ClinVar Miner

Variants from GeneReviews with conflicting interpretations

Location: United States — Primary collection method: curation
Minimum review status of the submission from GeneReviews: Collection method of the submission from GeneReviews:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
2519 1213 1503 714 86 98 376 2353

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
GeneReviews pathogenic likely pathogenic uncertain significance likely benign benign affects association drug response protective risk factor other
pathogenic 1462 552 286 79 57 1 1 12 3 37 28
likely pathogenic 11 0 6 3 3 0 0 0 0 0 0
uncertain significance 19 2 14 38 24 1 0 0 0 4 0
likely benign 0 0 0 1 0 0 0 0 0 0 0
benign 9 2 35 153 26 0 2 1 0 5 8
association 3 3 0 0 1 0 0 0 0 0 0
protective 0 0 0 1 1 0 0 0 0 1 0
other 1 0 0 0 0 0 0 0 0 0 0

Submitter to submitter summary #

Total submitters: 209
Download table as spreadsheet
Submitter Variants with only 1 submission Variants with at least 2 submissions and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any kind of conflict
OMIM 0 982 1224 11 4 73 41 1339
Invitae 0 301 288 71 22 7 115 502
GeneDx 0 437 298 104 8 2 65 475
EGL Genetic Diagnostics,Eurofins Clinical Diagnostics 0 233 225 24 11 14 81 353
Counsyl 0 136 153 173 0 1 24 350
Illumina Clinical Services Laboratory,Illumina 0 126 99 115 33 2 93 334
Integrated Genetics/Laboratory Corporation of America 0 177 132 10 0 0 19 160
Genetic Services Laboratory, University of Chicago 0 77 76 45 9 2 19 149
Laboratory for Molecular Medicine,Partners HealthCare Personalized Medicine 0 108 81 19 3 5 39 146
Fulgent Genetics 0 113 115 21 0 0 8 144
Ambry Genetics 0 105 80 30 4 0 23 137
Athena Diagnostics Inc 0 79 85 8 14 0 12 118
ARUP Laboratories, Molecular Genetics and Genomics,ARUP Laboratories 0 89 46 10 3 1 28 87
PreventionGenetics 0 126 30 12 5 2 29 76
Center for Pediatric Genomic Medicine,Children's Mercy Hospital and Clinics 0 51 30 9 3 0 21 63
Centre for Mendelian Genomics,University Medical Centre Ljubljana 0 13 24 13 0 1 7 45
CeGaT Praxis fuer Humangenetik Tuebingen 0 3 2 23 3 0 15 43
Baylor Miraca Genetics Laboratories, 0 28 29 0 0 0 10 39
Mayo Clinic Genetic Testing Laboratories,Mayo Clinic 0 22 24 6 2 0 8 39
Database of Curated Mutations (DoCM) 0 1 10 30 0 0 0 33
Division of Genomic Diagnostics,The Children's Hospital of Philadelphia 0 17 18 0 3 0 10 30
GeneReviews 6027 33 21 1 0 0 3 25
Genomic Research Center,Shahid Beheshti University of Medical Sciences 0 11 11 7 0 0 7 25
Diagnostic Laboratory, Department of Genetics,University Medical Center Groningen 0 37 14 2 2 1 6 25
Clinical Molecular Genetics Laboratory,Johns Hopkins All Children's Hospital 0 6 18 1 1 0 3 22
Soonchunhyang University Bucheon Hospital,Soonchunhyang University Medical Center 0 1 4 13 0 0 5 22
Division of Human Genetics,Children's Hospital of Philadelphia 0 13 15 4 0 0 2 20
SIB Swiss Institute of Bioinformatics 0 11 4 12 1 0 3 20
Color 0 28 5 5 0 0 8 18
Quest Diagnostics Nichols Institute San Juan Capistrano 0 43 9 2 0 0 6 17
Knight Diagnostic Laboratories,Oregon Health and Sciences University 0 19 15 2 0 0 1 17
Courtagen Diagnostics Laboratory,Courtagen Life Sciences 0 3 13 0 0 0 0 13
Equipe Genetique des Anomalies du Developpement,Université de Bourgogne 0 6 8 4 0 0 1 13
DNA and Cytogenetics Diagnostics Unit,Erasmus Medical Center 0 20 10 1 0 0 2 13
Genome Diagnostics Laboratory,University Medical Center Utrecht 0 8 7 2 0 0 3 12
Institute of Human Genetics,Klinikum rechts der Isar 0 20 11 1 0 0 0 12
PharmGKB 0 0 0 0 0 12 0 12
Center for Genomics, Ann and Robert H. Lurie Children's Hospital of Chicago 0 8 5 3 2 0 2 12
Biesecker Lab/Human Development Section,National Institutes of Health 0 4 4 0 1 0 6 11
Juha Muilu Group; Institute for Molecular Medicine Finland (FIMM) 0 2 2 9 0 0 0 11
UCLA Clinical Genomics Center, UCLA 0 2 6 5 0 0 0 11
CSER_CC_NCGL; University of Washington Medical Center 0 3 1 1 1 0 8 11
ARUP Institute,ARUP Laboratories 0 15 11 0 0 0 0 11
Mendelics 0 15 4 2 0 0 4 10
Human Genome Sequencing Center Clinical Lab,Baylor College of Medicine 0 5 4 5 0 1 0 10
NIHR Bioresource Rare Diseases,University of Cambridge 0 1 5 5 0 0 0 10
Center for Human Genetics, Inc 0 5 6 0 0 0 3 9
GeneKor MSA 0 5 4 2 0 1 2 9
Department of Pathology and Laboratory Medicine,Sinai Health System 0 7 5 0 0 0 4 9
Wong Mito Lab, Molecular and Human Genetics,Baylor College of Medicine 0 7 6 1 1 0 1 9
SingHealth Duke-NUS Institute of Precision Medicine 0 1 4 3 0 0 2 9
German Consortium for Hereditary Breast and Ovarian Cancer Center Cologne,University Hospital Cologne 0 1 6 3 0 0 0 9
Genetic Testing Center for Deafness, Department of Otolaryngology Head & Neck Surgery,Institute of Otolaryngology, Chinese PLA General Hospital 0 0 4 5 0 0 0 9
Molecular Diagnostics Lab,Nemours Alfred I. duPont Hospital for Children 0 5 3 4 0 0 1 8
Department of Ophthalmology and Visual Sciences Kyoto University 0 0 1 4 0 0 3 8
Foundation for Research in Genetics and Endocrinology,Institute of Human Genetics 0 2 4 4 0 0 1 8
Undiagnosed Diseases Network,NIH 0 2 7 0 0 0 1 8
Clinical Biochemistry Laboratory,Health Services Laboratory 0 13 2 0 4 0 1 7
Pathway Genomics 0 5 5 0 0 0 2 7
Genome Diagnostics Laboratory,VU University Medical Center Amsterdam 0 16 3 4 0 0 0 7
Department of Genetics,Sultan Qaboos University Hospital, Oman 0 9 3 2 0 0 2 7
Gharavi Laboratory,Columbia University 0 3 4 0 1 0 2 7
Sharing Clinical Reports Project (SCRP) 0 0 4 1 0 0 1 6
Blueprint Genetics, 0 5 3 3 0 0 0 6
Department of Medical Genetics,Oslo University Hospital 0 0 5 1 0 0 0 6
Bioscientia Institut fuer Medizinische Diagnostik GmbH,Sonic Healthcare 0 5 6 0 0 0 0 6
Research Molecular Genetics Laboratory,Women's College Hospital, University of Toronto 0 0 4 1 0 0 1 6
True Health Diagnostics 0 2 2 0 0 1 3 6
CHEO Genetics Diagnostic Laboratory,Children's Hospital of Eastern Ontario 0 4 3 0 0 0 2 5
Wellcome Centre for Mitochondrial Research,Newcastle University 0 10 5 0 0 0 0 5
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) 0 0 4 0 0 0 1 5
Stanford Center for Inherited Cardiovascular Disease,Stanford University 0 1 2 2 0 0 1 5
Center of Genomic medicine, Geneva,University Hospital of Geneva 0 5 4 0 0 0 1 5
NeuroMeGen,Hospital Clinico Santiago de Compostela 0 8 0 5 0 0 0 5
Human Genetics - Radboudumc,Radboudumc 0 0 4 1 0 0 0 5
Yale Center for Mendelian Genomics,Yale University 0 1 0 5 0 0 0 5
ClinGen RASopathy Variant Curation Expert Panel, 0 7 5 0 0 0 0 5
Broad Institute Rare Disease Group,Broad Institute 0 6 5 0 0 0 0 5
Molecular Diagnostics Laboratory,M Health: University of Minnesota 0 0 4 1 0 0 0 5
Department of Rehabilitation Medicine, Incheon St. Mary’s Hospital,College of Medicine, The Catholic University of Korea 0 0 5 0 0 0 0 5
Greenwood Genetic Center Diagnostic Laboratories,Greenwood Genetic Center 0 0 4 0 0 0 0 4
Michigan Medical Genetics Laboratories,University of Michigan 0 0 3 0 0 0 1 4
Foulkes Cancer Genetics LDI,Lady Davis Institute for Medical Research 0 0 2 0 0 0 2 4
ClinVar Staff, National Center for Biotechnology Information (NCBI) 0 3 0 2 0 0 2 4
Breast Cancer Information Core (BIC) (BRCA1) 0 0 2 0 0 0 2 4
Lupski Lab, Baylor-Hopkins CMG,Baylor College of Medicine 0 11 0 4 0 0 0 4
Laboratory of Molecular Genetics (Pr. Bezieau's lab),CHU de Nantes 0 4 3 0 0 0 1 4
Institute for Biomarker Research,Medical Diagnostic Laboratories, L.L.C. 0 1 3 0 0 0 1 4
Cardiovascular Research Group,Instituto Nacional de Saude Doutor Ricardo Jorge 0 1 0 2 0 0 2 4
Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA), c/o University of Cambridge 0 0 4 0 0 0 0 4
Bioinformatics Core,Luxembourg Center for Systems Biomedicine 0 4 0 0 0 0 4 4
ClinGen Hearing Loss Variant Curation Expert Panel, 0 1 4 0 0 0 0 4
Developmental Genetics Unit,King Faisal Specialist Hospital & Research Centre 0 0 0 3 0 0 0 3
Breast Cancer Information Core (BIC) (BRCA2) 0 0 2 0 0 0 1 3
Center for Genetic Medicine Research,Children's National Medical Center 0 0 0 2 0 0 1 3
Genomics and Pathology Services,Washington University in St.Louis 0 0 3 0 0 0 0 3
University of Washington Center for Mendelian Genomics,University of Washington 0 1 0 3 0 0 0 3
HudsonAlpha Institute for Biotechnology 0 15 2 1 0 0 0 3
Institute for Ophthalmic Research,University Tuebingen 0 2 2 0 0 0 1 3
UW Hindbrain Malformation Research Program,University of Washington 0 2 3 0 0 0 0 3
Bioinformatics dept.,Datar Cancer Genetics Limited, India 0 0 3 0 0 0 0 3
Institute of Molecular Biology and Genetics,Federal Almazov North-West Medical Research Centre 0 0 3 0 0 0 0 3
Neurogenetics Laboratory - MEYER,AOU Meyer 0 4 1 2 0 0 0 3
Geisinger Autism and Developmental Medicine Institute,Geisinger Health System 0 1 3 0 0 0 0 3
University of Washington Department of Laboratory Medicine,University of Washington 0 3 1 1 0 1 0 3
Claritas Genomics 0 1 2 0 0 0 0 2
Institute of Medical Genetics and Genomics,Sir Ganga Ram Hospital 0 2 2 0 0 0 0 2
Institute of Human Genetics,Cologne University 0 2 1 0 0 0 1 2
Molecular Genetics Laboratory,BC Children's and BC Women's Hospitals 0 4 2 0 0 0 0 2
Division Human Genetics,Medical University Innsbruck 0 0 1 1 0 0 0 2
RettBASE 0 0 1 1 0 0 0 2
Genologica Medica 0 0 2 0 0 0 0 2
Programa de Pós-Graduação em Ciências Genômicas e Biotecnologia,Universidade Católica de Brasília 0 0 2 0 0 0 0 2
Dobyns Lab,Seattle Children's Research Institute 0 1 2 0 0 0 0 2
Genome Sciences Centre,British Columbia Cancer Agency 0 0 1 1 0 0 0 2
Diagnostics Division,Centre for DNA Fingerprinting and Diagnostics 0 0 0 2 0 0 0 2
Laboratory of Molecular Genetics,CHU RENNES 0 0 0 2 0 0 0 2
Donald Williams Parsons Laboratory,Baylor College of Medicine 0 3 2 0 0 0 0 2
GenePathDx,Causeway Health Care Private Ltd 0 0 1 0 0 0 1 2
Robarts Research Institute,Western University 0 1 0 2 0 0 0 2
A.C.Camargo Cancer Center / LGBM, A.C.Camargo Cancer Center 0 0 2 0 0 0 0 2
ClinGen Inherited Cardiomyopathy Variant Curation Expert Panel, 0 3 0 2 0 0 0 2
TIDEX,University of British Columbia 0 2 1 1 0 0 0 2
Fundacion Hipercolesterolemia Familiar 0 1 0 0 0 0 2 2
Cancer Genetics and Genomics Laboratory,British Columbia Cancer Agency 0 0 1 0 0 0 1 2
Department of Pathology and Molecular Medicine,Queen's University 0 0 1 0 0 0 1 2
Section on Medical Neuroendocrinolgy,National Institutes of Health 0 0 2 0 0 0 0 2
Division of Hearing and Balance Research,National Hospital Organization Tokyo Medical Center 0 0 2 0 0 0 0 2
Tartaglia Lab, Genetics and Rare Diseases Research Division,Bambino Gesu' Children's Hospital 0 0 0 2 0 0 0 2
Biochemical Molecular Genetic Laboratory,King Abdulaziz Medical City 0 3 2 0 0 0 0 2
Medical Genetics Summaries 0 0 0 0 0 2 0 2
Department of Respiratory and Critical Care Medicine, Tongji Hospital,Tongji Medical College, Huazhong University of Science and Technology 0 0 2 0 0 0 0 2
Johns Hopkins Genomics,Johns Hopkins University 0 1 0 1 0 0 1 2
Unidad de Genómica Médica UC, Pontificia Universidad Católica de Chile 0 3 2 0 0 0 0 2
Molecular Otolaryngology and Renal Research Laboratories,University of Iowa Hospital and Clinics 0 0 1 0 0 0 1 1
Institute of Human Genetics,University of Goettingen 0 0 0 0 0 0 1 1
Molecular Genetics Laboratory,Children's Mercy Hospital and Clinics 0 0 1 0 0 0 0 1
FirmaLab 0 1 1 0 0 0 0 1
Molecular Vision Laboratory 0 0 0 0 0 1 0 1
Sema4,Sema4 0 0 1 0 0 0 0 1
Victorian Clinical Genetics Services,Murdoch Childrens Research Institute 0 2 1 0 0 0 0 1
Guangxi Key laboratory of Metabolic Diseases Research; Guilin 181st Hospital 0 0 0 1 0 0 0 1
Systems Biology Platform Zhejiang California International NanoSystems Institute 0 0 0 0 0 1 0 1
Unidad de Diagnostico y Tratamiento de Errores Congenitos del Metabolismo. Hospital Clínico Universitário de Santiago de Compostela 0 0 1 0 0 0 0 1
ITMI 0 11 1 0 0 0 0 1
Northcott Neuroscience Laboratory, ANZAC Research Institute 0 0 0 0 0 0 1 1
Center for Medical Genetics Ghent,University of Ghent 0 1 0 1 0 0 0 1
Centre for Translational Omics - GOSgene,University College London 0 2 1 0 0 0 0 1
Institute for Integrative and Experimental Genomics,University of Luebeck 0 0 0 1 0 0 0 1
Section on Endocrinology and Genetics,National Institutes of Health / The Eunice Kennedy Shriver National Institute of Child Health and Human Development 0 0 0 1 0 0 0 1
Department of Neurology, University Hospital of Strasbourg 0 1 0 0 0 0 1 1
Curoverse 0 0 1 0 0 0 0 1
Hadassah Hebrew University Medical Center 0 0 0 1 0 0 0 1
Laboratory of Genetics and Molecular Cardiology,University of São Paulo 0 1 0 0 0 0 1 1
Dept of Medicine and Surgery, University of Milano-Bicocca 0 0 1 0 0 0 0 1
Undiagnosed Diseases Program Translational Research Laboratory,National Institutes of Health 0 0 1 0 0 0 0 1
Laboratory of Metabolic Disorders,Peking University First Hospital 0 0 1 0 0 0 0 1
Laboratorio de Medicina Genomica, Hospital General de Culiacan 0 0 1 0 0 0 0 1
Centro de Genética y Biología Molecular,Universidad de San Martín de Porres 0 0 1 0 0 0 0 1
Centre for Genomic and Experimental Medicine,University of Edinburgh 0 1 0 1 0 0 0 1
Centre for Genomic Medicine, Manchester,Central Manchester University Hospitals 0 0 1 0 0 0 0 1
Aziz Sancar Institute of Experimental Medicine,Istanbul University 0 1 1 0 0 1 0 1
Department of Medical Genetics,University of Szeged 0 0 1 0 0 0 0 1
Next Generation Diagnostics,Novartis Institutes for BioMedical Research, Inc. 0 0 0 0 0 0 1 1
Laboratory of Prof. Karen Avraham,Tel Aviv University 0 0 1 0 0 0 0 1
Institute for Genomic Medicine, Columbia University,Columbia University Medical Center 0 0 1 0 0 0 0 1
Baylor-Hopkins Center for Mendelian Genomics,Johns Hopkins University 0 6 0 1 0 0 0 1
Institut Pasteur du Maroc 0 1 1 0 0 0 0 1
Hereditary Research Laboratory,Bethlehem University 0 0 1 0 0 0 0 1
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease,Montreal Heart Institute 0 1 1 0 0 0 0 1
International Peace Maternity and Child Health Hospital, Shanghai Jiao Tong University School of Medicine 0 0 1 0 0 0 0 1
Center for Statistical Genetics,Baylor College of Medicine 0 0 1 0 0 0 0 1
Reutter Lab, Institute of Human Genetics,University Hospital Bonn 0 0 0 0 0 0 1 1
