178636
NM_000146.4(FTL):c.163T>C (p.Leu55=) rs2230267
NM_000152.3(GAA):c.2065G>A (p.Glu689Lys) rs1800309
NM_000152.5(GAA):c.-32-13T>G rs386834236
NM_000152.5(GAA):c.1374C>T (p.Tyr458=) rs1800305
NM_000152.5(GAA):c.1581G>A (p.Arg527=) rs1042396
NM_000152.5(GAA):c.1726G>A (p.Gly576Ser) rs1800307
NM_000152.5(GAA):c.2133A>G (p.Thr711=) rs1800310
NM_000152.5(GAA):c.2446G>A (p.Val816Ile) rs1800314
NM_000152.5(GAA):c.271G>A (p.Asp91Asn) rs1800299
NM_000152.5(GAA):c.2780C>T (p.Thr927Ile) rs1800315
NM_000152.5(GAA):c.447G>A (p.Thr149=) rs2289536
NM_000152.5(GAA):c.642C>T (p.Ser214=) rs1800301
NM_000152.5(GAA):c.668G>A (p.Arg223His) rs1042395
NM_000152.5(GAA):c.688G>A (p.Val230Met) rs145866792
NM_000152.5(GAA):c.858+8G>A rs5822325
NM_000152.5(GAA):c.917C>T (p.Ser306Leu) rs138097673
NM_000152.5(GAA):c.921A>T (p.Ala307=) rs1800303
NM_000153.4(GALC):c.659G>A (p.Arg220Gln) rs199967869
NM_000156.6(GAMT):c.379G>A (p.Gly127Ser) rs570476209
NM_000156.6(GAMT):c.571-6G>A rs2074899
NM_000156.6(GAMT):c.626C>T (p.Thr209Met) rs17851582
NM_000156.6(GAMT):c.79T>C (p.Tyr27His) rs200833152
NM_000157.4(GBA):c.1226A>G (p.Asn409Ser) rs76763715
NM_000158.4(GBE1):c.1521T>C (p.Thr507=) rs372821643
NM_000158.4(GBE1):c.986A>G (p.Tyr329Cys) rs80338671
NM_000162.5(GCK):c.106C>T (p.Arg36Trp) rs762263694
NM_000162.5(GCK):c.1130_1138del (p.Arg377_Ala379del) rs1131691505
NM_000162.5(GCK):c.1253+8C>T rs2908274
NM_000162.5(GCK):c.1288C>T (p.Leu430=) rs193922276
NM_000162.5(GCK):c.1322C>T (p.Ser441Leu) rs1286804191
NM_000162.5(GCK):c.208+11G>A rs77440690
NM_000162.5(GCK):c.209-8G>A rs144798843
NM_000162.5(GCK):c.31G>A (p.Ala11Thr) rs116093166
NM_000162.5(GCK):c.333C>T (p.Pro111=) rs61736250
NM_000162.5(GCK):c.339C>T (p.Asp113=) rs149412035
NM_000162.5(GCK):c.364C>A (p.Leu122Ile) rs1554335616
NM_000162.5(GCK):c.370G>A (p.Asp124Asn) rs759072800
NM_000162.5(GCK):c.46-12C>T rs142829768
NM_000162.5(GCK):c.616A>C (p.Thr206Pro) rs587780346
NM_000162.5(GCK):c.618G>A (p.Thr206=) rs142817246
NM_000162.5(GCK):c.676G>A (p.Val226Met) rs148311934
NM_000162.5(GCK):c.835G>C (p.Glu279Gln) rs104894005
NM_000165.5(GJA1):c.226C>A (p.Arg76Ser) rs267606845
NM_000165.5(GJA1):c.717G>A (p.Arg239=) rs57946868
NM_000168.6(GLI3):c.1182A>G (p.Pro394=) rs748606221
NM_000168.6(GLI3):c.1207G>A (p.Val403Ile) rs201070431
NM_000168.6(GLI3):c.1242+8G>A rs75925934
NM_000168.6(GLI3):c.2119C>T (p.Pro707Ser) rs121917716
NM_000168.6(GLI3):c.280C>T (p.Leu94=) rs115137047
NM_000168.6(GLI3):c.341G>A (p.Arg114Lys) rs146458902
NM_000168.6(GLI3):c.3829C>G (p.Gln1277Glu) rs146582871
NM_000173.7(GP1BA):c.1282_1359del (p.415_427SEPAPSPTTPEPT[1]) rs869060239
NM_000173.7(GP1BA):c.1311_1349del (p.415_427SEPAPSPTTPEPT[2]) rs770991996
NM_000173.7(GP1BA):c.1321_1359del (p.415_427SEPAPSPTTPEPT[2]) rs1259394995
NM_000173.7(GP1BA):c.256C>T (p.Leu86Phe) rs13306411
NM_000179.2(MSH6):c.-8C>T rs565211544
NM_000179.2(MSH6):c.1050C>T (p.Ala350=) rs730881802
NM_000179.2(MSH6):c.1186C>G (p.Leu396Val) rs2020908
NM_000179.2(MSH6):c.1665A>G (p.Ala555=) rs146785465
NM_000179.2(MSH6):c.2633T>C (p.Val878Ala) rs2020912
NM_000179.2(MSH6):c.2667G>T (p.Gln889His) rs149945495
NM_000179.2(MSH6):c.3217C>T (p.Pro1073Ser) rs142254875
NM_000179.2(MSH6):c.3647-6T>A rs182871847
NM_000179.2(MSH6):c.3729A>G (p.Thr1243=) rs773807182
NM_000179.2(MSH6):c.4001+2TAAC[2] rs267608132
NM_000179.2(MSH6):c.4002-10T>A rs545466048
NM_000179.2(MSH6):c.431G>T (p.Ser144Ile) rs3211299
NM_000179.2(MSH6):c.73G>T (p.Ala25Ser) rs267608026
NM_000179.2(MSH6):c.984C>T (p.Ser328=) rs138143769
NM_000194.3(HPRT1):c.384+9C>T rs748658007
NM_000195.5(HPS1):c.1472_1487dup (p.His497fs) rs281865163
NM_000195.5(HPS1):c.1531C>A (p.Arg511=) rs147748659
NM_000195.5(HPS1):c.2052C>T (p.Ala684=) rs576260502
NM_000195.5(HPS1):c.478C>T (p.Arg160Trp) rs142893758
NM_000195.5(HPS1):c.557C>T (p.Ala186Val) rs1801286
NM_000195.5(HPS1):c.848G>C (p.Gly283Ala) rs74154475
NM_000207.2(INS):c.-152C>G rs748749585
NM_000207.3(INS):c.188-10G>A rs41275198
NM_000207.3(INS):c.265C>T (p.Arg89Cys) rs80356669
NM_000207.3(INS):c.94G>A (p.Gly32Ser) rs80356664
NM_000208.4(INSR):c.1080C>T (p.Cys360=) rs56066516
NM_000208.4(INSR):c.151G>A (p.Glu51Lys) rs140852238
NM_000208.4(INSR):c.190T>C (p.Leu64=) rs144836032
NM_000208.4(INSR):c.2243C>T (p.Ser748Leu) rs143523271
NM_000208.4(INSR):c.2295C>T (p.Gly765=) rs142654992
NM_000208.4(INSR):c.2355G>A (p.Ser785=) rs148137322
NM_000208.4(INSR):c.2736G>A (p.Arg912=) rs147125937
NM_000208.4(INSR):c.2838C>G (p.Asp946Glu) rs146588336
NM_000208.4(INSR):c.2971C>A (p.Leu991Ile) rs150114699
NM_000208.4(INSR):c.3034G>A (p.Val1012Met) rs1799816
NM_000208.4(INSR):c.653-23TC[8] rs3835070
NM_000208.4(INSR):c.687C>T (p.Thr229=) rs150568177
NM_000208.4(INSR):c.959C>T (p.Thr320Met) rs138528064
NM_000209.4(PDX1):c.188del (p.Pro63fs) rs193929377
NM_000209.4(PDX1):c.285G>A (p.Pro95=) rs797045885
NM_000217.3(KCNA1):c.1440T>A (p.Thr480=) rs4766309
NM_000217.3(KCNA1):c.684T>C (p.Cys228=) rs1048500
NM_000217.3(KCNA1):c.804G>C (p.Thr268=) rs2227910
NM_000222.2(KIT):c.200C>G (p.Thr67Ser) rs144933028
NM_000231.2(SGCG):c.228T>C (p.Asp76=) rs1800350
NM_000231.2(SGCG):c.347G>A (p.Arg116His) rs17314986
NM_000231.2(SGCG):c.435C>T (p.Asn145=) rs35628352
NM_000231.2(SGCG):c.705T>C (p.Leu235=) rs1800353
NM_000240.3(MAOA):c.1410T>C (p.Asp470=) rs1137070
NM_000240.3(MAOA):c.1559A>G (p.Lys520Arg) rs1800466
NM_000240.3(MAOA):c.385A>C (p.Arg129=) rs1800464
NM_000240.3(MAOA):c.825G>A (p.Pro275=) rs138703731
NM_000240.3(MAOA):c.891G>T (p.Arg297=) rs6323
NM_000244.3(MEN1):c.1201-6G>A rs576193460
NM_000249.3(MLH1):c.1151T>A (p.Val384Asp) rs63750447
NM_000249.3(MLH1):c.1321G>A (p.Ala441Thr) rs63750365
NM_000249.3(MLH1):c.1852A>G (p.Lys618Glu) rs35001569
NM_000249.3(MLH1):c.1853A>C (p.Lys618Thr) rs63750449
NM_000249.3(MLH1):c.1963A>G (p.Ile655Val) rs55907433
NM_000249.3(MLH1):c.303T>G (p.Gly101=) rs4647220
NM_000249.3(MLH1):c.637G>A (p.Val213Met) rs2308317
NM_000249.3(MLH1):c.790+10A>G rs182733777
NM_000249.3(MLH1):c.974G>A (p.Arg325Gln) rs63750268
NM_000251.2(MSH2):c.1387-8G>T rs187525243
NM_000251.2(MSH2):c.1563T>C (p.Tyr521=) rs63750330
NM_000251.2(MSH2):c.1737A>G (p.Lys579=) rs61756467
NM_000251.2(MSH2):c.2006-4G>A rs369853630
NM_000251.2(MSH2):c.339G>A (p.Lys113=) rs35898375
NM_000251.2(MSH2):c.409G>C (p.Gly137Arg) rs587781795
NM_000251.2(MSH2):c.435T>G (p.Ile145Met) rs63750124
NM_000251.2(MSH2):c.815C>T (p.Ala272Val) rs34136999
NM_000251.2(MSH2):c.984C>T (p.Ala328=) rs4987189
NM_000252.2(MTM1):c.1260+3G>A rs222410
NM_000252.2(MTM1):c.1260+5G>A rs587783769
NM_000252.2(MTM1):c.1291G>A (p.Asp431Asn) rs886044782
NM_000252.2(MTM1):c.1367T>C (p.Phe456Ser) rs587783783
NM_000252.2(MTM1):c.1406A>G (p.His469Arg) rs587783789
NM_000252.2(MTM1):c.1701C>T (p.Tyr567=) rs587783806
NM_000252.2(MTM1):c.422C>T (p.Ala141Val) rs140642341
NM_000252.2(MTM1):c.676C>A (p.Pro226Thr) rs587783848
NM_000252.2(MTM1):c.688T>C (p.Trp230Arg) rs398123274
NM_000253.3(MTTP):c.383T>C (p.Ile128Thr) rs3816873
NM_000253.3(MTTP):c.453T>C (p.Gly151=) rs991811
NM_000253.3(MTTP):c.522T>C (p.Cys174=) rs982424
NM_000253.3(MTTP):c.730C>G (p.Gln244Glu) rs17599091
NM_000253.3(MTTP):c.891C>G (p.His297Gln) rs2306985
NM_000257.4(MYH7):c.1002C>T (p.Asn334=) rs34803781
NM_000257.4(MYH7):c.1062C>T (p.Gly354=) rs735712
NM_000257.4(MYH7):c.1767C>T (p.Asn589=) rs3729816
NM_000257.4(MYH7):c.2334C>T (p.Asp778=) rs2069544
NM_000257.4(MYH7):c.2360G>A (p.Arg787His) rs376754645
NM_000257.4(MYH7):c.3036C>T (p.Ala1012=) rs145379951
NM_000257.4(MYH7):c.3153G>A (p.Ala1051=) rs45540831
NM_000257.4(MYH7):c.3337-4dup rs45504498
NM_000257.4(MYH7):c.3474C>T (p.Ser1158=) rs587780395
NM_000257.4(MYH7):c.4472C>G (p.Ser1491Cys) rs3729823
NM_000257.4(MYH7):c.4566T>C (p.Thr1522=) rs2754155
NM_000257.4(MYH7):c.4716C>T (p.Ile1572=) rs7140196
NM_000257.4(MYH7):c.597A>G (p.Ala199=) rs2069541
NM_000257.4(MYH7):c.975C>T (p.Asp325=) rs2231124
NM_000259.3(MYO5A):c.2814G>A (p.Glu938=) rs190656197
NM_000259.3(MYO5A):c.3568-4C>T rs144406001
NM_000259.3(MYO5A):c.696T>C (p.Tyr232=) rs148997257
NM_000262.3(NAGA):c.973G>A (p.Glu325Lys) rs121434529
NM_000267.3(NF1):c.*4T>C rs201044568
NM_000267.3(NF1):c.1810T>C (p.Leu604=) rs142712751
NM_000267.3(NF1):c.2022C>T (p.Ser674=) rs2230851
NM_000267.3(NF1):c.2553C>T (p.Cys851=) rs2230852
NM_000267.3(NF1):c.2622G>A (p.Lys874=) rs77917884
NM_000267.3(NF1):c.3198-4T>C rs587782218
NM_000267.3(NF1):c.340C>T (p.Leu114=) rs7207410
NM_000267.3(NF1):c.528T>A (p.Asp176Glu) rs112306990
NM_000267.3(NF1):c.6330C>T (p.His2110=) rs17881788
NM_000267.3(NF1):c.7347T>C (p.Asn2449=) rs17881903
NM_000267.3(NF1):c.7468G>C (p.Val2490Leu) rs2230850
NM_000267.3(NF1):c.8042A>T (p.Tyr2681Phe) rs201824349
NM_000267.3(NF1):c.8436T>C (p.Asn2812=) rs142636150
NM_000271.5(NPC1):c.1926G>C (p.Met642Ile) rs1788799
NM_000271.5(NPC1):c.2572A>G (p.Ile858Val) rs1805082
NM_000271.5(NPC1):c.2621A>T (p.Asp874Val) rs372030650
NM_000271.5(NPC1):c.2793C>T (p.Asn931=) rs1140458
NM_000271.5(NPC1):c.3182T>C (p.Ile1061Thr) rs80358259
NM_000271.5(NPC1):c.3246-2A>G rs886042268
NM_000271.5(NPC1):c.3561G>T (p.Ala1187=) rs55724504
NM_000271.5(NPC1):c.387T>C (p.Tyr129=) rs12970899
NM_000271.5(NPC1):c.644A>G (p.His215Arg) rs1805081
NM_000272.4(NPHP1):c.115C>A (p.Pro39Thr) rs33958626
NM_000272.4(NPHP1):c.14G>T (p.Arg5Leu) rs190983114
NM_000272.4(NPHP1):c.654G>A (p.Glu218=) rs11675767
NM_000272.4(NPHP1):c.810C>T (p.Cys270=) rs73954628
NM_000273.3(GPR143):c.371A>G (p.Gln124Arg) rs62635032
NM_000273.3(GPR143):c.570C>T (p.His190=) rs61733440
NM_000275.3(OCA2):c.1109T>C (p.Ile370Thr) rs34731820
NM_000275.3(OCA2):c.1183A>C (p.Met395Leu) rs757286784
NM_000275.3(OCA2):c.1320G>C (p.Leu440Phe) rs1800408
NM_000275.3(OCA2):c.1327G>A (p.Val443Ile) rs121918166
NM_000275.3(OCA2):c.1503+5G>A rs368124046
NM_000275.3(OCA2):c.1679G>A (p.Arg560His) rs35110389
NM_000275.3(OCA2):c.2207C>T (p.Ser736Leu) rs780296175
NM_000275.3(OCA2):c.2208G>T (p.Ser736=) rs1800418
NM_000275.3(OCA2):c.2425T>A (p.Phe809Ile) rs765779905
NM_000275.3(OCA2):c.79G>A (p.Gly27Arg) rs61738394
NM_000275.3(OCA2):c.819_822delinsGGTC (p.Asn273_Trp274delinsLysVal) rs797044784
NM_000276.4(OCRL):c.41C>T (p.Thr14Ile) rs61752970
NM_000276.4(OCRL):c.439+3A>G rs61752971
NM_000276.4(OCRL):c.954C>T (p.Arg318=) rs149646700
NM_000277.3(PAH):c.506G>A (p.Arg169His) rs199475679
NM_000284.4(PDHA1):c.1173_*5del (p.Ter391Xaa) rs762505127
NM_000284.4(PDHA1):c.795A>G (p.Ala265=) rs1126565
NM_000284.4(PDHA1):c.984T>C (p.Asn328=) rs767503319
NM_000287.4(PEX6):c.1802G>A (p.Arg601Gln) rs34324426
NM_000288.4(PEX7):c.875T>A (p.Leu292Ter) rs1805137
NM_000288.4(PEX7):c.903+1G>C rs148591292
NM_000303.3(PMM2):c.324G>A (p.Ala108=) rs62031146
NM_000303.3(PMM2):c.422G>A (p.Arg141His) rs28936415
NM_000304.4(PMP22):c.353C>T (p.Thr118Met) rs104894619
NM_000310.3(PPT1):c.363-4G>A rs117284255
NM_000310.3(PPT1):c.401T>C (p.Ile134Thr) rs1800205
NM_000310.3(PPT1):c.451C>T (p.Arg151Ter) rs137852700
NM_000310.3(PPT1):c.627+4A>G rs572153728
NM_000310.3(PPT1):c.837G>C (p.Gln279His) rs72937434
NM_000311.5(PRNP):c.385A>G (p.Met129Val) rs1799990
NM_000314.6(PTEN):c.-1027C>A rs587781128
NM_000314.7(PTEN):c.-734G>A rs886047384
NM_000314.7(PTEN):c.202T>C (p.Tyr68His) rs398123317
NM_000314.7(PTEN):c.210-7_210-3del rs587780544
NM_000314.7(PTEN):c.579G>A (p.Leu193=) rs568851024
NM_000317.3(PTS):c.347A>G (p.Asp116Gly) rs104894279
NM_000318.3(PEX2):c.748T>C (p.Trp250Arg) rs142645936
NM_000334.4(SCN4A):c.1167T>C (p.Tyr389=) rs16947296
NM_000334.4(SCN4A):c.2289C>T (p.Ile763=) rs76894284
NM_000334.4(SCN4A):c.2341G>A (p.Val781Ile) rs62070884
NM_000334.4(SCN4A):c.2631T>C (p.Asp877=) rs79893125
NM_000334.4(SCN4A):c.2717G>C (p.Ser906Thr) rs41280102
NM_000334.4(SCN4A):c.2919C>T (p.Pro973=) rs73992419
NM_000334.4(SCN4A):c.2989+5G>A rs115695396
NM_000334.4(SCN4A):c.3441+7G>A rs142270113
NM_000334.4(SCN4A):c.3604G>A (p.Glu1202Lys) rs201916531
NM_000334.4(SCN4A):c.366C>T (p.Arg122=) rs41280108
NM_000334.4(SCN4A):c.3759C>T (p.Ala1253=) rs72851170
NM_000334.4(SCN4A):c.4288+10G>T rs114059193
NM_000334.4(SCN4A):c.4690G>A (p.Val1564Ile) rs202106192
NM_000334.4(SCN4A):c.4905C>T (p.Ile1635=) rs59081944
NM_000334.4(SCN4A):c.5274C>T (p.His1758=) rs113418988
NM_000337.5(SGCD):c.290G>A (p.Arg97Gln) rs45559835
NM_000337.5(SGCD):c.294+8T>C rs11748588
NM_000340.2(SLC2A2):c.1437C>T (p.Phe479=) rs5398
NM_000340.2(SLC2A2):c.329C>T (p.Thr110Ile) rs5400
NM_000340.2(SLC2A2):c.594G>A (p.Thr198=) rs5404
NM_000340.2(SLC2A2):c.661C>T (p.Leu221=) rs5405
NM_000341.4(SLC3A1):c.*779C>T rs149012504
NM_000348.4(SRD5A2):c.680G>A (p.Arg227Gln) rs9332964
NM_000348.4(SRD5A2):c.682G>A (p.Ala228Thr) rs121434249
NM_000348.4(SRD5A2):c.734C>A (p.Ser245Tyr) rs145712014
NM_000352.4(ABCC8):c.-72G>A rs541244107
NM_000356.4(TCOF1):c.1050G>A (p.Ala350=) rs113299143
NM_000356.4(TCOF1):c.122C>T (p.Ala41Val) rs56180593
NM_000356.4(TCOF1):c.1347C>T (p.Pro449=) rs2071238
NM_000356.4(TCOF1):c.1530G>T (p.Gly510=) rs7701163
NM_000356.4(TCOF1):c.1611A>G (p.Ser537=) rs2071239
NM_000356.4(TCOF1):c.162A>G (p.Gln54=) rs73270831
NM_000356.4(TCOF1):c.1762G>C (p.Ala588Pro) rs2071240
NM_000356.4(TCOF1):c.1863A>G (p.Glu621=) rs34796297
NM_000356.4(TCOF1):c.2014C>T (p.Pro672Ser) rs73270846
NM_000356.4(TCOF1):c.2429T>C (p.Val810Ala) rs7713638
NM_000356.4(TCOF1):c.2534C>T (p.Ser845Leu) rs114689020
NM_000356.4(TCOF1):c.3296C>G (p.Pro1099Arg) rs1136103
NM_000356.4(TCOF1):c.3370-3C>T rs11743855
NM_000356.4(TCOF1):c.3478G>A (p.Ala1160Thr) rs137960641
NM_000356.4(TCOF1):c.3819G>A (p.Ser1273=) rs114169102
NM_000356.4(TCOF1):c.3938C>T (p.Ala1313Val) rs15251