Department of Medical Genetics,University Hospital of North Norway 0 0 0 1 0 0 0 1
Weber Lab,Hannover Medical School 0 0 1 0 0 0 0 1
Center for Human Genetics and Laboratory Diagnostics, Dr. Klein, Dr. Rost and Colleagues 0 1 1 0 0 0 0 1
Neurology Department,Peking University First Hospital 0 0 1 0 0 0 0 1
Kasturba Medical College,Manipal University 0 0 0 0 1 0 0 1
Centre de Génétique Moléculaire et Chromosomique, Unité de génétique de l'Obésité et des Dyslipidémies,APHP, GH Hôpitaux Universitaires Pitié-Salpêtrière / Charles-Foix 0 1 0 0 0 0 1 1
Biochimie-Hormonologie,Robert Debre Hospital 0 0 1 0 0 0 0 1
Center for Medical Genetics and Molecular Medicine,Haukeland University Hospital 0 0 0 0 0 0 1 1
Unit for Genetic & Epidemiological Research on Neurological Disorders,Instituto de Investigação e Inovação em Saúde 0 0 1 0 0 0 0 1
Embryology Laboratory,Victor Chang Cardiac Research Institute 0 0 1 0 0 0 0 1
Endocrine oncology group,Uppsala University 0 0 0 1 0 0 0 1
RBHT Clinical Genetics and Genomics Laboratory,Royal Brompton and Harefield NHS Foundation Trust 0 0 0 1 0 0 0 1
Department of Laboratory Medicine and Genetics,Trillium Health Partners Credit Valley Hospital 0 10 0 1 0 0 0 1
CHLA Center for Personalized Medicine,Children's Hospital, Los Angeles 0 2 1 0 0 0 0 1
Rare Disease Group, Clinical Genetics,Karolinska Institutet 0 0 0 0 0 0 1 1
Snyder Lab, Genetics Department,Stanford University 0 0 0 0 0 1 0 1
Institute of Cellular and Molecular Medicine,Copenhagen University 0 0 0 1 0 0 0 1
Department of Immunology,University Hospital Southampton NHSFT 0 0 1 0 0 0 0 1
Centre for Arab Genomic Studies,Sheikh Hamdan Award for Medical Sciences 0 0 1 0 0 0 0 1
Dan Cohn Lab,University Of California Los Angeles 0 0 1 0 0 0 0 1
Translational Research Program on Neuronal Ceroid Lipofuscinosis,Center for the Study of Inborn Errors of Metabolism 0 0 1 0 0 0 0 1
Degerman lab,Umeå University 0 0 1 0 0 0 0 1
Dept. of Medical Genetics, Telemark Hospital Trust 0 0 1 0 0 0 0 1
ClinGen PAH Variant Curation Expert Panel, 0 6 0 1 0 0 0 1
Laboratoire de Cytogenetique,Hospices Civils de Lyon 0 1 0 1 0 0 0 1
3DMed Clinical Laboratory Inc 0 0 1 0 0 0 0 1
Cancer Diagnostics Division,Gene Solutions 0 0 0 1 0 0 0 1
UNC Molecular Genetics Laboratory,University of North Carolina at Chapel Hill 0 0 0 1 0 0 0 1
Clinical Genomics Lab,St. Jude Children's Research Hospital 0 3 0 1 0 0 0 1
Cole/Wambach Lab,Washington University in St. Louis 0 0 1 0 0 0 0 1
Institute for Genomic Medicine (IGM) Clinical Laboratory,Nationwide Children's Hospital 0 0 0 0 0 0 1 1
Molecular Pathology Diagnostics Labratory,University of Iowa Hospitals & Clinics 0 0 0 1 0 0 0 1
Genetic Diseases Diagnostic Center,Koc University Hospital 0 0 0 1 0 0 0 1
Wessex Regional Genetics Laboratory,Salisbury District Hospital 0 4 0 1 0 0 0 1
Biochemistry Laboratory of CDMU,Chengde Medical University 0 0 1 0 0 0 0 1
Biesecker Lab Rare Disease,National Institutes of Health 0 0 1 0 0 0 0 1

All variants with conflicting interpretations #

Total variants: 2353
Download table as spreadsheet
HGVS dbSNP
NC_000008.11:g.(?_6406592)_(6439097_6442066)del
NC_000015.9:g.68504037_68504039delGAT rs121908080
NC_000017.11:g.3600934_3658165del57232
NC_012920.1:m.11778G>A rs199476112
NC_012920.1:m.14484T>C rs199476104
NC_012920.1:m.1555A>G rs267606617
NC_012920.1:m.3460G>A rs199476118
NG_011506.1:g.15883_17827del1945insTG
NG_011801.1:g.72149_72150delTT rs1169875761
NM_000017.3(ACADS):c.511C>T (p.Arg171Trp) rs1800556
NM_000017.3(ACADS):c.625G>A (p.Gly209Ser) rs1799958
NM_000018.3(ACADVL):c.1284G>A (p.Lys428=) rs35501596
NM_000018.3(ACADVL):c.128G>A (p.Gly43Asp) rs2230178
NM_000018.3(ACADVL):c.1322G>A (p.Gly441Asp) rs2309689
NM_000018.3(ACADVL):c.1600G>A (p.Glu534Lys) rs2230180
NM_000018.3(ACADVL):c.1679-6G>A rs113994171
NM_000018.3(ACADVL):c.194C>T (p.Pro65Leu) rs28934585
NM_000018.3(ACADVL):c.49C>T (p.Leu17Phe) rs2230179
NM_000018.3(ACADVL):c.68G>A (p.Arg23Gln) rs34153370
NM_000018.3(ACADVL):c.779C>T (p.Thr260Met) rs113994168
NM_000018.3(ACADVL):c.848T>C (p.Val283Ala) rs113994167
NM_000018.4(ACADVL):c.1038G>A (p.Ala346=) rs8064573
NM_000018.4(ACADVL):c.1226C>T (p.Thr409Met) rs113994169
NM_000018.4(ACADVL):c.1405C>T (p.Arg469Trp) rs113994170
NM_000021.3(PSEN1):c.1292C>A (p.Ala431Glu) rs63750083
NM_000021.3(PSEN1):c.236C>T (p.Ala79Val) rs63749824
NM_000021.3(PSEN1):c.338T>C (p.Leu113Pro) rs63751399
NM_000021.3(PSEN1):c.415A>G (p.Met139Val) rs63751037
NM_000021.3(PSEN1):c.436A>C (p.Met146Leu) rs63750306
NM_000021.3(PSEN1):c.509C>T (p.Ser170Phe) rs63750577
NM_000021.3(PSEN1):c.548G>T (p.Gly183Val) rs63751068
NM_000021.3(PSEN1):c.697A>G (p.Met233Val) rs63751287
NM_000021.3(PSEN1):c.806G>A (p.Arg269His) rs63750900
NM_000021.3(PSEN1):c.839A>C (p.Glu280Ala) rs63750231
NM_000030.2(AGXT):c.1020A>G (p.Ile340Met) rs4426527
NM_000030.2(AGXT):c.121G>A (p.Gly41Arg) rs121908523
NM_000030.2(AGXT):c.245G>A (p.Gly82Glu) rs121908522
NM_000030.2(AGXT):c.32C>T (p.Pro11Leu) rs34116584
NM_000030.2(AGXT):c.508G>A (p.Gly170Arg) rs121908529
NM_000030.2(AGXT):c.560C>T (p.Ser187Phe) rs180177238
NM_000030.2(AGXT):c.697C>T (p.Arg233Cys) rs121908526
NM_000030.2(AGXT):c.731T>C (p.Ile244Thr) rs121908525
NM_000032.4(ALAS2):c.1699_1700delAT (p.Met567Glufs) rs387906473
NM_000032.4(ALAS2):c.1706_1709delAGTG (p.Glu569Glyfs) rs387906472
NM_000032.4(ALAS2):c.1757A>T (p.Tyr586Phe) rs139596860
NM_000035.3(ALDOB):c.360_363delCAAA (p.Asn120Lysfs) rs387906225
NM_000035.4(ALDOB):c.178C>T (p.Arg60Ter) rs118204429
NM_000038.5(APC):c.3920T>A (p.Ile1307Lys) rs1801155
NM_000038.5(APC):c.3927_3931delAAAGA (p.Glu1309Aspfs) rs121913224
NM_000038.5(APC):c.3949G>C (p.Glu1317Gln) rs1801166
NM_000038.6(APC):c.5465T>A (p.Val1822Asp) rs459552
NM_000047.2(ARSE):c.1732C>T (p.Pro578Ser) rs28935474
NM_000047.2(ARSE):c.1743G>A (p.Trp581Ter) rs80338714
NM_000047.2(ARSE):c.410G>C (p.Gly137Ala) rs80338711
NM_000047.2(ARSE):c.410G>T (p.Gly137Val) rs80338711
NM_000048.3(ASL):c.1060C>T (p.Gln354Ter) rs367543005
NM_000050.4(ASS1):c.1168G>A (p.Gly390Arg) rs121908641
NM_000050.4(ASS1):c.773+49C>T rs763389916
NM_000050.4(ASS1):c.787G>A (p.Val263Met) rs192838388
NM_000050.4(ASS1):c.794G>A (p.Arg265His) rs398123131
NM_000050.4(ASS1):c.970+5G>A rs372128852
NM_000051.3(ATM):c.103C>T (p.Arg35Ter) rs55861249
NM_000051.3(ATM):c.1A>G (p.Met1Val) rs730881359
NM_000051.3(ATM):c.2284_2285delCT (p.Leu762Valfs) rs587781658
NM_000051.3(ATM):c.2T>C (p.Met1Thr) rs786203606
NM_000051.3(ATM):c.5762_5763insNG_009830.1:g.91138_91274 rs774925473
NM_000051.3(ATM):c.6154G>A (p.Glu2052Lys) rs202206540
NM_000051.3(ATM):c.6200C>A (p.Ala2067Asp) rs397514577
NM_000051.3(ATM):c.7638_7646delTAGAATTTC (p.Arg2547_Ser2549del) rs587776547
NM_000051.3(ATM):c.8147T>C (p.Val2716Ala) rs587782652
NM_000051.3(ATM):c.8494C>T (p.Arg2832Cys) rs587779872
NM_000051.3(ATM):c.8786+1G>A rs17174393
NM_000053.3(ATP7B):c.2333G>T (p.Arg778Leu) rs28942074
NM_000053.3(ATP7B):c.3207C>A (p.His1069Gln) rs76151636
NM_000057.2(BLM):c.2308-953_2555+4719del
NM_000057.2(BLM):c.2407dupT (p.Trp803Leufs) rs367543012
NM_000057.2(BLM):c.3475_3476delTT (p.Leu1159Ilefs) rs367543033
NM_000057.3(BLM):c.1544dupA (p.Asn515Lysfs) rs367543043
NM_000057.3(BLM):c.2074+1G>T rs367543036
NM_000057.3(BLM):c.2098C>T (p.Gln700Ter) rs367543028
NM_000057.3(BLM):c.2207_2212delATCTGAinsTAGATTC (p.Tyr736Leufs) rs113993962
NM_000057.3(BLM):c.2488dupA (p.Thr830Asnfs) rs367543019
NM_000057.3(BLM):c.2506_2507delAG (p.Arg836Glyfs) rs367543024
NM_000057.3(BLM):c.2923delC (p.Gln975Lysfs) rs367543014
NM_000057.3(BLM):c.3164G>C (p.Cys1055Ser) rs367543029
NM_000057.3(BLM):c.3847C>T (p.Gln1283Ter) rs367543031
NM_000057.3(BLM):c.557_559delCAA (p.Ser186_Pro521delinsTer) rs367543035
NM_000057.3(BLM):c.772_773delCT (p.Leu258Glufs) rs367543013
NM_000059.3(BRCA2):c.5946delT (p.Ser1982Argfs) rs80359550
NM_000059.3(BRCA2):c.771_775delTCAAA (p.Asn257Lysfs) rs80359671
NM_000059.3(BRCA2):c.9976A>T (p.Lys3326Ter) rs11571833
NM_000069.2(CACNA1S):c.1583G>A (p.Arg528His) rs80338777
NM_000069.2(CACNA1S):c.2691G>T (p.Arg897Ser) rs80338779
NM_000069.2(CACNA1S):c.3715C>G (p.Arg1239Gly) rs28930069
NM_000069.2(CACNA1S):c.3716G>A (p.Arg1239His) rs28930068
NM_000070.2(CAPN3):c.1795dupA (p.Thr599Asnfs) rs80338803
NM_000070.2(CAPN3):c.2306G>A (p.Arg769Gln) rs80338802
NM_000070.2(CAPN3):c.2362_2363delAGinsTCATCT (p.Arg788Serfs) rs1555423217
NM_000070.3(CAPN3):c.549delA (p.Thr184Argfs) rs80338800
NM_000081.3(LYST):c.118_119insG (p.Ala40Glyfs) rs80338642
NM_000081.3(LYST):c.1467del (p.Glu489Aspfs) rs80338644
NM_000081.3(LYST):c.148C>T (p.Arg50Ter) rs80338643
NM_000081.3(LYST):c.1902dupA (p.Ala635Serfs) rs80338646
NM_000081.3(LYST):c.2623delT (p.Tyr875Metfs) rs80338649
NM_000081.3(LYST):c.3085C>T (p.Gln1029Ter) rs80338651
NM_000081.3(LYST):c.3310C>T (p.Arg1104Ter) rs80338652
NM_000081.3(LYST):c.4688G>A (p.Arg1563His) rs80338657
NM_000081.3(LYST):c.5996T>A (p.Val1999Asp) rs28942077
NM_000081.3(LYST):c.9590del (p.Tyr3197Leufs) rs80338667
NM_000083.2(CLCN1):c.1013G>A (p.Arg338Gln) rs80356703
NM_000083.2(CLCN1):c.1283T>C (p.Phe428Ser) rs774843953
NM_000083.2(CLCN1):c.1439C>T (p.Pro480Leu) rs80356694
NM_000083.2(CLCN1):c.1592C>T (p.Ala531Val) rs80356704
NM_000083.2(CLCN1):c.1655A>G (p.Gln552Arg) rs80356696
NM_000083.2(CLCN1):c.2680C>T (p.Arg894Ter) rs55960271
NM_000083.2(CLCN1):c.2795C>T (p.Pro932Leu) rs80356706
NM_000083.2(CLCN1):c.2926C>T (p.Arg976Ter) rs142539932
NM_000083.2(CLCN1):c.382A>G (p.Met128Val) rs80356699
NM_000083.2(CLCN1):c.592C>G (p.Leu198Val) rs80356685
NM_000083.2(CLCN1):c.689G>A (p.Gly230Glu) rs80356700
NM_000083.2(CLCN1):c.803C>T (p.Thr268Met) rs80356687
NM_000083.2(CLCN1):c.870C>G (p.Ile290Met) rs80356690
NM_000083.2(CLCN1):c.920T>C (p.Phe307Ser) rs80356701
NM_000083.2(CLCN1):c.929C>T (p.Thr310Met) rs80356691
NM_000083.2(CLCN1):c.937G>A (p.Ala313Thr) rs80356692
NM_000083.2(CLCN1):c.950G>A (p.Arg317Gln) rs80356702
NM_000084.4(CLCN5):c.731C>T (p.Ser244Leu) rs151340626
NM_000084.4(CLCN5):c.779G>T (p.Gly260Val) rs151340630
NM_000086.2(CLN3):c.883G>A (p.Glu295Lys) rs121434286
NM_000088.3(COL1A1):c.3040C>T (p.Arg1014Cys) rs72653170
NM_000093.4(COL5A1):c.1588G>A (p.Gly530Ser) rs61735045
NM_000093.4(COL5A1):c.4916G>C (p.Cys1639Ser) rs80338764
NM_000095.2(COMP):c.1156A>G (p.Asn386Asp) rs61739916
NM_000095.2(COMP):c.1417_1419dupGAC (p.Asp473_Asn474insAsp)
NM_000095.2(COMP):c.1586C>T (p.Thr529Ile) rs312262903
NM_000095.2(COMP):c.1760A>G (p.His587Arg) rs312262901
NM_000095.2(COMP):c.2152C>T (p.Arg718Trp) rs28936368
NM_000095.2(COMP):c.2156G>A (p.Gly719Asp) rs137852655
NM_000096.3(CP):c.1286_1287insTACAC (p.Asp430Thrfs) rs386134145
NM_000096.3(CP):c.1652C>T (p.Thr551Ile) rs61733458
NM_000096.3(CP):c.2065delC (p.Pro689Leufs) rs386134147
NM_000096.3(CP):c.2158C>T (p.Arg720Trp) rs145784949
NM_000096.3(CP):c.2389delG (p.Glu797Argfs) rs386134149
NM_000096.3(CP):c.2630G>A (p.Trp877Ter) rs121909579
NM_000096.3(CP):c.2684G>C (p.Gly895Ala) rs139633388
NM_000096.3(CP):c.3019-1G>A rs386134142
NM_000096.3(CP):c.606dupA (p.Asp203Argfs) rs386134143
NM_000096.3(CP):c.650T>C (p.Phe217Ser) rs386134125
NM_000098.2(CPT2):c.1055T>G (p.Phe352Cys) rs2229291
NM_000098.2(CPT2):c.1148T>A (p.Phe383Tyr) rs74315295
NM_000098.2(CPT2):c.1342T>C (p.Phe448Leu) rs74315297
NM_000098.2(CPT2):c.1507C>T (p.Arg503Cys) rs74315296
NM_000098.2(CPT2):c.1646G>A (p.Gly549Asp) rs186044004
NM_000098.2(CPT2):c.1883A>C (p.Tyr628Ser) rs28936673
NM_000098.2(CPT2):c.1939A>G (p.Met647Val) rs1799822
NM_000098.2(CPT2):c.338C>T (p.Ser113Leu) rs74315294
NM_000098.2(CPT2):c.359A>G (p.Tyr120Cys) rs121918528
NM_000098.2(CPT2):c.452G>A (p.Arg151Gln) rs515726177
NM_000098.2(CPT2):c.520G>A (p.Glu174Lys) rs28936674
NM_000098.2(CPT2):c.534_558del25insT (p.Leu178_Ile186delinsPhe) rs515726173
NM_000098.2(CPT2):c.680C>T (p.Pro227Leu) rs74315298
NM_000100.3(CSTB):c.125C>A (p.Ser42Ter) rs386833439
NM_000100.3(CSTB):c.168G>A (p.Lys56=) rs386833440
NM_000100.3(CSTB):c.169-2A>G rs386833441
NM_000100.3(CSTB):c.218_219delTC (p.Leu73Profs) rs796943858
NM_000100.3(CSTB):c.66G>A (p.Gln22=) rs386833443
NM_000100.3(CSTB):c.67-1G>C rs147484110
NM_000112.3(SLC26A2):c.-26+2T>C rs386833492
NM_000112.3(SLC26A2):c.1020_1022delTGT (p.Val341del) rs121908077
NM_000112.3(SLC26A2):c.1273A>G (p.Asn425Asp) rs104893920
NM_000112.3(SLC26A2):c.1361A>C (p.Gln454Pro) rs104893921
NM_000112.3(SLC26A2):c.1474C>T (p.Arg492Trp) rs78676079
NM_000112.3(SLC26A2):c.1957T>A (p.Cys653Ser) rs104893924
NM_000112.3(SLC26A2):c.2033G>T (p.Gly678Val) rs104893916
NM_000112.3(SLC26A2):c.2065A>T (p.Thr689Ser) rs3776070
NM_000112.3(SLC26A2):c.532C>T (p.Arg178Ter) rs104893919
NM_000112.3(SLC26A2):c.835C>T (p.Arg279Trp) rs104893915
NM_000113.2(TOR1A):c.613T>A (p.Phe205Ile) rs267607134
NM_000113.2(TOR1A):c.646G>C (p.Asp216His) rs1801968
NM_000113.2(TOR1A):c.863G>A (p.Arg288Gln) rs727502811
NM_000113.2(TOR1A):c.907_909delGAG (p.Glu303del) rs80358233
NM_000119.2(EPB42):c.424G>A (p.Ala142Thr) rs104894487
NM_000121.3(EPOR):c.1310G>A (p.Arg437His) rs62638744
NM_000121.3(EPOR):c.1317G>A (p.Trp439Ter) rs121918116
NM_000121.3(EPOR):c.1460A>G (p.Asn487Ser) rs62638745
NM_000121.3(EPOR):c.1462C>T (p.Pro488Ser) rs142094773
NM_000135.2(FANCA):c.1115_1118delTTGG (p.Val372Alafs) rs397507552
NM_000135.2(FANCA):c.3788_3790delTCT (p.Phe1263del) rs397507553
NM_000136.2(FANCC):c.1642C>T (p.Arg548Ter) rs104886457
NM_000136.2(FANCC):c.37C>T (p.Gln13Ter) rs121917784
NM_000137.2(FAH):c.1009G>A (p.Gly337Ser) rs80338900
NM_000137.2(FAH):c.1021C>T (p.Arg341Trp) rs11555096
NM_000137.2(FAH):c.1062+5G>A rs80338901
NM_000137.2(FAH):c.192G>T (p.Gln64His) rs80338894
NM_000137.2(FAH):c.554-1G>T rs80338895
NM_000137.2(FAH):c.607-6T>G rs80338896
NM_000137.2(FAH):c.782C>T (p.Pro261Leu) rs80338898
NM_000137.2(FAH):c.786G>A (p.Trp262Ter) rs80338899
NM_000140.3(FECH):c.315-48T>C rs2272783
NM_000142.4(FGFR3):c.1024G>T (p.Gly342Cys) rs587778775
NM_000142.4(FGFR3):c.1108G>T (p.Gly370Cys) rs121913479
NM_000142.4(FGFR3):c.1111A>T (p.Ser371Cys) rs121913484
NM_000142.4(FGFR3):c.1118A>G (p.Tyr373Cys) rs121913485
NM_000142.4(FGFR3):c.1612A>G (p.Ile538Val) rs80053154
NM_000142.4(FGFR3):c.1619A>C (p.Asn540Thr) rs77722678
NM_000142.4(FGFR3):c.1619A>G (p.Asn540Ser) rs77722678
NM_000142.4(FGFR3):c.1620C>A (p.Asn540Lys) rs28933068
NM_000142.4(FGFR3):c.1948A>C (p.Lys650Gln) rs78311289
NM_000142.4(FGFR3):c.1948A>G (p.Lys650Glu) rs78311289
NM_000142.4(FGFR3):c.1949A>C (p.Lys650Thr) rs121913105
NM_000142.4(FGFR3):c.1949A>T (p.Lys650Met) rs121913105
NM_000142.4(FGFR3):c.1950G>T (p.Lys650Asn) rs28928868
NM_000142.4(FGFR3):c.2419T>A (p.Ter807Arg) rs121913101
NM_000142.4(FGFR3):c.2419T>G (p.Ter807Gly) rs121913101
NM_000142.4(FGFR3):c.2420G>T (p.Ter807Leu) rs397515514
NM_000142.4(FGFR3):c.2421A>T (p.Ter807Cys) rs121913103
NM_000142.4(FGFR3):c.251C>T (p.Ser84Leu) rs121913116
NM_000142.4(FGFR3):c.742C>T (p.Arg248Cys) rs121913482
NM_000142.4(FGFR3):c.746C>G (p.Ser249Cys) rs121913483
NM_000143.3(FH):c.1127A>C (p.Gln376Pro) rs200796606
NM_000143.3(FH):c.1431_1433dupAAA (p.Lys477_Asn478insLys) rs367543046
NM_000143.3(FH):c.302G>C (p.Arg101Pro) rs75086406
NM_000151.3(G6PC):c.379_380dupTA (p.Tyr128Thrfs) rs80356488
NM_000151.3(G6PC):c.648G>T (p.Leu216=) rs80356484
NM_000152.3(GAA):c.2560C>T (p.Arg854Ter) rs121907943
NM_000152.3(GAA):c.525delT (p.Glu176Argfs) rs386834235
NM_000152.4(GAA):c.-32-13T>G rs386834236
NM_000152.4(GAA):c.1935C>A (p.Asp645Glu) rs28940868
NM_000152.4(GAA):c.2482_2646del165 (p.Gly828_Asn882del) rs1555603048
NM_000155.2(GALT):c.-119_-116delGTCA rs111033640
NM_000155.3(GALT):c.404C>T (p.Ser135Leu) rs111033690
NM_000155.3(GALT):c.512T>C (p.Phe171Ser) rs111033715
NM_000155.3(GALT):c.607G>A (p.Glu203Lys) rs111033736
NM_000155.3(GALT):c.626A>G (p.Tyr209Cys) rs111033744
NM_000155.3(GALT):c.652C>T (p.Leu218=) rs2070075
NM_000155.3(GALT):c.940A>G (p.Asn314Asp) rs2070074
NM_000156.5(GAMT):c.327G>A (p.Lys109=) rs80338735
NM_000156.5(GAMT):c.59G>C (p.Trp20Ser) rs80338734
NM_000156.5(GAMT):c.626C>T (p.Thr209Met) rs17851582
NM_000157.3(GBA):c.1246G>A (p.Gly416Ser) rs121908311
NM_000157.3(GBA):c.1342G>C (p.Asp448His) rs1064651
NM_000157.3(GBA):c.1448T>C rs421016
NM_000157.3(GBA):c.1604G>A (p.Arg535His) rs75822236
NM_000157.3(GBA):c.475C>T (p.Arg159Trp) rs439898
NM_000157.3(GBA):c.476G>A (p.Arg159Gln) rs79653797
NM_000157.3(GBA):c.509G>T (p.Arg170Leu) rs80356763
NM_000157.3(GBA):c.754T>A (p.Phe252Ile) rs381737
NM_000158.3(GBE1):c.143+1G>A rs397515343
NM_000158.3(GBE1):c.1543C>T (p.Arg515Cys) rs80338672
NM_000158.3(GBE1):c.1570C>T (p.Arg524Ter) rs137852888
NM_000158.3(GBE1):c.1571G>A (p.Arg524Gln) rs80338673
NM_000158.3(GBE1):c.1634A>G (p.His545Arg) rs137852889
NM_000158.3(GBE1):c.1643G>A (p.Trp548Ter) rs137852894
NM_000158.3(GBE1):c.1774G>T (p.Glu592Ter) rs137852890
NM_000158.3(GBE1):c.1883A>G (p.His628Arg) rs137852891
NM_000158.3(GBE1):c.671T>C (p.Leu224Pro) rs137852886
NM_000158.3(GBE1):c.691+5G>C rs397515344
NM_000158.3(GBE1):c.771T>A (p.Phe257Leu) rs137852887
NM_000158.3(GBE1):c.986A>C (p.Tyr329Ser) rs80338671
NM_000158.3(GBE1):c.993-?_1618+?del
NM_000162.3(GCK):c.1019+2T>G rs193929376
NM_000162.3(GCK):c.1190G>T (p.Arg397Leu) rs193929375
NM_000162.3(GCK):c.629T>A (p.Met210Lys) rs80356654
NM_000162.3(GCK):c.683C>T (p.Thr228Met) rs80356655
NM_000166.5(GJB1):c.164C>T (p.Thr55Ile) rs104894824
NM_000166.5(GJB1):c.187G>A (p.Val63Ile) rs116840818
NM_000166.5(GJB1):c.223C>T (p.Arg75Trp) rs116840819
NM_000166.5(GJB1):c.407T>C (p.Val136Ala) rs104894826
NM_000166.5(GJB1):c.415G>A (p.Val139Met) rs104894812
NM_000166.5(GJB1):c.43C>T (p.Arg15Trp) rs116840815
NM_000166.5(GJB1):c.536G>A (p.Cys179Tyr) rs116840822
NM_000166.5(GJB1):c.556G>A (p.Glu186Lys) rs116840821
NM_000166.5(GJB1):c.614A>G (p.Asn205Ser) rs104894822
NM_000166.5(GJB1):c.704T>G (p.Phe235Cys) rs104894825
NM_000168.5(GLI3):c.2012delG (p.Gly671Glufs) rs116840743
NM_000168.5(GLI3):c.2023delG (p.Glu675Serfs) rs116840744
NM_000168.5(GLI3):c.2188_2206delCTTCCTCTGACCGATGGAG (p.Leu730Valfs) rs116840754
NM_000168.5(GLI3):c.2770_2771insNC_012920.1:g.12243..12314
NM_000168.5(GLI3):c.3439G>T (p.Glu1147Ter) rs116840768
NM_000169.2(GLA):c.352C>T (p.Arg118Cys) rs148158093
NM_000169.2(GLA):c.427G>A (p.Ala143Thr) rs104894845
NM_000169.2(GLA):c.639+919G>A rs199473684
NM_000170.2(GLDC):c.1545G>C (p.Arg515Ser) rs121964976
NM_000170.2(GLDC):c.1691G>T (p.Ser564Ile) rs121964974
NM_000170.2(GLDC):c.2284G>A (p.Gly762Arg) rs386833550
NM_000171.3(GLRA1):c.1108G>A (p.Gly370Ser) rs116474260
NM_000171.3(GLRA1):c.299G>A (p.Arg100His) rs281864914
NM_000171.3(GLRA1):c.896G>T (p.Arg299Leu) rs121918408
NM_000171.3(GLRA1):c.920A>G (p.Tyr307Cys) rs121918410
NM_000186.3(CFH):c.3572C>T (p.Ser1191Leu) rs460897
NM_000187.3(HGD):c.1102A>G (p.Met368Val) rs120074173
NM_000187.3(HGD):c.1111dupC (p.His371Profs) rs397515516
NM_000187.3(HGD):c.16-1G>A rs397515347
NM_000187.3(HGD):c.175delA (p.Ser59Alafs) rs397515517
NM_000187.3(HGD):c.342+1G>A rs397515518
NM_000187.3(HGD):c.360T>G (p.Cys120Trp) rs149165166
NM_000187.3(HGD):c.457dupG (p.Asp153Glyfs) rs397515346
NM_000187.3(HGD):c.481G>A (p.Gly161Arg) rs28941783
NM_000187.3(HGD):c.688C>T (p.Pro230Ser) rs28942100
NM_000187.3(HGD):c.808G>A (p.Gly270Arg) rs120074174
NM_000187.3(HGD):c.899T>G (p.Val300Gly) rs120074170
NM_000193.3(SHH):c.1132_1140del (p.Ala378_Phe380del) rs397515376
NM_000193.3(SHH):c.1147G>A (p.Ala383Thr) rs137853341
NM_000193.3(SHH):c.1270C>G (p.Pro424Ala) rs104894048
NM_000193.3(SHH):c.263A>T (p.Asp88Val) rs104894050
NM_000193.3(SHH):c.298C>T (p.Gln100Ter) rs104894044
NM_000193.3(SHH):c.313A>T (p.Lys105Ter) rs104894045
NM_000193.3(SHH):c.345C>A (p.Asn115Lys) rs267607047
NM_000193.3(SHH):c.349T>C (p.Trp117Arg) rs104894040
NM_000193.3(SHH):c.349T>G (p.Trp117Gly) rs104894040
NM_000193.3(SHH):c.570G>A (p.Ser190=) rs9333633
NM_000193.3(SHH):c.630C>T (p.Gly210=) rs9333634
NM_000193.3(SHH):c.671T>A (p.Val224Glu) rs104894042
NM_000193.3(SHH):c.676G>A (p.Ala226Thr) rs104894043
NM_000193.3(SHH):c.766G>T (p.Glu256Ter) rs104894051
NM_000193.3(SHH):c.788_808del21 (p.Arg263_Ala269del) rs397515375
NM_000193.3(SHH):c.850G>T (p.Glu284Ter) rs104894046
NM_000193.3(SHH):c.869G>A (p.Gly290Asp) rs104894047
NM_000193.3(SHH):c.876G>A (p.Gly292=) rs112055654
NM_000193.3(SHH):c.885C>T (p.Ser295=) rs549625672
NM_000193.3(SHH):c.91G>A (p.Gly31Arg) rs28936675
NM_000195.3(HPS1):c.1189delC (p.Gln397Serfs) rs281865084
NM_000195.3(HPS1):c.1996G>T (p.Glu666Ter) rs121908385
NM_000195.4(HPS1):c.1472C>G (p.Pro491Arg) rs2296434
NM_000195.4(HPS1):c.1472_1487dup16 (p.His497Glnfs) rs281865163
NM_000195.4(HPS1):c.1808A>G (p.Gln603Arg) rs2296436
NM_000195.4(HPS1):c.397G>T (p.Glu133Ter) rs121908386
NM_000195.4(HPS1):c.398+5G>A rs281865077
NM_000195.4(HPS1):c.847G>T (p.Gly283Trp) rs11592273
NM_000195.4(HPS1):c.972delC (p.Met325Trpfs) rs281865082
NM_000195.4(HPS1):c.972dupC (p.Met325Hisfs) rs281865082
NM_000203.4(IDUA):c.1081G>A (p.Ala361Thr) rs6831280
NM_000203.4(IDUA):c.246C>G (p.His82Gln) rs148775298
NM_000203.4(IDUA):c.46_57delTCGCTCCTGGCC (p.Ser16_Ala19del) rs398123260
NM_000203.5(IDUA):c.965T>A (p.Val322Glu) rs76722191
NM_000204.4(CFI):c.782G>A (p.Gly261Asp) rs112534524
NM_000207.2(INS):c.-152C>G rs748749585
NM_000207.2(INS):c.127T>G (p.Cys43Gly) rs80356666
NM_000207.2(INS):c.143T>G (p.Phe48Cys) rs80356668
NM_000207.2(INS):c.265C>T (p.Arg89Cys) rs80356669
NM_000207.2(INS):c.287G>A (p.Cys96Tyr) rs80356671
NM_000207.2(INS):c.71C>A (p.Ala24Asp) rs80356663
NM_000207.2(INS):c.94G>A (p.Gly32Ser) rs80356664
NM_000209.3(PDX1):c.188del (p.Pro63Argfs) rs193929377
NM_000209.3(PDX1):c.492G>T (p.Glu164Asp) rs80356661
NM_000209.3(PDX1):c.532G>A (p.Glu178Lys) rs80356662
NM_000213.3(ITGB4):c.182G>A (p.Cys61Tyr) rs80338755
NM_000217.3(KCNA1):c.1249C>T (p.Arg417Ter) rs104894358
NM_000217.3(KCNA1):c.676A>G (p.Thr226Ala) rs104894354
NM_000217.3(KCNA1):c.677C>G (p.Thr226Arg) rs28933383
NM_000217.3(KCNA1):c.684T>C (p.Cys228=) rs1048500
NM_000217.3(KCNA1):c.804G>C (p.Thr268=) rs2227910
NM_000218.2(KCNQ1):c.573_577delGCGCT (p.Arg192Cysfs) rs397508118
NM_000227.4(LAMA3):c.151dup (p.Val51Glyfs) rs80356678
NM_000228.2(LAMB3):c.124C>T (p.Arg42Ter) rs80356680
NM_000228.2(LAMB3):c.1903C>T (p.Arg635Ter) rs80356682
NM_000228.2(LAMB3):c.727C>T (p.Gln243Ter) rs80356681
NM_000235.3(LIPA):c.894G>A (p.Gln298=) rs116928232
NM_000243.2(MEFV):c.1105C>T (p.Pro369Ser) rs11466023
NM_000243.2(MEFV):c.1223G>A (p.Arg408Gln) rs11466024
NM_000243.2(MEFV):c.1772T>C (p.Ile591Thr) rs11466045
NM_000243.2(MEFV):c.2080A>G (p.Met694Val) rs61752717
NM_000243.2(MEFV):c.2082G>A (p.Met694Ile) rs28940578
NM_000243.2(MEFV):c.2084A>G rs104895094
NM_000243.2(MEFV):c.2177T>C (p.Val726Ala) rs28940579
NM_000243.2(MEFV):c.2230G>T rs61732874
NM_000243.2(MEFV):c.2282G>A (p.Arg761His) rs104895097
NM_000243.2(MEFV):c.442G>C (p.Glu148Gln) rs3743930
NM_000255.3(MMUT):c.1495G>A (p.Ala499Thr) rs2229385
NM_000255.3(MMUT):c.2099T>A (p.Met700Lys) rs140600746
NM_000255.3(MMUT):c.313T>C (p.Trp105Arg) rs121918249
NM_000255.3(MMUT):c.52C>T (p.Gln18Ter) rs121918248
NM_000257.3(MYH7):c.1322C>T (p.Thr441Met) rs121913653
NM_000257.3(MYH7):c.4772T>C (p.Leu1591Pro) rs730880808
NM_000257.3(MYH7):c.4807G>C (p.Ala1603Pro) rs730880809
NM_000257.3(MYH7):c.4835T>C (p.Leu1612Pro) rs587779392
NM_000257.3(MYH7):c.5186_5188delAGA (p.Lys1729del) rs367543052
NM_000257.3(MYH7):c.5807A>G (p.Ter1936Trp) rs367543053
NM_000257.4(MYH7):c.4472C>G (p.Ser1491Cys) rs3729823
NM_000257.4(MYH7):c.4566T>C (p.Thr1522=) rs2754155
NM_000257.4(MYH7):c.5401G>A (p.Glu1801Lys) rs397516248
NM_000257.4(MYH7):c.5740G>A (p.Glu1914Lys) rs397516254
NM_000260.3(MYO7A):c.1556G>A (p.Gly519Asp) rs111033206
NM_000260.3(MYO7A):c.3719G>A (p.Arg1240Gln) rs111033178
NM_000260.3(MYO7A):c.4805G>A (p.Arg1602Gln) rs139889944
NM_000265.5(NCF1):c.75_76del (p.Tyr26Hisfs) rs4029402
NM_000271.4(NPC1):c.2572A>G (p.Ile858Val) rs1805082
NM_000271.4(NPC1):c.2793C>T (p.Asn931=) rs1140458
NM_000271.4(NPC1):c.2974G>A (p.Gly992Arg) rs80358254
NM_000271.4(NPC1):c.2974G>C (p.Gly992Arg) rs80358254
NM_000271.4(NPC1):c.2974G>T (p.Gly992Trp) rs80358254
NM_000271.4(NPC1):c.3019C>G (p.Pro1007Ala) rs80358257
NM_000271.4(NPC1):c.3182T>C (p.Ile1061Thr) rs80358259
NM_000271.4(NPC1):c.3797G>A (p.Arg1266Gln) rs1805084
NM_000271.4(NPC1):c.530G>A (p.Cys177Tyr) rs80358252
NM_000271.4(NPC1):c.709C>T (p.Pro237Ser) rs80358251
NM_000276.3(OCRL):c.952C>T (p.Arg318Cys) rs137853263
NM_000277.3(PAH):c.194T>C (p.Ile65Thr) rs75193786
NM_000277.3(PAH):c.782G>A (p.Arg261Gln) rs5030849
NM_000277.3(PAH):c.842C>T (p.Pro281Leu) rs5030851
NM_000282.3(PCCA):c.1651G>T (p.Val551Phe) rs61749895
NM_000282.3(PCCA):c.937C>T (p.Arg313Ter) rs138149179
NM_000288.3(PEX7):c.13_19dup (p.Gly7Valfs) rs62636519
NM_000288.3(PEX7):c.340-10A>G rs267608255
NM_000288.3(PEX7):c.40A>C (p.Thr14Pro) rs61753233
NM_000288.3(PEX7):c.45_52dupGGGACGCC (p.His18Argfs) rs63535662
NM_000288.3(PEX7):c.649G>A (p.Gly217Arg) rs121909152
NM_000288.3(PEX7):c.653C>T (p.Ala218Val) rs121909151
NM_000288.3(PEX7):c.854A>G (p.His285Arg) rs62653611
NM_000288.3(PEX7):c.875T>A (p.Leu292Ter) rs1805137
NM_000288.3(PEX7):c.903+1G>C rs148591292
NM_000303.2(PMM2):c.338C>T (p.Pro113Leu) rs80338700
NM_000303.2(PMM2):c.357C>A (p.Phe119Leu) rs80338701
NM_000303.2(PMM2):c.395T>C (p.Ile132Thr) rs80338702
NM_000303.2(PMM2):c.415G>A (p.Glu139Lys) rs80338703
NM_000303.2(PMM2):c.422G>A (p.Arg141His) rs28936415
NM_000303.2(PMM2):c.563A>G (p.Asp188Gly) rs80338704
NM_000303.2(PMM2):c.677C>G (p.Thr226Ser) rs80338706
NM_000303.2(PMM2):c.691G>A (p.Val231Met) rs80338707
NM_000303.2(PMM2):c.710C>T (p.Thr237Met) rs80338708
NM_000303.2(PMM2):c.722G>C (p.Cys241Ser) rs80338709
NM_000304.3(PMP22):c.199G>C (p.Ala67Pro) rs104894623
NM_000304.3(PMP22):c.353C>T (p.Thr118Met) rs104894619
NM_000304.3(PMP22):c.47T>C (p.Leu16Pro) rs104894617
NM_000304.3(PMP22):c.65C>T (p.Ser22Phe) rs104894625
NM_000304.3(PMP22):c.82T>C (p.Trp28Arg) rs104894626
NM_000304.4(PMP22):c.281dup (p.Arg95Glnfs) rs80338763
NM_000304.4(PMP22):c.469C>T (p.Arg157Trp) rs28936682
NM_000310.3(PPT1):c.364A>T (p.Arg122Trp) rs137852695
NM_000310.3(PPT1):c.451C>T (p.Arg151Ter) rs137852700
NM_000311.3(PRNP):c.204_227del24 (p.Pro84_Gln91del) rs193922906
NM_000311.3(PRNP):c.538G>A (p.Val180Ile) rs74315408
NM_000311.4(PRNP):c.160_183GGTGGTGGCTGGGGGCAGCCTCAT(4) (p.Gln59_Pro60insGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGlnGlnGlyGlyGlyGlyTrpGlyGln) rs193922906
NM_000311.4(PRNP):c.305C>T (p.Pro102Leu) rs74315401
NM_000311.4(PRNP):c.313C>A (p.Pro105Thr) rs74315414
NM_000311.4(PRNP):c.313C>T (p.Pro105Ser) rs74315414
NM_000311.4(PRNP):c.314C>T (p.Pro105Leu) rs11538758
NM_000311.4(PRNP):c.350C>T (p.Ala117Val) rs74315402
NM_000311.4(PRNP):c.385A>G (p.Met129Val) rs1799990
NM_000311.4(PRNP):c.435T>G (p.Tyr145Ter) rs80356710
NM_000311.4(PRNP):c.478C>T (p.Gln160Ter) rs80356711
NM_000311.4(PRNP):c.512A>G (p.Asn171Ser) rs16990018
NM_000311.4(PRNP):c.547A>G (p.Thr183Ala) rs74315411
NM_000311.4(PRNP):c.560A>G (p.His187Arg) rs74315413
NM_000311.4(PRNP):c.593T>C (p.Phe198Ser) rs74315405
NM_000311.4(PRNP):c.598G>A (p.Glu200Lys) rs28933385
NM_000311.4(PRNP):c.623G>A (p.Arg208His) rs74315412
NM_000311.4(PRNP):c.628G>A (p.Val210Ile) rs74315407
NM_000311.4(PRNP):c.650A>G (p.Gln217Arg) rs74315406
NM_000311.4(PRNP):c.655G>A (p.Glu219Lys) rs1800014
NM_000311.4(PRNP):c.695T>G (p.Met232Arg) rs74315409
NM_000334.4(SCN4A):c.2006G>A (p.Arg669His) rs80338784
NM_000334.4(SCN4A):c.2014C>A (p.Arg672Ser) rs80338785
NM_000334.4(SCN4A):c.2014C>G (p.Arg672Gly) rs80338785
NM_000334.4(SCN4A):c.2014C>T (p.Arg672Cys) rs80338785
NM_000334.4(SCN4A):c.2015G>A (p.Arg672His) rs80338788
NM_000334.4(SCN4A):c.2341G>A (p.Val781Ile) rs62070884
NM_000334.4(SCN4A):c.2717G>C (p.Ser906Thr) rs41280102
NM_000334.4(SCN4A):c.3386G>A (p.Arg1129Gln) rs527236149
NM_000334.4(SCN4A):c.3395G>A (p.Arg1132Gln) rs80338789
NM_000334.4(SCN4A):c.4078A>G (p.Met1360Val) rs80338959
NM_000334.4(SCN4A):c.4343G>A (p.Arg1448His) rs121908545
NM_000334.4(SCN4A):c.664C>T (p.Arg222Trp) rs527236148
NM_000334.4(SCN4A):c.737C>T (p.Ser246Leu) rs80338951
NM_000334.4(SCN4A):c.968C>T (p.Thr323Met) rs80338952
NM_000346.3(SOX9):c.1320C>A (p.Tyr440Ter) rs80338688
NM_000346.3(SOX9):c.1320C>G (p.Tyr440Ter) rs80338688
NM_000352.4(ABCC8):c.1144G>A (p.Glu382Lys) rs80356651
NM_000352.4(ABCC8):c.215A>G (p.Asn72Ser) rs80356634
NM_000352.4(ABCC8):c.257T>G (p.Val86Gly) rs193929360
NM_000352.4(ABCC8):c.3554C>A (p.Ser1185Tyr) rs193929369
NM_000352.4(ABCC8):c.394T>C (p.Phe132Leu) rs80356637