NM_000356.4(TCOF1):c.4061G>C (p.Gly1354Ala) rs45491898
NM_000368.4(TSC1):c.1001C>T (p.Ser334Leu) rs118203481
NM_000368.4(TSC1):c.1335A>G (p.Glu445=) rs7862221
NM_000368.4(TSC1):c.1760A>G (p.Lys587Arg) rs118203576
NM_000368.4(TSC1):c.2194C>T (p.His732Tyr) rs118203657
NM_000368.4(TSC1):c.2646C>T (p.Ala882=) rs118203720
NM_000368.4(TSC1):c.2829C>T (p.Ala943=) rs4962081
NM_000368.4(TSC1):c.3103G>A (p.Gly1035Ser) rs118203742
NM_000368.4(TSC1):c.3324C>T (p.Gly1108=) rs35593170
NM_000368.4(TSC1):c.3387C>T (p.Ala1129=) rs200200869
NM_000368.4(TSC1):c.965T>C (p.Met322Thr) rs1073123
NM_000369.2(TSHR):c.1657G>A (p.Ala553Thr) rs121908872
NM_000369.2(TSHR):c.357T>A (p.Pro119=) rs144084915
NM_000369.3(TSHR):c.202C>T rs142063461
NM_000372.5(TYR):c.1037-7T>A rs61754381
NM_000372.5(TYR):c.1064C>T (p.Ala355Val) rs151206295
NM_000372.5(TYR):c.1199G>T (p.Trp400Leu) rs62645916
NM_000372.5(TYR):c.1204C>T (p.Arg402Ter) rs62645917
NM_000372.5(TYR):c.1205G>A (p.Arg402Gln) rs1126809
NM_000372.5(TYR):c.1217C>T (p.Pro406Leu) rs104894313
NM_000372.5(TYR):c.1234C>G (p.Pro412Ala) rs797046081
NM_000372.5(TYR):c.140G>A (p.Gly47Asp) rs61753180
NM_000372.5(TYR):c.230G>A (p.Arg77Gln) rs61753185
NM_000372.5(TYR):c.242C>T (p.Pro81Leu) rs28940876
NM_000372.5(TYR):c.650G>A (p.Arg217Gln) rs61754365
NM_000372.5(TYR):c.823G>T (p.Val275Phe) rs104894314
NM_000372.5(TYR):c.832C>T (p.Arg278Ter) rs62645904
NM_000372.5(TYR):c.835T>C (p.Leu279=) rs4987234
NM_000372.5(TYR):c.896G>A (p.Arg299His) rs61754375
NM_000377.2(WAS):c.1299G>A (p.Ala433=) rs372649110
NM_000377.2(WAS):c.1378C>T (p.Pro460Ser) rs143885622
NM_000377.2(WAS):c.538C>A (p.His180Asn) rs145040665
NM_000377.2(WAS):c.995T>C (p.Val332Ala) rs2737799
NM_000383.4(AIRE):c.1095+6G>A rs1800525
NM_000383.4(AIRE):c.1197T>C (p.Ala399=) rs1800521
NM_000383.4(AIRE):c.1296G>A (p.Ala432=) rs144359012
NM_000383.4(AIRE):c.1322C>T (p.Thr441Met) rs72650677
NM_000383.4(AIRE):c.1411C>T (p.Arg471Cys) rs74203920
NM_000383.4(AIRE):c.1578T>C (p.Asp526=) rs1133779
NM_000383.4(AIRE):c.588C>T (p.Ser196=) rs878081
NM_000383.4(AIRE):c.595G>A (p.Val199Ile) rs74162061
NM_000383.4(AIRE):c.681C>T (p.Gly227=) rs1055311
NM_000383.4(AIRE):c.789C>T (p.Gly263=) rs138066507
NM_000383.4(AIRE):c.834C>G (p.Ser278Arg) rs1800520
NM_000383.4(AIRE):c.99T>C (p.Ala33=) rs3746964
NM_000384.3(APOB):c.10580G>A (p.Arg3527Gln) rs5742904
NM_000384.3(APOB):c.10913G>A (p.Arg3638Gln) rs1801701
NM_000384.3(APOB):c.12541G>A (p.Glu4181Lys) rs1042031
NM_000384.3(APOB):c.13013G>A (p.Ser4338Asn) rs1042034
NM_000384.3(APOB):c.13441G>A (p.Ala4481Thr) rs1801695
NM_000384.3(APOB):c.1853C>T (p.Ala618Val) rs679899
NM_000384.3(APOB):c.2188G>A (p.Val730Ile) rs12691202
NM_000384.3(APOB):c.293C>T (p.Thr98Ile) rs1367117
NM_000384.3(APOB):c.5768A>G (p.His1923Arg) rs533617
NM_000384.3(APOB):c.6936_6937inv (p.Ile2313Val) rs1041968
NM_000384.3(APOB):c.7285T>A (p.Ser2429Thr) rs72653092
NM_000384.3(APOB):c.7545C>T (p.Thr2515=) rs693
NM_000384.3(APOB):c.7696G>A (p.Glu2566Lys) rs1801696
NM_000384.3(APOB):c.8216C>T (p.Pro2739Leu) rs676210
NM_000388.4(CASR):c.3091G>A (p.Gly1031Ser) rs142704083
NM_000391.4(TPP1):c.1044C>T (p.Ala348=) rs35706972
NM_000391.4(TPP1):c.1266+5G>A rs1800753
NM_000391.4(TPP1):c.1494C>T (p.Pro498=) rs117942457
NM_000391.4(TPP1):c.14C>A (p.Ala5Asp) rs138976576
NM_000391.4(TPP1):c.1542A>T (p.Gly514=) rs1128396
NM_000391.4(TPP1):c.293C>T (p.Thr98Met) rs140726254
NM_000391.4(TPP1):c.299A>G (p.Gln100Arg) rs1800746
NM_000391.4(TPP1):c.441A>G (p.Glu147=) rs2555170
NM_000391.4(TPP1):c.509-1G>C rs56144125
NM_000391.4(TPP1):c.622C>T (p.Arg208Ter) rs119455955
NM_000391.4(TPP1):c.840G>C (p.Leu280=) rs140349036
NM_000404.4(GLB1):c.29C>T (p.Pro10Leu) rs7637099
NM_000404.4(GLB1):c.325C>T (p.Arg109Trp) rs35289681
NM_000404.4(GLB1):c.34T>C (p.Leu12=) rs7614776
NM_000410.3(HFE):c.187C>G (p.His63Asp) rs1799945
NM_000410.3(HFE):c.340+4T>C rs2071303
NM_000410.3(HFE):c.845G>A (p.Cys282Tyr) rs1800562
NM_000411.8(HLCS):c.834C>T (p.Ser278=) rs1065758
NM_000419.5(ITGA2B):c.2916G>A (p.Pro972=) rs5913
NM_000426.3(LAMA2):c.1308T>G (p.Gly436=) rs41285286
NM_000426.3(LAMA2):c.1491T>C (p.Cys497=) rs2306220
NM_000426.3(LAMA2):c.1533T>C (p.Asn511=) rs9492266
NM_000426.3(LAMA2):c.156C>T (p.Ile52=) rs1140366
NM_000426.3(LAMA2):c.1621A>G (p.Ser541Gly) rs141363186
NM_000426.3(LAMA2):c.1798G>A (p.Gly600Arg) rs36044314
NM_000426.3(LAMA2):c.1930C>G (p.His644Asp) rs35879899
NM_000426.3(LAMA2):c.2115T>G (p.Leu705=) rs149753273
NM_000426.3(LAMA2):c.2217G>T (p.Trp739Cys) rs192317605
NM_000426.3(LAMA2):c.2462C>T (p.Thr821Met) rs117422805
NM_000426.3(LAMA2):c.255C>T (p.Ile85=) rs142083777
NM_000426.3(LAMA2):c.2756G>T (p.Arg919Leu) rs35277491
NM_000426.3(LAMA2):c.3279C>T (p.Cys1093=) rs371376404
NM_000426.3(LAMA2):c.3296A>G (p.Asn1099Ser) rs35065563
NM_000426.3(LAMA2):c.3412G>A (p.Val1138Met) rs2306942
NM_000426.3(LAMA2):c.3613A>G (p.Thr1205Ala) rs35889149
NM_000426.3(LAMA2):c.4487C>T (p.Ala1496Val) rs147077184
NM_000426.3(LAMA2):c.4750G>A (p.Gly1584Ser) rs117781224
NM_000426.3(LAMA2):c.4935C>A (p.Thr1645=) rs35579821
NM_000426.3(LAMA2):c.4956C>G (p.Thr1652=) rs17057184
NM_000426.3(LAMA2):c.5021G>A (p.Arg1674Lys) rs143333246
NM_000426.3(LAMA2):c.5382A>G (p.Thr1794=) rs565429072
NM_000426.3(LAMA2):c.5530C>A (p.Arg1844Ser) rs56173620
NM_000426.3(LAMA2):c.5633C>T (p.Ser1878Phe) rs139586720
NM_000426.3(LAMA2):c.5688C>T (p.His1896=) rs573779258
NM_000426.3(LAMA2):c.6161A>G (p.Gln2054Arg) rs56035053
NM_000426.3(LAMA2):c.6167C>A (p.Thr2056Lys) rs73775407
NM_000426.3(LAMA2):c.6234A>G (p.Lys2078=) rs56920166
NM_000426.3(LAMA2):c.6237G>A (p.Thr2079=) rs2297738
NM_000426.3(LAMA2):c.6429+8C>A rs199773264
NM_000426.3(LAMA2):c.6539A>T (p.Asp2180Val) rs567385461
NM_000426.3(LAMA2):c.7300+10T>A rs200469923
NM_000426.3(LAMA2):c.7431A>T (p.Arg2477Ser) rs34367843
NM_000426.3(LAMA2):c.7906A>G (p.Thr2636Ala) rs2244008
NM_000426.3(LAMA2):c.8028T>C (p.Asn2676=) rs35313209
NM_000426.3(LAMA2):c.8124T>A (p.Gly2708=) rs34997144
NM_000426.3(LAMA2):c.8223G>A (p.Thr2741=) rs150596964
NM_000426.3(LAMA2):c.8528A>G (p.Asn2843Ser) rs73599293
NM_000426.3(LAMA2):c.8548-10T>C rs113644365
NM_000426.3(LAMA2):c.8691A>G (p.Arg2897=) rs2228599
NM_000426.3(LAMA2):c.8755C>T (p.Pro2919Ser) rs143026295
NM_000426.3(LAMA2):c.9123C>T (p.Val3041=) rs61749497
NM_000430.4(PAFAH1B1):c.1002+1G>A rs113994203
NM_000430.4(PAFAH1B1):c.1050del (p.Lys351fs) rs113994200
NM_000430.4(PAFAH1B1):c.1050dup (p.Lys351fs) rs113994200
NM_000430.4(PAFAH1B1):c.162del (p.Lys54fs) rs113994198
NM_000430.4(PAFAH1B1):c.162dup (p.Trp55fs) rs113994198
NM_000430.4(PAFAH1B1):c.387T>C (p.Asp129=) rs140936904
NM_000430.4(PAFAH1B1):c.474C>T (p.Phe158=) rs116237011
NM_000430.4(PAFAH1B1):c.484G>A (p.Gly162Ser) rs121434487
NM_000430.4(PAFAH1B1):c.568+27C>T rs3213696
NM_000430.4(PAFAH1B1):c.569-10T>C rs113994202
NM_000430.4(PAFAH1B1):c.672-10A>C rs77153143
NM_000430.4(PAFAH1B1):c.693A>T (p.Thr231=) rs2228614
NM_000430.4(PAFAH1B1):c.780A>G (p.Val260=) rs150380620
NM_000431.4(MVK):c.1129G>A (p.Val377Ile) rs28934897
NM_000431.4(MVK):c.155G>A (p.Ser52Asn) rs7957619
NM_000431.4(MVK):c.405G>A (p.Ser135=) rs34368092
NM_000431.4(MVK):c.510C>T (p.Asp170=) rs2287218
NM_000431.4(MVK):c.924C>T (p.Leu308=) rs72648042
NM_000445.5(PLEC):c.10006C>T (p.Arg3336Cys) rs77303974
NM_000445.5(PLEC):c.10026C>T (p.Ser3342=) rs28657061
NM_000445.5(PLEC):c.10042G>A (p.Gly3348Arg) rs34132016
NM_000445.5(PLEC):c.10047C>T (p.Val3349=) rs35613096
NM_000445.5(PLEC):c.10095C>T (p.Val3365=) rs35775257
NM_000445.5(PLEC):c.10127C>T (p.Thr3376Met) rs34725742
NM_000445.5(PLEC):c.10139G>C (p.Gly3380Ala) rs35261863
NM_000445.5(PLEC):c.10693T>C (p.Leu3565=) rs6992333
NM_000445.5(PLEC):c.10746G>A (p.Thr3582=) rs6984820
NM_000445.5(PLEC):c.11001C>T (p.Tyr3667=) rs28455570
NM_000445.5(PLEC):c.11067C>T (p.Thr3689=) rs35134741
NM_000445.5(PLEC):c.11170C>T (p.Leu3724=) rs17062686
NM_000445.5(PLEC):c.11208T>C (p.Ala3736=) rs7819099
NM_000445.5(PLEC):c.11680G>C (p.Asp3894His) rs62642465
NM_000445.5(PLEC):c.11682C>T (p.Asp3894=) rs75833626
NM_000445.5(PLEC):c.11709A>G (p.Pro3903=) rs7822511
NM_000445.5(PLEC):c.1176T>C (p.Asp392=) rs11783799
NM_000445.5(PLEC):c.11967A>G (p.Thr3989=) rs6558406
NM_000445.5(PLEC):c.11994G>A (p.Ala3998=) rs73715559
NM_000445.5(PLEC):c.1239C>G (p.Ser413Arg) rs201667254
NM_000445.5(PLEC):c.12642C>T (p.Asp4214=) rs11998271
NM_000445.5(PLEC):c.12696C>T (p.Ile4232=) rs202116866
NM_000445.5(PLEC):c.12894A>G (p.Ser4298=) rs6558405
NM_000445.5(PLEC):c.13191C>T (p.Ala4397=) rs187810163
NM_000445.5(PLEC):c.13286C>T (p.Thr4429Met) rs113513807
NM_000445.5(PLEC):c.133G>A (p.Gly45Ser) rs201820569
NM_000445.5(PLEC):c.13542T>C (p.Ala4514=) rs7014582
NM_000445.5(PLEC):c.1455C>T (p.Thr485=) rs115081018
NM_000445.5(PLEC):c.1592C>T (p.Ala531Val) rs11136336
NM_000445.5(PLEC):c.1731C>T (p.Ser577=) rs541271992
NM_000445.5(PLEC):c.1787G>A (p.Arg596Gln) rs3135103
NM_000445.5(PLEC):c.1833C>T (p.Pro611=) rs185978075
NM_000445.5(PLEC):c.2259+9C>G rs114256617
NM_000445.5(PLEC):c.2298G>A (p.Gln766=) rs116612406
NM_000445.5(PLEC):c.2538+6C>T rs11780911
NM_000445.5(PLEC):c.2629G>A (p.Ala877Thr) rs58836306
NM_000445.5(PLEC):c.2694-7C>A rs11990994
NM_000445.5(PLEC):c.2739G>A (p.Leu913=) rs78012434
NM_000445.5(PLEC):c.2913C>T (p.Gly971=) rs145050858
NM_000445.5(PLEC):c.3151G>A (p.Ala1051Thr) rs376665854
NM_000445.5(PLEC):c.3273C>T (p.Arg1091=) rs73377210
NM_000445.5(PLEC):c.3459G>A (p.Glu1153=) rs11991764
NM_000445.5(PLEC):c.3631T>C (p.Leu1211=) rs3135109
NM_000445.5(PLEC):c.3798C>T (p.Ala1266=) rs112173070
NM_000445.5(PLEC):c.3827G>A (p.Arg1276Gln) rs11136334
NM_000445.5(PLEC):c.3838-6A>G rs11136333
NM_000445.5(PLEC):c.3838-9A>G rs57461687
NM_000445.5(PLEC):c.3966G>A (p.Pro1322=) rs148465219
NM_000445.5(PLEC):c.4046A>G (p.His1349Arg) rs55895668
NM_000445.5(PLEC):c.4126-4A>G rs7002152
NM_000445.5(PLEC):c.4304C>T (p.Ala1435Val) rs111851716
NM_000445.5(PLEC):c.4494T>C (p.Ala1498=) rs35916068
NM_000445.5(PLEC):c.4536T>G (p.Ala1512=) rs56117011
NM_000445.5(PLEC):c.4557G>A (p.Ala1519=) rs55646585
NM_000445.5(PLEC):c.459T>C (p.Ala153=) rs6993938
NM_000445.5(PLEC):c.4638G>A (p.Ser1546=) rs79705634
NM_000445.5(PLEC):c.4716G>A (p.Ala1572=) rs76426116
NM_000445.5(PLEC):c.4725G>A (p.Ala1575=) rs62642470
NM_000445.5(PLEC):c.4761G>A (p.Ala1587=) rs55836855
NM_000445.5(PLEC):c.5310G>A (p.Ala1770=) rs140406501
NM_000445.5(PLEC):c.5558G>A (p.Arg1853Gln) rs147838690
NM_000445.5(PLEC):c.5664G>A (p.Ala1888=) rs75586449
NM_000445.5(PLEC):c.5842C>T (p.Arg1948Trp) rs201278290
NM_000445.5(PLEC):c.5946G>A (p.Ala1982=) rs62642469
NM_000445.5(PLEC):c.5988T>C (p.Ala1996=) rs2857829
NM_000445.5(PLEC):c.6009G>A (p.Ala2003=) rs1140522
NM_000445.5(PLEC):c.6243C>T (p.His2081=) rs563719398
NM_000445.5(PLEC):c.6251C>T (p.Ala2084Val) rs7002002
NM_000445.5(PLEC):c.6394G>A (p.Ala2132Thr) rs781931836
NM_000445.5(PLEC):c.6395C>T (p.Ala2132Val) rs74772299
NM_000445.5(PLEC):c.6522G>A (p.Ala2174=) rs7016416
NM_000445.5(PLEC):c.6537G>A (p.Ala2179=) rs201072292
NM_000445.5(PLEC):c.6658C>T (p.Leu2220=) rs28610521
NM_000445.5(PLEC):c.6822C>T (p.Ile2274=) rs62641755
NM_000445.5(PLEC):c.7191C>T (p.Ala2397=) rs80143277
NM_000445.5(PLEC):c.7341G>A (p.Thr2447=) rs34490562
NM_000445.5(PLEC):c.7347C>T (p.Leu2449=) rs117306121
NM_000445.5(PLEC):c.7348G>A (p.Ala2450Thr) rs193257576
NM_000445.5(PLEC):c.7662A>C (p.Ala2554=) rs11778026
NM_000445.5(PLEC):c.7807C>T (p.Leu2603=) rs11988293
NM_000445.5(PLEC):c.7959G>A (p.Leu2653=) rs34803322
NM_000445.5(PLEC):c.799+10C>T rs12545876
NM_000445.5(PLEC):c.8041T>C (p.Ser2681Pro) rs7833924
NM_000445.5(PLEC):c.8093G>A (p.Arg2698Gln) rs28526657
NM_000445.5(PLEC):c.8106C>T (p.Gly2702=) rs35139934
NM_000445.5(PLEC):c.8131C>T (p.Arg2711Trp) rs35723243
NM_000445.5(PLEC):c.8334C>T (p.Asn2778=) rs11777402
NM_000445.5(PLEC):c.8400C>T (p.Ala2800=) rs34534853
NM_000445.5(PLEC):c.8412C>T (p.Tyr2804=) rs141673192
NM_000445.5(PLEC):c.8576G>A (p.Arg2859His) rs6558407
NM_000445.5(PLEC):c.8901C>G (p.Asp2967Glu) rs58308209
NM_000445.5(PLEC):c.9154G>A (p.Val3052Ile) rs35027700
NM_000445.5(PLEC):c.9182C>T (p.Ala3061Val) rs35858667
NM_000445.5(PLEC):c.9504C>T (p.Gly3168=) rs61529674
NM_000445.5(PLEC):c.9516C>T (p.Asp3172=) rs60091617
NM_000445.5(PLEC):c.9858T>A (p.Ser3286=) rs34644439
NM_000454.4(SOD1):c.272A>C (p.Asp91Ala) rs80265967
NM_000457.4(HNF4A):c.116-5C>T rs745975
NM_000462.5(UBE3A):c.1278C>T (p.Asp426=) rs149506027
NM_000462.5(UBE3A):c.1776C>T (p.Tyr592=) rs139082033
NM_000462.5(UBE3A):c.1811_1813CTT[1] (p.Ser605del) rs587781234
NM_000462.5(UBE3A):c.2133+9T>C rs79328837
NM_000465.4(BARD1):c.1652C>G (p.Ser551Ter) rs587781707
NM_000466.3(PEX1):c.2088A>G (p.Ile696Met) rs35996821
NM_000466.3(PEX1):c.2331C>A (p.Gly777=) rs10278857
NM_000474.4(TWIST1):c.94G>A (p.Gly32Ser) rs878852992
NM_000478.6(ALPL):c.413G>A (p.Arg138Gln) rs140167865
NM_000479.5(AMH):c.974A>G (p.Gln325Arg) rs140765565
NM_000487.6(ARSA):c.1010A>T (p.Asp337Val) rs74315475
NM_000487.6(ARSA):c.1283C>T (p.Pro428Leu) rs28940893
NM_000487.6(ARSA):c.937C>T (p.Arg313Ter) rs551472773
NM_000489.5(ATRX):c.1438A>G (p.Thr480Ala) rs587780284
NM_000489.5(ATRX):c.1467C>T (p.Thr489=) rs199929884
NM_000489.5(ATRX):c.1633C>G (p.Gln545Glu) rs35738915
NM_000489.5(ATRX):c.1868A>G (p.Lys623Arg) rs145678415
NM_000489.5(ATRX):c.2000C>T (p.Pro667Leu) rs61752457
NM_000489.5(ATRX):c.2169G>C (p.Glu723Asp) rs61752456
NM_000489.5(ATRX):c.228G>A (p.Ser76=) rs5959371
NM_000489.5(ATRX):c.2785= (p.Glu929=) rs3088074
NM_000489.5(ATRX):c.2806G>C (p.Val936Leu) rs149232501