NM_000352.4(ABCC8):c.4270A>G (p.Ile1424Val) rs80356653
NM_000352.4(ABCC8):c.638T>G (p.Leu213Arg) rs80356642
NM_000370.3(TTPA):c.175C>T (p.Arg59Trp) rs397515522
NM_000370.3(TTPA):c.303T>G (p.His101Gln) rs121917849
NM_000370.3(TTPA):c.358G>A (p.Ala120Thr) rs143010236
NM_000370.3(TTPA):c.400C>T (p.Arg134Ter) rs121917851
NM_000370.3(TTPA):c.487delT (p.Trp163Glyfs) rs397515378
NM_000370.3(TTPA):c.513_514insTT (p.Thr172Leufs) rs397515379
NM_000370.3(TTPA):c.575G>A (p.Arg192His) rs121917850
NM_000370.3(TTPA):c.661C>T (p.Arg221Trp) rs35916840
NM_000370.3(TTPA):c.744delA (p.Glu249Asnfs) rs397515377
NM_000372.4(TYR):c.1205G>A (p.Arg402Gln) rs1126809
NM_000372.4(TYR):c.575C>A (p.Ser192Tyr) rs1042602
NM_000375.2(UROS):c.-219C>A rs4385801
NM_000375.2(UROS):c.197C>T (p.Ala66Val) rs28941774
NM_000375.2(UROS):c.217T>C (p.Cys73Arg) rs121908012
NM_000375.2(UROS):c.244G>T (p.Val82Phe) rs121908016
NM_000375.2(UROS):c.673G>A (p.Gly225Ser) rs121908020
NM_000384.2(APOB):c.10579C>T (p.Arg3527Trp) rs144467873
NM_000384.2(APOB):c.10580G>A (p.Arg3527Gln) rs5742904
NM_000384.2(APOB):c.10672C>T (p.Arg3558Cys) rs12713559
NM_000391.3(TPP1):c.509-1G>C rs56144125
NM_000391.3(TPP1):c.622C>T (p.Arg208Ter) rs119455955
NM_000399.3(EGR2):c.1075C>T (p.Arg359Trp) rs104894161
NM_000399.4(EGR2):c.1142G>A (p.Arg381His) rs281865137
NM_000399.4(EGR2):c.1225C>T (p.Arg409Trp) rs104894159
NM_000399.4(EGR2):c.803T>A (p.Ile268Asn) rs104894158
NM_000400.3(ERCC2):c.2047C>T (p.Arg683Trp) rs41556519
NM_000403.3(GALE):c.101A>G (p.Asn34Ser) rs121908046
NM_000403.3(GALE):c.269G>A (p.Gly90Glu) rs28940882
NM_000403.3(GALE):c.280G>A (p.Val94Met) rs121908047
NM_000403.3(GALE):c.505C>T (p.Arg169Trp) rs137853859
NM_000403.3(GALE):c.548T>C (p.Leu183Pro) rs121908045
NM_000403.3(GALE):c.715C>T (p.Arg239Trp) rs137853860
NM_000403.3(GALE):c.770A>G (p.Lys257Arg) rs28940884
NM_000403.3(GALE):c.956G>A (p.Gly319Glu) rs28940885
NM_000410.3(HFE):c.187C>G (p.His63Asp) rs1799945
NM_000410.3(HFE):c.193A>T (p.Ser65Cys) rs1800730
NM_000410.3(HFE):c.845G>A (p.Cys282Tyr) rs1800562
NM_000424.3(KRT5):c.1649delG (p.Gly550Alafs) rs61126080
NM_000424.3(KRT5):c.74C>T (p.Pro25Leu) rs57499817
NM_000426.3(LAMA2):c.1854_1861dupACGTGTTC (p.Leu621Hisfs) rs202247791
NM_000426.3(LAMA2):c.2049_2050delAG rs202247790
NM_000426.3(LAMA2):c.2901C>A (p.Cys967Ter) rs121913577
NM_000426.3(LAMA2):c.7750-1713_7899-2153del4987
NM_000426.3(LAMA2):c.7881T>G (p.His2627Gln) rs202247792
NM_000430.3(PAFAH1B1):c.1002+1G>A rs113994203
NM_000430.3(PAFAH1B1):c.1050delG (p.Lys351Serfs) rs113994200
NM_000430.3(PAFAH1B1):c.1050dupG (p.Lys351Glufs) rs113994200
NM_000430.3(PAFAH1B1):c.162delA (p.Lys54Asnfs) rs113994198
NM_000430.3(PAFAH1B1):c.162dupA (p.Trp55Metfs) rs113994198
NM_000430.3(PAFAH1B1):c.569-10T>C rs113994202
NM_000441.1(SLC26A4):c.1001+1G>A rs80338849
NM_000441.1(SLC26A4):c.1151A>G (p.Glu384Gly) rs111033244
NM_000441.1(SLC26A4):c.1246A>C (p.Thr416Pro) rs28939086
NM_000441.1(SLC26A4):c.2168A>G (p.His723Arg) rs121908362
NM_000441.1(SLC26A4):c.707T>C (p.Leu236Pro) rs80338848
NM_000441.1(SLC26A4):c.919-2A>G rs111033313
NM_000447.2(PSEN2):c.422A>T (p.Asn141Ile) rs63750215
NM_000447.2(PSEN2):c.717G>A (p.Met239Ile) rs63749884
NM_000456.2(SUOX):c.650G>A (p.Arg217Gln) rs121908007
NM_000459.4(TEK):c.2545C>T (p.Arg849Trp) rs80338908
NM_000459.4(TEK):c.2690A>C (p.Tyr897Ser) rs80338909
NM_000478.4(ALPL):c.1565T>C (p.Val522Ala) rs34605986
NM_000478.4(ALPL):c.571G>A (p.Glu191Lys) rs121918007
NM_000478.4(ALPL):c.979T>C (p.Phe327Leu) rs121918010
NM_000478.5(ALPL):c.1001G>A (p.Gly334Asp) rs121918009
NM_000478.5(ALPL):c.455G>A (p.Arg152His) rs149344982
NM_000481.3(AMT):c.125A>G (p.His42Arg) rs121964983
NM_000481.3(AMT):c.878-1G>A rs181134220
NM_000481.3(AMT):c.959G>A (p.Arg320His) rs121964985
NM_000484.3(APP):c.2010_2011delGAinsTC (p.Lys670_Met671delinsAsnLeu) rs281865161
NM_000484.3(APP):c.2075C>G (p.Ala692Gly) rs63750671
NM_000484.3(APP):c.2078A>G (p.Glu693Gly) rs63751039
NM_000484.3(APP):c.2149G>A (p.Val717Ile) rs63750264
NM_000485.2(APRT):c.321+2_321+3insT rs281860263
NM_000487.5(ARSA):c.*96A>G rs6151429
NM_000487.5(ARSA):c.1055A>G (p.Asn352Ser) rs2071421
NM_000487.5(ARSA):c.1178C>G (p.Thr393Ser) rs743616
NM_000487.5(ARSA):c.1210+1G>A rs80338820
NM_000487.5(ARSA):c.1232C>T (p.Thr411Ile) rs74315481
NM_000487.5(ARSA):c.1283C>T (p.Pro428Leu) rs28940893
NM_000487.5(ARSA):c.1408_1418del11 (p.Ala470Leufs) rs80338823
NM_000487.5(ARSA):c.257G>A (p.Arg86Gln) rs74315458
NM_000487.5(ARSA):c.293C>T (p.Ser98Phe) rs74315456
NM_000487.5(ARSA):c.302G>A (p.Gly101Asp) rs74315455
NM_000487.5(ARSA):c.465+1G>A rs80338815
NM_000487.5(ARSA):c.542T>G (p.Ile181Ser) rs74315457
NM_000487.5(ARSA):c.641C>T (p.Ala214Val) rs74315467
NM_000487.5(ARSA):c.739G>A (p.Gly247Arg) rs74315471
NM_000487.5(ARSA):c.769G>C (p.Asp257His) rs80338819
NM_000492.3(CFTR):c.1521_1523delCTT (p.Phe508delPhe) rs113993960
NM_000492.3(CFTR):c.1584G>A (p.Glu528=) rs1800095
NM_000492.3(CFTR):c.1624G>T (p.Gly542Ter) rs113993959
NM_000492.3(CFTR):c.1652G>A (p.Gly551Asp) rs75527207
NM_000492.3(CFTR):c.224G>A (p.Arg75Gln) rs1800076
NM_000492.3(CFTR):c.3870A>G (p.Pro1290=) rs1800130
NM_000495.4(COL4A5):c.4691G>C (p.Cys1564Ser) rs104886287
NM_000495.4(COL4A5):c.4946T>G (p.Leu1649Arg) rs104886303
NM_000495.4(COL4A5):c.5030G>A (p.Arg1677Gln) rs104886308
NM_000500.7(CYP21A2):c.1069C>T (p.Arg357Trp) rs7769409
NM_000500.7(CYP21A2):c.1360C>T (p.Pro454Ser) rs6445
NM_000500.7(CYP21A2):c.293-13C>G rs6467
NM_000500.7(CYP21A2):c.308G>A (p.Arg103Lys) rs6474
NM_000500.7(CYP21A2):c.332_339delGAGACTAC (p.Gly111Valfs) rs387906510
NM_000500.7(CYP21A2):c.518T>A (p.Ile173Asn) rs6475
NM_000500.7(CYP21A2):c.552C>G (p.Asp184Glu) rs397515531
NM_000500.7(CYP21A2):c.806G>C (p.Ser269Thr) rs6472
NM_000500.7(CYP21A2):c.844G>T (p.Val282Leu) rs6471
NM_000500.7(CYP21A2):c.92C>T (p.Pro31Leu) rs9378251
NM_000500.7(CYP21A2):c.955C>T (p.Gln319Ter) rs7755898
NM_000500.9(CYP21A2):c.25_27dup (p.Leu10_Pro11insLeu) rs61338903
NM_000500.9(CYP21A2):c.923dup (p.Leu308Phefs) rs267606756
NM_000506.4(F2):c.1787G>T (p.Arg596Leu) rs387907201
NM_000512.4(GALNS):c.337A>T (p.Ile113Phe) rs118204438
NM_000512.4(GALNS):c.935C>G (p.Thr312Ser) rs118204446
NM_000516.5(GNAS):c.601C>T (p.Arg201Cys) rs11554273
NM_000516.5(GNAS):c.602G>A (p.Arg201His) rs121913495
NM_000516.5(GNAS):c.602G>T (p.Arg201Leu) rs121913495
NM_000516.5(GNAS):c.680A>T (p.Gln227Leu) rs121913494
NM_000517.4(HBA2):c.427T>C (p.Ter143Gln) rs41464951
NM_000517.6(HBA2):c.207C>G (p.Asn69Lys) rs111033601
NM_000517.6(HBA2):c.377T>C (p.Leu126Pro) rs41397847
NM_000518.4(HBB):c.126_129delCTTT (p.Phe42fs) rs80356821
NM_000518.4(HBB):c.19G>A (p.Glu7Lys) rs33930165
NM_000518.4(HBB):c.364G>A (p.Glu122Lys) rs33946267
NM_000518.4(HBB):c.364G>C (p.Glu122Gln) rs33946267
NM_000518.5(HBB):c.*113A>G rs33985472
NM_000518.5(HBB):c.-137C>A rs33941377
NM_000518.5(HBB):c.-137C>G rs33941377
NM_000518.5(HBB):c.-138C>A rs33944208
NM_000518.5(HBB):c.-138C>T rs33944208
NM_000518.5(HBB):c.-140C>T rs34999973
NM_000518.5(HBB):c.-142C>T rs34883338
NM_000518.5(HBB):c.-78A>G rs33931746
NM_000518.5(HBB):c.20A>T (p.Glu7Val) rs334
NM_000518.5(HBB):c.316-7C>G rs34483965
NM_000518.5(HBB):c.59A>G (p.Asn20Ser) rs33972047
NM_000518.5(HBB):c.75T>A (p.Gly25=) rs33951465
NM_000518.5(HBB):c.79G>A (p.Glu27Lys) rs33950507
NM_000518.5(HBB):c.82G>T (p.Ala28Ser) rs35424040
NM_000525.3(KCNJ11):c.124T>C (p.Cys42Arg) rs80356610
NM_000525.3(KCNJ11):c.149G>C (p.Arg50Pro) rs80356611
NM_000525.3(KCNJ11):c.157G>A (p.Gly53Ser) rs80356613
NM_000525.3(KCNJ11):c.157G>C (p.Gly53Arg) rs80356613
NM_000525.3(KCNJ11):c.158G>A (p.Gly53Asp) rs80356615
NM_000525.3(KCNJ11):c.175G>A (p.Val59Met) rs80356616
NM_000525.3(KCNJ11):c.176T>G (p.Val59Gly) rs80356617
NM_000525.3(KCNJ11):c.497G>T (p.Cys166Phe) rs80356618
NM_000525.3(KCNJ11):c.499A>C (p.Ile167Leu) rs80356620
NM_000525.3(KCNJ11):c.509A>G (p.Lys170Arg) rs80356621
NM_000525.3(KCNJ11):c.510G>C (p.Lys170Asn) rs80356622
NM_000525.3(KCNJ11):c.601C>T (p.Arg201Cys) rs80356625
NM_000525.3(KCNJ11):c.602G>A (p.Arg201His) rs80356624
NM_000525.3(KCNJ11):c.67A>G (p.Lys23Glu) rs5219
NM_000525.3(KCNJ11):c.964G>A (p.Glu322Lys) rs193929355
NM_000525.3(KCNJ11):c.989A>G (p.Tyr330Cys) rs193929356
NM_000526.4(KRT14):c.356T>C (p.Met119Thr) rs28928893
NM_000526.4(KRT14):c.368A>G (p.Asn123Ser) rs60171927
NM_000526.4(KRT14):c.373C>T (p.Arg125Cys) rs60399023
NM_000526.4(KRT14):c.374G>A (p.Arg125His) rs58330629
NM_000528.3(MAN2B1):c.1830+1G>C rs80338677
NM_000528.3(MAN2B1):c.1831-2A>G rs80338678
NM_000528.3(MAN2B1):c.2248C>T (p.Arg750Trp) rs80338680
NM_000528.3(MAN2B1):c.2426T>C (p.Leu809Pro) rs80338681
NM_000530.6(MPZ):c.337G>T (p.Val113Phe) rs281865126
NM_000530.6(MPZ):c.487G>C (p.Gly163Arg) rs281865128
NM_000530.7(MPZ):c.242A>G (p.His81Arg) rs121913594
NM_000530.7(MPZ):c.389A>G (p.Lys130Arg) rs281865127
NM_000530.7(MPZ):c.499G>C (p.Gly167Arg) rs121913586
NM_000532.4(PCCB):c.1218_1231delGGGCATCATCCGGCinsTAGAGCACAGGA (p.Gly407Argfs) rs397507445
NM_000532.4(PCCB):c.1228C>T (p.Arg410Trp) rs121964959
NM_000532.4(PCCB):c.1283C>T (p.Thr428Ile) rs111033542
NM_000532.4(PCCB):c.1304A>G (p.Tyr435Cys) rs121964961
NM_000532.4(PCCB):c.1490C>T (p.Ala497Val) rs142403318
NM_000532.4(PCCB):c.1495C>T (p.Arg499Ter) rs202247820
NM_000532.4(PCCB):c.1539_1540insCCC (p.Ala513_Arg514insPro) rs202247821
NM_000532.4(PCCB):c.1606A>G (p.Asn536Asp) rs202247823
NM_000532.4(PCCB):c.502G>A (p.Glu168Lys) rs121964960
NM_000540.2(RYR1):c.10204T>G (p.Cys3402Gly) rs367543058
NM_000540.2(RYR1):c.1209C>G (p.Ile403Met) rs118192116
NM_000540.2(RYR1):c.13673G>A (p.Arg4558Gln) rs118192130
NM_000540.2(RYR1):c.13900G>A (p.Glu4634Lys) rs118192133
NM_000540.2(RYR1):c.13910C>T (p.Thr4637Ile) rs118192134
NM_000540.2(RYR1):c.13912G>A (p.Gly4638Ser) rs118192136
NM_000540.2(RYR1):c.13913G>A (p.Gly4638Asp) rs118192135
NM_000540.2(RYR1):c.13949T>C (p.Leu4650Pro) rs118192138
NM_000540.2(RYR1):c.14126C>T (p.Thr4709Met) rs118192140
NM_000540.2(RYR1):c.14378T>C (p.Leu4793Pro) rs118192179
NM_000540.2(RYR1):c.14387A>G (p.Tyr4796Cys) rs118192167
NM_000540.2(RYR1):c.1453A>G (p.Met485Val) rs147723844
NM_000540.2(RYR1):c.14581C>T (p.Arg4861Cys) rs118192181
NM_000540.2(RYR1):c.14659C>T (p.His4887Tyr) rs118192147
NM_000540.2(RYR1):c.14677C>T (p.Arg4893Trp) rs118192150
NM_000540.2(RYR1):c.14678G>A (p.Arg4893Gln) rs118192151
NM_000540.2(RYR1):c.14717C>T (p.Ala4906Val) rs118192153
NM_000540.2(RYR1):c.14741G>C (p.Arg4914Thr) rs118192154
NM_000540.2(RYR1):c.14779_14784del6 (p.Val4927_Ile4928del) rs193922893
NM_000540.2(RYR1):c.14814C>G (p.Ile4938Met) rs118192159
NM_000540.2(RYR1):c.14818G>A (p.Ala4940Thr) rs118192158
NM_000540.2(RYR1):c.178G>A (p.Asp60Asn) rs118192160
NM_000540.2(RYR1):c.212C>A (p.Ser71Tyr) rs118192113
NM_000540.2(RYR1):c.4729G>A (p.Ala1577Thr) rs118192120
NM_000540.2(RYR1):c.6178G>T (p.Gly2060Cys) rs35364374
NM_000540.2(RYR1):c.6487C>T (p.Arg2163Cys) rs118192175
NM_000540.2(RYR1):c.6488G>A (p.Arg2163His) rs118192163
NM_000540.2(RYR1):c.7354C>T (p.Arg2452Trp) rs118192124
NM_000540.2(RYR1):c.7361G>A (p.Arg2454His) rs118192122
NM_000540.2(RYR1):c.7522C>T (p.Arg2508Cys) rs118192178
NM_000543.4(SMPD1):c.1267C>T (p.His423Tyr) rs120074126
NM_000543.4(SMPD1):c.1426C>T rs182812968
NM_000548.3(TSC2):c.4508A>C (p.Gln1503Pro) rs45516293
NM_000548.4(TSC2):c.3106T>C (p.Ser1036Pro) rs45517281
NM_000553.4(WRN):c.3139-1G>C rs113993961
NM_000553.4(WRN):c.3590delA (p.Asn1197Thrfs) rs281865160
NM_000553.5(WRN):c.1105C>T (p.Arg369Ter) rs17847577
NM_000553.5(WRN):c.2500C>T (p.Arg834Cys) rs3087425
NM_000558.5(HBA1):c.223G>C (p.Asp75His) rs28928875
NM_000602.4(SERPINE1):c.-820_-817G(4_5) rs1799762
NM_000602.4(SERPINE1):c.43G>A (p.Ala15Thr) rs6092
NM_000639.2(FASLG):c.466A>G (p.Arg156Gly) rs80358238
NM_000642.2(AGL):c.1222C>T (p.Arg408Ter) rs113994128
NM_000642.2(AGL):c.16C>T (p.Gln6Ter) rs113994126
NM_000642.2(AGL):c.18_19delGA (p.Gln6Hisfs) rs113994127
NM_000642.2(AGL):c.2039G>A (p.Trp680Ter) rs113994129
NM_000642.2(AGL):c.2590C>T (p.Arg864Ter) rs113994130
NM_000642.2(AGL):c.3682C>T (p.Arg1228Ter) rs113994131
NM_000642.2(AGL):c.3965delT (p.Val1322Alafs) rs113994132
NM_000642.2(AGL):c.4260-12A>G rs369973784
NM_000642.2(AGL):c.4456delT (p.Ser1486Profs) rs113994134
NM_000660.6(TGFB1):c.29C>T (p.Pro10Leu) rs1800470
NM_000709.3(BCKDHA):c.1312T>A (p.Tyr438Asn) rs137852870
NM_000719.6(CACNA1C):c.1204G>A (p.Gly402Ser) rs80315385
NM_000719.6(CACNA1C):c.1216G>A (p.Gly406Arg) rs79891110
NM_000719.6(CACNA1C):c.1468G>A (p.Gly490Arg) rs121912775
NM_000719.6(CACNA1C):c.4418C>G (p.Ala1473Gly) rs794727587
NM_000742.3(CHRNA2):c.836T>A (p.Ile279Asn) rs104894063
NM_000744.6(CHRNA4):c.1007G>A (p.Arg336His) rs281865068
NM_000744.6(CHRNA4):c.839C>T (p.Ser280Phe) rs121909580
NM_000744.6(CHRNA4):c.851C>T (p.Ser284Leu) rs28931591
NM_000748.2(CHRNB2):c.859G>A (p.Val287Met) rs74315291
NM_000748.2(CHRNB2):c.859G>C (p.Val287Leu) rs74315291
NM_000748.2(CHRNB2):c.923T>C (p.Val308Ala) rs281865070
NM_000756.3(CRH):c.89C>G (p.Pro30Arg) rs748404250
NM_000784.3(CYP27A1):c.1016C>T (p.Thr339Met) rs121908102
NM_000784.3(CYP27A1):c.1151C>T (p.Pro384Leu) rs41272687
NM_000784.3(CYP27A1):c.1183C>A (p.Arg395Ser) rs121908096
NM_000784.3(CYP27A1):c.1184+1G>A rs587778777
NM_000784.3(CYP27A1):c.1184G>A (p.Arg395His) rs587778778
NM_000784.3(CYP27A1):c.1209C>G (p.Asn403Lys) rs587778781
NM_000784.3(CYP27A1):c.1213C>T (p.Arg405Trp) rs573951598
NM_000784.3(CYP27A1):c.1214G>A (p.Arg405Gln) rs121908099
NM_000784.3(CYP27A1):c.1263+1G>A rs397515355
NM_000784.3(CYP27A1):c.1420C>T (p.Arg474Trp) rs121908098
NM_000784.3(CYP27A1):c.1421G>A (p.Arg474Gln) rs121908097
NM_000784.3(CYP27A1):c.1435C>G (p.Arg479Gly) rs72551322
NM_000784.3(CYP27A1):c.1435C>T (p.Arg479Cys) rs72551322
NM_000784.3(CYP27A1):c.243G>A (p.Leu81=) rs75897848
NM_000784.3(CYP27A1):c.379C>T (p.Arg127Trp) rs201114717
NM_000784.3(CYP27A1):c.380G>A (p.Arg127Gln) rs376230356
NM_000784.3(CYP27A1):c.409C>T (p.Arg137Trp) rs72551312
NM_000784.3(CYP27A1):c.410G>A (p.Arg137Gln) rs587778818
NM_000784.3(CYP27A1):c.434G>A (p.Gly145Glu) rs72551313
NM_000784.3(CYP27A1):c.435G>T (p.Gly145=) rs587778796
NM_000784.3(CYP27A1):c.438G>A (p.Pro146=) rs692003
NM_000784.3(CYP27A1):c.446+1G>A rs587778797
NM_000784.3(CYP27A1):c.475C>T (p.Gln159Ter) rs72551314