NM_000489.5(ATRX):c.3395T>C (p.Ile1132Thr) rs587780285
NM_000489.5(ATRX):c.4031A>G (p.Lys1344Arg) rs782556767
NM_000489.5(ATRX):c.4035G>A (p.Leu1345=) rs111725949
NM_000489.5(ATRX):c.4120+4A>C rs200420513
NM_000489.5(ATRX):c.4347_4349AGA[1] (p.Glu1464del) rs587780288
NM_000489.5(ATRX):c.4365_4367GGA[4] (p.Glu1464del) rs398123423
NM_000489.5(ATRX):c.4620_4625TGAAGA[1] (p.1540_1541DE[1]) rs797045406
NM_000489.5(ATRX):c.4635C>A (p.Thr1545=) rs148975763
NM_000489.5(ATRX):c.4659T>C (p.His1553=) rs25641
NM_000489.5(ATRX):c.5579A>G (p.Asn1860Ser) rs45439799
NM_000489.5(ATRX):c.5787-24GTTT[4] rs782072699
NM_000489.5(ATRX):c.6405C>T (p.Phe2135=) rs148659669
NM_000489.5(ATRX):c.6871A>G (p.Ile2291Val) rs374244026
NM_000489.5(ATRX):c.846C>T (p.Ser282=) rs148015780
NM_000492.3(CFTR):c.1408G>A (p.Val470Met) rs213950
NM_000492.3(CFTR):c.1521_1523delCTT (p.Phe508delPhe) rs113993960
NM_000492.3(CFTR):c.224G>A (p.Arg75Gln) rs1800076
NM_000492.3(CFTR):c.2562T>G (p.Thr854=) rs1042077
NM_000492.3(CFTR):c.3705T>G (p.Ser1235Arg) rs34911792
NM_000492.3(CFTR):c.3870A>G (p.Pro1290=) rs1800130
NM_000492.3(CFTR):c.4389G>A (p.Gln1463=) rs1800136
NM_000497.3(CYP11B1):c.1014G>A (p.Gln338=) rs151335623
NM_000497.3(CYP11B1):c.1042G>A (p.Ala348Thr) rs6407
NM_000497.3(CYP11B1):c.395+9C>T rs61751140
NM_000518.5(HBB):c.20A>T (p.Glu7Val) rs334
NM_000520.6(HEXA):c.1306A>G (p.Ile436Val) rs1800431
NM_000520.6(HEXA):c.1518A>G (p.Glu506=) rs4777502
NM_000520.6(HEXA):c.9C>T (p.Ser3=) rs1800428
NM_000521.4(HEXB):c.1051T>C (p.Leu351=) rs114661695
NM_000521.4(HEXB):c.1597C>T (p.Arg533Cys) rs764552042
NM_000521.4(HEXB):c.214C>T (p.Leu72Phe) rs147155126
NM_000521.4(HEXB):c.619A>G (p.Ile207Val) rs10805890
NM_000525.3(KCNJ11):c.1009G>A (p.Val337Ile) rs5215
NM_000525.3(KCNJ11):c.1017G>T (p.Val339=) rs770408379
NM_000525.3(KCNJ11):c.1089A>G (p.Ser363=) rs5214
NM_000525.3(KCNJ11):c.108G>A (p.Val36=) rs112070496
NM_000525.3(KCNJ11):c.1095C>T (p.Arg365=) rs143276279
NM_000525.3(KCNJ11):c.1143G>A (p.Lys381=) rs8175351
NM_000525.3(KCNJ11):c.1154C>G (p.Ser385Cys) rs41282930
NM_000525.3(KCNJ11):c.175G>A (p.Val59Met) rs80356616
NM_000525.3(KCNJ11):c.567C>T (p.Ile189=) rs114899765
NM_000525.3(KCNJ11):c.570C>T (p.Ala190=) rs5218
NM_000525.3(KCNJ11):c.584G>A (p.Arg195His) rs5217
NM_000525.3(KCNJ11):c.601C>T (p.Arg201Cys) rs80356625
NM_000525.3(KCNJ11):c.602G>A (p.Arg201His) rs80356624
NM_000525.3(KCNJ11):c.678C>T (p.Pro226=) rs74162102
NM_000525.3(KCNJ11):c.67A>G (p.Lys23Glu) rs5219
NM_000525.3(KCNJ11):c.79C>T (p.Arg27Cys) rs752507753
NM_000525.3(KCNJ11):c.801C>G (p.Leu267=) rs5216
NM_000525.3(KCNJ11):c.808C>G (p.Leu270Val) rs1800467
NM_000525.3(KCNJ11):c.843C>T (p.Leu281=) rs116392938
NM_000525.3(KCNJ11):c.844G>A (p.Glu282Lys) rs267607196
NM_000525.3(KCNJ11):c.881C>T (p.Thr294Met) rs780957825
NM_000525.3(KCNJ11):c.964G>A (p.Glu322Lys) rs193929355
NM_000525.3(KCNJ11):c.989A>G (p.Tyr330Cys) rs193929356
NM_000528.4(MAN2B1):c.1010G>A (p.Arg337Gln) rs1133330
NM_000528.4(MAN2B1):c.1238A>G (p.Asn413Ser) rs35836657
NM_000528.4(MAN2B1):c.832C>G (p.Leu278Val) rs1054486
NM_000528.4(MAN2B1):c.935C>T (p.Thr312Ile) rs1054487
NM_000530.8(MPZ):c.684C>T (p.Ser228=) rs34307129
NM_000531.6(OTC):c.137A>G (p.Lys46Arg) rs1800321
NM_000531.6(OTC):c.809A>G (p.Gln270Arg) rs1800328
NM_000533.5(PLP1):c.168A>G (p.Gln56=) rs2233697
NM_000533.5(PLP1):c.609T>C (p.Asp203=) rs1126707
NM_000535.7(PMS2):c.1266G>A (p.Glu422=) rs138049175
NM_000535.7(PMS2):c.1711C>A (p.Leu571Ile) rs63750055
NM_000535.7(PMS2):c.2187C>G (p.Leu729=) rs373630535
NM_000535.7(PMS2):c.23+10G>C rs192027828
NM_000535.7(PMS2):c.353+9A>C rs139990791
NM_000535.7(PMS2):c.379G>A (p.Ala127Thr) rs114090343
NM_000535.7(PMS2):c.383C>T (p.Ser128Leu) rs116373169
NM_000535.7(PMS2):c.52A>G (p.Ile18Val) rs63750123
NM_000540.2(RYR1):c.10048C>A (p.Arg3350=) rs200355885
NM_000540.2(RYR1):c.10097G>A (p.Arg3366His) rs137932199
NM_000540.2(RYR1):c.10204T>G (p.Cys3402Gly) rs367543058
NM_000540.2(RYR1):c.10259+7G>A rs143752962
NM_000540.2(RYR1):c.10564C>A (p.Leu3522Met) rs200144997
NM_000540.2(RYR1):c.10616G>A (p.Arg3539His) rs143987857
NM_000540.2(RYR1):c.10687-7C>T rs2960354
NM_000540.2(RYR1):c.10747G>C (p.Glu3583Gln) rs55876273
NM_000540.2(RYR1):c.11141+7A>G rs78350770
NM_000540.2(RYR1):c.1123-11C>T rs3745845
NM_000540.2(RYR1):c.11315G>A (p.Arg3772Gln) rs193922839
NM_000540.2(RYR1):c.1140G>A (p.Glu380=) rs35189056
NM_000540.2(RYR1):c.11547G>A (p.Gln3849=) rs142518033
NM_000540.2(RYR1):c.11625G>A (p.Ala3875=) rs61729397
NM_000540.2(RYR1):c.11798A>G (p.Tyr3933Cys) rs147136339
NM_000540.2(RYR1):c.11941C>T (p.His3981Tyr) rs148772854
NM_000540.2(RYR1):c.12283-7C>T rs143861818
NM_000540.2(RYR1):c.12588C>T (p.Ile4196=) rs61739895
NM_000540.2(RYR1):c.12741C>T (p.Ala4247=) rs80039127
NM_000540.2(RYR1):c.12879G>C (p.Ala4293=) rs193922854
NM_000540.2(RYR1):c.12881C>T (p.Thr4294Met) rs587784372
NM_000540.2(RYR1):c.12990C>G (p.Thr4330=) rs184450380
NM_000540.2(RYR1):c.12990C>T (p.Thr4330=) rs184450380
NM_000540.2(RYR1):c.13122G>A (p.Val4374=) rs797045930
NM_000540.2(RYR1):c.13317C>T (p.Ala4439=) rs113579185
NM_000540.2(RYR1):c.13350G>A (p.Gly4450=) rs748743312
NM_000540.2(RYR1):c.13464G>A (p.Pro4488=) rs10405232
NM_000540.2(RYR1):c.13503G>A (p.Pro4501=) rs2960319
NM_000540.2(RYR1):c.13673G>A (p.Arg4558Gln) rs118192130
NM_000540.2(RYR1):c.14304-10G>A rs368201693
NM_000540.2(RYR1):c.14505G>A (p.Gly4835=) rs118126378
NM_000540.2(RYR1):c.1453A>G (p.Met485Val) rs147723844
NM_000540.2(RYR1):c.14582G>A (p.Arg4861His) rs63749869
NM_000540.2(RYR1):c.14589C>T (p.Phe4863=) rs146072491
NM_000540.2(RYR1):c.14600G>A (p.Ser4867Asn) rs587784373
NM_000540.2(RYR1):c.14678G>A (p.Arg4893Gln) rs118192151
NM_000540.2(RYR1):c.14818G>A (p.Ala4940Thr) rs118192158
NM_000540.2(RYR1):c.1577-6C>G rs61586345
NM_000540.2(RYR1):c.2091C>T (p.Ala697=) rs138704724
NM_000540.2(RYR1):c.2122G>A (p.Asp708Asn) rs138874610
NM_000540.2(RYR1):c.216G>T (p.Leu72=) rs113389877
NM_000540.2(RYR1):c.2199G>C (p.Gly733=) rs749285937
NM_000540.2(RYR1):c.2366G>A (p.Arg789Gln) rs200069592
NM_000540.2(RYR1):c.2622G>A (p.Ala874=) rs149381996
NM_000540.2(RYR1):c.2658C>T (p.Ile886=) rs148094797
NM_000540.2(RYR1):c.2870+1G>A rs765241115
NM_000540.2(RYR1):c.2871-5C>T rs45585535
NM_000540.2(RYR1):c.2919C>T (p.His973=) rs139363830
NM_000540.2(RYR1):c.325C>T (p.Arg109Trp) rs118192173
NM_000540.2(RYR1):c.3876C>A (p.Leu1292=) rs143750836
NM_000540.2(RYR1):c.4055C>G (p.Ala1352Gly) rs112105381
NM_000540.2(RYR1):c.4711A>G (p.Ile1571Val) rs146429605
NM_000540.2(RYR1):c.4894C>T (p.Pro1632Ser) rs76537615
NM_000540.2(RYR1):c.5036G>A (p.Arg1679His) rs146504767
NM_000540.2(RYR1):c.5360C>T (p.Pro1787Leu) rs34934920
NM_000540.2(RYR1):c.5493G>T (p.Gly1831=) rs140004449
NM_000540.2(RYR1):c.5622A>G (p.Glu1874=) rs35021937
NM_000540.2(RYR1):c.573C>T (p.Asp191=) rs892054
NM_000540.2(RYR1):c.594A>G (p.Leu198=) rs2229139
NM_000540.2(RYR1):c.6127+1G>A rs1283302989
NM_000540.2(RYR1):c.6178G>T (p.Gly2060Cys) rs35364374
NM_000540.2(RYR1):c.6617C>T (p.Thr2206Met) rs118192177
NM_000540.2(RYR1):c.6654C>T (p.Gly2218=) rs149185729
NM_000540.2(RYR1):c.6721C>T rs200563280
NM_000540.2(RYR1):c.6838G>A (p.Val2280Ile) rs193922797
NM_000540.2(RYR1):c.7281C>T (p.Ala2427=) rs77310009
NM_000540.2(RYR1):c.7584C>T (p.Pro2528=) rs1465698
NM_000540.2(RYR1):c.7737G>A (p.Val2579=) rs114975624
NM_000540.2(RYR1):c.7835+7C>T rs114522234
NM_000540.2(RYR1):c.8026C>T (p.Arg2676Trp) rs193922826
NM_000540.2(RYR1):c.8068-14C>T rs57376136
NM_000540.2(RYR1):c.8360C>G (p.Thr2787Ser) rs35180584
NM_000540.2(RYR1):c.8376G>A (p.Arg2792=) rs150388417
NM_000540.2(RYR1):c.8598C>T (p.Thr2866=) rs538250432
NM_000540.2(RYR1):c.8715G>C (p.Leu2905=) rs368684717
NM_000540.2(RYR1):c.873G>A (p.Ala291=) rs2229140
NM_000540.2(RYR1):c.897G>C (p.Val299=) rs76854339
NM_000540.2(RYR1):c.906C>T (p.Asp302=) rs145943283
NM_000540.2(RYR1):c.94C>T (p.Leu32Phe) rs138630815
NM_000540.2(RYR1):c.9571G>A (p.Gly3191Arg) rs756331568
NM_000540.2(RYR1):c.9758T>C (p.Ile3253Thr) rs375626634
NM_000540.2(RYR1):c.9882C>T (p.Ser3294=) rs142610625
NM_000545.6(HNF1A):c.1375C>T (p.Leu459=) rs2259820
NM_000545.6(HNF1A):c.1425G>A (p.Pro475=) rs145589373
NM_000545.6(HNF1A):c.1460G>A (p.Ser487Asn) rs2464196
NM_000545.6(HNF1A):c.1501+6C>T rs374306837
NM_000545.6(HNF1A):c.1501+7G>A rs2464195
NM_000545.6(HNF1A):c.1539C>T (p.Thr513=) rs193922584
NM_000545.6(HNF1A):c.1545G>A (p.Thr515=) rs55834942
NM_000545.6(HNF1A):c.276C>T (p.Leu92=) rs34056805
NM_000545.6(HNF1A):c.293C>T (p.Ala98Val) rs1800574
NM_000545.6(HNF1A):c.336G>A (p.Pro112=) rs371365341
NM_000545.6(HNF1A):c.51C>G (p.Leu17=) rs1169289
NM_000545.6(HNF1A):c.79A>C (p.Ile27Leu) rs1169288
NM_000545.6(HNF1A):c.92G>A (p.Gly31Asp) rs137853247
NM_000546.5(TP53):c.319T>C (p.Tyr107His) rs368771578
NM_000547.5(TPO):c.30G>A (p.Thr10=) rs28909989
NM_000547.5(TPO):c.660C>T (p.Val220=) rs151154074
NM_000548.5(TSC2):c.1100G>A (p.Arg367Gln) rs1800725
NM_000548.5(TSC2):c.1110G>A (p.Gln370=) rs1800742
NM_000548.5(TSC2):c.1258-5G>T rs925954967
NM_000548.5(TSC2):c.1281C>A (p.Ile427=) rs45478892
NM_000548.5(TSC2):c.1318G>A (p.Gly440Ser) rs45484298
NM_000548.5(TSC2):c.1543C>T (p.Leu515=) rs35896166
NM_000548.5(TSC2):c.1578C>T (p.Ser526=) rs34012042
NM_000548.5(TSC2):c.1747G>A (p.Ala583Thr) rs1800729
NM_000548.5(TSC2):c.2031C>T (p.Pro677=) rs45517208
NM_000548.5(TSC2):c.2331T>C (p.His777=) rs139963953
NM_000548.5(TSC2):c.2476C>A (p.Leu826Met) rs45517238
NM_000548.5(TSC2):c.2580T>C (p.Phe860=) rs13337626
NM_000548.5(TSC2):c.3126G>C (p.Pro1042=) rs36078782
NM_000548.5(TSC2):c.3883+8C>G rs45517316
NM_000548.5(TSC2):c.3914C>T (p.Pro1305Leu) rs45517320
NM_000548.5(TSC2):c.3915G>A (p.Pro1305=) rs11551373
NM_000548.5(TSC2):c.3986G>A (p.Arg1329His) rs45517323
NM_000548.5(TSC2):c.4215C>T (p.Ala1405=) rs45517331
NM_000548.5(TSC2):c.4285G>T (p.Ala1429Ser) rs45474795
NM_000548.5(TSC2):c.4346C>T (p.Ser1449Phe) rs759004251
NM_000548.5(TSC2):c.4435G>A (p.Ala1479Thr) rs777529733
NM_000548.5(TSC2):c.4536C>T (p.Asp1512=) rs35986575
NM_000548.5(TSC2):c.4680C>T (p.Ala1560=) rs139507276
NM_000548.5(TSC2):c.482-3C>T rs1800720
NM_000548.5(TSC2):c.4911G>A (p.Lys1637=) rs35282988
NM_000548.5(TSC2):c.4983C>T (p.Thr1661=) rs35534817
NM_000548.5(TSC2):c.5161-10A>C rs1800718
NM_000548.5(TSC2):c.5202T>C (p.Asp1734=) rs1748
NM_000548.5(TSC2):c.5321G>C (p.Ser1774Thr) rs9209
NM_000548.5(TSC2):c.5383C>T (p.Arg1795Cys) rs45517423
NM_000548.5(TSC2):c.5397G>C (p.Ser1799=) rs1051771
NM_000548.5(TSC2):c.729C>G (p.Leu243=) rs45473698
NM_000549.4(TSHB):c.373delT (p.Cys125Valfs) rs755485552
NM_000550.3(TYRP1):c.1029C>T (p.Asp343=) rs145061390
NM_000550.3(TYRP1):c.1261+1G>A rs140365820
NM_000550.3(TYRP1):c.278G>A (p.Arg93His) rs61752937
NM_000550.3(TYRP1):c.977G>A (p.Arg326His) rs16929374
NM_000551.3(VHL):c.74C>T (p.Pro25Leu) rs35460768
NM_000552.4(VWF):c.114C>T (p.Phe38=) rs2229443
NM_000553.4(WRN):c.1577-3C>A rs3087409
NM_000553.4(WRN):c.2361G>T (p.Leu787=) rs1800392
NM_000553.4(WRN):c.3138+6C>T rs3024239
NM_000553.4(WRN):c.3138+7G>A rs2737335
NM_000553.4(WRN):c.3222G>T (p.Leu1074Phe) rs1801195
NM_000553.4(WRN):c.3236C>T (p.Ser1079Leu) rs3087414
NM_000553.4(WRN):c.4083C>T (p.Ser1361=) rs1801196
NM_000553.4(WRN):c.4099T>C (p.Cys1367Arg) rs1346044
NM_000553.5(WRN):c.1161G>A (p.Met387Ile) rs1800391
NM_000553.5(WRN):c.340G>A (p.Val114Ile) rs2230009
NM_000553.5(WRN):c.3900C>A (p.Pro1300=) rs138886038
NM_000686.5(AGTR2):c.62G>T (p.Gly21Val) rs121917810
NM_000702.4(ATP1A2):c.1119G>A (p.Ser373=) rs1063125
NM_000702.4(ATP1A2):c.129G>A (p.Lys43=) rs61734527
NM_000702.4(ATP1A2):c.1704C>T (p.Phe568=) rs17846714
NM_000702.4(ATP1A2):c.1980C>T (p.Cys660=) rs61734529
NM_000702.4(ATP1A2):c.2259C>T (p.Ala753=) rs17846715
NM_000702.4(ATP1A2):c.2563+4C>T rs3747626
NM_000702.4(ATP1A2):c.2961C>T (p.Cys987=) rs74123254
NM_000702.4(ATP1A2):c.340G>A (p.Gly114Ser) rs116711766
NM_000702.4(ATP1A2):c.8G>A (p.Arg3His) rs781687346
NM_000709.4(BCKDHA):c.116C>A (p.Pro39His) rs11549936
NM_000709.4(BCKDHA):c.1221A>G (p.Leu407=) rs4674
NM_000709.4(BCKDHA):c.1312T>A (p.Tyr438Asn) rs137852870
NM_000709.4(BCKDHA):c.34C>A (p.Arg12=) rs34541442
NM_000709.4(BCKDHA):c.972C>T (p.Phe324=) rs284652
NM_000726.4(CACNB4):c.1239G>A (p.Leu413=) rs1805028
NM_000726.4(CACNB4):c.1303-3T>C rs143442080
NM_000726.4(CACNB4):c.44C>G (p.Pro15Arg) rs200662010
NM_000726.4(CACNB4):c.5C>T (p.Ser2Phe) rs200092211
NM_000726.4(CACNB4):c.762T>A (p.Ile254=) rs61736804
NM_000742.4(CHRNA2):c.1234G>A (p.Glu412Lys) rs141721605
NM_000742.4(CHRNA2):c.1324C>T (p.Leu442=) rs56298562
NM_000742.4(CHRNA2):c.351C>T (p.Asp117=) rs2565061
NM_000742.4(CHRNA2):c.373A>G (p.Thr125Ala) rs891398
NM_000742.4(CHRNA2):c.65C>T (p.Thr22Ile) rs2472553
NM_000742.4(CHRNA2):c.771C>T (p.Tyr257=) rs56229264
NM_000742.4(CHRNA2):c.913C>T (p.Leu305=) rs114294066
NM_000744.6(CHRNA4):c.1047G>A (p.Leu349=) rs75593857
NM_000744.6(CHRNA4):c.1143C>T (p.Ala381=) rs75221202
NM_000744.6(CHRNA4):c.1209G>T (p.Pro403=) rs2229959
NM_000744.6(CHRNA4):c.1227T>C (p.Cys409=) rs2229960
NM_000744.6(CHRNA4):c.1353G>A (p.Pro451=) rs113168860
NM_000744.6(CHRNA4):c.1629C>T (p.Ser543=) rs1044396
NM_000744.6(CHRNA4):c.1659G>A (p.Ala553=) rs1044397
NM_000744.6(CHRNA4):c.189C>T (p.Leu63=) rs2273506
NM_000744.6(CHRNA4):c.24G>C (p.Ala8=) rs6089898
NM_000744.6(CHRNA4):c.51G>A (p.Leu17=) rs79739740
NM_000744.6(CHRNA4):c.639T>C (p.Asp213=) rs1044393
NM_000744.6(CHRNA4):c.678T>C (p.Cys226=) rs1044394
NM_000747.3(CHRNB1):c.1259T>C (p.Ile420Thr) rs76927517
NM_000747.3(CHRNB1):c.610+6T>C rs2302765