NM_000784.3(CYP27A1):c.526delG (p.Asp176Metfs) rs765512351
NM_000784.3(CYP27A1):c.745C>T (p.Gln249Ter) rs72551316
NM_000784.3(CYP27A1):c.776A>G (p.Lys259Arg) rs72551317
NM_000784.3(CYP27A1):c.808C>T (p.Arg270Ter) rs72551318
NM_000784.3(CYP27A1):c.819delT (p.Asp273Glufs) rs587778812
NM_000784.3(CYP27A1):c.844+1G>A rs397515354
NM_000784.3(CYP27A1):c.845-1G>A rs397515353
NM_000784.3(CYP27A1):c.882G>A (p.Glu294=) rs59428328
NM_000784.3(CYP27A1):c.888A>G (p.Gln296=) rs61733619
NM_000784.3(CYP27A1):c.944_948delTGGCC (p.Leu315Glnfs) rs397515356
NM_000784.4(CYP27A1):c.1183C>T (p.Arg395Cys) rs121908096
NM_000784.4(CYP27A1):c.1185-1G>T rs587778779
NM_000824.4(GLRB):c.610+5G>A rs281864922
NM_000824.4(GLRB):c.752G>A (p.Gly251Asp) rs121909749
NM_000833.4(GRIN2A):c.1553G>A (p.Arg518His) rs397518470
NM_000833.4(GRIN2A):c.2146G>A (p.Ala716Thr) rs762659685
NM_000833.4(GRIN2A):c.2927A>G (p.Asn976Ser) rs886039239
NM_000890.3(KCNJ5):c.1159G>C (p.Gly387Arg) rs199830292
NM_000891.2(KCNJ2):c.953A>G (p.Asn318Ser) rs367560052
NM_000920.3(PC):c.1351C>T (p.Arg451Cys) rs113994143
NM_000920.3(PC):c.1828G>A (p.Ala610Thr) rs28940589
NM_000920.3(PC):c.1892G>A (p.Arg631Gln) rs113994145
NM_000920.3(PC):c.2229G>T (p.Met743Ile) rs28940590
NM_000920.3(PC):c.2619C>T (p.Asn873=) rs2229745
NM_000920.3(PC):c.434T>C (p.Val145Ala) rs28940591
NM_000996.2(RPL35A):c.304C>T (p.Arg102Ter) rs116840809
NM_000996.2(RPL35A):c.82_84delCTT (p.Leu28del) rs116840807
NM_000996.2(RPL35A):c.97G>A (p.Val33Ile) rs116840808
NM_001005741.2(GBA):c.115+1G>A rs104886460
NM_001005741.2(GBA):c.1265_1319del55 (p.Leu422Profs) rs80356768
NM_001005741.2(GBA):c.1297G>T (p.Val433Leu) rs80356769
NM_001005741.2(GBA):c.1343A>T (p.Asp448Val) rs77369218
NM_001005741.2(GBA):c.1504C>T (p.Arg502Cys) rs80356771
NM_001005741.2(GBA):c.1505G>A (p.Arg502His) rs80356772
NM_001005741.2(GBA):c.680A>G (p.Asn227Ser) rs364897
NM_001005741.2(GBA):c.703T>C (p.Ser235Pro) rs1064644
NM_001005741.2(GBA):c.887G>A (p.Arg296Gln) rs78973108
NM_001006657.1(WDR35):c.1592T>C (p.Leu531Pro) rs397515533
NM_001006657.1(WDR35):c.1877A>G (p.Glu626Gly) rs267607174
NM_001006657.1(WDR35):c.1922T>G (p.Leu641Ter) rs199952377
NM_001006657.1(WDR35):c.2623G>A (p.Ala875Thr) rs267607175
NM_001006657.1(WDR35):c.2891del (p.Pro964Leufs) rs397515334
NM_001007792.1(NTRK1):c.1730G>T (p.Gly577Val) rs6339
NM_001009944.2(PKD1):c.9829C>T (p.Arg3277Cys) rs148812376
NM_001010892.2(RSPH4A):c.1468C>T (p.Arg490Ter) rs118204043
NM_001010892.2(RSPH4A):c.325C>T (p.Gln109Ter) rs118204042
NM_001010892.2(RSPH4A):c.460C>T (p.Gln154Ter) rs118204041
NM_001011.4(RPS7):c.147+1G>A rs397507554
NM_001017420.2(ESCO2):c.1111dupA (p.Thr371Asnfs) rs80359859
NM_001017420.2(ESCO2):c.1132-7A>G rs80359862
NM_001017420.2(ESCO2):c.1269G>A (p.Trp423Ter) rs80359864
NM_001017420.2(ESCO2):c.1615T>G (p.Trp539Gly) rs80359868
NM_001017420.2(ESCO2):c.239C>T (p.Ala80Val) rs4732748
NM_001017420.2(ESCO2):c.294_297delGAGA (p.Arg99Serfs) rs80359845
NM_001017420.2(ESCO2):c.505C>T (p.Arg169Ter) rs80359849
NM_001017420.2(ESCO2):c.604C>T (p.Gln202Ter) rs80359850
NM_001017420.2(ESCO2):c.751dupG (p.Glu251Glyfs) rs1554554098
NM_001017420.2(ESCO2):c.760delA (p.Thr254Leufs) rs80359852
NM_001017420.2(ESCO2):c.760dupA (p.Thr254Asnfs) rs80359852
NM_001021.5(RPS17):c.200_201delGA (p.Gly68Tyrfs) rs116840812
NM_001021.6(RPS17):c.2T>G (p.Met1Arg) rs116840811
NM_001023570.3(IQCB1):c.1178T>A (p.Ile393Asn) rs1141528
NM_001024630.3(RUNX2):c.598A>G (p.Thr200Ala) rs104893993
NM_001024943.1(ASL):c.1153C>T (p.Arg385Cys) rs28940286
NM_001031681.2(CTNS):c.198_218del21 (p.Ile67_Pro73del) rs113994204
NM_001031726.3(C19orf12):c.187G>C (p.Ala63Pro) rs376103979
NM_001031847.2(CPT1A):c.948delG (p.Ile317Serfs) rs80356800
NM_001034850.2(RETREG1):c.1135C>G (p.Gln379Glu) rs34432513
NM_001034850.2(RETREG1):c.1145G>C (p.Ser382Thr) rs61733811
NM_001034850.2(RETREG1):c.433C>T (p.Gln145Ter) rs137852737
NM_001034850.2(RETREG1):c.926C>G (p.Ser309Ter) rs137852739
NM_001035.2(RYR2):c.12602A>G (p.Gln4201Arg) rs121918605
NM_001035.2(RYR2):c.13489C>T (p.Arg4497Cys) rs121918600
NM_001035.2(RYR2):c.13957G>T (p.Val4653Phe) rs121918604
NM_001035.2(RYR2):c.6982C>T (p.Pro2328Ser) rs121918603
NM_001039958.2(MESP2):c.197C>G (p.Ala66Gly) rs71647809
NM_001039958.2(MESP2):c.241G>T (p.Gly81Ter) rs118204034
NM_001039958.2(MESP2):c.307G>T (p.Glu103Ter) rs71647808
NM_001039958.2(MESP2):c.373C>G (p.Leu125Val) rs71647806
NM_001039958.2(MESP2):c.500_503dup (p.Gly169Profs) rs113994158
NM_001039958.2(MESP2):c.700G>T (p.Glu234Ter) rs118204035
NM_001040167.1(LFNG):c.564C>A (p.Phe188Leu) rs104894024
NM_001042432.1(CLN3):c.461-280_677+382del rs1555468634
NM_001044385.2(TMEM237):c.52C>T (p.Arg18Ter) rs199469707
NM_001080116.1(LDB3):c.440C>T (p.Ala147Val) rs281865143
NM_001097642.2(GJB1):c.572_580dup(p.Phe193_Met194insThrValPhe) rs116840823
NM_001099274.1(TINF2):c.844C>T (p.Arg282Cys) rs121918545
NM_001099274.1(TINF2):c.847C>T (p.Pro283Ser) rs199422311
NM_001099274.2(TINF2):c.706C>T (p.Pro236Ser) rs199422321
NM_001099274.2(TINF2):c.734C>A (p.Ser245Tyr) rs142777869
NM_001099274.2(TINF2):c.838A>G (p.Lys280Glu) rs121918543
NM_001099274.2(TINF2):c.841G>A (p.Glu281Lys) rs199422322
NM_001099274.2(TINF2):c.844C>A (p.Arg282Ser) rs121918545
NM_001100.3(ACTA1):c.1000C>T (p.Pro334Ser) rs121909531
NM_001100.3(ACTA1):c.16G>A (p.Glu6Lys) rs367543048
NM_001100.3(ACTA1):c.668T>C (p.Leu223Pro) rs121909530
NM_001100.3(ACTA1):c.881A>T (p.Asp294Val) rs121909529
NM_001101.3(ACTB):c.220G>A (p.Gly74Ser) rs587779770
NM_001101.3(ACTB):c.586C>T (p.Arg196Cys) rs281875333
NM_001101.4(ACTB):c.547C>T (p.Arg183Trp) rs104894003
NM_001110556.1(FLNA):c.1923C>T (p.Gly641=) rs80338841
NM_001110556.1(FLNA):c.3562G>A (p.Ala1188Thr) rs28935472
NM_001110556.1(FLNA):c.3596C>T (p.Ser1199Leu) rs28935473
NM_001110556.1(FLNA):c.5217G>A (p.Thr1739=) rs387907371
NM_001110556.1(FLNA):c.65_66delAC (p.Thr23Alafs) rs80338840
NM_001111.5(ADAR):c.3019G>A (p.Gly1007Arg) rs398122822
NM_001111.5(ADAR):c.577C>G (p.Pro193Ala) rs145588689
NM_001114982.1(TP63):c.16A>C (p.Asn6His) rs113993963
NM_001122764.3(PPOX):c.175C>T (p.Arg59Trp) rs121918324
NM_001122764.3(PPOX):c.35T>C (p.Ile12Thr) rs28936677
NM_001127605.2(LIPA):c.260G>T (p.Gly87Val) rs587778878
NM_001127701.1(SERPINA1):c.1096G>A (p.Glu366Lys) rs28929474
NM_001127701.1(SERPINA1):c.1159G>A (p.Glu387Lys) rs121912712
NM_001127701.1(SERPINA1):c.1178C>T (p.Pro393Leu) rs199422209
NM_001127701.1(SERPINA1):c.194T>C (p.Leu65Pro) rs28931569
NM_001127701.1(SERPINA1):c.227_229del (p.Phe76del) rs775982338
NM_001127701.1(SERPINA1):c.230C>T (p.Ser77Phe) rs55819880
NM_001127701.1(SERPINA1):c.272G>A (p.Gly91Glu) rs28931568
NM_001127701.1(SERPINA1):c.347T>A (p.Ile116Asn) rs28931572
NM_001127701.1(SERPINA1):c.739C>T (p.Arg247Cys) rs28929470
NM_001127701.1(SERPINA1):c.863A>T (p.Glu288Val) rs17580
NM_001127713.1(ATL1):c.470T>G (p.Leu157Trp) rs119476051
NM_001128227.2(GNE):c.2228T>C (p.Met743Thr) rs28937594
NM_001128425.1(MUTYH):c.1118C>T (p.Ala373Val) rs35352891
NM_001128425.1(MUTYH):c.1187G>A (p.Gly396Asp) rs36053993
NM_001128425.1(MUTYH):c.1227_1228dupGG (p.Glu410Glyfs) rs587780078
NM_001128425.1(MUTYH):c.857G>A (p.Gly286Glu) rs730881833
NM_001129765.1(NSDHL):c.1098dupT (p.Arg367Serfs) rs121909834
NM_001129765.1(NSDHL):c.262C>T (p.Arg88Ter) rs104894903
NM_001129765.1(NSDHL):c.314C>T (p.Ala105Val) rs104894909
NM_001129765.1(NSDHL):c.613G>A (p.Gly205Ser) rs104894901
NM_001129765.1(NSDHL):c.696_698delGAA (p.Lys232del) rs121909833
NM_001131019.2(GFAP):c.1289G>A (p.Arg430His) rs748860341
NM_001135242.1(NDRG1):c.442C>T (p.Arg148Ter) rs119483085
NM_001145320.1(ADAMTSL2):c.2431G>A (p.Gly811Arg) rs113994124
NM_001145320.1(ADAMTSL2):c.2586G>A (p.Trp862Ter) rs113994125
NM_001145320.1(ADAMTSL2):c.338G>A (p.Arg113His) rs113994122
NM_001145320.1(ADAMTSL2):c.340G>A (p.Glu114Lys) rs113994123
NM_001145320.1(ADAMTSL2):c.440C>T (p.Pro147Leu) rs113994121
NM_001146040.1(GLRA1):c.(?_-287)_(912+?)del
NM_001146040.1(GLRA1):c.690C>A (p.Tyr230Ter) rs121918415
NM_001146040.1(GLRA1):c.777C>G (p.Ser259Arg) rs121918417
NM_001146040.1(GLRA1):c.815T>A (p.Ile272Asn) rs121918409
NM_001146040.1(GLRA1):c.832C>A (p.Pro278Thr) rs121918413
NM_001146040.1(GLRA1):c.862G>A (p.Val288Met) rs121918416
NM_001146040.1(GLRA1):c.882G>C (p.Gln294His) rs121918411
NM_001146040.1(GLRA1):c.896G>A (p.Arg299Gln) rs121918408
NM_001146040.1(GLRA1):c.910A>G (p.Lys304Glu) rs121918412
NM_001163213.1(FGFR3):c.1626C>G (p.Asn542Lys) rs28933068
NM_001163213.1(FGFR3):c.833A>G (p.Tyr278Cys) rs121913115
NM_001164675.1(SUMF1):c.836C>T (p.Ala279Val) rs137852849
NM_001173990.2(TMEM216):c.218G>T (p.Arg73Leu) rs201108965
NM_001184985.1(WNK1):c.3021dupA (p.Ser1008Ilefs) rs137852735
NM_001184985.1(WNK1):c.3046C>T (p.Gln1016Ter) rs111033590
NM_001193466.1(KANSL1):c.1652+1G>A rs281865470
NM_001193466.1(KANSL1):c.1816C>T (p.Arg606Ter) rs281865469
NM_001193466.1(KANSL1):c.2785_2786delAG (p.Arg929Glyfs) rs281865471
NM_001193466.1(KANSL1):c.916C>T (p.Gln306Ter) rs281865468
NM_001193466.1(KANSL1):c.985_986delTT (p.Leu329Glufs) rs281865473
NM_001194958.2(KCNJ18):c.1061C>T (p.Thr354Met) rs527236158
NM_001194958.2(KCNJ18):c.1097A>G (p.Lys366Arg) rs527236159
NM_001194958.2(KCNJ18):c.429delC (p.Ile144Serfs) rs527236153
NM_001204824.1(KCNQ3):c.1043A>G (p.Asn348Ser) rs118192252
NM_001206927.1(DNAH8):c.2419C>T (p.Arg807Ter) rs567050969
NM_001232.3(CASQ2):c.919G>C (p.Asp307His) rs121434549
NM_001232.3(CASQ2):c.97C>T (p.Arg33Ter) rs397507556
NM_001242896.1(DEPDC5):c.1909C>T (p.Arg637Ter) rs780960812
NM_001242896.1(DEPDC5):c.3265-3C>T rs371377906
NM_001242896.2(DEPDC5):c.1355C>T (p.Ala452Val) rs202226316
NM_001242896.2(DEPDC5):c.161A>C (p.Gln54Pro) rs201312113
NM_001242896.2(DEPDC5):c.2591C>T (p.Thr864Met) rs564667614
NM_001242896.2(DEPDC5):c.268G>A (p.Val90Ile) rs768456731
NM_001242896.2(DEPDC5):c.3241A>C (p.Thr1081Pro) rs142540948
NM_001242896.2(DEPDC5):c.3484A>G (p.Ser1162Gly) rs886039280
NM_001242896.2(DEPDC5):c.814G>T (p.Val272Leu) rs187334123
NM_001244008.1(KIF1A):c.2840delT (p.Leu947Argfs) rs587778791
NM_001256850.1(TTN):c.102966delA (p.Lys34322Asnfs) rs281864930
NM_001256850.1(TTN):c.90203C>G (p.Pro30068Arg) rs869320739
NM_001256850.1(TTN):c.90264G>C (p.Trp30088Cys) rs869320742
NM_001256850.1(TTN):c.97348C>T (p.Arg32450Trp) rs140319117
NM_001257180.1(SLC20A2):c.1802C>G (p.Ser601Trp) rs387906652
NM_001257180.1(SLC20A2):c.1802C>T (p.Ser601Leu) rs387906652
NM_001257989.1(TYMP):c.1315+1G>A rs1064792878
NM_001267550.2(TTN):c.95372G>A (p.Gly31791Asp) rs869320744
NM_001271.3(CHD2):c.361C>T (p.Arg121Ter) rs397514740
NM_001277115.1(DNAH11):c.12363C>G (p.Tyr4121Ter) rs121908855
NM_001277115.1(DNAH11):c.13531_*36del57 rs1554294478
NM_001277115.1(DNAH11):c.8533C>T (p.Arg2845Ter) rs121908854
NM_001281723.2(BTD):c.104_110delGCGGCTGinsTCC (p.Cys35Phefs) rs80338684
NM_001281723.2(BTD):c.1618C>T (p.Arg540Cys) rs80338686
NM_001281723.2(BTD):c.517G>A (p.Ala173Thr) rs13073139
NM_001281724.2(BTD):c.1336G>C (p.Asp446His) rs13078881
NM_001281724.2(BTD):c.1374A>C (p.Gln458His) rs80338685
NM_001282624.1(LMNA):c.342C>G (p.Asn114Lys) rs28933091
NM_001287.5(CLCN7):c.1252G>A (p.Val418Met) rs12926089
NM_001287.5(CLCN7):c.2299C>T (p.Arg767Trp) rs121434435
NM_001287.5(CLCN7):c.296A>G (p.Tyr99Cys) rs387907576
NM_001301339.1(CHCHD10):c.100C>T (p.Pro34Ser) rs551521196
NM_001301339.1(CHCHD10):c.239C>T (p.Pro80Leu) rs775332895
NM_001301339.1(CHCHD10):c.44G>T (p.Arg15Leu) rs730880030
NM_001317924.1(WDR19):c.1649T>C (p.Leu550Ser) rs387906980
NM_001360.2(DHCR7):c.1054C>T (p.Arg352Trp) rs80338860
NM_001360.2(DHCR7):c.1210C>T (p.Arg404Cys) rs61757582
NM_001360.2(DHCR7):c.1228G>A (p.Gly410Ser) rs80338862
NM_001360.2(DHCR7):c.1342G>A (p.Glu448Lys) rs80338864
NM_001360.2(DHCR7):c.278C>T (p.Thr93Met) rs80338853
NM_001360.2(DHCR7):c.452G>A (p.Trp151Ter) rs11555217
NM_001360.2(DHCR7):c.506C>T (p.Ser169Leu) rs80338855
NM_001360.2(DHCR7):c.724C>T (p.Arg242Cys) rs80338856
NM_001360.2(DHCR7):c.725G>A (p.Arg242His) rs80338857
NM_001360.2(DHCR7):c.832-1G>C rs80338863
NM_001360.2(DHCR7):c.906C>G (p.Phe302Leu) rs80338858
NM_001360.2(DHCR7):c.976G>T (p.Val326Leu) rs80338859
NM_001363.3(DKC1):c.146C>T (p.Thr49Met) rs121912304
NM_001363.3(DKC1):c.361A>G (p.Ser121Gly) rs121912305
NM_001363.4(DKC1):c.-142C>G rs199422241
NM_001363.4(DKC1):c.1058C>T (p.Ala353Val) rs121912288
NM_001363.4(DKC1):c.106T>G (p.Phe36Val) rs121912293
NM_001363.4(DKC1):c.109_111delCTT (p.Leu37del) rs137854489
NM_001363.4(DKC1):c.113T>C (p.Ile38Thr) rs28936072
NM_001363.4(DKC1):c.119C>G (p.Pro40Arg) rs121912292
NM_001363.4(DKC1):c.1205G>A (p.Gly402Glu) rs121912295
NM_001363.4(DKC1):c.1223C>T (p.Thr408Ile) rs199422254
NM_001363.4(DKC1):c.472C>T (p.Arg158Trp) rs199422246
NM_001363.4(DKC1):c.838A>C (p.Ser280Arg) rs146700772
NM_001363.4(DKC1):c.91C>A (p.Gln31Lys) rs137854491
NM_001369.2(DNAH5):c.10815delT (p.Pro3606Hisfs) rs397515540
NM_001369.2(DNAH5):c.1730G>C (p.Arg577Thr) rs397515541
NM_001457.3(FLNB):c.1945C>T (p.Arg649Ter) rs80356517
NM_001457.3(FLNB):c.2452C>T (p.Arg818Ter) rs80356519
NM_001457.3(FLNB):c.4756G>A (p.Gly1586Arg) rs80356513
NM_001457.3(FLNB):c.4819C>T (p.Arg1607Ter) rs80356520
NM_001457.3(FLNB):c.482T>G (p.Phe161Cys) rs80356506
NM_001457.3(FLNB):c.5071G>A (p.Gly1691Ser) rs80356503
NM_001457.3(FLNB):c.6408delC (p.Ser2137Leufs) rs80356521
NM_001457.3(FLNB):c.679G>A (p.Glu227Lys) rs80356508
NM_001467.5(SLC37A4):c.1042_1043delCT (p.Leu348Valfs) rs80356491
NM_001482.2(GATM):c.446G>A (p.Trp149Ter) rs80338737
NM_001482.2(GATM):c.484+1G>T rs80338738
NM_001614.5(ACTG1):c.766C>T (p.Arg256Trp) rs281875329
NM_001739.2(CA5A):c.555G>A (p.Lys185=) rs147623570
NM_001759.3(CCND2):c.838A>G (p.Thr280Ala) rs587777618
NM_001845.5(COL4A1):c.1493G>T (p.Gly498Val) rs113994104
NM_001845.5(COL4A1):c.1555G>A (p.Gly519Arg) rs113994105
NM_001845.5(COL4A1):c.1583G>A (p.Gly528Glu) rs113994106
NM_001845.5(COL4A1):c.1A>T (p.Met1Leu) rs113994103
NM_001845.5(COL4A1):c.2159G>A (p.Gly720Asp) rs113994108
NM_001845.5(COL4A1):c.2245G>A (p.Gly749Ser) rs113994109
NM_001845.5(COL4A1):c.3389G>A (p.Gly1130Asp) rs113994111
NM_001845.5(COL4A1):c.3706G>A (p.Gly1236Arg) rs113994112
NM_001845.5(COL4A1):c.4267G>C (p.Gly1423Arg) rs113994113
NM_001845.5(COL4A1):c.4738G>C (p.Gly1580Arg) rs113994114
NM_001876.3(CPT1A):c.(?_1744)_2107del (p.(?))