NM_000747.3(CHRNB1):c.821-9C>T rs76001008
NM_000748.3(CHRNB2):c.1191G>C (p.Gln397His) rs55685423
NM_000748.3(CHRNB2):c.1338+14G>T rs4845378
NM_000748.3(CHRNB2):c.1432T>C (p.Phe478Leu) rs79137415
NM_000748.3(CHRNB2):c.210+9A>G rs3926124
NM_000751.3(CHRND):c.1047+9T>C rs3762528
NM_000751.3(CHRND):c.120G>A (p.Lys40=) rs55921262
NM_000751.3(CHRND):c.243C>T (p.His81=) rs115841867
NM_000760.4(CSF3R):c.108C>T (p.Val36=) rs3918011
NM_000760.4(CSF3R):c.1319G>A (p.Arg440Gln) rs3918020
NM_000760.4(CSF3R):c.1458G>A (p.Thr486=) rs138289951
NM_000760.4(CSF3R):c.1748G>A (p.Arg583His) rs148104401
NM_000760.4(CSF3R):c.1919C>T (p.Thr640Ile) rs121918426
NM_000760.4(CSF3R):c.2422G>A (p.Glu808Lys) rs146617729
NM_000760.4(CSF3R):c.2496G>A (p.Ala832=) rs150501885
NM_000760.4(CSF3R):c.447G>C (p.Glu149Asp) rs139332126
NM_000784.4(CYP27A1):c.1016C>T (p.Thr339Met) rs121908102
NM_000834.4(GRIN2B):c.1500+7G>A rs201094275
NM_000834.4(GRIN2B):c.15G>A (p.Ala5=) rs34315573
NM_000834.4(GRIN2B):c.1665C>T (p.Ser555=) rs1805482
NM_000834.4(GRIN2B):c.1672G>A (p.Val558Ile) rs1057519004
NM_000834.4(GRIN2B):c.1806C>T (p.Ile602=) rs1805522
NM_000834.4(GRIN2B):c.1851C>T (p.Ser617=) rs147373250
NM_000834.4(GRIN2B):c.2002G>A (p.Asp668Asn) rs876661151
NM_000834.4(GRIN2B):c.2514C>T (p.Cys838=) rs3026160
NM_000834.4(GRIN2B):c.2664C>T (p.Thr888=) rs1806201
NM_000834.4(GRIN2B):c.2691C>T (p.Asn897=) rs35125534
NM_000834.4(GRIN2B):c.291G>A (p.Val97=) rs202223470
NM_000834.4(GRIN2B):c.3498C>T (p.Ser1166=) rs45600931
NM_000834.4(GRIN2B):c.3534C>T (p.His1178=) rs1806191
NM_000834.4(GRIN2B):c.366C>G (p.Pro122=) rs7301328
NM_000834.4(GRIN2B):c.3747C>T (p.Gly1249=) rs138771137
NM_000834.4(GRIN2B):c.381C>T (p.His127=) rs200608452
NM_000834.4(GRIN2B):c.3981G>A (p.Lys1327=) rs201670483
NM_000834.4(GRIN2B):c.4077C>T (p.Ala1359=) rs375217280
NM_000834.4(GRIN2B):c.4197T>C (p.His1399=) rs1805247
NM_000834.4(GRIN2B):c.4218C>T (p.Phe1406=) rs1805246
NM_000834.4(GRIN2B):c.4311C>T (p.Ala1437=) rs112265127
NM_000834.4(GRIN2B):c.504C>A (p.Ile168=) rs36031537
NM_000834.4(GRIN2B):c.870C>T (p.Pro290=) rs1124894
NM_000925.4(PDHB):c.438G>A (p.Gly146=) rs1126551
NM_000939.4(POMC):c.280_288AGCAGCGGC[3] (p.94_96SSG[3]) rs10654394
NM_000939.4(POMC):c.641A>G (p.Glu214Gly) rs80326661
NM_000941.3(POR):c.571G>A (p.Val191Met) rs201513102
NM_000941.3(POR):c.683C>T (p.Pro228Leu) rs17853284
NM_000969.5(RPL5):c.418G>A (p.Gly140Ser) rs121434406
NM_000969.5(RPL5):c.629A>G (p.Tyr210Cys) rs11540832
NM_000996.4(RPL35A):c.21C>T (p.Ser7=) rs145660527
NM_001001433.3(STX16):c.456G>T (p.Glu152Asp) rs138647604
NM_001003787.4(STRADA):c.135G>A (p.Ala45=) rs56163554
NM_001003800.2(BICD2):c.2080C>T (p.Arg694Cys) rs797045412
NM_001003841.3(SLC6A19):c.517G>A (p.Asp173Asn) rs121434346
NM_001005336.3(DNM1):c.849+6C>T rs527412689
NM_001005360.2(DNM2):c.1077C>T (p.Gly359=) rs112238216
NM_001005360.2(DNM2):c.1827C>T (p.Ser609=) rs371412466
NM_001005360.2(DNM2):c.1856C>T (p.Ser619Leu) rs121909095
NM_001005360.2(DNM2):c.1880C>G (p.Pro627Arg) rs587783598
NM_001005360.2(DNM2):c.1902C>T (p.Asn634=) rs2229919
NM_001005360.2(DNM2):c.190G>A (p.Val64Ile) rs144250390
NM_001005360.2(DNM2):c.1973A>G (p.Asn658Ser) rs753175954
NM_001005360.2(DNM2):c.2061G>A (p.Thr687=) rs149164657
NM_001005360.2(DNM2):c.2139T>C (p.Ala713=) rs2229920
NM_001005360.2(DNM2):c.235+12C>A rs147026993
NM_001005360.2(DNM2):c.235+6A>G rs113192269
NM_001005360.2(DNM2):c.238C>T (p.His80Tyr) rs148790687
NM_001005360.2(DNM2):c.2543+7C>G rs201979143
NM_001005360.2(DNM2):c.633C>T (p.Asp211=) rs200191870
NM_001005360.2(DNM2):c.822G>A (p.Thr274=) rs201763720
NM_001005360.2(DNM2):c.958G>A (p.Asp320Asn) rs150613209
NM_001006657.2(WDR35):c.2997+10C>A rs201207790
NM_001007026.1(ATN1):c.1462CAG[17] (p.Gln488[17]) rs60216939
NM_001008537.3(NEXMIF):c.133G>A (p.Ala45Thr) rs199960807
NM_001008537.3(NEXMIF):c.151C>A (p.Pro51Thr) rs145018752
NM_001008537.3(NEXMIF):c.206C>T (p.Ser69Phe) rs201351157
NM_001008537.3(NEXMIF):c.2098G>C (p.Val700Leu) rs141776597
NM_001008537.3(NEXMIF):c.2130G>A (p.Lys710=) rs749479992
NM_001008537.3(NEXMIF):c.2598C>A (p.Ser866=) rs41298498
NM_001008537.3(NEXMIF):c.2669C>T (p.Pro890Leu) rs377201508
NM_001008537.3(NEXMIF):c.3402C>A (p.His1134Gln) rs138632224
NM_001008537.3(NEXMIF):c.381G>A (p.Glu127=) rs148717498
NM_001008537.3(NEXMIF):c.4246C>T (p.Pro1416Ser) rs143577015
NM_001008537.3(NEXMIF):c.4509T>C (p.Pro1503=) rs41303725
NM_001010898.4(SLC6A17):c.525G>A (p.Pro175=) rs142901935
NM_001015877.2(PHF6):c.414C>T (p.Ser138=) rs200423380
NM_001015877.2(PHF6):c.927C>T (p.Asp309=) rs112199174
NM_001017420.3(ESCO2):c.1132-7A>G rs80359862
NM_001017420.3(ESCO2):c.1175G>A (p.Cys392Tyr) rs146312522
NM_001017420.3(ESCO2):c.239C>T (p.Ala80Val) rs4732748
NM_001017420.3(ESCO2):c.760del (p.Thr254fs) rs80359852
NM_001017535.1(VDR):c.909C>T (p.Ala303=) rs12721365
NM_001017989.3(OPA3):c.143-24367T>C rs3826860
NM_001018113.3(FANCB):c.1105-26TATT[7] rs398123537
NM_001018113.3(FANCB):c.127T>A (p.Leu43Ile) rs771007866
NM_001018113.3(FANCB):c.1494G>T (p.Lys498Asn) rs199510538
NM_001018113.3(FANCB):c.1996G>A (p.Gly666Ser) rs145110602
NM_001018113.3(FANCB):c.2228T>G (p.Phe743Cys) rs747865842
NM_001018113.3(FANCB):c.2452A>G (p.Arg818Gly) rs143131218
NM_001023570.4(IQCB1):c.1549A>T (p.Asn517Tyr) rs139468837
NM_001024630.4(RUNX2):c.172_192CAACAGCAGCAGCAGCAGCAG[1] (p.Gln65_Gln71del) rs774172072
NM_001024688.2(NBN):c.-141_-140del rs767454740
NM_001024688.2(NBN):c.1728del (p.Glu576fs) rs1057516668
NM_001024688.2(NBN):c.411_415del (p.Lys137fs) rs587776650
NM_001029.5(RPS26):c.93C>T (p.Pro31=) rs760255764
NM_001029896.2(WDR45):c.397C>T (p.Arg133Ter) rs797046101
NM_001031737.3(CCDC78):c.549G>A (p.Leu183=) rs8055909
NM_001031737.3(CCDC78):c.60T>C (p.Asn20=) rs73489339
NM_001031737.3(CCDC78):c.730G>A (p.Val244Ile) rs752077571
NM_001031737.3(CCDC78):c.803C>T (p.Thr268Met) rs77707419
NM_001031737.3(CCDC78):c.937C>T (p.Leu313=) rs61998209
NM_001031737.3(CCDC78):c.966C>A (p.Asn322Lys) rs148595483
NM_001032386.2(SUOX):c.1281G>C (p.Ser427=) rs773115
NM_001032386.2(SUOX):c.1358G>A (p.Gly453Asp) rs76537761
NM_001037.5(SCN1B):c.-9C>A rs66671189
NM_001037.5(SCN1B):c.253C>T (p.Arg85Cys) rs786205830
NM_001037.5(SCN1B):c.363C>G (p.Cys121Trp) rs104894718
NM_001037.5(SCN1B):c.412G>A (p.Val138Ile) rs72558029
NM_001037.5(SCN1B):c.501T>C (p.Ile167=) rs16969930
NM_001039523.3(CHRNA1):c.1035C>T (p.His345=) rs2229957
NM_001039523.3(CHRNA1):c.1148A>T (p.Asp383Val) rs6739001
NM_001039523.3(CHRNA1):c.615+4G>C rs112674580
NM_001039523.3(CHRNA1):c.718G>A (p.Asp240Asn) rs148304857
NM_001039591.3(USP9X):c.7431+9dup rs774054468
NM_001039891.3(ZNF674):c.1028C>T (p.Thr343Met) rs61730637
NM_001039891.3(ZNF674):c.601C>T (p.Arg201Ter) rs182004761
NM_001040142.2(SCN2A):c.100G>A (p.Ala34Thr) rs144814658
NM_001040142.2(SCN2A):c.1269G>A (p.Val423=) rs139815570
NM_001040142.2(SCN2A):c.1376A>C (p.Glu459Ala) rs184769423
NM_001040142.2(SCN2A):c.1725G>A (p.Ala575=) rs543538780
NM_001040142.2(SCN2A):c.1785T>C (p.Asp595=) rs141815642
NM_001040142.2(SCN2A):c.1842G>T (p.Pro614=) rs114315466
NM_001040142.2(SCN2A):c.1959G>A (p.Val653=) rs200546427
NM_001040142.2(SCN2A):c.2034A>G (p.Thr678=) rs147891446
NM_001040142.2(SCN2A):c.2083T>C (p.Leu695=) rs368043574
NM_001040142.2(SCN2A):c.2388+9C>A rs191955969
NM_001040142.2(SCN2A):c.2389G>A (p.Val797Ile) rs142128956
NM_001040142.2(SCN2A):c.24G>A (p.Pro8=) rs149534277
NM_001040142.2(SCN2A):c.2563-4C>A rs561375550
NM_001040142.2(SCN2A):c.2566C>T (p.Arg856Ter) rs1553579225
NM_001040142.2(SCN2A):c.2567G>A (p.Arg856Gln) rs797045942
NM_001040142.2(SCN2A):c.2673C>T (p.Ile891=) rs529842407
NM_001040142.2(SCN2A):c.2723A>G (p.Lys908Arg) rs2228980
NM_001040142.2(SCN2A):c.2923C>T (p.Leu975=) rs375858093
NM_001040142.2(SCN2A):c.2955C>T (p.Ser985=) rs149859004
NM_001040142.2(SCN2A):c.3372C>T (p.Ser1124=) rs571408286
NM_001040142.2(SCN2A):c.3457G>A (p.Glu1153Lys) rs200138205
NM_001040142.2(SCN2A):c.3631G>A (p.Glu1211Lys) rs387906684
NM_001040142.2(SCN2A):c.387-10G>A rs2304015
NM_001040142.2(SCN2A):c.4565G>C (p.Gly1522Ala) rs147522594
NM_001040142.2(SCN2A):c.5155T>C (p.Leu1719=) rs199698414
NM_001040142.2(SCN2A):c.5319G>A (p.Ala1773=) rs373913233
NM_001040142.2(SCN2A):c.5364G>A (p.Glu1788=) rs199925238
NM_001040142.2(SCN2A):c.5397T>C (p.Tyr1799=) rs200603552
NM_001040142.2(SCN2A):c.5446G>T (p.Ala1816Ser) rs147084515
NM_001040142.2(SCN2A):c.5468A>C (p.Asp1823Ala) rs138497939
NM_001040142.2(SCN2A):c.56G>A (p.Arg19Lys) rs17183814
NM_001040142.2(SCN2A):c.5910G>A (p.Thr1970=) rs75057869
NM_001040142.2(SCN2A):c.5919C>T (p.Pro1973=) rs73025979
NM_001040142.2(SCN2A):c.788C>T (p.Ala263Val) rs387906686
NM_001040142.2(SCN2A):c.897A>G (p.Ser299=) rs143765389
NM_001040142.2(SCN2A):c.960T>C (p.Ile320=) rs185590667
NM_001040616.3(LINS1):c.1124C>T (p.Thr375Ile) rs143097819
NM_001040616.3(LINS1):c.1194A>G (p.Gln398=) rs138347314
NM_001040616.3(LINS1):c.1479T>C (p.Cys493=) rs144513217
NM_001040616.3(LINS1):c.1813A>G (p.Met605Val) rs141855950
NM_001040616.3(LINS1):c.1887C>T (p.Tyr629=) rs61999313
NM_001040616.3(LINS1):c.2119G>A (p.Gly707Arg) rs74039425
NM_001040616.3(LINS1):c.718C>T (p.Arg240Trp) rs145145735
NM_001040616.3(LINS1):c.864C>T (p.Thr288=) rs150775570
NM_001040716.2(PC):c.1513+9C>A rs45580638
NM_001042384.2(CEP63):c.1329+6282G>A rs140668390
NM_001042384.2(CEP63):c.567C>A (p.Val189=) rs146845434
NM_001042384.2(CEP63):c.572G>A (p.Arg191Gln) rs529386244
NM_001042413.2(GLIS3):c.1044C>T (p.Tyr348=) rs146238548
NM_001042413.2(GLIS3):c.1092G>T (p.Pro364=) rs74680081
NM_001042413.2(GLIS3):c.1270T>C (p.Ser424Pro) rs806052
NM_001042413.2(GLIS3):c.1367C>A (p.Pro456Gln) rs6415788
NM_001042413.2(GLIS3):c.1430C>T (p.Ala477Val) rs114838275
NM_001042413.2(GLIS3):c.1536C>A (p.Asp512Glu) rs148199056
NM_001042413.2(GLIS3):c.2686C>T (p.Leu896Phe) rs76094493
NM_001042413.2(GLIS3):c.938G>C (p.Gly313Ala) rs35154632
NM_001042413.2(GLIS3):c.954C>T (p.Thr318=) rs75564360
NM_001042472.3(ABHD12):c.1045G>A (p.Ala349Thr) rs746748
NM_001042472.3(ABHD12):c.1068T>C (p.Asp356=) rs10966
NM_001042472.3(ABHD12):c.837C>T (p.Arg279=) rs6107027
NM_001042537.1(SLC9A6):c.*12C>T rs190788663
NM_001042537.1(SLC9A6):c.1462+8G>A rs6654310
NM_001042537.1(SLC9A6):c.1703G>A (p.Arg568Gln) rs146263125
NM_001042537.1(SLC9A6):c.1755C>T (p.Ser585=) rs2307131
NM_001042537.1(SLC9A6):c.25G>T (p.Ala9Ser) rs201523857
NM_001042537.1(SLC9A6):c.526-9_526-5del rs796053290
NM_001042723.2(RYR1):c.12837_12845CACGGCGGC[3] (p.4280_4282TAA[3]) rs398123469
NM_001042723.2(RYR1):c.14746_14748TTC[3] (p.Phe4919del) rs1064794572
NM_001042723.2(RYR1):c.2654G>A (p.Arg885His) rs370634440
NM_001042723.2(RYR1):c.3801dup (p.Cys1268fs) rs587784374
NM_001042723.2(RYR1):c.4405C>T (p.Arg1469Trp) rs200546266
NM_001042723.2(RYR1):c.5628_5630GGA[2] (p.Glu1878del) rs371047178
NM_001042723.2(RYR1):c.9579C>G (p.Cys3193Trp) rs587784379
NM_001044385.3(TMEM237):c.1065C>G (p.Leu355=) rs149240122
NM_001044385.3(TMEM237):c.1096G>T (p.Ala366Ser) rs73989521
NM_001044385.3(TMEM237):c.395+7A>G rs78297522
NM_001044385.3(TMEM237):c.9T>G (p.Thr3=) rs6736435
NM_001048166.1(STIL):c.1024-4T>C rs188900275
NM_001048166.1(STIL):c.1055G>A (p.Arg352His) rs141678367
NM_001048166.1(STIL):c.1069G>A (p.Ala357Thr) rs75426387
NM_001048166.1(STIL):c.1136C>T (p.Ser379Phe) rs149185431
NM_001048166.1(STIL):c.1229C>G (p.Pro410Arg) rs202194355
NM_001048166.1(STIL):c.1452C>G (p.Ser484=) rs10789505
NM_001048166.1(STIL):c.1455G>C (p.Leu485Phe) rs139912214
NM_001048166.1(STIL):c.2017A>G (p.Ser673Gly) rs140448154
NM_001048166.1(STIL):c.257C>T (p.Ala86Val) rs3125630
NM_001048166.1(STIL):c.2615+27A>G rs2742104
NM_001048166.1(STIL):c.2906A>G (p.His969Arg) rs148193936
NM_001048166.1(STIL):c.2954A>G (p.His985Arg) rs13376679
NM_001048166.1(STIL):c.3378A>G (p.Arg1126=) rs142315727
NM_001048166.1(STIL):c.3430G>A (p.Asp1144Asn) rs112563569
NM_001048166.1(STIL):c.3437C>T (p.Ala1146Val) rs3766317
NM_001048166.1(STIL):c.3581C>T (p.Pro1194Leu) rs144746030
NM_001069.3(TUBB2A):c.1033A>T (p.Ile345Phe) rs797046074
NM_001072.4(UGT1A6):c.1088C>T (p.Pro363Leu) rs34946978
NM_001072.4(UGT1A6):c.1453T>G (p.Tyr485Asp) rs34993780
NM_001072.4(UGT1A6):c.862-6061C>A rs35350960
NM_001072.4(UGT1A6):c.862-6073T>G rs35003977
NM_001072.4(UGT1A6):c.862-6122C>T rs72551343
NM_001072.4(UGT1A6):c.862-6207A>G rs148755655
NM_001072.4(UGT1A6):c.862-6606C>T rs34526305
NM_001072.4(UGT1A6):c.993+15T>C rs4148327
NM_001077365.2(POMT1):c.123-6_123-5dup rs148086540
NM_001077365.2(POMT1):c.2178G>A (p.Ter726=) rs147143094
NM_001077365.2(POMT1):c.699+52C>T rs3887873
NM_001077418.3(TMEM231):c.140-28C>G rs375353411
NM_001077418.3(TMEM231):c.16C>G (p.Leu6Val) rs3743601
NM_001077418.3(TMEM231):c.177G>C (p.Pro59=) rs78196225
NM_001077418.3(TMEM231):c.582+3A>G rs114290622
NM_001077418.3(TMEM231):c.582+8C>G rs144252983
NM_001077418.3(TMEM231):c.813G>A (p.Val271=) rs2242406
NM_001077418.3(TMEM231):c.891G>A (p.Val297=) rs149888762
NM_001077446.4(TSEN34):c.394G>A (p.Gly132Arg) rs201506921
NM_001077446.4(TSEN34):c.39G>A (p.Val13=) rs184898622
NM_001077446.4(TSEN34):c.688C>A (p.Arg230=) rs11879943
NM_001079846.1(CREBBP):c.1149G>A (p.Pro383=) rs61759495
NM_001079846.1(CREBBP):c.1537C>A (p.Leu513Ile) rs61753381
NM_001079846.1(CREBBP):c.2614A>G (p.Thr872Ala) rs143247685
NM_001079846.1(CREBBP):c.2697G>A (p.Pro899=) rs146168040
NM_001079846.1(CREBBP):c.2859C>T (p.Asp953=) rs142528559
NM_001079846.1(CREBBP):c.3386A>G (p.Tyr1129Cys) rs587783481
NM_001079846.1(CREBBP):c.3718G>A (p.Glu1240Lys) rs267606752
NM_001079846.1(CREBBP):c.4019+19T>C rs202204380
NM_001079846.1(CREBBP):c.4166+8T>C rs376814421
NM_001079846.1(CREBBP):c.4922_4924CCT[1] (p.Ser1642del) rs587783502
NM_001079846.1(CREBBP):c.5322C>G (p.Thr1774=) rs61731405
NM_001079846.1(CREBBP):c.5605G>A (p.Ala1869Thr) rs199990883
NM_001079846.1(CREBBP):c.5686T>C (p.Ser1896Pro) rs587783504
NM_001079846.1(CREBBP):c.5715G>A (p.Pro1905=) rs546554430
NM_001079846.1(CREBBP):c.5723del (p.Pro1908fs) rs587783507
NM_001079846.1(CREBBP):c.5889T>C (p.Asn1963=) rs200998860
NM_001079846.1(CREBBP):c.5976G>A (p.Gln1992=) rs374969185
NM_001079846.1(CREBBP):c.6495A>G (p.Gln2165=) rs62636220
NM_001079846.1(CREBBP):c.6510A>C (p.Gln2170His) rs142545779
NM_001079846.1(CREBBP):c.6510A>G (p.Gln2170=) rs142545779
NM_001080.3(ALDH5A1):c.10T>G (p.Cys4Gly) rs200793796
NM_001080.3(ALDH5A1):c.1344-6T>C rs368212282
NM_001080.3(ALDH5A1):c.538C>T (p.His180Tyr) rs2760118
NM_001080.3(ALDH5A1):c.545C>T (p.Pro182Leu) rs3765310
NM_001080.3(ALDH5A1):c.961G>A (p.Val321Met) rs115784602
NM_001080414.4(CCDC88C):c.1962G>A (p.Leu654=) rs61746076
NM_001080414.4(CCDC88C):c.3202G>T (p.Ala1068Ser) rs201044013
NM_001080414.4(CCDC88C):c.322G>A (p.Gly108Ser) rs61745604
NM_001080414.4(CCDC88C):c.5980C>G (p.Arg1994Gly) rs45560241
NM_001080414.4(CCDC88C):c.912C>T (p.Asp304=) rs61736349
NM_001080522.2(CC2D2A):c.1127A>C (p.Glu376Ala) rs16892095
NM_001080522.2(CC2D2A):c.1339del (p.Ala447fs) rs386833745
NM_001080522.2(CC2D2A):c.1519A>G (p.Lys507Glu) rs144439937
NM_001080522.2(CC2D2A):c.1764+45T>G rs1558572
NM_001080522.2(CC2D2A):c.1765-24A>G rs1861044
NM_001080522.2(CC2D2A):c.1978G>A (p.Val660Ile) rs16892134
NM_001080522.2(CC2D2A):c.1978G>C (p.Val660Leu) rs16892134
NM_001080522.2(CC2D2A):c.2003+19C>T rs17476642
NM_001080522.2(CC2D2A):c.2050T>A (p.Leu684Ile) rs190698163
NM_001080522.2(CC2D2A):c.2182-24C>T rs2041673
NM_001080522.2(CC2D2A):c.2804G>A (p.Arg935Gln) rs187003641
NM_001080522.2(CC2D2A):c.2830-38G>T rs35309200
NM_001080522.2(CC2D2A):c.3183-8T>C rs13121363
NM_001080522.2(CC2D2A):c.3201G>A (p.Ser1067=) rs73125627
NM_001080522.2(CC2D2A):c.3288+41A>C rs13116304
NM_001080522.2(CC2D2A):c.3289delG rs386833751
NM_001080522.2(CC2D2A):c.3509G>A (p.Arg1170Lys) rs61734948
NM_001080522.2(CC2D2A):c.3595-22C>T rs4280724
NM_001080522.2(CC2D2A):c.3872T>C (p.Ile1291Thr) rs370492044
NM_001080522.2(CC2D2A):c.4065+28A>T rs6832789
NM_001080522.2(CC2D2A):c.4179+1del rs386833760
NM_001080522.2(CC2D2A):c.4296T>C (p.Cys1432=) rs372671421
NM_001080522.2(CC2D2A):c.4465_4468del (p.Asp1489fs) rs797045437
NM_001080522.2(CC2D2A):c.517C>T (p.Arg173Ter) rs386833763
NM_001080522.2(CC2D2A):c.541-25G>T rs16892080
NM_001080522.2(CC2D2A):c.777C>T (p.His259=) rs2286976
NM_001082486.2(ACD):c.132C>T (p.Gly44=) rs138527794
NM_001082486.2(ACD):c.1336C>T (p.Leu446=) rs1050346
NM_001082538.3(TCTN1):c.1234A>G (p.Ile412Val) rs75714509
NM_001082538.3(TCTN1):c.1396G>T (p.Gly466Cys) rs118096349
NM_001082538.3(TCTN1):c.220+12G>C rs76843552
NM_001082538.3(TCTN1):c.473-10T>A rs12307716
NM_001082538.3(TCTN1):c.699_701TAA[1] (p.Asn235del) rs797046038
NM_001082538.3(TCTN1):c.894C>T (p.Leu298=) rs16940927
NM_001082538.3(TCTN1):c.940G>A (p.Ala314Thr) rs199529768
NM_001083602.2(PTCH1):c.3189C>T (p.Gly1063=) rs28446339
NM_001083602.2(PTCH1):c.4-1786GGC[3] rs71366293
NM_001083961.2(WDR62):c.*5G>A rs61740165
NM_001083961.2(WDR62):c.1225A>G (p.Asn409Asp) rs146180912
NM_001083961.2(WDR62):c.1228G>T (p.Val410Leu) rs139460397
NM_001083961.2(WDR62):c.1233+13C>T rs76130844
NM_001083961.2(WDR62):c.1233+15del rs373693641
NM_001083961.2(WDR62):c.1359C>T (p.Asn453=) rs148667984
NM_001083961.2(WDR62):c.142C>T (p.Leu48Phe) rs62109744
NM_001083961.2(WDR62):c.1470C>T (p.Asp490=) rs45567532
NM_001083961.2(WDR62):c.1509C>T (p.Asp503=) rs758922011
NM_001083961.2(WDR62):c.1576G>A (p.Glu526Lys) rs147875659
NM_001083961.2(WDR62):c.1641G>A (p.Thr547=) rs2301734
NM_001083961.2(WDR62):c.1641G>T (p.Thr547=) rs2301734
NM_001083961.2(WDR62):c.1642+8C>T rs143309981
NM_001083961.2(WDR62):c.1643-10C>T rs4806263
NM_001083961.2(WDR62):c.1643-39G>A rs2301735
NM_001083961.2(WDR62):c.1768+28G>A rs77938609
NM_001083961.2(WDR62):c.180G>A (p.Val60=) rs61742664
NM_001083961.2(WDR62):c.186C>T (p.Leu62=) rs11538454
NM_001083961.2(WDR62):c.2147-34G>A rs2301736
NM_001083961.2(WDR62):c.2211-4G>A rs202109439
NM_001083961.2(WDR62):c.2271G>A (p.Leu757=) rs61494900
NM_001083961.2(WDR62):c.2281C>T (p.His761Tyr) rs61744321
NM_001083961.2(WDR62):c.2334-29C>T rs2301737
NM_001083961.2(WDR62):c.2334-6C>A rs138928852
NM_001083961.2(WDR62):c.2529C>T (p.Asp843=) rs144697999
NM_001083961.2(WDR62):c.2549T>C (p.Leu850Ser) rs2285745
NM_001083961.2(WDR62):c.2666T>C (p.Met889Thr) rs139749569
NM_001083961.2(WDR62):c.269+12del rs797046108
NM_001083961.2(WDR62):c.2766C>T (p.Arg922=) rs373906889
NM_001083961.2(WDR62):c.2975C>T (p.Ser992Leu) rs74518295
NM_001083961.2(WDR62):c.2976G>A (p.Ser992=) rs757294519
NM_001083961.2(WDR62):c.2991C>T (p.Ala997=) rs77898819
NM_001083961.2(WDR62):c.3033G>A (p.Pro1011=) rs118175551
NM_001083961.2(WDR62):c.3303G>A (p.Thr1101=) rs117887683
NM_001083961.2(WDR62):c.3401T>G (p.Met1134Arg) rs61741470
NM_001083961.2(WDR62):c.3468C>T (p.Leu1156=) rs17851502
NM_001083961.2(WDR62):c.3514+44G>A rs45468494
NM_001083961.2(WDR62):c.3612C>T (p.Gly1204=) rs139946168
NM_001083961.2(WDR62):c.3639C>T (p.Ser1213=) rs45470992
NM_001083961.2(WDR62):c.3674G>A (p.Arg1225His) rs61743589
NM_001083961.2(WDR62):c.3786C>T (p.Gly1262=) rs148415080
NM_001083961.2(WDR62):c.3812C>T (p.Ala1271Val) rs111294536
NM_001083961.2(WDR62):c.3946C>G (p.Gln1316Glu) rs35811023
NM_001083961.2(WDR62):c.4123G>A (p.Gly1375Ser) rs17851503
NM_001083961.2(WDR62):c.4159C>A (p.Leu1387Ile) rs147652186
NM_001083961.2(WDR62):c.4312-5T>G rs182467995
NM_001083961.2(WDR62):c.4338C>T (p.Thr1446=) rs149289227
NM_001083961.2(WDR62):c.562-13C>T rs78138007
NM_001083961.2(WDR62):c.700-18C>T rs10423651
NM_001083961.2(WDR62):c.866A>G (p.Lys289Arg) rs12327568
NM_001083962.2(TCF4):c.1299G>A (p.Leu433=) rs552340151
NM_001083962.2(TCF4):c.1354G>A (p.Gly452Arg) rs138570124
NM_001083962.2(TCF4):c.1419G>C (p.Pro473=) rs143944746
NM_001083962.2(TCF4):c.1487-5G>A rs749176054
NM_001083962.2(TCF4):c.1739G>A (p.Arg580Gln) rs121909121
NM_001083962.2(TCF4):c.1741G>T (p.Val581Phe) rs587784460
NM_001083962.2(TCF4):c.1905G>A (p.Ala635=) rs151150677
NM_001083962.2(TCF4):c.1923G>A (p.Glu641=) rs76956936
NM_001083962.2(TCF4):c.1965dup (p.Gly656fs) rs797046035
NM_001083962.2(TCF4):c.305-165C>T rs17522826
NM_001083962.2(TCF4):c.504A>G (p.Val168=) rs370160994
NM_001083962.2(TCF4):c.789+23C>T rs1788027
NM_001083962.2(TCF4):c.944C>T (p.Ala315Val) rs147445499
NM_001083962.2(TCF4):c.990G>A (p.Ser330=) rs587784469
NM_001098.3(ACO2):c.192A>C (p.Thr64=) rs137831
NM_001098.3(ACO2):c.670C>T (p.Leu224=) rs1799932
NM_001098511.2(KIF2A):c.48G>A (p.Glu16=) rs533812435
NM_001098511.2(KIF2A):c.959C>T (p.Thr320Ile) rs1554042050
NM_001099274.3(TINF2):c.1092G>A (p.Leu364=) rs184422577
NM_001099274.3(TINF2):c.400-9C>T rs201087708
NM_001099922.3(ALG13):c.3143C>G (p.Ala1048Gly) rs773401427
NM_001100.3(ACTA1):c.130-10G>C rs41271481
NM_001100.3(ACTA1):c.130-5T>C rs11803533
NM_001100.3(ACTA1):c.246T>C (p.Asp82=) rs373785144
NM_001100.3(ACTA1):c.809G>A (p.Gly270Asp) rs1553255362
NM_001100.3(ACTA1):c.867C>T (p.Ile289=) rs140074813
NM_001100.3(ACTA1):c.996C>A (p.Ile332=) rs74897770
NM_001101.5(ACTB):c.-6-4G>T rs13447394
NM_001101.5(ACTB):c.1023C>T (p.Ile341=) rs58704474
NM_001101.5(ACTB):c.547C>T (p.Arg183Trp) rs104894003
NM_001101.5(ACTB):c.625G>A (p.Val209Met) rs587779777
NM_001101.5(ACTB):c.942G>A (p.Gln314=) rs11546939
NM_001101362.2(KBTBD13):c.1128G>A (p.Thr376=) rs116623596
NM_001101362.2(KBTBD13):c.1197C>T (p.Arg399=) rs150830358
NM_001101362.2(KBTBD13):c.188A>T (p.Gln63Leu) rs202004658
NM_001101362.2(KBTBD13):c.244G>A (p.Val82Met) rs1303411209
NM_001101362.2(KBTBD13):c.794G>A (p.Gly265Asp) rs146917406
NM_001101362.2(KBTBD13):c.954C>G (p.Thr318=) rs368781046
NM_001101426.4(CRPPA):c.1220T>C (p.Leu407Ser) rs141625803
NM_001101426.4(CRPPA):c.277_279del (p.Ile93del) rs397515398
NM_001101426.4(CRPPA):c.32C>G (p.Pro11Arg) rs192925278
NM_001101426.4(CRPPA):c.407C>T (p.Ala136Val) rs61734789
NM_001101426.4(CRPPA):c.726A>G (p.Gln242=) rs61746966
NM_001102401.3(TTI2):c.1063C>T (p.Arg355Cys) rs138108276
NM_001102401.3(TTI2):c.1115+7C>G rs199720231
NM_001102401.3(TTI2):c.118C>T (p.Pro40Ser) rs78781527
NM_001104631.2(PDE4D):c.1762A>G (p.Met588Val) rs1554033934
NM_001109809.4(ZFP57):c.1086T>C (p.Thr362=) rs61730326
NM_001109809.4(ZFP57):c.374G>A (p.Arg125Gln) rs114591600
NM_001109809.4(ZFP57):c.593A>G (p.Asn198Ser) rs9461544
NM_001110556.2(FLNA):c.1029C>T (p.Ser343=) rs199853721
NM_001110556.2(FLNA):c.1176G>A (p.Glu392=) rs201173693
NM_001110556.2(FLNA):c.1239G>A (p.Thr413=) rs200278701
NM_001110556.2(FLNA):c.1286C>T (p.Thr429Met) rs36051194
NM_001110556.2(FLNA):c.1291G>C (p.Glu431Gln) rs781915319
NM_001110556.2(FLNA):c.1429+8C>T rs202181557
NM_001110556.2(FLNA):c.1579C>T (p.Arg527Cys) rs202029322
NM_001110556.2(FLNA):c.1587G>A (p.Lys529=) rs782615607
NM_001110556.2(FLNA):c.1691+7C>A rs199565118
NM_001110556.2(FLNA):c.1875C>T (p.Asp625=) rs200660642
NM_001110556.2(FLNA):c.1968C>T (p.Leu656=) rs73638274
NM_001110556.2(FLNA):c.2023-8C>T rs587780335
NM_001110556.2(FLNA):c.2178C>T (p.Asn726=) rs371501734
NM_001110556.2(FLNA):c.237G>C (p.Ala79=) rs200626788
NM_001110556.2(FLNA):c.2433C>T (p.Ala811=) rs35986650
NM_001110556.2(FLNA):c.2538C>T (p.Tyr846=) rs782571710
NM_001110556.2(FLNA):c.2613C>T (p.Asp871=) rs188212919
NM_001110556.2(FLNA):c.2725G>A (p.Val909Ile) rs199911951
NM_001110556.2(FLNA):c.3035C>T (p.Ser1012Leu) rs17091204
NM_001110556.2(FLNA):c.3045G>A (p.Ala1015=) rs370868704
NM_001110556.2(FLNA):c.3270C>T (p.Ile1090=) rs79391751
NM_001110556.2(FLNA):c.3285C>T (p.Ala1095=) rs199530601
NM_001110556.2(FLNA):c.3522C>T (p.Thr1174=) rs373625856
NM_001110556.2(FLNA):c.3690C>T (p.Thr1230=) rs35015603
NM_001110556.2(FLNA):c.3708C>T (p.Gly1236=) rs200363918
NM_001110556.2(FLNA):c.3717C>T (p.Pro1239=) rs372265042
NM_001110556.2(FLNA):c.3756G>A (p.Ala1252=) rs186619828
NM_001110556.2(FLNA):c.3876C>T (p.His1292=) rs199917719
NM_001110556.2(FLNA):c.3915G>A (p.Thr1305=) rs201488545
NM_001110556.2(FLNA):c.4232C>T (p.Ser1411Leu) rs782426283
NM_001110556.2(FLNA):c.4233G>A (p.Ser1411=) rs34439033
NM_001110556.2(FLNA):c.4451A>G (p.Gln1484Arg) rs200130356
NM_001110556.2(FLNA):c.4737G>C (p.Leu1579=) rs201904661
NM_001110556.2(FLNA):c.4866C>T (p.Tyr1622=) rs200835571
NM_001110556.2(FLNA):c.4920G>A (p.Gly1640=) rs61741041
NM_001110556.2(FLNA):c.5190C>T (p.His1730=) rs781793192
NM_001110556.2(FLNA):c.5251C>T (p.Pro1751Ser) rs56102764
NM_001110556.2(FLNA):c.5290G>A (p.Ala1764Thr) rs57108893
NM_001110556.2(FLNA):c.5589C>T (p.Val1863=) rs200787122
NM_001110556.2(FLNA):c.5763C>T (p.Ser1921=) rs781929535
NM_001110556.2(FLNA):c.5850T>C (p.Ala1950=) rs2070825
NM_001110556.2(FLNA):c.5972C>T (p.Ser1991Leu) rs187029309
NM_001110556.2(FLNA):c.6023-10C>G rs72616474
NM_001110556.2(FLNA):c.663C>T (p.Pro221=) rs2073470
NM_001110556.2(FLNA):c.6642G>C (p.Val2214=) rs1064822
NM_001110556.2(FLNA):c.66C>T (p.Asp22=) rs782358007
NM_001110556.2(FLNA):c.6742C>T (p.Leu2248=) rs113510895
NM_001110556.2(FLNA):c.7224C>T (p.Gly2408=) rs12008807
NM_001110556.2(FLNA):c.7389G>A (p.Ser2463=) rs373103712
NM_001110556.2(FLNA):c.861C>T (p.Tyr287=) rs375503410
NM_001110792.2(MECP2):c.1176G>A (p.Val392=) rs201711454
NM_001110792.2(MECP2):c.1198_1203CCACCT[1] (p.Pro402_Pro403del) rs61753008
NM_001110792.2(MECP2):c.1224C>T (p.Ser408=) rs781816931
NM_001110792.2(MECP2):c.1225G>A (p.Glu409Lys) rs56268439
NM_001110792.2(MECP2):c.1233C>T (p.Pro411=) rs61753012
NM_001110792.2(MECP2):c.1291C>T (p.Pro431Ser) rs140258520
NM_001110792.2(MECP2):c.1351G>A (p.Ala451Thr) rs61753973
NM_001110792.2(MECP2):c.1366G>A (p.Ala456Thr) rs61753975
NM_001110792.2(MECP2):c.1371G>A (p.Thr457=) rs3027927
NM_001110792.2(MECP2):c.338C>G (p.Pro113Arg) rs61754453
NM_001110792.2(MECP2):c.33_35AGG[7] (p.Gly15_Gly16dup) rs587783744
NM_001110792.2(MECP2):c.352C>T (p.Arg118Trp) rs28934907
NM_001110792.2(MECP2):c.411C>A (p.Ile137=) rs146107517
NM_001110792.2(MECP2):c.429C>G (p.Ala143=) rs61748385
NM_001110792.2(MECP2):c.433C>T (p.Arg145Cys) rs28934904
NM_001110792.2(MECP2):c.491C>G (p.Pro164Arg) rs61748404
NM_001110792.2(MECP2):c.509C>T (p.Thr170Met) rs28934906
NM_001110792.2(MECP2):c.535C>T (p.Arg179Trp) rs61748420
NM_001110792.2(MECP2):c.644C>T (p.Thr215Met) rs61749720
NM_001110792.2(MECP2):c.6_8CGC[7] (p.Ala8dup) rs398123566
NM_001110792.2(MECP2):c.786C>T (p.Arg262=) rs61748424
NM_001110792.2(MECP2):c.799C>T (p.Arg267Ter) rs61749721
NM_001110792.2(MECP2):c.813C>T (p.Ala271=) rs1042870
NM_001110792.2(MECP2):c.844C>T (p.Arg282Ter) rs61750240
NM_001110792.2(MECP2):c.916C>T (p.Arg306Ter) rs61751362
NM_001110792.2(MECP2):c.933C>T (p.Thr311=) rs61748423
NM_001110792.2(MECP2):c.961C>T (p.Arg321Trp) rs61751444
NM_001111077.2(EZR):c.752A>G (p.Asn251Ser) rs139467617
NM_001111077.2(EZR):c.959+7G>A rs201317128
NM_001111125.3(IQSEC2):c.1592G>C (p.Arg531Pro) rs149027201
NM_001111125.3(IQSEC2):c.1641G>A (p.Ala547=) rs61745228
NM_001111125.3(IQSEC2):c.2571C>A (p.Ile857=) rs146979083
NM_001111125.3(IQSEC2):c.3663A>G (p.Pro1221=) rs797045629
NM_001111125.3(IQSEC2):c.3735C>T (p.His1245=) rs797045630
NM_001111125.3(IQSEC2):c.3990G>A (p.Gly1330=) rs371450118
NM_001111125.3(IQSEC2):c.4104G>A (p.Leu1368=) rs184087864
NM_001111125.3(IQSEC2):c.578G>C (p.Gly193Ala) rs782357394
NM_001111125.3(IQSEC2):c.618C>T (p.Ser206=) rs370573314