NM_001876.3(CPT1A):c.1079A>G (p.Glu360Gly) rs80356787
NM_001876.3(CPT1A):c.1241C>T (p.Ala414Val) rs80356790
NM_001876.3(CPT1A):c.1361A>G (p.Asp454Gly) rs80356778
NM_001876.3(CPT1A):c.1436C>T (p.Pro479Leu) rs80356779
NM_001876.3(CPT1A):c.1493A>G (p.Tyr498Cys) rs80356791
NM_001876.3(CPT1A):c.1876-1G>A (p.Val626_Glu676del) rs80356798
NM_001876.3(CPT1A):c.2126G>A (p.Gly709Glu) rs28936374
NM_001876.3(CPT1A):c.2129G>A (p.Gly710Glu) rs80356780
NM_001876.3(CPT1A):c.298C>T (p.Gln100Ter) rs80356774
NM_001876.3(CPT1A):c.367C>T (p.Arg123Cys) rs80356775
NM_001876.3(CPT1A):c.478C>T (p.Arg160Ter) rs80356782
NM_001876.3(CPT1A):c.823G>A (p.Ala275Thr) rs2229738
NM_001876.3(CPT1A):c.946C>G (p.Arg316Gly) rs80356796
NM_001885.2(CRYAB):c.343delT (p.Ser115Profs) rs281865142
NM_001885.2(CRYAB):c.358A>G (p.Arg120Gly) rs104894201
NM_001885.2(CRYAB):c.60del (p.Ser21Alafs) rs281865141
NM_001920.4(DCN):c.941delC (p.Pro314Hisfs) rs80338742
NM_001920.4(DCN):c.947delG (p.Gly316Aspfs) rs397515545
NM_001920.4(DCN):c.967delT (p.Ser323Leufs) rs80338741
NM_001927.3(DES):c.517_537del21 (p.Ala174_Arg180del) rs60538473
NM_001953.3(TYMP):c.665A>G rs149977726
NM_001953.4(TYMP):c.1393G>A (p.Ala465Thr) rs112723255
NM_001953.4(TYMP):c.1401C>T (p.Phe467=) rs1061205
NM_001953.4(TYMP):c.1412C>T (p.Ser471Leu) rs11479
NM_001953.4(TYMP):c.622G>A (p.Val208Met) rs121913039
NM_001953.4(TYMP):c.831G>A (p.Leu277=) rs8141558
NM_001953.4(TYMP):c.929-6_929-3del rs201685922
NM_002055.4(GFAP):c.715C>G (p.Arg239Gly) rs58064122
NM_002055.4(GFAP):c.934G>T (p.Glu312Ter) rs763868966
NM_002087.3(GRN):c.1477C>T (p.Arg493Ter) rs63751294
NM_002111.6(HTT):c.53_55[(41_?)] (p.Gln40(41_?)) rs71180116
NM_002140.4(HNRNPK):c.257G>A (p.Arg86His) rs863223403
NM_002180.2(IGHMBP2):c.1591C>A (p.Pro531Thr) rs756985703
NM_002180.2(IGHMBP2):c.1738G>A (p.Val580Ile) rs137852667
NM_002180.2(IGHMBP2):c.2911_2912delAG (p.Arg971Glufs) rs724159994
NM_002180.2(IGHMBP2):c.449+1G>T rs797044802
NM_002230.2(JUP):c.116_118dupGCA (p.Ser39_Lys40insSer) rs113994176
NM_002230.2(JUP):c.2038_2039delTG (p.Trp680Glyfs) rs113994177
NM_002230.2(JUP):c.2089A>T (p.Met697Leu) rs1126821
NM_002381.4(MATN3):c.209G>A (p.Arg70His) rs104893640
NM_002381.4(MATN3):c.361C>T (p.Arg121Trp) rs104893637
NM_002381.4(MATN3):c.910T>A (p.Cys304Ser) rs104893639
NM_002437.4(MPV17):c.148C>T (p.Arg50Trp) rs121909723
NM_002437.4(MPV17):c.149G>A (p.Arg50Gln) rs121909721
NM_002437.4(MPV17):c.186+2T>C rs147952488
NM_002437.4(MPV17):c.206G>A (p.Trp69Ter) rs267607261
NM_002437.4(MPV17):c.263_265delAGA (p.Lys88del) rs267607263
NM_002437.4(MPV17):c.271_273delTTG (p.Leu91del) rs267607264
NM_002437.4(MPV17):c.359G>A (p.Trp120Ter) rs121909724
NM_002437.4(MPV17):c.451dupC (p.Leu151Profs) rs267607267
NM_002437.4(MPV17):c.462-904_*601del1575insGCCTG
NM_002437.4(MPV17):c.498C>A (p.Asn166Lys) rs121909722
NM_002437.4(MPV17):c.70G>T (p.Gly24Trp) rs121909725
NM_002437.5(MPV17):c.293C>T (p.Pro98Leu) rs267607258
NM_002449.4(MSX2):c.443C>A (p.Pro148His) rs104893895
NM_002473.5(MYH9):c.2104C>T (p.Arg702Cys) rs80338826
NM_002473.5(MYH9):c.2105G>A (p.Arg702His) rs80338827
NM_002473.5(MYH9):c.2114G>A (p.Arg705His) rs80338828
NM_002473.5(MYH9):c.287C>T (p.Ser96Leu) rs121913657
NM_002473.5(MYH9):c.3493C>T (p.Arg1165Cys) rs80338829
NM_002473.5(MYH9):c.4270G>A (p.Asp1424Asn) rs80338831
NM_002473.5(MYH9):c.4270G>C (p.Asp1424His) rs80338831
NM_002473.5(MYH9):c.5521G>A (p.Glu1841Lys) rs80338834
NM_002473.5(MYH9):c.5797C>T (p.Arg1933Ter) rs80338835
NM_002485.4(NBN):c.643C>T (p.Arg215Trp) rs34767364
NM_002485.4(NBN):c.657_661delACAAA (p.Lys219Asnfs) rs587776650
NM_002485.4(NBN):c.741_742dupGG (p.Glu248Glyfs) rs864309670
NM_002529.3(NTRK1):c.1660delC (p.Arg554Glyfs) rs80356675
NM_002529.3(NTRK1):c.1810C>T (p.His604Tyr) rs6336
NM_002529.3(NTRK1):c.1860_1861insT (p.Pro621Serfs) rs80356676
NM_002529.3(NTRK1):c.851-33T>A rs80356674
NM_002609.3(PDGFRB):c.1973T>C (p.Leu658Pro) rs397509381
NM_002609.3(PDGFRB):c.2959C>T (p.Arg987Trp) rs397509382
NM_002693.2(POLG):c.1399G>A (p.Ala467Thr) rs113994095
NM_002693.2(POLG):c.1550G>T (p.Gly517Val) rs61752783
NM_002693.2(POLG):c.1636C>T (p.Arg546Cys) rs2307447
NM_002693.2(POLG):c.1760C>T (p.Pro587Leu) rs113994096
NM_002693.2(POLG):c.1984G>A (p.Glu662Lys) rs2307450
NM_002693.2(POLG):c.2243G>C (p.Trp748Ser) rs113994097
NM_002693.2(POLG):c.2542G>A (p.Gly848Ser) rs113994098
NM_002693.2(POLG):c.2864A>G (p.Tyr955Cys) rs113994099
NM_002693.2(POLG):c.3424C>T (p.Arg1142Trp) rs2307442
NM_002693.2(POLG):c.3428A>G (p.Glu1143Gly) rs2307441
NM_002693.2(POLG):c.3436C>T (p.Arg1146Cys) rs2307440
NM_002693.2(POLG):c.3708G>T (p.Gln1236His) rs3087374
NM_002693.2(POLG):c.578G>A (p.Arg193Gln) rs3176162
NM_002693.2(POLG):c.695G>A (p.Arg232His) rs113994093
NM_002693.2(POLG):c.752C>T (p.Thr251Ile) rs113994094
NM_002693.2(POLG):c.970C>T (p.Pro324Ser) rs2307437
NM_002734.3(PRKAR1A):c.491_492delTG (p.Val164Aspfs) rs281864790
NM_002739.3(PRKCG):c.2075T>G (p.Val692Gly) rs78437096
NM_002739.3(PRKCG):c.2091_*98del102 rs1555808841
NM_002739.4(PRKCG):c.1081A>G (p.Ser361Gly) rs121918517
NM_002739.4(PRKCG):c.1927T>C (p.Phe643Leu) rs121918516
NM_002739.4(PRKCG):c.301C>T (p.His101Tyr) rs121918511
NM_002739.4(PRKCG):c.303C>G (p.His101Gln) rs121918518
NM_002739.4(PRKCG):c.353G>A (p.Gly118Asp) rs121918514
NM_002739.4(PRKCG):c.355T>C (p.Ser119Pro) rs121918512
NM_002739.4(PRKCG):c.356C>T (p.Ser119Phe) rs386134163
NM_002739.4(PRKCG):c.380A>G (p.Gln127Arg) rs121918515
NM_002739.4(PRKCG):c.383G>A (p.Gly128Asp) rs121918513
NM_002755.3(MAP2K1):c.171G>T (p.Lys57Asn) rs869025608
NM_002755.3(MAP2K1):c.199G>A (p.Asp67Asn) rs727504317
NM_002764.3(PRPS1):c.129A>C (p.Glu43Asp) rs80338731
NM_002764.3(PRPS1):c.344T>C (p.Met115Thr) rs80338732
NM_002764.3(PRPS1):c.398A>C (p.Gln133Pro) rs80338675
NM_002764.3(PRPS1):c.447G>A (p.Pro149=) rs80338730
NM_002764.3(PRPS1):c.455T>C (p.Leu152Pro) rs80338676
NM_002769.4(PRSS1):c.346C>T (p.Arg116Cys) rs387906698
NM_002769.4(PRSS1):c.364C>T (p.Arg122Cys) rs111033568
NM_002769.4(PRSS1):c.365G>A (p.Arg122His) rs111033565
NM_002769.4(PRSS1):c.47C>T (p.Ala16Val) rs202003805
NM_002769.4(PRSS1):c.68A>G (p.Lys23Arg) rs111033567
NM_002769.4(PRSS1):c.86A>T (p.Asn29Ile) rs111033566
NM_002775.4(HTRA1):c.102C>T (p.Ala34=) rs1049331
NM_002775.4(HTRA1):c.108G>C (p.Gly36=) rs2293870
NM_002775.4(HTRA1):c.108G>T (p.Gly36=) rs2293870
NM_002775.4(HTRA1):c.1108C>T (p.Arg370Ter) rs113993971
NM_002775.4(HTRA1):c.854C>T (p.Pro285Leu) rs587776446
NM_002834.3(PTPN11):c.179_181delGTG (p.Gly60del) rs80338836
NM_002834.4(PTPN11):c.1381G>A (p.Ala461Thr) rs121918468
NM_002834.4(PTPN11):c.1391G>C (p.Gly464Ala) rs121918469
NM_002834.4(PTPN11):c.1403C>T (p.Thr468Met) rs121918457
NM_002834.4(PTPN11):c.1492C>T (p.Arg498Trp) rs397507541
NM_002834.4(PTPN11):c.1493G>T (p.Arg498Leu) rs397507542
NM_002834.4(PTPN11):c.1517A>C (p.Gln506Pro) rs397507548
NM_002834.4(PTPN11):c.1528C>G (p.Gln510Glu) rs397507549
NM_002834.4(PTPN11):c.836A>G (p.Tyr279Cys) rs121918456
NM_002834.4(PTPN11):c.922A>G (p.Asn308Asp) rs28933386
NM_002863.4(PYGL):c.1016A>G (p.Asn339Ser) rs113993976
NM_002863.4(PYGL):c.1131C>G (p.Asn377Lys) rs113993977
NM_002863.4(PYGL):c.1195C>T (p.Arg399Ter) rs113993978
NM_002863.4(PYGL):c.1620+1G>A rs113993981
NM_002863.4(PYGL):c.1768+1G>A rs113993982
NM_002863.4(PYGL):c.1900G>C (p.Asp634His) rs35026927
NM_002863.4(PYGL):c.2042A>C (p.Lys681Thr) rs113993987
NM_002863.4(PYGL):c.38A>C (p.Gln13Pro) rs113993972
NM_002863.4(PYGL):c.529-1G>C rs113993974
NM_002880.3(RAF1):c.1472C>T (p.Thr491Ile) rs80338799
NM_002880.3(RAF1):c.1837C>G (p.Leu613Val) rs80338797
NM_002880.3(RAF1):c.770C>T (p.Ser257Leu) rs80338796
NM_002968.2(SALL1):c.3160C>T (p.Arg1054Ter) rs864321635
NM_002973.3:c.496_498CAG([33_?])
NM_002977.3(SCN9A):c.1828C>A (p.Pro610Thr) rs41268673
NM_002977.3(SCN9A):c.2543T>C (p.Ile848Thr) rs80356474
NM_002977.3(SCN9A):c.2572C>T (p.Leu858Phe) rs80356476
NM_002977.3(SCN9A):c.2573T>A (p.Leu858His) rs80356475
NM_002977.3(SCN9A):c.4345T>G (p.Phe1449Val) rs80356478
NM_002977.3(SCN9A):c.601T>G (p.Leu201Val) rs80356465
NM_002977.3(SCN9A):c.647T>C (p.Phe216Ser) rs80356469
NM_002977.3(SCN9A):c.721T>A (p.Ser241Thr) rs80356470
NM_003002.3(SDHD):c.112C>T (p.Arg38Ter) rs80338843
NM_003002.3(SDHD):c.242C>T (p.Pro81Leu) rs80338844
NM_003002.3(SDHD):c.274G>T (p.Asp92Tyr) rs80338845
NM_003002.3(SDHD):c.3G>C (p.Met1Ile) rs80338842
NM_003002.3(SDHD):c.416T>C (p.Leu139Pro) rs80338847
NM_003035.2(STIL):c.257C>T (p.Ala86Val) rs3125630
NM_003035.2(STIL):c.2826+1G>A rs199422206
NM_003035.2(STIL):c.3434C>T (p.Ala1145Val) rs3766317
NM_003035.2(STIL):c.3655delG (p.Val1219Terfs) rs199422207
NM_003035.2(STIL):c.3715C>T (p.Gln1239Ter) rs121918609
NM_003073.4(SMARCB1):c.1091_1093delAGA (p.Lys364del) rs875989800
NM_003122.4(SPINK1):c.101A>G (p.Asn34Ser) rs17107315
NM_003122.4(SPINK1):c.163C>T (p.Pro55Ser) rs111966833
NM_003122.4(SPINK1):c.199C>T (p.Arg67Cys) rs515726208
NM_003165.3(STXBP1):c.416C>T (p.Pro139Leu) rs796053353
NM_003221.3(TFAP2B):c.218C>G (p.Pro73Arg) rs80338910
NM_003221.3(TFAP2B):c.601+5G>A rs80338911
NM_003221.3(TFAP2B):c.706C>A (p.Arg236Ser) rs80338912
NM_003221.3(TFAP2B):c.706C>T (p.Arg236Cys) rs80338912
NM_003221.3(TFAP2B):c.824C>A (p.Ala275Asp) rs80338914
NM_003221.3(TFAP2B):c.854G>A (p.Arg285Gln) rs80338915
NM_003221.3(TFAP2B):c.898C>T (p.Arg300Cys) rs80338917
NM_003227.3(TFR2):c.1364G>A (p.Arg455Gln) rs41303501
NM_003227.3(TFR2):c.1403G>A (p.Arg468His) rs80338885
NM_003227.3(TFR2):c.1770C>T (p.Asp590=) rs35704760
NM_003227.3(TFR2):c.2069A>C (p.Gln690Pro) rs80338889
NM_003227.3(TFR2):c.2374G>A (p.Gly792Arg) rs80338891
NM_003227.3(TFR2):c.515T>A (p.Met172Lys) rs80338879
NM_003227.3(TFR2):c.714C>G (p.Ile238Met) rs34242818
NM_003227.3(TFR2):c.750C>G (p.Tyr250Ter) rs80338880
NM_003227.3(TFR2):c.88_89insC (p.Arg30Profs) rs80338877
NM_003283.5(TNNT1):c.538G>T (p.Glu180Ter) rs80358249
NM_003289.3(TPM2):c.349G>A (p.Glu117Lys) rs104894129
NM_003332.3(TYROBP):c.141delG (p.Met48Trpfs) rs386833840
NM_003334.3(UBA1):c.1617G>T (p.Met539Ile) rs80356545
NM_003334.3(UBA1):c.1639A>G (p.Ser547Gly) rs80356546
NM_003334.3(UBA1):c.1731C>T (p.Asn577=) rs80356547
NM_003383.4(VLDLR):c.1342C>T (p.Arg448Ter) rs80338905
NM_003383.4(VLDLR):c.2339delT (p.Ile780Thrfs) rs80338906
NM_003383.4(VLDLR):c.769C>T (p.Arg257Ter) rs80338907
NM_003392.4(WNT5A):c.206G>A (p.Cys69Tyr) rs786204837
NM_003611.2(OFD1):c.111+2T>C rs312262809
NM_003611.2(OFD1):c.1193_1196delAATC (p.Gln398Leufs) rs312262868
NM_003611.2(OFD1):c.1303A>C (p.Ser435Arg) rs122460150
NM_003611.2(OFD1):c.1887_1888insAT (p.Asn630Ilefs) rs312262886
NM_003611.2(OFD1):c.1923G>A (p.Glu641=) rs145300245
NM_003611.2(OFD1):c.260A>G (p.Tyr87Cys) rs312262818
NM_003611.2(OFD1):c.294_312delTGGTTTGGCAAAAGAAAAG (p.Ser98Argfs) rs312262821
NM_003611.2(OFD1):c.312+1delG rs312262822
NM_003611.2(OFD1):c.400_403delGAAA (p.Glu134Ilefs) rs312262830
NM_003611.2(OFD1):c.413-10T>G rs312262833
NM_003611.2(OFD1):c.710delA (p.Lys237Serfs) rs312262845
NM_003611.2(OFD1):c.877_878delAT (p.Met293Glyfs) rs312262858
NM_003611.3(OFD1):c.2123_2126dup (p.Asn711Lysfs) rs312262890
NM_003664.4(AP3B1):c.1168_1230del63 (p.Leu390_Gln410del) rs1554072100
NM_003664.4(AP3B1):c.1474-7072_1650+921del
NM_003664.4(AP3B1):c.1525C>T (p.Arg509Ter) rs121908906
NM_003664.4(AP3B1):c.1739T>G (p.Leu580Arg) rs121908904
NM_003664.4(AP3B1):c.1975G>T (p.Glu659Ter) rs121908907
NM_003722.4(TP63):c.1009C>G (p.Arg337Gly) rs113993966
NM_003722.4(TP63):c.1010G>A (p.Arg337Gln) rs113993967
NM_003850.2(SUCLA2):c.534+1G>A rs113994161
NM_003977.2(AIP):c.174G>C (p.Lys58Asn) rs267606539
NM_003977.3(AIP):c.135C>T (p.Asp45=) rs181969066
NM_003977.3(AIP):c.145G>A (p.Val49Met) rs1063385
NM_003977.3(AIP):c.469-1G>A rs267606555
NM_003977.3(AIP):c.47G>A (p.Arg16His) rs145047094
NM_003977.3(AIP):c.542delT (p.Ile182Serfs) rs267606559
NM_003977.3(AIP):c.591G>A (p.Glu197=) rs202006716
NM_003977.3(AIP):c.64C>T (p.Arg22Ter) rs121908357
NM_003977.3(AIP):c.66_71delAGGAGA (p.Gly23_Glu24del) rs267606567
NM_003977.3(AIP):c.804C>A (p.Tyr268Ter) rs121908356
NM_003977.3(AIP):c.807C>T (p.Phe269=) rs139407567
NM_003977.3(AIP):c.896C>T (p.Ala299Val) rs148986773
NM_003977.3(AIP):c.910C>T (p.Arg304Ter) rs104894195
NM_003977.3(AIP):c.911G>A (p.Arg304Gln) rs104894190
NM_003977.4(AIP):c.824dup (p.His275Glnfs) rs267606580
NM_004004.5(GJB2):c.101T>C (p.Met34Thr) rs35887622
NM_004004.5(GJB2):c.167delT (p.Leu56Argfs) rs80338942
NM_004004.5(GJB2):c.231G>A (p.Trp77Ter) rs80338944
NM_004004.5(GJB2):c.235delC (p.Leu79Cysfs) rs80338943
NM_004004.5(GJB2):c.269T>C (p.Leu90Pro) rs80338945
NM_004004.5(GJB2):c.339T>G (p.Ser113Arg) rs80338946
NM_004004.5(GJB2):c.358_360delGAG (p.Glu120del) rs80338947
NM_004004.5(GJB2):c.35G>T (p.Gly12Val) rs1801002