NM_001113378.1(FANCI):c.1326G>A (p.Glu442=) rs34405660
NM_001113378.1(FANCI):c.1573A>G (p.Met525Val) rs144908351
NM_001113378.1(FANCI):c.1813C>T (p.Leu605Phe) rs117125761
NM_001113378.1(FANCI):c.2487T>G (p.Leu829=) rs145762491
NM_001113378.1(FANCI):c.2997C>T (p.Ser999=) rs138675752
NM_001113378.1(FANCI):c.3055C>T (p.Arg1019Trp) rs149167939
NM_001113378.1(FANCI):c.3525C>A (p.Ala1175=) rs114810692
NM_001113378.1(FANCI):c.3721-7C>T rs1434575390
NM_001114636.1(FANCL):c.1022_1024del (p.Ile341_Cys342delinsSer) rs747253294
NM_001114636.1(FANCL):c.108C>G (p.Phe36Leu) rs149726602
NM_001114636.1(FANCL):c.1111_1114dup (p.Thr372fs) rs759217526
NM_001114636.1(FANCL):c.112C>T (p.Leu38Phe) rs55849827
NM_001114636.1(FANCL):c.402T>C (p.Ser134=) rs145284589
NM_001114636.1(FANCL):c.685A>G (p.Thr229Ala) rs149731356
NM_001114636.1(FANCL):c.770T>G (p.Phe257Cys) rs139801716
NM_001114636.1(FANCL):c.832T>C (p.Leu278=) rs61753272
NM_001114748.2(TMEM240):c.509C>T (p.Pro170Leu) rs606231451
NM_001123383.1(BCOR):c.1260T>C (p.Asp420=) rs5917933
NM_001123383.1(BCOR):c.1650C>T (p.Thr550=) rs17145653
NM_001123383.1(BCOR):c.1692A>G (p.Ala564=) rs6520618
NM_001123383.1(BCOR):c.1779C>A (p.Ser593=) rs17145652
NM_001123383.1(BCOR):c.2035G>A (p.Val679Ile) rs144722432
NM_001123383.1(BCOR):c.2199G>T (p.Thr733=) rs140693978
NM_001123383.1(BCOR):c.2514C>A (p.Pro838=) rs147497014
NM_001123383.1(BCOR):c.408C>T (p.Ala136=) rs139802143
NM_001123383.1(BCOR):c.4218T>C (p.Pro1406=) rs753786462
NM_001123383.1(BCOR):c.4386A>C (p.Ala1462=) rs138741225
NM_001123383.1(BCOR):c.4578G>A (p.Thr1526=) rs146007249
NM_001123383.1(BCOR):c.4875-4G>T rs5963725
NM_001126049.1(KLLN):c.-956G>T rs34149102
NM_001126112.2(TP53):c.701A>G (p.Tyr234Cys) rs587780073
NM_001126112.2(TP53):c.704A>G (p.Asn235Ser) rs144340710
NM_001126112.2(TP53):c.847C>T (p.Arg283Cys) rs149633775
NM_001126112.2(TP53):c.848G>A (p.Arg283His) rs371409680
NM_001126112.2(TP53):c.869G>A (p.Arg290His) rs55819519
NM_001126121.2(SLC25A19):c.*2T>C rs1809352
NM_001126121.2(SLC25A19):c.339T>C (p.Tyr113=) rs7213318
NM_001126121.2(SLC25A19):c.414C>T (p.Pro138=) rs532597121
NM_001126121.2(SLC25A19):c.483C>T (p.Ala161=) rs142281464
NM_001126121.2(SLC25A19):c.750G>A (p.Glu250=) rs147904037
NM_001126121.2(SLC25A19):c.797T>G (p.Met266Arg) rs148372053
NM_001126121.2(SLC25A19):c.819G>A (p.Leu273=) rs4789164
NM_001126131.2(POLG):c.126_128GCA[12] (p.Gln55dup) rs41550117
NM_001126131.2(POLG):c.1550G>T (p.Gly517Val) rs61752783
NM_001126131.2(POLG):c.1760C>T (p.Pro587Leu) rs113994096
NM_001126131.2(POLG):c.752C>T (p.Thr251Ile) rs113994094
NM_001127221.1(CACNA1A):c.1182G>A (p.Glu394=) rs2248069
NM_001127221.1(CACNA1A):c.1629G>A (p.Thr543=) rs16011
NM_001127221.1(CACNA1A):c.1779C>G (p.Val593=) rs16012
NM_001127221.1(CACNA1A):c.2094G>A (p.Thr698=) rs16016
NM_001127221.1(CACNA1A):c.2195A>C (p.Glu732Ala) rs16019
NM_001127221.1(CACNA1A):c.2740C>T (p.Pro914Ser) rs16020
NM_001127221.1(CACNA1A):c.2742C>T (p.Pro914=) rs16021
NM_001127221.1(CACNA1A):c.2754G>C (p.Glu918Asp) rs16022
NM_001127221.1(CACNA1A):c.2978A>T (p.Glu993Val) rs16023
NM_001127221.1(CACNA1A):c.3031C>G (p.Pro1011Ala) rs28413664
NM_001127221.1(CACNA1A):c.3060G>A (p.Arg1020=) rs16025
NM_001127221.1(CACNA1A):c.3240C>T (p.Ala1080=) rs16026
NM_001127221.1(CACNA1A):c.3313G>A (p.Gly1105Ser) rs16027
NM_001127221.1(CACNA1A):c.3549C>T (p.Val1183=) rs16029
NM_001127221.1(CACNA1A):c.3864T>C (p.Phe1288=) rs16030
NM_001127221.1(CACNA1A):c.462C>T (p.Ala154=) rs1800039
NM_001127221.1(CACNA1A):c.5742C>T (p.Ala1914=) rs16044
NM_001127221.1(CACNA1A):c.579G>A (p.Thr193=) rs41276894
NM_001127221.1(CACNA1A):c.6345C>G (p.Thr2115=) rs16049
NM_001127221.1(CACNA1A):c.6381C>T (p.Ser2127=) rs16050
NM_001127221.1(CACNA1A):c.654G>C (p.Ser218=) rs201991581
NM_001127221.1(CACNA1A):c.6660T>C (p.His2220=) rs16051
NM_001127221.1(CACNA1A):c.6661_6662insACC (p.His2220dup) rs768950814
NM_001127221.1(CACNA1A):c.876A>G (p.Glu292=) rs16006
NM_001127644.2(GABRA1):c.1323G>A (p.Thr441=) rs138259457
NM_001127644.2(GABRA1):c.156T>C (p.Gly52=) rs1129647
NM_001127644.2(GABRA1):c.74+9A>T rs41275339
NM_001127644.2(GABRA1):c.96A>G (p.Gln32=) rs76224028
NM_001127713.1(ATL1):c.351G>A (p.Glu117=) rs1060197
NM_001127713.1(ATL1):c.84A>G (p.Pro28=) rs35014209
NM_001128126.3(AP4S1):c.124C>A (p.Arg42=) rs387906970
NM_001128126.3(AP4S1):c.289C>T (p.Arg97Ter) rs200440467
NM_001128126.3(AP4S1):c.29A>G (p.Lys10Arg) rs147135554
NM_001128126.3(AP4S1):c.306+4191A>G rs200969079
NM_001128126.3(AP4S1):c.306+4283C>T rs143795469
NM_001128126.3(AP4S1):c.306+42G>A rs74807133
NM_001128844.2(SMARCA4):c.2275-3C>A rs117611401
NM_001128849.2(SMARCA4):c.*1G>T rs76118382
NM_001128849.2(SMARCA4):c.1114T>C (p.Tyr372His) rs140192268
NM_001128849.2(SMARCA4):c.1118+7del rs774132615
NM_001128849.2(SMARCA4):c.1140C>T (p.His380=) rs114594206
NM_001128849.2(SMARCA4):c.120C>T (p.His40=) rs375884151
NM_001128849.2(SMARCA4):c.1287G>A (p.Ala429=) rs143600641
NM_001128849.2(SMARCA4):c.1413G>A (p.Lys471=) rs17001073
NM_001128849.2(SMARCA4):c.1419+7T>C rs112977340
NM_001128849.2(SMARCA4):c.1419+8C>T rs115492175
NM_001128849.2(SMARCA4):c.1419+9C>T rs374635008
NM_001128849.2(SMARCA4):c.1509A>G (p.Ala503=) rs17001075
NM_001128849.2(SMARCA4):c.1748A>G (p.Lys583Arg) rs1043517699
NM_001128849.2(SMARCA4):c.1791T>G (p.Pro597=) rs141806282
NM_001128849.2(SMARCA4):c.2001+8T>G rs112549813
NM_001128849.2(SMARCA4):c.223-5C>T rs376775933
NM_001128849.2(SMARCA4):c.2438+10C>T rs370782232
NM_001128849.2(SMARCA4):c.2460C>T (p.Tyr820=) rs372410282
NM_001128849.2(SMARCA4):c.2739G>A (p.Pro913=) rs183695281
NM_001128849.2(SMARCA4):c.2757C>T (p.Pro919=) rs113955216
NM_001128849.2(SMARCA4):c.2936G>A (p.Arg979Gln) rs797045981
NM_001128849.2(SMARCA4):c.2967C>T (p.Pro989=) rs149874634
NM_001128849.2(SMARCA4):c.3045C>T (p.Gly1015=) rs56101423
NM_001128849.2(SMARCA4):c.3168+31C>G rs2075021
NM_001128849.2(SMARCA4):c.3546+9G>A rs544551192
NM_001128849.2(SMARCA4):c.3732C>T (p.Arg1244=) rs797045983
NM_001128849.2(SMARCA4):c.3975C>T (p.Arg1325=) rs144803359
NM_001128849.2(SMARCA4):c.4152G>A (p.Thr1384=) rs372620534
NM_001128849.2(SMARCA4):c.4590C>T (p.Tyr1530=) rs139505007
NM_001128849.2(SMARCA4):c.4680C>T (p.Asp1560=) rs9105
NM_001128849.2(SMARCA4):c.4689C>T (p.Leu1563=) rs757189400
NM_001128849.2(SMARCA4):c.4864+10G>A rs201665695
NM_001128849.2(SMARCA4):c.4930G>A (p.Gly1644Ser) rs372319442
NM_001128849.2(SMARCA4):c.589C>T (p.Pro197Ser) rs200664441
NM_001128849.2(SMARCA4):c.708T>C (p.Pro236=) rs62639303
NM_001128849.2(SMARCA4):c.747C>T (p.Tyr249=) rs756224211
NM_001128849.2(SMARCA4):c.915G>A (p.Pro305=) rs149573400
NM_001128849.2(SMARCA4):c.930C>A (p.Arg310=) rs146141457
NM_001128849.2(SMARCA4):c.981A>C (p.Pro327=) rs547268941
NM_001130438.3(SPTAN1):c.1221+11C>T rs113357847
NM_001130438.3(SPTAN1):c.1303T>G (p.Ser435Ala) rs144787939
NM_001130438.3(SPTAN1):c.1330G>A (p.Val444Ile) rs77358650
NM_001130438.3(SPTAN1):c.1389C>T (p.Tyr463=) rs587784431
NM_001130438.3(SPTAN1):c.1462-27T>A rs7040737
NM_001130438.3(SPTAN1):c.1511C>T (p.Ala504Val) rs148727077
NM_001130438.3(SPTAN1):c.1737C>T (p.Phe579=) rs143941068
NM_001130438.3(SPTAN1):c.2343C>A (p.Ala781=) rs34084388
NM_001130438.3(SPTAN1):c.237+4C>T rs371350283
NM_001130438.3(SPTAN1):c.2560+47C>T rs4837284
NM_001130438.3(SPTAN1):c.2889G>A (p.Thr963=) rs34654141
NM_001130438.3(SPTAN1):c.3042T>G (p.Gly1014=) rs150870424
NM_001130438.3(SPTAN1):c.3051G>A (p.Pro1017=) rs140279996
NM_001130438.3(SPTAN1):c.3215+15_3215+16del rs551595039
NM_001130438.3(SPTAN1):c.3300G>A (p.Ala1100=) rs2227865
NM_001130438.3(SPTAN1):c.3415-9G>T rs199802986
NM_001130438.3(SPTAN1):c.3520-14C>G rs142682344
NM_001130438.3(SPTAN1):c.3546T>C (p.Asp1182=) rs945831
NM_001130438.3(SPTAN1):c.3579+3_3579+4dup rs797046004
NM_001130438.3(SPTAN1):c.3673C>T (p.Arg1225Trp) rs569997507
NM_001130438.3(SPTAN1):c.4199A>T (p.Gln1400Leu) rs143108250
NM_001130438.3(SPTAN1):c.4283C>G (p.Ala1428Gly) rs143166100
NM_001130438.3(SPTAN1):c.4410C>T (p.Thr1470=) rs2228951
NM_001130438.3(SPTAN1):c.5149-10C>T rs587784437
NM_001130438.3(SPTAN1):c.5437C>A (p.Arg1813=) rs3750333
NM_001130438.3(SPTAN1):c.5478+12G>A rs41275900
NM_001130438.3(SPTAN1):c.5479-41A>C rs7864187
NM_001130438.3(SPTAN1):c.5523C>T (p.Ile1841=) rs79569204
NM_001130438.3(SPTAN1):c.5925G>A (p.Ala1975=) rs11543345
NM_001130438.3(SPTAN1):c.6042T>G (p.Ser2014=) rs142830725
NM_001130438.3(SPTAN1):c.6111C>T (p.Gly2037=) rs139799727
NM_001130438.3(SPTAN1):c.6234C>T (p.Ala2078=) rs147132904
NM_001130438.3(SPTAN1):c.6235G>A (p.Ala2079Thr) rs377253398
NM_001130438.3(SPTAN1):c.6280-27C>T rs3737308
NM_001130438.3(SPTAN1):c.6498C>A (p.Arg2166=) rs72758823
NM_001130438.3(SPTAN1):c.6498C>T (p.Arg2166=) rs72758823
NM_001130438.3(SPTAN1):c.6660C>T (p.Asn2220=) rs112955915
NM_001130438.3(SPTAN1):c.6708-7C>T rs16930539
NM_001130438.3(SPTAN1):c.6899_6907ACCAGCTGG[3] (p.2300_2302DQL[3]) rs587784440
NM_001130438.3(SPTAN1):c.6960-8T>C rs140241053
NM_001130438.3(SPTAN1):c.7161-9C>T rs187613754
NM_001130438.3(SPTAN1):c.7389C>T (p.Thr2463=) rs2228952
NM_001130438.3(SPTAN1):c.862G>C (p.Ala288Pro) rs796053298
NM_001130438.3(SPTAN1):c.979C>T (p.Leu327=) rs587784442
NM_001130987.2(DYSF):c.1038C>T (p.His346=) rs36122356
NM_001130987.2(DYSF):c.1380+6G>C rs75796187
NM_001130987.2(DYSF):c.1465G>A (p.Glu489Lys) rs61740288
NM_001130987.2(DYSF):c.1518C>T (p.Ile506=) rs34387018
NM_001130987.2(DYSF):c.1785G>A (p.Ala595=) rs35984374
NM_001130987.2(DYSF):c.1881T>C (p.Asp627=) rs2303596
NM_001130987.2(DYSF):c.1914C>T (p.Tyr638=) rs35721373
NM_001130987.2(DYSF):c.1944G>A (p.Pro648=) rs115849497
NM_001130987.2(DYSF):c.2554A>G (p.Ile852Val) rs34671418
NM_001130987.2(DYSF):c.2622G>A (p.Leu874=) rs191337920
NM_001130987.2(DYSF):c.2637A>T (p.Ser879=) rs2288355
NM_001130987.2(DYSF):c.2856G>A (p.Pro952=) rs34836829
NM_001130987.2(DYSF):c.3119G>A (p.Arg1040Gln) rs34211915
NM_001130987.2(DYSF):c.3341G>A (p.Arg1114His) rs59915619
NM_001130987.2(DYSF):c.3477G>A (p.Thr1159=) rs576460368
NM_001130987.2(DYSF):c.3588C>T (p.Ile1196=) rs79899601
NM_001130987.2(DYSF):c.3756+9G>T rs191746041
NM_001130987.2(DYSF):c.396C>T (p.Pro132=) rs34603128
NM_001130987.2(DYSF):c.4026C>T (p.Asn1342=) rs11558179
NM_001130987.2(DYSF):c.4046G>T (p.Arg1349Leu) rs61742872
NM_001130987.2(DYSF):c.4062C>A (p.Ile1354=) rs2303606
NM_001130987.2(DYSF):c.4122C>T (p.Ser1374=) rs2303607
NM_001130987.2(DYSF):c.4377G>A (p.Gln1459=) rs76576806
NM_001130987.2(DYSF):c.4430A>G (p.Asp1477Gly) rs61738567
NM_001130987.2(DYSF):c.4621C>T (p.Leu1541=) rs7573406
NM_001130987.2(DYSF):c.4848G>A (p.Glu1616=) rs62145939
NM_001130987.2(DYSF):c.5976A>C (p.Pro1992=) rs17718530
NM_001130987.2(DYSF):c.605C>A (p.Ala202Glu) rs34999029
NM_001130987.2(DYSF):c.661C>G (p.Leu221Val) rs13407355
NM_001130987.2(DYSF):c.666T>C (p.Pro222=) rs35392229
NM_001130987.2(DYSF):c.951+4T>C rs11903960
NM_001131005.2(MEF2C):c.579C>T (p.Asn193=) rs398123686
NM_001131005.2(MEF2C):c.636C>T (p.Asn212=) rs79455305
NM_001131005.2(MEF2C):c.805-899G>A rs149706617
NM_001134407.3(GRIN2A):c.1275G>A (p.Leu425=) rs2229193
NM_001134407.3(GRIN2A):c.1329-8C>T rs7193290
NM_001134407.3(GRIN2A):c.2085G>C (p.Arg695=) rs9806806
NM_001134407.3(GRIN2A):c.2190C>T (p.Tyr730=) rs61753382
NM_001134407.3(GRIN2A):c.2277C>T (p.Thr759=) rs148846694
NM_001134407.3(GRIN2A):c.2636A>G (p.Lys879Arg) rs183029507
NM_001134407.3(GRIN2A):c.2664G>A (p.Thr888=) rs113847665
NM_001134407.3(GRIN2A):c.2883C>T (p.Asn961=) rs77705198
NM_001134407.3(GRIN2A):c.2899G>C (p.Val967Leu) rs61731465
NM_001134407.3(GRIN2A):c.3103G>A (p.Asp1035Asn) rs540445580
NM_001134407.3(GRIN2A):c.3190A>G (p.Thr1064Ala) rs138809301
NM_001134407.3(GRIN2A):c.3228C>A (p.Asn1076Lys) rs61758995
NM_001134407.3(GRIN2A):c.3578T>G (p.Leu1193Trp) rs75761674
NM_001134407.3(GRIN2A):c.3702C>T (p.Phe1234=) rs372083517
NM_001134407.3(GRIN2A):c.3827C>G (p.Ala1276Gly) rs145063086
NM_001134407.3(GRIN2A):c.422C>T (p.Thr141Met) rs78631453
NM_001134407.3(GRIN2A):c.4307A>G (p.Asn1436Ser) rs77029288
NM_001134407.3(GRIN2A):c.547T>A (p.Phe183Ile) rs587780353
NM_001134407.3(GRIN2A):c.662A>G (p.Lys221Arg) rs61731464
NM_001134665.3(TRMT10A):c.955C>A (p.Pro319Thr) rs143207059
NM_001134673.4(NFIA):c.*42C>T rs114023473
NM_001134831.2(AHI1):c.1643G>A (p.Arg548His) rs35433555
NM_001134831.2(AHI1):c.2223T>C (p.Asp741=) rs2273761
NM_001134831.2(AHI1):c.2488C>T (p.Arg830Trp) rs13312995
NM_001134831.2(AHI1):c.2624-6A>G rs41288015
NM_001134831.2(AHI1):c.3015A>G (p.Ser1005=) rs41287054
NM_001134831.2(AHI1):c.3053A>C (p.Gln1018Pro) rs6940875
NM_001134831.2(AHI1):c.72T>C (p.Ser24=) rs73777558
NM_001134831.2(AHI1):c.804A>C (p.Ser268=) rs35528530
NM_001142283.1(RPS24):c.189T>C (p.His63=) rs201805132
NM_001142301.1(TMEM67):c.-62+714G>T rs797046045
NM_001142301.1(TMEM67):c.1045+46C>T rs73694952
NM_001142301.1(TMEM67):c.1066C>G (p.Leu356Val) rs35765535
NM_001142301.1(TMEM67):c.107C>T (p.Pro36Leu) rs73324992
NM_001142301.1(TMEM67):c.1567A>G (p.Ile523Val) rs3134031
NM_001142301.1(TMEM67):c.1918C>T (p.Pro640Ser) rs116445698
NM_001142301.1(TMEM67):c.2154T>C (p.Asp718=) rs117195541
NM_001142301.1(TMEM67):c.2649A>C (p.Thr883=) rs16916221
NM_001142301.1(TMEM67):c.336_337del (p.Gly114fs) rs386834202
NM_001142301.1(TMEM67):c.538G>A (p.Asp180Asn) rs35793208
NM_001142301.1(TMEM67):c.627-29A>G rs116802062
NM_001142301.1(TMEM67):c.803T>C (p.Leu268Ser) rs386834180
NM_001142301.1(TMEM67):c.823-3C>T rs3097427
NM_001142633.2(PIK3R5):c.1011C>T (p.Asp337=) rs16957702
NM_001142633.2(PIK3R5):c.1075T>C (p.Leu359=) rs381309
NM_001142633.2(PIK3R5):c.1101G>A (p.Ser367=) rs9915880
NM_001142633.2(PIK3R5):c.2557C>T (p.Pro853Ser) rs62620227
NM_001142633.2(PIK3R5):c.837C>T (p.His279=) rs394811
NM_001142633.2(PIK3R5):c.933A>G (p.Leu311=) rs11650737
NM_001142784.2(IL11RA):c.72C>T (p.Ser24=) rs34893971
NM_001143992.2(WRAP53):c.1075C>T (p.Pro359Ser) rs149359927
NM_001143992.2(WRAP53):c.936C>T (p.Cys312=) rs73248508
NM_001145536.2(C17orf107):c.*1074G>A rs33970119
NM_001145536.2(C17orf107):c.*1561G>A rs72835059
NM_001145536.2(C17orf107):c.*2224C>A rs4790235
NM_001145661.2(GATA2):c.1035C>T (p.Ala345=) rs371599112
NM_001145661.2(GATA2):c.1084C>T (p.Arg362Ter) rs1553770510
NM_001145661.2(GATA2):c.1192C>T (p.Arg398Trp) rs387906629
NM_001145661.2(GATA2):c.121C>G (p.Pro41Ala) rs143590990
NM_001145661.2(GATA2):c.1286G>C (p.Ser429Thr) rs201155045
NM_001145661.2(GATA2):c.480C>T (p.Thr160=) rs199640729
NM_001145661.2(GATA2):c.481C>G (p.Pro161Ala) rs34799090
NM_001145661.2(GATA2):c.710G>A (p.Gly237Asp) rs191501191
NM_001145661.2(GATA2):c.857C>T (p.Ala286Val) rs797045592
NM_001146261.2(SYT14):c.1554T>C (p.Tyr518=) rs17188183
NM_001146261.2(SYT14):c.807_809AGA[1] (p.Glu270del) rs2307890
NM_001159699.2(FHL1):c.204+5C>T rs182106777
NM_001160372.4(TRAPPC9):c.1164C>T (p.Tyr388=) rs148976893
NM_001160372.4(TRAPPC9):c.1326G>A (p.Ser442=) rs145960296
NM_001160372.4(TRAPPC9):c.1407C>T (p.Tyr469=) rs117632905
NM_001160372.4(TRAPPC9):c.1458C>T (p.Phe486=) rs34179337
NM_001160372.4(TRAPPC9):c.159C>T (p.Leu53=) rs112997540
NM_001160372.4(TRAPPC9):c.1692C>T (p.Asn564=) rs12549048
NM_001160372.4(TRAPPC9):c.1809G>A (p.Leu603=) rs146235874
NM_001160372.4(TRAPPC9):c.1869C>T (p.Ser623=) rs117685875
NM_001160372.4(TRAPPC9):c.2037G>A (p.Pro679=) rs371880751
NM_001160372.4(TRAPPC9):c.207T>C (p.Gly69=) rs3735801
NM_001160372.4(TRAPPC9):c.2292C>T (p.Gly764=) rs11166965
NM_001160372.4(TRAPPC9):c.2431+7G>A rs11166964
NM_001160372.4(TRAPPC9):c.263C>T (p.Ser88Leu) rs139631202
NM_001160372.4(TRAPPC9):c.2796C>T (p.Ala932=) rs145607512
NM_001160372.4(TRAPPC9):c.2797G>A (p.Gly933Ser) rs114949291
NM_001160372.4(TRAPPC9):c.2799= (p.Gly933=) rs2614718
NM_001160372.4(TRAPPC9):c.288T>C (p.Phe96=) rs3735802
NM_001160372.4(TRAPPC9):c.3012C>T (p.Asn1004=) rs148805943
NM_001160372.4(TRAPPC9):c.3069C>T (p.Asp1023=) rs144383785
NM_001160372.4(TRAPPC9):c.3136C>T (p.Arg1046Trp) rs376617920
NM_001160372.4(TRAPPC9):c.3157C>T (p.Arg1053Cys) rs147499593
NM_001160372.4(TRAPPC9):c.3163G>A (p.Val1055Ile) rs35578974
NM_001160372.4(TRAPPC9):c.3225C>T (p.Tyr1075=) rs58740567
NM_001160372.4(TRAPPC9):c.3241G>A (p.Val1081Ile) rs141067069
NM_001160372.4(TRAPPC9):c.3249C>T (p.Phe1083=) rs112551069
NM_001160372.4(TRAPPC9):c.3279+4C>T rs79877357
NM_001160372.4(TRAPPC9):c.3356G>A (p.Arg1119Gln) rs145503551
NM_001160372.4(TRAPPC9):c.3390A>C (p.Pro1130=) rs143396124
NM_001160372.4(TRAPPC9):c.3411C>A (p.Pro1137=) rs373979305
NM_001160372.4(TRAPPC9):c.3414T>G (p.Ser1138Arg) rs147127279
NM_001160372.4(TRAPPC9):c.357G>A (p.Gly119=) rs34457678
NM_001160372.4(TRAPPC9):c.399T>C (p.Ala133=) rs61739560
NM_001160372.4(TRAPPC9):c.411C>T (p.Asn137=) rs3735803
NM_001160372.4(TRAPPC9):c.414C>T (p.Tyr138=) rs115986561
NM_001160372.4(TRAPPC9):c.555G>A (p.Lys185=) rs57593250
NM_001160372.4(TRAPPC9):c.588T>C (p.His196=) rs61736350
NM_001161352.2(KCNMA1):c.1578G>T (p.Leu526=) rs74140280
NM_001161352.2(KCNMA1):c.1680C>A (p.Ala560=) rs2229008
NM_001161352.2(KCNMA1):c.2015+7G>A rs78670694
NM_001161352.2(KCNMA1):c.2391T>C (p.Asp797=) rs77280228
NM_001161352.2(KCNMA1):c.2526C>T (p.Val842=) rs41274568
NM_001161352.2(KCNMA1):c.2710-8T>C rs78672251
NM_001161352.2(KCNMA1):c.3051C>T (p.Asp1017=) rs115772068
NM_001161352.2(KCNMA1):c.3195C>T (p.Thr1065=) rs45527834
NM_001161352.2(KCNMA1):c.34A>G (p.Ser12Gly) rs77602559
NM_001161352.2(KCNMA1):c.687C>T (p.Phe229=) rs1131824
NM_001161352.2(KCNMA1):c.90C>T (p.His30=) rs75040504
NM_001163673.1(WDR81):c.1362A>G (p.Leu454=) rs3809872
NM_001163673.1(WDR81):c.1518G>A (p.Pro506=) rs8065251
NM_001164732.2(REEP1):c.182+9253G>A rs2276625
NM_001165927.1(MKS1):c.1358G>A (p.Arg453Gln) rs201619500
NM_001165927.1(MKS1):c.1406G>A (p.Arg469His) rs111315726
NM_001165927.1(MKS1):c.161-44G>A rs73329636
NM_001165927.1(MKS1):c.1641G>C (p.Leu547=) rs11548967
NM_001165927.1(MKS1):c.183C>G (p.Asp61Glu) rs142813109
NM_001165927.1(MKS1):c.814C>T (p.Arg272Ter) rs797045706
NM_001165927.1(MKS1):c.828+9A>G rs3826300
NM_001165928.3(DAG1):c.2256C>T (p.His752=) rs1801143
NM_001165928.3(DAG1):c.258G>C (p.Leu86Phe) rs145403829
NM_001165928.3(DAG1):c.259A>G (p.Ile87Val) rs116717961
NM_001166108.2(PALLD):c.3297T>C (p.Tyr1099=) rs114593924
NM_001168272.1(ITPR1):c.1962G>A (p.Lys654=) rs2306875
NM_001168272.1(ITPR1):c.2613A>C (p.Leu871=) rs2306877
NM_001168272.1(ITPR1):c.6672A>G (p.Thr2224=) rs13079522
NM_001168272.1(ITPR1):c.7009C>T (p.Leu2337=) rs2291862
NM_001168272.1(ITPR1):c.731A>G (p.His244Arg) rs1085308010
NM_001168272.1(ITPR1):c.7590T>C (p.Thr2530=) rs711631
NM_001168272.1(ITPR1):c.7644G>A (p.Lys2548=) rs901854
NM_001171603.1(PREPL):c.1207A>T (p.Asn403Tyr) rs140990611
NM_001172435.2(RAB3GAP1):c.1006C>T (p.Arg336Cys) rs150478342
NM_001172435.2(RAB3GAP1):c.1041A>G (p.Arg347=) rs77972211
NM_001172435.2(RAB3GAP1):c.1325A>G (p.Tyr442Cys) rs114901298
NM_001172435.2(RAB3GAP1):c.1793A>G (p.Asn598Ser) rs10445686
NM_001172435.2(RAB3GAP1):c.1992G>A (p.Ser664=) rs7595725
NM_001172435.2(RAB3GAP1):c.2265T>C (p.Phe755=) rs17261772
NM_001172435.2(RAB3GAP1):c.2463C>T (p.Phe821=) rs61748693
NM_001172435.2(RAB3GAP1):c.2676G>T (p.Arg892Ser) rs144455066
NM_001172435.2(RAB3GAP1):c.2925T>C (p.Phe975=) rs146045827
NM_001172435.2(RAB3GAP1):c.357A>G (p.Val119=) rs73959261
NM_001172435.2(RAB3GAP1):c.411C>T (p.Asp137=) rs140929274
NM_001172435.2(RAB3GAP1):c.724T>C (p.Tyr242His) rs577915245
NM_001172435.2(RAB3GAP1):c.816C>T (p.Cys272=) rs199898437
NM_001173990.3(TMEM216):c.264G>A (p.Pro88=) rs3741265
NM_001174150.2(ARL13B):c.1043C>G (p.Thr348Ser) rs33944211
NM_001174150.2(ARL13B):c.105C>T (p.Thr35=) rs146396078
NM_001174150.2(ARL13B):c.1186C>G (p.Pro396Ala) rs11554412
NM_001182.5(ALDH7A1):c.1234A>G (p.Thr412Ala) rs2306618
NM_001182.5(ALDH7A1):c.1315A>C (p.Lys439Gln) rs12514417
NM_001182.5(ALDH7A1):c.1567A>G (p.Thr523Ala) rs61757684
NM_001182.5(ALDH7A1):c.201G>T (p.Thr67=) rs747643987
NM_001182.5(ALDH7A1):c.273T>C (p.Thr91=) rs60720055
NM_001182.5(ALDH7A1):c.373A>G (p.Ile125Val) rs117295656
NM_001182.5(ALDH7A1):c.675C>T (p.Leu225=) rs57902950
NM_001184.4(ATR):c.1326A>G (p.Lys442=) rs28897765
NM_001184.4(ATR):c.1776T>A (p.Gly592=) rs2227930
NM_001184.4(ATR):c.1950G>A (p.Glu650=) rs28910270
NM_001184.4(ATR):c.2205C>T (p.His735=) rs148955716
NM_001184.4(ATR):c.2290A>G (p.Lys764Glu) rs77208665
NM_001184.4(ATR):c.2442A>G (p.Glu814=) rs55895932
NM_001184.4(ATR):c.2688G>A (p.Leu896=) rs117926957
NM_001184.4(ATR):c.268C>T (p.His90Tyr) rs28897763
NM_001184.4(ATR):c.2776T>C (p.Phe926Leu) rs141783863
NM_001184.4(ATR):c.2844A>C (p.Ala948=) rs147286949
NM_001184.4(ATR):c.2875G>A (p.Val959Met) rs28910271
NM_001184.4(ATR):c.3120G>A (p.Leu1040=) rs28910272
NM_001184.4(ATR):c.3726-47A>G rs73240314
NM_001184.4(ATR):c.4002G>A (p.Gln1334=) rs56026468
NM_001184.4(ATR):c.423T>C (p.Ile141=) rs10935466
NM_001184.4(ATR):c.4677C>T (p.Asp1559=) rs112726878
NM_001184.4(ATR):c.4764C>T (p.Leu1588=) rs142240637
NM_001184.4(ATR):c.4835A>G (p.Asn1612Ser) rs55894265
NM_001184.4(ATR):c.5208T>C (p.Tyr1736=) rs2227931
NM_001184.4(ATR):c.5381-41C>T rs34502778
NM_001184.4(ATR):c.5460T>C (p.Tyr1820=) rs2227932
NM_001184.4(ATR):c.5868C>T (p.Tyr1956=) rs112018640
NM_001184.4(ATR):c.632T>C (p.Met211Thr) rs2227928
NM_001184.4(ATR):c.6339A>G (p.Val2113=) rs7635479
NM_001184.4(ATR):c.6394T>G (p.Tyr2132Asp) rs28910273
NM_001184.4(ATR):c.7041+8G>A rs201106004
NM_001184.4(ATR):c.7274G>A (p.Arg2425Gln) rs2229032
NM_001184.4(ATR):c.7300C>G (p.Pro2434Ala) rs33972295
NM_001184.4(ATR):c.7875G>A (p.Gln2625=) rs1802904
NM_001184.4(ATR):c.891G>C (p.Lys297Asn) rs2229033
NM_001184.4(ATR):c.946G>A (p.Val316Ile) rs28897764
NM_001184.4(ATR):c.992A>G (p.Asp331Gly) rs150008448
NM_001184880.2(PCDH19):c.1330A>G (p.Thr444Ala) rs201671718
NM_001184880.2(PCDH19):c.1683G>A (p.Pro561=) rs192354176
NM_001184880.2(PCDH19):c.1725C>T (p.Val575=) rs200471732
NM_001184880.2(PCDH19):c.2796C>T (p.Asn932=) rs193148631
NM_001184880.2(PCDH19):c.2938C>T (p.Arg980Cys) rs3764758
NM_001184880.2(PCDH19):c.3280C>G (p.Leu1094Val) rs184545774
NM_001184880.2(PCDH19):c.3319C>G (p.Arg1107Gly) rs191333060
NM_001184880.2(PCDH19):c.3439G>A (p.Val1147Ile) rs138771033
NM_001184880.2(PCDH19):c.513C>T (p.Asn171=) rs749602848
NM_001184880.2(PCDH19):c.531G>A (p.Glu177=) rs192122222
NM_001184880.2(PCDH19):c.6G>A (p.Glu2=) rs184883626
NM_001184880.2(PCDH19):c.769G>C (p.Val257Leu) rs201713027
NM_001184880.2(PCDH19):c.790G>T (p.Asp264Tyr) rs587784300
NM_001184880.2(PCDH19):c.81C>T (p.Tyr27=) rs56307810
NM_001184880.2(PCDH19):c.942G>A (p.Leu314=) rs773740606
NM_001190919.1(THRA):c.577-4C>T rs188965373
NM_001191061.2(SLC25A22):c.132C>T (p.Arg44=) rs146402942
NM_001191061.2(SLC25A22):c.151G>A (p.Asp51Asn) rs116134953
NM_001191061.2(SLC25A22):c.169G>A (p.Val57Ile) rs150242281
NM_001191061.2(SLC25A22):c.234C>T (p.Pro78=) rs80335370
NM_001191061.2(SLC25A22):c.293+27G>A rs79478359
NM_001191061.2(SLC25A22):c.394C>T (p.Gln132Ter) rs1554965669
NM_001191061.2(SLC25A22):c.412+10G>T rs113091974
NM_001191061.2(SLC25A22):c.413-8G>C rs376015598
NM_001191061.2(SLC25A22):c.448C>G (p.Leu150Val) rs111277421
NM_001191061.2(SLC25A22):c.495C>T (p.Ala165=) rs374780430
NM_001191061.2(SLC25A22):c.561C>T (p.Tyr187=) rs77117049
NM_001191061.2(SLC25A22):c.585C>T (p.Leu195=) rs147840220
NM_001191061.2(SLC25A22):c.618G>A (p.Pro206=) rs150544061
NM_001191061.2(SLC25A22):c.876G>A (p.Ala292=) rs146300431
NM_001191061.2(SLC25A22):c.885C>T (p.Ile295=) rs543285265
NM_001191061.2(SLC25A22):c.897C>T (p.Phe299=) rs7124179
NM_001193376.2(TERT):c.1317_1319GGA[2] (p.Glu441del) rs377639087
NM_001194998.2(CEP152):c.1180A>G (p.Ile394Val) rs181295720
NM_001194998.2(CEP152):c.1577+6G>A rs78525896
NM_001194998.2(CEP152):c.161C>T (p.Ser54Leu) rs2289181
NM_001194998.2(CEP152):c.1866G>T (p.Leu622=) rs61737684
NM_001194998.2(CEP152):c.186C>T (p.Asp62=) rs548567364
NM_001194998.2(CEP152):c.1909-8G>C rs116089174
NM_001194998.2(CEP152):c.191+11G>A rs75503597
NM_001194998.2(CEP152):c.2000A>G (p.Lys667Arg) rs200879436
NM_001194998.2(CEP152):c.2018+9T>C rs587783417
NM_001194998.2(CEP152):c.2019-13G>A rs9302144
NM_001194998.2(CEP152):c.2034T>G (p.Tyr678Ter) rs182018947
NM_001194998.2(CEP152):c.2262G>A (p.Glu754=) rs149176738
NM_001194998.2(CEP152):c.2378G>T (p.Ser793Ile) rs2289178
NM_001194998.2(CEP152):c.2681C>T (p.Ser894Phe) rs145138194
NM_001194998.2(CEP152):c.2740C>G (p.Leu914Val) rs16961560
NM_001194998.2(CEP152):c.2777A>T (p.Glu926Val) rs117557829
NM_001194998.2(CEP152):c.2878T>C (p.Trp960Arg) rs201342438
NM_001194998.2(CEP152):c.3278G>A (p.Cys1093Tyr) rs74012142
NM_001194998.2(CEP152):c.3313C>G (p.Leu1105Val) rs74553953
NM_001194998.2(CEP152):c.3317T>C (p.Val1106Ala) rs16961557
NM_001194998.2(CEP152):c.3325G>C (p.Ala1109Pro) rs115832709
NM_001194998.2(CEP152):c.344G>A (p.Arg115Gln) rs188101277
NM_001194998.2(CEP152):c.4072C>G (p.Gln1358Glu) rs149478199
NM_001194998.2(CEP152):c.4094-9A>T rs80090788
NM_001194998.2(CEP152):c.4299T>C (p.His1433=) rs114085678
NM_001194998.2(CEP152):c.4744T>C (p.Ser1582Pro) rs77745570
NM_001194998.2(CEP152):c.4757G>C (p.Arg1586Pro) rs202237336
NM_001194998.2(CEP152):c.4857T>C (p.Asp1619=) rs74986073
NM_001194998.2(CEP152):c.4914A>G (p.Pro1638=) rs150910683
NM_001194998.2(CEP152):c.5078C>T (p.Pro1693Leu) rs368764302
NM_001194998.2(CEP152):c.5115A>G (p.Pro1705=) rs1048042
NM_001194998.2(CEP152):c.691+9C>T rs77732888
NM_001194998.2(CEP152):c.794A>C (p.Gln265Pro) rs267606717
NM_001194998.2(CEP152):c.996T>C (p.Thr332=) rs199873069
NM_001195553.2(DCX):c.305G>A (p.Arg102His) rs267606317
NM_001195553.2(DCX):c.557G>A (p.Arg186His) rs587783563
NM_001195553.2(DCX):c.586C>T (p.Arg196Cys) rs587783568
NM_001195553.2(DCX):c.667G>A (p.Gly223Arg) rs587783577
NM_001195553.2(DCX):c.809-1G>A rs587783589
NM_001195553.2(DCX):c.856G>T (p.Ala286Ser) rs149495971
NM_001195794.1(CLRN1):c.149_152delinsTGTCCAAT (p.Ser50fs) rs786204428
NM_001197104.1(KMT2A):c.1810A>G (p.Met604Val) rs150328852
NM_001197104.1(KMT2A):c.3461G>A (p.Arg1154Gln) rs1131691799
NM_001197104.1(KMT2A):c.89C>G (p.Ala30Gly) rs9332745
NM_001199107.2(TBC1D24):c.1002C>T (p.Ala334=) rs184389316
NM_001199107.2(TBC1D24):c.1026G>A (p.Ser342=) rs370244846
NM_001199107.2(TBC1D24):c.1143-6C>T rs73490287
NM_001199107.2(TBC1D24):c.1326C>T (p.Tyr442=) rs184639841
NM_001199107.2(TBC1D24):c.1327G>A (p.Glu443Lys) rs141399869
NM_001199107.2(TBC1D24):c.1440G>A (p.Ser480=) rs12373107
NM_001199107.2(TBC1D24):c.1500G>A (p.Ala500=) rs201059992
NM_001199107.2(TBC1D24):c.1509C>T (p.Ser503=) rs189089167
NM_001199107.2(TBC1D24):c.207T>C (p.Pro69=) rs13339237
NM_001199107.2(TBC1D24):c.641G>A (p.Arg214His) rs200324356
NM_001199107.2(TBC1D24):c.845C>G (p.Pro282Arg) rs747538224
NM_001199107.2(TBC1D24):c.885C>G (p.Phe295Leu) rs72768728
NM_001205254.2(OCLN):c.173_194del (p.Trp58fs) rs797045841
NM_001205254.2(OCLN):c.452C>T (p.Ala151Val) rs28562785
NM_001206999.2(CIT):c.4224C>T (p.Asn1408=) rs34105832
NM_001211.5(BUB1B):c.348T>C (p.Tyr116=) rs28989189
NM_001234.5(CAV3):c.171G>A (p.Val57=) rs61147808
NM_001244710.1(GFPT1):c.147T>C (p.Asp49=) rs2230300
NM_001244710.1(GFPT1):c.549T>C (p.Gly183=) rs144566433
NM_001244710.1(GFPT1):c.675C>T (p.Leu225=) rs78952091