NM_004004.5(GJB2):c.35delG (p.Gly12Valfs) rs80338939
NM_004004.5(GJB2):c.487A>G (p.Met163Val) rs80338949
NM_004004.5(GJB2):c.551G>C (p.Arg184Pro) rs80338950
NM_004004.5(GJB2):c.56G>C (p.Ser19Thr) rs80338941
NM_004004.6(GJB2):c.-23+1G>A rs80338940
NM_004004.6(GJB2):c.109G>A (p.Val37Ile) rs72474224
NM_004004.6(GJB2):c.427C>T (p.Arg143Trp) rs80338948
NM_004004.6(GJB2):c.428G>A (p.Arg143Gln) rs104894401
NM_004082.4(DCTN1):c.167A>G (p.Lys56Arg) rs566433112
NM_004082.4(DCTN1):c.175G>A (p.Gly59Ser) rs121909342
NM_004082.4(DCTN1):c.211G>A (p.Gly71Arg) rs72466485
NM_004082.4(DCTN1):c.212G>A (p.Gly71Glu) rs67586389
NM_004082.4(DCTN1):c.221A>C (p.Gln74Pro) rs72466487
NM_004085.3(TIMM8A):c.198C>G (p.Cys66Trp) rs80356560
NM_004168.3(SDHA):c.1753C>T (p.Arg585Trp) rs200397144
NM_004168.3(SDHA):c.1765C>T (p.Arg589Trp) rs387906780
NM_004168.3(SDHA):c.91C>T (p.Arg31Ter) rs142441643
NM_004211.4(SLC6A5):c.1131C>A (p.Tyr377Ter) rs121908493
NM_004211.4(SLC6A5):c.1274C>T (p.Thr425Met) rs121908498
NM_004211.4(SLC6A5):c.1294delGinsTT (p.Val432Phefs) rs281864924
NM_004211.4(SLC6A5):c.1472A>G (p.Tyr491Cys) rs121908494
NM_004211.4(SLC6A5):c.1526A>G (p.Asn509Ser) rs121908497
NM_004211.4(SLC6A5):c.1530T>G (p.Ser510Arg) rs281864926
NM_004211.4(SLC6A5):c.1888C>T (p.Gln630Ter) rs121908495
NM_004211.4(SLC6A5):c.916C>G (p.Leu306Val) rs121908496
NM_004281.3(BAG3):c.626C>T (p.Pro209Leu) rs121918312
NM_004299.6(ABCB7):c.1234G>C (p.Val412Leu) rs80356713
NM_004299.6(ABCB7):c.1300G>A (p.Glu434Lys) rs80356714
NM_004304.4(ALK):c.3260C>T (p.Thr1087Ile) rs113994090
NM_004304.4(ALK):c.3383G>C (p.Gly1128Ala) rs113994088
NM_004304.4(ALK):c.3452C>T (p.Thr1151Met) rs113994091
NM_004304.4(ALK):c.3520T>G (p.Phe1174Val) rs281864719
NM_004304.4(ALK):c.3575G>C (p.Arg1192Pro) rs113994089
NM_004304.4(ALK):c.3733T>G (p.Phe1245Val) rs281864720
NM_004304.4(ALK):c.3749T>C (p.Ile1250Thr) rs113994092
NM_004304.4(ALK):c.3824G>A (p.Arg1275Gln) rs113994087
NM_004333.4(BRAF):c.721A>C (p.Thr241Pro) rs387906661
NM_004333.4(BRAF):c.735A>T (p.Leu245Phe) rs397507466
NM_004333.5(BRAF):c.1600G>C (p.Gly534Arg) rs180177041
NM_004333.5(BRAF):c.1787G>T (p.Gly596Val) rs397507483
NM_004333.5(BRAF):c.1789C>G (p.Leu597Val) rs121913369
NM_004333.5(BRAF):c.1799T>A (p.Val600Glu) rs113488022
NM_004333.5(BRAF):c.722C>T (p.Thr241Met) rs387906660
NM_004364.4(CEBPA):c.68delC (p.Pro23Argfs) rs137852728
NM_004366.5(CLCN2):c.143C>G (p.Pro48Arg) rs115661422
NM_004366.5(CLCN2):c.1730G>A (p.Arg577Gln) rs137852682
NM_004366.5(CLCN2):c.1795G>A (p.Asp599Asn) rs141242566
NM_004366.5(CLCN2):c.203G>A (p.Arg68His) rs61729156
NM_004366.5(CLCN2):c.2063G>A (p.Arg688Gln) rs111656822
NM_004366.5(CLCN2):c.2154G>C (p.Glu718Asp) rs2228292
NM_004366.5(CLCN2):c.2173C>T (p.Arg725Trp) rs114702742
NM_004366.5(CLCN2):c.218G>A (p.Arg73His) rs144412275
NM_004366.5(CLCN2):c.597dupG (p.Met200Aspfs) rs515726131
NM_004366.5(CLCN2):c.704G>A (p.Arg235Gln) rs71318369
NM_004366.6(CLCN2):c.2386C>T (p.Gln796Ter) rs376823689
NM_004518.5(KCNQ2):c.431G>A (p.Arg144Gln) rs796052618
NM_004519.3(KCNQ3):c.1241A>G (p.Glu414Gly) rs2303995
NM_004519.3(KCNQ3):c.1720C>T (p.Pro574Ser) rs74582884
NM_004519.3(KCNQ3):c.2462A>G (p.Asn821Ser) rs118192254
NM_004519.3(KCNQ3):c.988C>T (p.Arg330Cys) rs118192251
NM_004525.2(LRP2):c.2640-1G>A rs587776717
NM_004525.2(LRP2):c.8452+1G>A rs80338748
NM_004525.2(LRP2):c.8516_8519delTTTA (p.Tyr2840Cysfs) rs80338749
NM_004525.2(LRP2):c.9484_9485delGT (p.Val3162Leufs) rs80338751
NM_004525.3(LRP2):c.10195C>T (p.Arg3399Ter) rs80338752
NM_004525.3(LRP2):c.1093C>T (p.Arg365Ter) rs80338744
NM_004525.3(LRP2):c.1341+2T>G rs80338745
NM_004525.3(LRP2):c.7564T>C (p.Tyr2522His) rs80338747
NM_004543.4(NEB):c.7432-2025_7536+372del
NM_004562.2(PRKN):c.1096C>T (p.Arg366Trp) rs56092260
NM_004562.2(PRKN):c.1138G>C (p.Val380Leu) rs1801582
NM_004562.2(PRKN):c.500G>A (p.Ser167Asn) rs1801474
NM_004595.4(SMS):c.166G>A (p.Gly56Ser) rs121434610
NM_004595.4(SMS):c.200G>A (p.Gly67Glu) rs397515550
NM_004595.4(SMS):c.329+5G>A rs397515381
NM_004595.4(SMS):c.395T>G (p.Val132Gly) rs267607076
NM_004595.4(SMS):c.443A>G (p.Gln148Arg) rs397515551
NM_004614.4(TK2):c.156+2T>C rs281865499
NM_004614.4(TK2):c.159C>G (p.Ile53Met) rs137854432
NM_004614.4(TK2):c.173A>G (p.Asn58Ser) rs138439950
NM_004614.4(TK2):c.191C>T (p.Thr64Met) rs281865487
NM_004614.4(TK2):c.268C>T (p.Arg90Cys) rs281865489
NM_004614.4(TK2):c.323C>T (p.Thr108Met) rs137854431
NM_004614.4(TK2):c.361C>A (p.His121Asn) rs137854429
NM_004614.4(TK2):c.416C>T (p.Ala139Val) rs281865494
NM_004614.4(TK2):c.547C>G (p.Arg183Gly) rs137886900
NM_004614.4(TK2):c.547C>T (p.Arg183Trp) rs137886900
NM_004614.4(TK2):c.562A>G (p.Thr188Ala) rs281865495
NM_004614.4(TK2):c.575G>A (p.Arg192Lys) rs281865496
NM_004614.4(TK2):c.604_606delAAG (p.Lys202del) rs281865501
NM_004614.4(TK2):c.635T>A (p.Ile212Asn) rs137854430
NM_004614.4(TK2):c.760C>T (p.Arg254Ter) rs281865498
NM_004629.1(FANCG):c.1480+1G>C rs149616199
NM_004629.1(FANCG):c.1795_1804del (p.Trp599Profs) rs397507560
NM_004629.1(FANCG):c.307+1G>C rs200479612
NM_004629.1(FANCG):c.925-2A>G rs397507561
NM_004700.3(KCNQ4):c.211_223delCAGCGCTCCTCGG (p.Gln71Profs) rs80358271
NM_004700.3(KCNQ4):c.211delC (p.Gln71Serfs) rs80358272
NM_004700.3(KCNQ4):c.827G>C (p.Trp276Ser) rs80358277
NM_004700.3(KCNQ4):c.853G>T (p.Gly285Cys) rs28937588
NM_004700.4(KCNQ4):c.853G>A (p.Gly285Ser) rs28937588
NM_004715.4(CTDP1):c.863+389C>T rs113994102
NM_004795.4(KL):c.578A>G (p.His193Arg) rs121908423
NM_004802.3(OTOF):c.3515G>A (p.Arg1172Gln) rs80356605
NM_004862.3(LITAF):c.334G>A (p.Gly112Ser) rs104894519
NM_004862.3(LITAF):c.344C>A (p.Thr115Asn) rs104894520
NM_004862.3(LITAF):c.346T>G (p.Trp116Gly) rs104894521
NM_004937.2(CTNS):c.382C>T (p.Gln128Ter) rs550254092
NM_004937.2(CTNS):c.414G>A (p.Trp138Ter) rs113994205
NM_004937.2(CTNS):c.416C>T (p.Ser139Phe) rs267606754
NM_004937.2(CTNS):c.559_561+24del27 rs113994211
NM_004937.2(CTNS):c.589G>A (p.Gly197Arg) rs113994207
NM_004937.2(CTNS):c.613G>A (p.Asp205Asn) rs113994208
NM_004937.2(CTNS):c.614_616delACG (p.Asp205del) rs760256854
NM_004937.2(CTNS):c.853-3C>G rs113994210
NM_004990.3(MARS):c.1852C>T (p.Arg618Cys) rs587777718
NM_004992.3(MECP2):c.397C>T (p.Arg133Cys) rs28934904
NM_004992.3(MECP2):c.419C>T (p.Ala140Val) rs28934908
NM_004993.5(ATXN3):c.916G>C (p.Gly306Arg) rs12895357
NM_005027.3(PIK3R2):c.1117G>A (p.Gly373Arg) rs587776934
NM_005045.3(RELN):c.2015C>T (p.Pro672Leu) rs201044262
NM_005105.4(RBM8A):c.-21G>A rs139428292
NM_005105.4(RBM8A):c.67+32G>C rs201779890
NM_005120.2(MED12):c.2881C>T (p.Arg961Trp) rs80338758
NM_005120.2(MED12):c.3020A>G (p.Asn1007Ser) rs80338759
NM_005120.2(MED12):c.4147G>A (p.Ala1383Thr) rs863223696
NM_005120.2(MED12):c.5922G>T (p.Gln1974His) rs879255528
NM_005163.2(AKT1):c.49G>A (p.Glu17Lys) rs121434592
NM_005183.3(CACNA1F):c.3166dup (p.Leu1056Profs) rs80359870
NM_005211.3(CSF1R):c.1754-2A>G rs281860267
NM_005211.3(CSF1R):c.1897G>A (p.Glu633Lys) rs281860269
NM_005211.3(CSF1R):c.2345G>A (p.Arg782His) rs281860281
NM_005211.3(CSF1R):c.2381T>C (p.Ile794Thr) rs281860274
NM_005211.3(CSF1R):c.2624T>C (p.Met875Thr) rs281860279
NM_005211.3(CSF1R):c.2629C>T (p.Gln877Ter) rs690016556
NM_005247.2(FGF3):c.146A>G (p.Tyr49Cys) rs281860300
NM_005247.2(FGF3):c.17T>C (p.Leu6Pro) rs121917706
NM_005247.2(FGF3):c.196G>T (p.Gly66Cys) rs121917705
NM_005247.2(FGF3):c.255delT (p.Ile85Metfs) rs281860302
NM_005247.2(FGF3):c.283C>T (p.Arg95Trp) rs281860303
NM_005247.2(FGF3):c.310C>T (p.Arg104Ter) rs121917704
NM_005247.2(FGF3):c.317A>G (p.Tyr106Cys) rs281860306
NM_005247.2(FGF3):c.457_458delTG (p.Trp153Valfs) rs281860307
NM_005247.2(FGF3):c.466T>C (p.Ser156Pro) rs121917703
NM_005247.2(FGF3):c.616delG (p.Val206Serfs) rs281860305
NM_005259.2(MSTN):c.163G>A (p.Ala55Thr) rs1805085
NM_005259.2(MSTN):c.373+5G>A rs397515373
NM_005259.2(MSTN):c.458A>G (p.Lys153Arg) rs1805086
NM_005272.3(GNAT2):c.461+24G>A rs397515384
NM_005333.4(HCCS):c.589C>T (p.Arg197Ter) rs121917888
NM_005333.4(HCCS):c.649C>T (p.Arg217Cys) rs121917889
NM_005359.5(SMAD4):c.1081C>T (p.Arg361Cys) rs80338963
NM_005359.5(SMAD4):c.1162C>T (p.Gln388Ter) rs80338964
NM_005359.5(SMAD4):c.1245_1248delCAGA (p.Asp415Glufs) rs80338965
NM_005359.5(SMAD4):c.1486C>T (p.Arg496Cys) rs397518413
NM_005378.5(MYCN):c.217G>T (p.Glu73Ter) rs113994115
NM_005413.3(SIX3):c.219C>T (p.Pro73=) rs186163123
NM_005413.3(SIX3):c.576C>T (p.Arg192=) rs182881
NM_005413.3(SIX3):c.676C>G (p.Leu226Val) rs121917878
NM_005413.3(SIX3):c.749T>C (p.Val250Ala) rs121917880
NM_005413.3(SIX3):c.770G>C (p.Arg257Pro) rs121917879
NM_005413.3(SIX3):c.90G>T (p.Ala30=) rs78018362
NM_005465.4(AKT3):c.1393C>T (p.Arg465Trp) rs587776935
NM_005465.4(AKT3):c.548T>A (p.Val183Asp) rs886041100
NM_005476.5(GNE):c.1714G>C (p.Val572Leu) rs121908632
NM_005476.5(GNE):c.527A>T (p.Asp176Val) rs139425890
NM_005476.5(GNE):c.797G>A (p.Arg266Gln) rs121908622
NM_005476.6(GNE):c.788G>T (p.Arg263Leu) rs121908623
NM_005476.6(GNE):c.796C>T (p.Arg266Trp) rs121908621
NM_005506.3(SCARB2):c.361C>T (p.Arg121Ter) rs200053119
NM_005562.2(LAMC2):c.283C>T (p.Arg95Ter) rs80356683
NM_005572.3(LMNA):c.1711C>A (p.Arg571Ser) rs80338938
NM_005572.3(LMNA):c.664C>T (p.His222Tyr) rs28928901
NM_005572.3(LMNA):c.673C>T (p.Arg225Ter) rs60682848
NM_005572.3(LMNA):c.674G>A (p.Arg225Gln) rs199474724
NM_005572.3(LMNA):c.959delT (p.Arg321Glufs) rs56771886
NM_005609.2(PYGM):c.645G>A (p.Lys215=) rs116315896
NM_005609.3(PYGM):c.1240C>G (p.Arg414Gly) rs11231866
NM_005609.3(PYGM):c.1494C>T (p.Pro498=) rs11231865
NM_005609.3(PYGM):c.1827G>A (p.Lys609=) rs119103259
NM_005609.3(PYGM):c.2128_2130delTTC (p.Phe710del) rs527236147
NM_005609.3(PYGM):c.2392T>C (p.Trp798Arg) rs119103258
NM_005609.3(PYGM):c.255C>A (p.Tyr85Ter) rs527236146
NM_005629.3(SLC6A8):c.1222_1224delTTC (p.Phe408del) rs80338740
NM_005629.3(SLC6A8):c.1661C>T (p.Pro554Leu) rs397515559
NM_005629.3(SLC6A8):c.321_323delCTT (p.Phe107del) rs80338739
NM_005670.3(EPM2A):c.163C>A (p.Gln55Lys) rs187930476
NM_005709.3(USH1C):c.216G>A (p.Val72=) rs151045328
NM_005709.3(USH1C):c.238dupC (p.Arg80Profs) rs397515359
NM_005859.4(PURA):c.596G>C (p.Arg199Pro) rs587783001
NM_005982.3(SIX1):c.328C>T (p.Arg110Trp) rs80356459
NM_005982.3(SIX1):c.386A>G (p.Tyr129Cys) rs104894478
NM_005982.3(SIX1):c.397_399delGAG (p.Glu133del) rs80356460
NM_006005.3(WFS1):c.2590G>A (p.Glu864Lys) rs74315205
NM_006086.3(TUBB3):c.292G>A (p.Gly98Ser) rs587784505
NM_006087.3(TUBB4A):c.1162A>G (p.Met388Val) rs886041019
NM_006087.3(TUBB4A):c.763G>A (p.Val255Ile) rs767399782
NM_006087.3(TUBB4A):c.941C>T (p.Ala314Val) rs886041013
NM_006158.4(NEFL):c.22_23delCCinsAG (p.Pro8Arg) rs60261494
NM_006158.4(NEFL):c.293A>G (p.Asn98Ser) rs58982919
NM_006158.4(NEFL):c.64C>T (p.Pro22Ser) rs28928910
NM_006204.3(PDE6C):c.85C>T (p.Arg29Trp) rs121918537
NM_006205.2(PDE6H):c.35C>G (p.Ser12Ter) rs200311463
NM_006208.3(ENPP1):c.1831C>G (p.Leu611Val) rs79079368
NM_006208.3(ENPP1):c.2002G>A (p.Glu668Lys) rs115371819
NM_006208.3(ENPP1):c.2320C>T (p.Arg774Cys) rs28933977
NM_006208.3(ENPP1):c.913C>A (p.Pro305Thr) rs374270497
NM_006218.4(PIK3CA):c.1258T>C (p.Cys420Arg) rs121913272
NM_006218.4(PIK3CA):c.1624G>A (p.Glu542Lys) rs121913273
NM_006218.4(PIK3CA):c.1633G>A (p.Glu545Lys) rs104886003
NM_006218.4(PIK3CA):c.3140A>G (p.His1047Arg) rs121913279
NM_006218.4(PIK3CA):c.3140A>T (p.His1047Leu) rs121913279
NM_006267.4(RANBP2):c.1754C>T (p.Thr585Met) rs121434502
NM_006267.4(RANBP2):c.1958C>T (p.Thr653Ile) rs121434503
NM_006267.4(RANBP2):c.1966A>G (p.Ile656Val) rs121434504
NM_006329.3(FBLN5):c.1171G>T (p.Glu391Ter) rs80338767
NM_006329.3(FBLN5):c.604G>A (p.Gly202Arg) rs80338765
NM_006329.3(FBLN5):c.649T>C (p.Cys217Arg) rs80338766
NM_006329.3(FBLN5):c.679T>C (p.Ser227Pro) rs28939370
NM_006383.3(CIB2):c.192G>C (p.Glu64Asp) rs145415848
NM_006397.2(RNASEH2A):c.556C>T (p.Arg186Trp) rs77103971
NM_006412.3(AGPAT2):c.335C>T (p.Pro112Leu) rs886063722
NM_006412.3(AGPAT2):c.514G>A (p.Glu172Lys) rs748157664
NM_006412.3(AGPAT2):c.646A>T (p.Lys216Ter) rs138994150
NM_006415.3(SPTLC1):c.1160G>C (p.Gly387Ala) rs119482084
NM_006415.3(SPTLC1):c.398G>A (p.Cys133Tyr) rs119482081
NM_006415.3(SPTLC1):c.399T>G (p.Cys133Trp) rs119482082
NM_006415.3(SPTLC1):c.431T>A (p.Val144Asp) rs119482083
NM_006432.3(NPC2):c.27delG (p.Leu10Serfs) rs80358267
NM_006432.3(NPC2):c.332delA (p.Asn111Ilefs) rs80358265
NM_006432.3(NPC2):c.58G>T (p.Glu20Ter) rs80358260
NM_006432.4(NPC2):c.115G>A (p.Val39Met) rs80358261
NM_006432.4(NPC2):c.133C>T (p.Gln45Ter) rs80358262
NM_006432.4(NPC2):c.141C>A (p.Cys47Ter) rs80358263
NM_006432.4(NPC2):c.190+5G>A rs80358268
NM_006432.4(NPC2):c.199T>C (p.Ser67Pro) rs11694
NM_006432.4(NPC2):c.352G>T (p.Glu118Ter) rs80358266
NM_006493.2(CLN5):c.1175_1176delAT (p.Tyr392Terfs) rs386833969