NM_001253852.3(AP4B1):c.114-10C>T rs200301524
NM_001253852.3(AP4B1):c.1365T>C (p.Tyr455=) rs114201291
NM_001253852.3(AP4B1):c.1439T>C (p.Leu480Ser) rs1217401
NM_001253852.3(AP4B1):c.1723A>G (p.Ile575Val) rs114734921
NM_001253852.3(AP4B1):c.1793-9C>G rs17031980
NM_001253852.3(AP4B1):c.240A>G (p.Pro80=) rs34249695
NM_001253852.3(AP4B1):c.402A>C (p.Ser134=) rs34751342
NM_001253852.3(AP4B1):c.576C>T (p.Gly192=) rs17464525
NM_001253852.3(AP4B1):c.618-13G>C rs3789613
NM_001253852.3(AP4B1):c.69A>G (p.Gln23=) rs117872964
NM_001253852.3(AP4B1):c.767C>T (p.Thr256Ile) rs143286419
NM_001253852.3(AP4B1):c.803A>G (p.His268Arg) rs201047107
NM_001254.4(CDC6):c.1321G>A (p.Val441Ile) rs13706
NM_001254.4(CDC6):c.165C>T (p.Pro55=) rs142289528
NM_001254.4(CDC6):c.438T>C (p.Cys146=) rs1130199
NM_001254.4(CDC6):c.712A>G (p.Thr238Ala) rs4135010
NM_001256047.1(C19orf12):c.154G>C (p.Ala52Pro) rs376103979
NM_001256047.1(C19orf12):c.205C>T (p.Gln69Ter) rs1064797235
NM_001256047.1(C19orf12):c.303G>A (p.Trp101Ter) rs1555714808
NM_001256047.1(C19orf12):c.392A>C (p.Lys131Thr) rs79915936
NM_001256053.1(ANKRD26):c.1590_1592AGA[2] (p.Glu533del) rs138423863
NM_001256849.1(POLD1):c.971-4G>A rs200144991
NM_001257988.1(TYMP):c.1412C>T (p.Ser471Leu) rs11479
NM_001257988.1(TYMP):c.622G>A (p.Val208Met) rs121913039
NM_001257988.1(TYMP):c.972C>T (p.Ala324=) rs131804
NM_001259.8(CDK6):c.328G>A (p.Asp110Asn) rs35654944
NM_001267550.1(TTN):c.45599C>G rs201057307
NM_001267550.2(TTN):c.100094G>A (p.Arg33365Gln) rs55742743
NM_001267550.2(TTN):c.100096G>A (p.Val33366Ile) rs55675869
NM_001267550.2(TTN):c.100172-17dup rs397517782
NM_001267550.2(TTN):c.1003G>A (p.Val335Met) rs72647846
NM_001267550.2(TTN):c.100459C>T (p.Pro33487Ser) rs72629779
NM_001267550.2(TTN):c.100579G>A (p.Val33527Ile) rs2278196
NM_001267550.2(TTN):c.101212C>T (p.Arg33738Cys) rs56273463
NM_001267550.2(TTN):c.101665G>A (p.Val33889Ile) rs34924609
NM_001267550.2(TTN):c.101766G>C (p.Gln33922His) rs55886356
NM_001267550.2(TTN):c.101891G>A (p.Arg33964His) rs55669553
NM_001267550.2(TTN):c.10242C>T (p.Tyr3414=) rs45447891
NM_001267550.2(TTN):c.102519C>T (p.Gly34173=) rs2857265
NM_001267550.2(TTN):c.102520G>A (p.Val34174Ile) rs200430493
NM_001267550.2(TTN):c.10256G>A (p.Ser3419Asn) rs2291310
NM_001267550.2(TTN):c.102595A>G (p.Ile34199Val) rs56347248
NM_001267550.2(TTN):c.102833G>T (p.Gly34278Val) rs3731752
NM_001267550.2(TTN):c.102877A>G (p.Lys34293Glu) rs72629783
NM_001267550.2(TTN):c.102963C>T (p.Asn34321=) rs528502993
NM_001267550.2(TTN):c.103147G>C (p.Glu34383Gln) rs148525155
NM_001267550.2(TTN):c.103781G>A (p.Arg34594His) rs3829747
NM_001267550.2(TTN):c.104560G>C (p.Val34854Leu) rs55866005
NM_001267550.2(TTN):c.104576G>A (p.Arg34859Gln) rs68080670
NM_001267550.2(TTN):c.104988C>T (p.Val34996=) rs3829748
NM_001267550.2(TTN):c.105180G>C (p.Glu35060Asp) rs56308529
NM_001267550.2(TTN):c.105384A>G (p.Ala35128=) rs3813250
NM_001267550.2(TTN):c.105529G>A (p.Val35177Met) rs55865284
NM_001267550.2(TTN):c.105582C>T (p.Ser35194=) rs3829749
NM_001267550.2(TTN):c.105769G>A (p.Glu35257Lys) rs56324595
NM_001267550.2(TTN):c.105782C>T (p.Pro35261Leu) rs16866380
NM_001267550.2(TTN):c.105787G>T (p.Ala35263Ser) rs67254537
NM_001267550.2(TTN):c.105788C>T (p.Ala35263Val) rs66961115
NM_001267550.2(TTN):c.106275G>C (p.Gly35425=) rs56207956
NM_001267550.2(TTN):c.106578T>A (p.Ser35526=) rs55838839
NM_001267550.2(TTN):c.106580A>T (p.Glu35527Val) rs55725279
NM_001267550.2(TTN):c.106619T>C (p.Ile35540Thr) rs55880440
NM_001267550.2(TTN):c.107267T>C (p.Val35756Ala) rs16866378
NM_001267550.2(TTN):c.1079G>C (p.Arg360Thr) rs56128843
NM_001267550.2(TTN):c.14525G>A (p.Arg4842Lys) rs2742347
NM_001267550.2(TTN):c.14610C>T (p.Ser4870=) rs2742348
NM_001267550.2(TTN):c.14765G>A (p.Ser4922Asn) rs184740744
NM_001267550.2(TTN):c.14911T>G (p.Cys4971Gly) rs537312655
NM_001267550.2(TTN):c.1492G>A (p.Val498Ile) rs72647851
NM_001267550.2(TTN):c.15792T>C (p.Ile5264=) rs12993099
NM_001267550.2(TTN):c.15796C>T (p.Arg5266Ter) rs372277017
NM_001267550.2(TTN):c.15850G>A (p.Val5284Met) rs66839174
NM_001267550.2(TTN):c.16095C>T (p.Asn5365=) rs72648935
NM_001267550.2(TTN):c.16303G>A (p.Val5435Met) rs72648937
NM_001267550.2(TTN):c.16313A>G (p.Lys5438Arg) rs190636272
NM_001267550.2(TTN):c.16529A>G (p.Tyr5510Cys) rs72648939
NM_001267550.2(TTN):c.17048A>G (p.Tyr5683Cys) rs72648942
NM_001267550.2(TTN):c.17227C>T (p.Arg5743Trp) rs377193479
NM_001267550.2(TTN):c.17888A>G (p.Glu5963Gly) rs146983095
NM_001267550.2(TTN):c.178G>T (p.Asp60Tyr) rs35683768
NM_001267550.2(TTN):c.18390A>T (p.Thr6130=) rs66523653
NM_001267550.2(TTN):c.18776C>G (p.Thr6259Ser) rs72648949
NM_001267550.2(TTN):c.18816T>C (p.Ile6272=) rs146219199
NM_001267550.2(TTN):c.18824A>G (p.Asn6275Ser) rs184412722
NM_001267550.2(TTN):c.18903C>T (p.Thr6301=) rs72648950
NM_001267550.2(TTN):c.19004A>G (p.Asp6335Gly) rs72648951
NM_001267550.2(TTN):c.19204A>G (p.Met6402Val) rs72648954
NM_001267550.2(TTN):c.19301G>A (p.Ser6434Asn) rs11888217
NM_001267550.2(TTN):c.19383T>C (p.Asn6461=) rs76771282
NM_001267550.2(TTN):c.19976C>T (p.Thr6659Met) rs16866475
NM_001267550.2(TTN):c.20175A>G (p.Ile6725Met) rs146627500
NM_001267550.2(TTN):c.20341G>A (p.Glu6781Lys) rs72648958
NM_001267550.2(TTN):c.20355G>A (p.Ser6785=) rs549470227
NM_001267550.2(TTN):c.204C>T (p.Pro68=) rs201089861
NM_001267550.2(TTN):c.20743G>T (p.Ala6915Ser) rs201728165
NM_001267550.2(TTN):c.20861C>T (p.Ala6954Val) rs17355446
NM_001267550.2(TTN):c.21044C>T (p.Ala7015Val) rs72648960
NM_001267550.2(TTN):c.21106G>A (p.Asp7036Asn) rs72648962
NM_001267550.2(TTN):c.21173G>A (p.Gly7058Asp) rs72648964
NM_001267550.2(TTN):c.21779C>A (p.Ser7260Tyr) rs187925021
NM_001267550.2(TTN):c.22074A>G (p.Lys7358=) rs34562585
NM_001267550.2(TTN):c.22077A>T (p.Gly7359=) rs202102237
NM_001267550.2(TTN):c.22080T>C (p.Asp7360=) rs16866473
NM_001267550.2(TTN):c.22384G>C (p.Asp7462His) rs12693166
NM_001267550.2(TTN):c.2244G>A (p.Glu748=) rs6715406
NM_001267550.2(TTN):c.22611T>C (p.His7537=) rs16866469
NM_001267550.2(TTN):c.22634G>A (p.Arg7545Gln) rs72648969
NM_001267550.2(TTN):c.22786G>C (p.Asp7596His) rs72648970
NM_001267550.2(TTN):c.23001G>A (p.Thr7667=) rs16866467
NM_001267550.2(TTN):c.23099-3T>C rs2562830
NM_001267550.2(TTN):c.23223G>A (p.Gln7741=) rs2562831
NM_001267550.2(TTN):c.23538C>G (p.Phe7846Leu) rs149523263
NM_001267550.2(TTN):c.2432C>T (p.Thr811Ile) rs35813871
NM_001267550.2(TTN):c.24431A>C (p.Glu8144Ala) rs16866465
NM_001267550.2(TTN):c.24516C>T (p.Thr8172=) rs72648978
NM_001267550.2(TTN):c.24652A>G (p.Ser8218Gly) rs72648980
NM_001267550.2(TTN):c.24880A>G (p.Arg8294Gly) rs72648982
NM_001267550.2(TTN):c.24909G>A (p.Lys8303=) rs72648983
NM_001267550.2(TTN):c.24952G>A (p.Val8318Ile) rs200103997
NM_001267550.2(TTN):c.25064C>A (p.Ala8355Glu) rs2627043
NM_001267550.2(TTN):c.25087G>T (p.Ala8363Ser) rs200972189
NM_001267550.2(TTN):c.25274G>A (p.Ser8425Asn) rs13390491
NM_001267550.2(TTN):c.25398T>A (p.Asp8466Glu) rs72648986
NM_001267550.2(TTN):c.25490G>A (p.Arg8497His) rs149855485
NM_001267550.2(TTN):c.25626G>T (p.Gln8542His) rs2562832
NM_001267550.2(TTN):c.25707T>C (p.Tyr8569=) rs2742329
NM_001267550.2(TTN):c.25921+10C>T rs10183237
NM_001267550.2(TTN):c.25936C>T (p.Arg8646Cys) rs72648987
NM_001267550.2(TTN):c.25978G>A (p.Val8660Ile) rs141856116
NM_001267550.2(TTN):c.26091A>T (p.Leu8697=) rs2562836
NM_001267550.2(TTN):c.26245G>A (p.Val8749Ile) rs16866457
NM_001267550.2(TTN):c.26289A>G (p.Glu8763=) rs2562838
NM_001267550.2(TTN):c.26408A>G (p.Asn8803Ser) rs12693164
NM_001267550.2(TTN):c.26494A>G (p.Ile8832Val) rs72648989
NM_001267550.2(TTN):c.26655C>T (p.Ser8885=) rs2562839
NM_001267550.2(TTN):c.26681C>T (p.Pro8894Leu) rs13398235
NM_001267550.2(TTN):c.26762-10_26762-9insTTGTTTTGTA rs1553893826
NM_001267550.2(TTN):c.26762-39TTTGT[7] rs71393436
NM_001267550.2(TTN):c.26863A>G (p.Ile8955Val) rs72648994
NM_001267550.2(TTN):c.26991A>G (p.Thr8997=) rs61232800
NM_001267550.2(TTN):c.2781A>C (p.Thr927=) rs55892860
NM_001267550.2(TTN):c.27914G>A (p.Arg9305Gln) rs397517527
NM_001267550.2(TTN):c.28313G>A (p.Arg9438Gln) rs72648998
NM_001267550.2(TTN):c.28662G>A (p.Arg9554=) rs2742332
NM_001267550.2(TTN):c.29079G>A (p.Ala9693=) rs372997298
NM_001267550.2(TTN):c.29153T>C (p.Ile9718Thr) rs4893852
NM_001267550.2(TTN):c.29178C>A (p.Ile9726=) rs72650003
NM_001267550.2(TTN):c.29245C>T (p.Gln9749Ter) rs746721983
NM_001267550.2(TTN):c.29397C>T (p.Gly9799=) rs770084292
NM_001267550.2(TTN):c.2949C>T (p.Ile983=) rs56310516
NM_001267550.2(TTN):c.29763T>C (p.Ile9921=) rs2742343
NM_001267550.2(TTN):c.29799G>A (p.Ser9933=) rs2742344
NM_001267550.2(TTN):c.29812A>T (p.Thr9938Ser) rs72650006
NM_001267550.2(TTN):c.30274C>T (p.His10092Tyr) rs72650011
NM_001267550.2(TTN):c.30718G>T (p.Val10240Phe) rs111671438
NM_001267550.2(TTN):c.3087T>C (p.Tyr1029=) rs55863869
NM_001267550.2(TTN):c.30952G>A (p.Glu10318Lys) rs73038324
NM_001267550.2(TTN):c.3100G>A (p.Val1034Met) rs142951505
NM_001267550.2(TTN):c.31071C>T (p.His10357=) rs368973334
NM_001267550.2(TTN):c.31564A>G (p.Ile10522Val) rs2042995
NM_001267550.2(TTN):c.31806C>T (p.Pro10602=) rs370080995
NM_001267550.2(TTN):c.31864G>A (p.Gly10622Arg) rs2244492
NM_001267550.2(TTN):c.32254G>A (p.Val10752Ile) rs72650028
NM_001267550.2(TTN):c.32350C>G (p.Leu10784Val) rs72650029
NM_001267550.2(TTN):c.3241G>A (p.Ala1081Thr) rs55914517
NM_001267550.2(TTN):c.32624C>T (p.Pro10875Leu) rs72650031
NM_001267550.2(TTN):c.32648G>A (p.Arg10883Lys) rs116676813
NM_001267550.2(TTN):c.32743G>C (p.Ala10915Pro) rs72650032
NM_001267550.2(TTN):c.33063A>G (p.Glu11021=) rs115744476
NM_001267550.2(TTN):c.33287G>A (p.Arg11096His) rs36051007
NM_001267550.2(TTN):c.33501_33503AGA[6] (p.Glu11172dup) rs368327166
NM_001267550.2(TTN):c.33834G>A (p.Glu11278=) rs35112591
NM_001267550.2(TTN):c.34129_34149GTTCTACCTGAAGAAGAGGAA[1] (p.11363_11369VLPEEEE[3]) rs587780487
NM_001267550.2(TTN):c.34566A>C (p.Glu11522Asp) rs140640738
NM_001267550.2(TTN):c.34864G>A (p.Val11622Ile) rs202014478
NM_001267550.2(TTN):c.34970G>A (p.Arg11657His) rs59887778
NM_001267550.2(TTN):c.3601A>G (p.Lys1201Glu) rs10497520
NM_001267550.2(TTN):c.3668C>T (p.Ala1223Val) rs78269740
NM_001267550.2(TTN):c.3759A>G (p.Arg1253=) rs2291308
NM_001267550.2(TTN):c.3884C>T (p.Ser1295Leu) rs1552280
NM_001267550.2(TTN):c.39082G>A (p.Val13028Met) rs73038314
NM_001267550.2(TTN):c.39183T>A (p.Pro13061=) rs12474306
NM_001267550.2(TTN):c.39704C>G (p.Pro13235Arg) rs72650066
NM_001267550.2(TTN):c.39731_39748TTGCTCCTGAAGAGGAAA[1] (p.13244_13249IAPEEE[1]) rs139512154
NM_001267550.2(TTN):c.3993C>T (p.Ile1331=) rs55757622
NM_001267550.2(TTN):c.40558G>C (p.Val13520Leu) rs587780488
NM_001267550.2(TTN):c.40576_40578GAA[3] (p.Glu13529del) rs727504199
NM_001267550.2(TTN):c.41103C>T (p.Gly13701=) rs72650077
NM_001267550.2(TTN):c.41508T>C (p.Ala13836=) rs55847232
NM_001267550.2(TTN):c.4177A>G (p.Ile1393Val) rs16866531
NM_001267550.2(TTN):c.42071A>G (p.His14024Arg) rs2288563
NM_001267550.2(TTN):c.4246C>T (p.Arg1416Cys) rs72647875
NM_001267550.2(TTN):c.4261C>T (p.Arg1421Trp) rs144672482
NM_001267550.2(TTN):c.42783A>G (p.Lys14261=) rs16866425
NM_001267550.2(TTN):c.42958A>G (p.Lys14320Glu) rs6723526
NM_001267550.2(TTN):c.4322G>C (p.Arg1441Pro) rs72647876
NM_001267550.2(TTN):c.4328T>C (p.Leu1443Pro) rs142317580
NM_001267550.2(TTN):c.4347A>G (p.Ser1449=) rs719202
NM_001267550.2(TTN):c.43488G>A (p.Arg14496=) rs56034831
NM_001267550.2(TTN):c.43596T>C (p.Asn14532=) rs16866423
NM_001267550.2(TTN):c.43603C>T (p.Arg14535Cys) rs12471771
NM_001267550.2(TTN):c.4480+6C>T rs719201
NM_001267550.2(TTN):c.45206A>T (p.Glu15069Val) rs114331773
NM_001267550.2(TTN):c.45408G>T (p.Lys15136Asn) rs72677225
NM_001267550.2(TTN):c.45526C>T (p.Leu15176=) rs61004744
NM_001267550.2(TTN):c.45738T>C (p.Ala15246=) rs2303829
NM_001267550.2(TTN):c.4715G>A (p.Arg1572Gln) rs12476289
NM_001267550.2(TTN):c.47191C>T (p.Arg15731Cys) rs72677231
NM_001267550.2(TTN):c.47400G>A (p.Lys15800=) rs114145817
NM_001267550.2(TTN):c.47545C>A (p.Pro15849Thr) rs146181477
NM_001267550.2(TTN):c.47955A>G (p.Pro15985=) rs192953152
NM_001267550.2(TTN):c.48953T>C (p.Ile16318Thr) rs72677243
NM_001267550.2(TTN):c.48996G>A (p.Glu16332=) rs72677244
NM_001267550.2(TTN):c.49731T>C (p.His16577=) rs2115558
NM_001267550.2(TTN):c.49919G>C (p.Ser16640Thr) rs55663050
NM_001267550.2(TTN):c.49944G>A (p.Lys16648=) rs190021597
NM_001267550.2(TTN):c.49985A>C (p.Asn16662Thr) rs36043230
NM_001267550.2(TTN):c.50390G>A (p.Arg16797His) rs200835354
NM_001267550.2(TTN):c.51482C>T (p.Ala17161Val) rs16866412
NM_001267550.2(TTN):c.51684G>A (p.Ala17228=) rs2288566
NM_001267550.2(TTN):c.51887G>A (p.Arg17296His) rs200456782
NM_001267550.2(TTN):c.52821T>C (p.Asp17607=) rs2303831
NM_001267550.2(TTN):c.52852C>T (p.Arg17618Cys) rs201213901
NM_001267550.2(TTN):c.52917T>C (p.Asp17639=) rs73036398
NM_001267550.2(TTN):c.53123A>T (p.Lys17708Ile) rs2303832
NM_001267550.2(TTN):c.53192T>C (p.Ile17731Thr) rs72646809
NM_001267550.2(TTN):c.542G>A (p.Ser181Asn) rs72647843
NM_001267550.2(TTN):c.55029G>A (p.Arg18343=) rs62178963
NM_001267550.2(TTN):c.55553A>G (p.Lys18518Arg) rs72646823
NM_001267550.2(TTN):c.55929A>G (p.Gln18643=) rs151335428
NM_001267550.2(TTN):c.55932T>C (p.Phe18644=) rs755839294
NM_001267550.2(TTN):c.56101A>G (p.Asn18701Asp) rs1001238
NM_001267550.2(TTN):c.56529G>A (p.Thr18843=) rs72646827
NM_001267550.2(TTN):c.56535G>A (p.Thr18845=) rs529480368
NM_001267550.2(TTN):c.56963-3C>T rs375979145
NM_001267550.2(TTN):c.5697C>T (p.Ile1899=) rs148434577
NM_001267550.2(TTN):c.57073G>A (p.Val19025Ile) rs181957743