NM_006493.2(CLN5):c.225G>A (p.Trp75Ter) rs104894385
NM_006502.2(POLH):c.490G>T (p.Glu164Ter) rs767433001
NM_006517.4(SLC16A2):c.1079T>G (p.Leu360Trp) rs104894939
NM_006517.4(SLC16A2):c.1481T>C (p.Leu494Pro) rs104894938
NM_006517.4(SLC16A2):c.1612delC (p.Pro538Glnfs) rs113994166
NM_006567.4(FARS2):c.431A>G (p.Tyr144Cys) rs397514610
NM_006640.4(SEPTIN9):c.-134G>C rs80338760
NM_006640.4(SEPTIN9):c.262C>T (p.Arg88Trp) rs80338761
NM_006640.4(SEPTIN9):c.278C>T (p.Ser93Phe) rs80338762
NM_006662.2(SRCAP):c.7303C>T (p.Arg2435Ter) rs199469465
NM_006662.2(SRCAP):c.7330C>T (p.Arg2444Ter) rs199469464
NM_006790.2(MYOT):c.170C>T (p.Thr57Ile) rs28937597
NM_006796.2(AFG3L2):c.1295A>C (p.Asn432Thr) rs151344512
NM_006796.2(AFG3L2):c.1961C>T (p.Thr654Ile) rs151344513
NM_006796.2(AFG3L2):c.1996A>G (p.Met666Val) rs151344514
NM_006796.2(AFG3L2):c.1997T>G (p.Met666Arg) rs151344515
NM_006796.2(AFG3L2):c.2011G>A (p.Gly671Arg) rs151344517
NM_006796.2(AFG3L2):c.2021_2022delCCinsTA (p.Ser674Leu) rs151344519
NM_006796.2(AFG3L2):c.2071G>A (p.Glu691Lys) rs151344520
NM_006796.2(AFG3L2):c.2081C>A (p.Ala694Glu) rs151344521
NM_006796.2(AFG3L2):c.2105G>A (p.Arg702Gln) rs151344523
NM_006888.4(CALM1):c.161A>T (p.Asn54Ile) rs267607276
NM_006888.5(CALM1):c.293A>G (p.Asn98Ser) rs267607277
NM_006894.4(FMO3):c.[472G>A;923A>G]
NM_006894.5(FMO3):c.458C>T (p.Pro153Leu) rs72549326
NM_006894.5(FMO3):c.913G>T (p.Glu305Ter) rs61753344
NM_007055.3(POLR3A):c.1674C>G (p.Phe558Leu) rs267608668
NM_007055.3(POLR3A):c.1909+18G>A rs267608677
NM_007055.3(POLR3A):c.2015G>A (p.Gly672Glu) rs267608670
NM_007055.3(POLR3A):c.2554A>G rs267608671
NM_007055.3(POLR3A):c.2617-1G>A rs181087667
NM_007055.3(POLR3A):c.2690T>A (p.Ile897Asn) rs267608681
NM_007055.3(POLR3A):c.3013C>T (p.Arg1005Cys) rs267608682
NM_007055.3(POLR3A):c.418C>T (p.Arg140Ter) rs267608678
NM_007129.3(ZIC2):c.1366_1368(15_45) rs749567106
NM_007129.4(ZIC2):c.1040_1046del (p.Glu348Serfs) rs397515365
NM_007129.4(ZIC2):c.1318dup (p.Leu440Profs) rs397515364
NM_007129.4(ZIC2):c.177_178ins56
NM_007272.2(CTRC):c.164G>A (p.Trp55Ter) rs121909294
NM_007272.2(CTRC):c.180C>A (p.Gly60=) rs497078
NM_007272.2(CTRC):c.760C>T (p.Arg254Trp) rs121909293
NM_007294.3(BRCA1):c.5096G>A (p.Arg1699Gln) rs41293459
NM_007294.3(BRCA1):c.5266dupC (p.Gln1756Profs) rs397507247
NM_007294.3(BRCA1):c.68_69delAG (p.Glu23Valfs) rs386833395
NM_007375.3(TARDBP):c.1144G>A (p.Ala382Thr) rs367543041
NM_007375.3(TARDBP):c.1150G>C (p.Gly384Arg) rs797044594
NM_007375.3(TARDBP):c.506A>G (p.Asp169Gly) rs80356717
NM_007375.3(TARDBP):c.859G>A (p.Gly287Ser) rs80356719
NM_012144.3(DNAI1):c.1490G>A (p.Gly497Asp) rs376252276
NM_012144.3(DNAI1):c.2001+1G>A (p.Ala607_Lys667del) rs397515563
NM_012203.1(GRHPR):c.103delG (p.Asp35Thrfs) rs80356708
NM_012203.1(GRHPR):c.404+3_404+6delAAGT rs180177309
NM_012203.1(GRHPR):c.579A>G (p.Ala193=) rs309458
NM_012203.1(GRHPR):c.866-25CT[9] rs34302950
NM_012330.3(KAT6B):c.3769_3772delTCTA (p.Lys1258Glyfs) rs199470470
NM_012330.3(KAT6B):c.4205_4206delCT (p.Ser1402Cysfs) rs199470477
NM_012330.3(KAT6B):c.5201_5210dupTGCTGCAGCA (p.Gln1737Hisfs) rs199470482
NM_012414.3(RAB3GAP2):c.1276C>T (p.Arg426Cys) rs587777167
NM_012434.4(SLC17A5):c.115C>T (p.Arg39Cys) rs80338794
NM_012434.4(SLC17A5):c.406A>G (p.Lys136Glu) rs80338795
NM_012463.3(ATP6V0A2):c.187C>T (p.Arg63Ter) rs80356750
NM_012463.3(ATP6V0A2):c.1929delA (p.Gln645Argfs) rs80356756
NM_012463.3(ATP6V0A2):c.2293C>T (p.Gln765Ter) rs80356758
NM_012463.3(ATP6V0A2):c.294+1G>A rs80356751
NM_012472.5(LRRC6):c.220G>C (p.Ala74Pro) rs397514596
NM_012472.5(LRRC6):c.436G>C (p.Asp146His) rs200321595
NM_012472.5(LRRC6):c.574C>T (p.Gln192Ter) rs141945265
NM_012472.5(LRRC6):c.576dupA (p.Glu193Argfs) rs397515425
NM_012472.5(LRRC6):c.598_599delAA (p.Lys200Glufs) rs397515424
NM_013236.3(ATXN10):c.1173+54822_1173+54826ATTCT(10_32) rs60726084
NM_013246.2(CLCF1):c.321C>A (p.Tyr107Ter) rs104894198
NM_013246.2(CLCF1):c.46T>C (p.Cys16Arg) rs137853934
NM_013246.2(CLCF1):c.590G>T (p.Arg197Leu) rs104894203
NM_013275.5(ANKRD11):c.1903_1907delAAACA (p.Lys635Glnfs) rs886041125
NM_014043.3(CHMP2B):c.311C>A (p.Thr104Asn) rs281864934
NM_014043.3(CHMP2B):c.442G>T (p.Asp148Tyr) rs63750653
NM_014043.3(CHMP2B):c.493C>T (p.Gln165Ter) rs63750355
NM_014043.3(CHMP2B):c.618A>C (p.Gln206His) rs63751126
NM_014043.3(CHMP2B):c.85A>G (p.Ile29Val) rs63750818
NM_014112.4(TRPS1):c.2794G>A (p.Ala932Thr) rs1057518972
NM_014112.4(TRPS1):c.2894G>A (p.Arg965His) rs28939070
NM_014191.3(SCN8A):c.1588C>T (p.Arg530Trp) rs761336234
NM_014191.3(SCN8A):c.2549G>A (p.Arg850Gln) rs587780586
NM_014191.3(SCN8A):c.3979A>G (p.Ile1327Val) rs879255704
NM_014191.3(SCN8A):c.4351G>A (p.Gly1451Ser) rs863223345
NM_014191.3(SCN8A):c.4748T>C (p.Ile1583Thr) rs201458257
NM_014191.3(SCN8A):c.4774G>C (p.Val1592Leu) rs587780454
NM_014191.3(SCN8A):c.4850G>A (p.Arg1617Gln) rs587777721
NM_014251.2(SLC25A13):c.1177+1G>A rs80338722
NM_014251.2(SLC25A13):c.1311+1G>A rs80338723
NM_014251.2(SLC25A13):c.1638_1660dup23 (p.Ala554Glyfs) rs80338725
NM_014251.2(SLC25A13):c.1799dupA (p.Tyr600Terfs) rs80338726
NM_014251.2(SLC25A13):c.1813C>T (p.Arg605Ter) rs80338729
NM_014251.2(SLC25A13):c.615+5G>A rs80338717
NM_014251.2(SLC25A13):c.674C>A (p.Ser225Ter) rs80338719
NM_014251.2(SLC25A13):c.852_855delTATG (p.Met285Profs) rs80338720
NM_014252.3(SLC25A15):c.110T>G (p.Met37Arg) rs121908533
NM_014252.3(SLC25A15):c.212T>A (p.Leu71Gln) rs121908534
NM_014252.3(SLC25A15):c.535C>T (p.Arg179Ter) rs104894429
NM_014252.3(SLC25A15):c.538G>A (p.Glu180Lys) rs104894424
NM_014252.3(SLC25A15):c.562_564delTTC (p.Phe188del) rs202247803
NM_014252.3(SLC25A15):c.79G>A (p.Gly27Arg) rs104894430
NM_014252.3(SLC25A15):c.815C>T (p.Thr272Ile) rs121908535
NM_014252.3(SLC25A15):c.824G>A (p.Arg275Gln) rs104894431
NM_014252.3(SLC25A15):c.95C>G (p.Thr32Arg) rs121908536
NM_014297.4(ETHE1):c.482G>A (p.Cys161Tyr) rs1555762722
NM_014336.4(AIPL1):c.1126C>T (p.Pro376Ser) rs61757484
NM_014336.4(AIPL1):c.715T>C (p.Cys239Arg) rs62637012
NM_014336.4(AIPL1):c.784G>A (p.Gly262Ser) rs142326926
NM_014336.4(AIPL1):c.834G>A (p.Trp278Ter) rs62637014
NM_014336.4(AIPL1):c.905G>T (p.Arg302Leu) rs62637015
NM_014363.5(SACS):c.10907G>A (p.Arg3636Gln) rs281865119
NM_014363.5(SACS):c.12160C>T (p.Gln4054Ter) rs281865120
NM_014363.5(SACS):c.7504C>T (p.Arg2502Ter) rs281865118
NM_014363.5(SACS):c.8844delT (p.Ile2949Phefs) rs281865117
NM_014425.3(INVS):c.2782C>T (p.Arg928Ter) rs376879175
NM_014491.3(FOXP2):c.1789A>C (p.Asn597His) rs766476648
NM_014491.3(FOXP2):c.50A>T (p.Gln17Leu) rs201649896
NM_014646.2(LPIN2):c.1043C>T (p.Pro348Leu) rs34676691
NM_014646.2(LPIN2):c.2201C>T (p.Ser734Leu) rs80338807
NM_014646.2(LPIN2):c.540_541del (p.Cys181Terfs) rs80338806
NM_014646.2(LPIN2):c.991G>T (p.Ala331Ser) rs80338805
NM_014845.5(FIG4):c.122T>C (p.Ile41Thr) rs121908287
NM_014846.3(WASHC5):c.1411A>G (p.Asn471Asp) rs80338865
NM_014846.3(WASHC5):c.1876G>T (p.Val626Phe) rs80338867
NM_014846.3(WASHC5):c.2087G>C (p.Gly696Ala) rs397515564
NM_015141.3(GPD1L):c.247G>A (p.Glu83Lys) rs72552292
NM_015141.3(GPD1L):c.839C>T (p.Ala280Val) rs72552291
NM_015166.3(MLC1):c.1031A>G (p.Asn344Ser) rs11568188
NM_015166.3(MLC1):c.135dupC (p.Cys46Leufs) rs80358241
NM_015166.3(MLC1):c.176G>A (p.Gly59Glu) rs80358242
NM_015166.3(MLC1):c.178-10T>A rs80358243
NM_015166.3(MLC1):c.278C>T (p.Ser93Leu) rs80358245
NM_015166.3(MLC1):c.512G>T (p.Cys171Phe) rs6010260
NM_015166.3(MLC1):c.654C>A (p.Asn218Lys) rs41302601
NM_015265.3(SATB2):c.1165C>T (p.Arg389Cys) rs1057521083
NM_015272.4(RPGRIP1L):c.685G>A (p.Ala229Thr) rs61747071
NM_015339.3(ADNP):c.2157C>G (p.Tyr719Ter) rs587777526
NM_015474.3(SAMHD1):c.1324C>T (p.Arg442Ter) rs369587937
NM_015474.3(SAMHD1):c.602T>A (p.Ile201Asn) rs138603088
NM_015560.2(OPA1):c.1334G>A (p.Arg445His) rs80356529
NM_015560.2(OPA1):c.2826delT (p.Arg943Glufs) rs80356531
NM_015697.8(COQ2):c.1159C>T (p.Arg387Ter) rs751185256
NM_015697.8(COQ2):c.382A>G (p.Met128Val) rs778094136
NM_015697.8(COQ2):c.590G>A (p.Arg197His) rs121918231
NM_015697.8(COQ2):c.683A>G (p.Asn228Ser) rs121918232
NM_015713.4(RRM2B):c.253_255delGAG (p.Glu85del) rs515726184
NM_015713.4(RRM2B):c.431C>T (p.Thr144Ile) rs515726189
NM_015713.4(RRM2B):c.606T>A (p.Phe202Leu) rs515726194
NM_015713.4(RRM2B):c.671T>G (p.Ile224Ser) rs515726196
NM_015713.4(RRM2B):c.817G>A (p.Gly273Ser) rs387906891
NM_015713.4(RRM2B):c.97C>T (p.Pro33Ser) rs387906892
NM_015896.3(ZMYND10):c.797T>C (p.Leu266Pro) rs200913791
NM_015915.4(ATL1):c.1222A>G (p.Met408Val) rs28939094
NM_015915.4(ATL1):c.1243C>T (p.Arg415Trp) rs119476050
NM_015915.4(ATL1):c.351G>A (p.Glu117=) rs1060197
NM_015915.4(ATL1):c.467C>T (p.Thr156Ile) rs137852657
NM_015915.4(ATL1):c.621G>A (p.Lys207=) rs35629585
NM_015915.4(ATL1):c.715C>T (p.Arg239Cys) rs119476046
NM_015915.4(ATL1):c.773A>G (p.His258Arg) rs119476048
NM_015915.4(ATL1):c.84A>G (p.Pro28=) rs35014209
NM_016035.4(COQ4):c.718C>T (p.Arg240Cys) rs143441644
NM_016038.2(SBDS):c.183_184delTAinsCT (p.Lys62Ter) rs113993991
NM_016038.2(SBDS):c.258+1G>C rs113993992
NM_016038.2(SBDS):c.258+2T>C rs113993993
NM_016038.3(SBDS):c.120del (p.Ser41Alafs) rs113993990
NM_016038.3(SBDS):c.505C>T (p.Arg169Cys) rs113993996
NM_016038.3(SBDS):c.635T>C (p.Ile212Thr) rs79344818
NM_016042.3(EXOSC3):c.238G>T (p.Val80Phe) rs374550999
NM_016042.4(EXOSC3):c.395A>C (p.Asp132Ala) rs141138948
NM_016156.5(MTMR2):c.826G>T (p.Glu276Ter) rs121434403
NM_016616.4(NME8):c.1277T>A (p.Leu426Ter) rs121918300
NM_016616.4(NME8):c.271-27C>T rs117149381
NM_016938.4(EFEMP2):c.1070_1073dupCCGC (p.Asp359Argfs) rs193302865
NM_016938.4(EFEMP2):c.1189G>A (p.Ala397Thr) rs193302868
NM_016938.4(EFEMP2):c.169G>A (p.Glu57Lys) rs119489101
NM_016938.4(EFEMP2):c.376G>A (p.Glu126Lys) rs193302867
NM_016938.4(EFEMP2):c.377A>T (p.Glu126Val) rs193302869
NM_016938.4(EFEMP2):c.577delC (p.Gln193Serfs) rs193302870
NM_016938.4(EFEMP2):c.608A>C (p.Asp203Ala) rs193302864
NM_016938.4(EFEMP2):c.800G>A (p.Cys267Tyr) rs193302866
NM_016938.4(EFEMP2):c.835C>T (p.Arg279Cys) rs119489102
NM_016941.3(DLL3):c.425T>A (p.Leu142Gln) rs55741253
NM_017411.3(SMN2):c.859G>C (p.Gly287Arg) rs121909192
NM_017802.3(DNAAF5):c.2384T>C (p.Leu795Pro) rs397514561
NM_017838.3(NHP2):c.376G>A (p.Val126Met) rs121908090
NM_017838.3(NHP2):c.415T>C (p.Tyr139His) rs121908089
NM_017838.3(NHP2):c.460T>A (p.Ter154Arg) rs121908091
NM_017841.2(SDHAF2):c.232G>A (p.Gly78Arg) rs113560320
NM_017882.2(CLN6):c.214G>T (p.Glu72Ter) rs104894483
NM_017882.2(CLN6):c.316dupC (p.Arg106Profs) rs397515352
NM_017890.4(VPS13B):c.9260dupT (p.Leu3087Phefs) rs180177329
NM_017950.3(CCDC40):c.248delC (p.Ala83Valfs) rs397515393
NM_018081.2(WRAP53):c.1126C>T (p.His376Tyr) rs281865549
NM_018081.2(WRAP53):c.1192C>T (p.Arg398Trp) rs281865548
NM_018081.2(WRAP53):c.1303G>A (p.Gly435Arg) rs281865550
NM_018081.2(WRAP53):c.492C>A (p.Phe164Leu) rs281865547
NM_018082.5(POLR3B):c.1508C>A (p.Thr503Lys) rs267608683
NM_018082.5(POLR3B):c.1533delT (p.Ile511Metfs) rs267608684
NM_018082.5(POLR3B):c.1568T>A rs138249161
NM_018082.5(POLR3B):c.1648C>T (p.Arg550Ter) rs267608688
NM_018082.5(POLR3B):c.1857-2A>C rs267608686
NM_018082.5(POLR3B):c.2303G>A (p.Arg768His) rs267608687
NM_018082.5(POLR3B):c.2686A>T (p.Lys896Ter) rs267608685
NM_018082.5(POLR3B):c.2778C>G (p.Asp926Glu) rs267608689
NM_018122.5(DARS2):c.228-21_228-20delTTinsC rs1553201258
NM_018122.5(DARS2):c.455G>T (p.Cys152Phe) rs121918208
NM_018122.5(DARS2):c.492+2T>C rs142433332
NM_018136.4(ASPM):c.1154_1155delAG (p.Glu385Valfs) rs199422137
NM_018136.4(ASPM):c.1179delT (p.Asn394Ilefs) rs199422138
NM_018136.4(ASPM):c.1260_1266delTCAAGTC (p.Gln421Hisfs) rs199422139
NM_018136.4(ASPM):c.1288A>G (p.Arg430Gly) rs6428388
NM_018136.4(ASPM):c.1631_1635delATCTT (p.Tyr544Serfs) rs199422144
NM_018136.4(ASPM):c.1729_1730delAG (p.Ser577Argfs) rs199422146
NM_018136.4(ASPM):c.1959_1962delCAAA (p.Asn653Lysfs) rs199422147
NM_018136.4(ASPM):c.1977T>C (p.Ile659=) rs17550662
NM_018136.4(ASPM):c.2389C>T (p.Arg797Ter) rs145489194
NM_018136.4(ASPM):c.3138G>A (p.Arg1046=) rs6676084
NM_018136.4(ASPM):c.3269C>T (p.Ser1090Phe) rs16841081
NM_018136.4(ASPM):c.349C>T (p.Arg117Ter) rs137852996
NM_018136.4(ASPM):c.3579T>A (p.Ser1193=) rs4915337
NM_018136.4(ASPM):c.3710C>G (p.Ser1237Ter) rs199422159
NM_018136.4(ASPM):c.3796G>T (p.Glu1266Ter) rs199422161
NM_018136.4(ASPM):c.3811C>T (p.Arg1271Ter) rs140602858
NM_018136.4(ASPM):c.3978G>A (p.Trp1326Ter) rs137852995
NM_018136.4(ASPM):c.4195dupA (p.Thr1399Asnfs) rs199422163
NM_018136.4(ASPM):c.4795C>T (p.Arg1599Ter) rs199422165
NM_018136.4(ASPM):c.577C>T (p.Gln193Ter) rs199422134
NM_018136.4(ASPM):c.6189T>G (p.Tyr2063Ter) rs137852997
NM_018136.4(ASPM):c.6337_6338delAT (p.Ile2113Serfs) rs199422169
NM_018136.4(ASPM):c.719_720delCT (p.Ser240Cysfs) rs199422135
NM_018136.4(ASPM):c.7566A>G (p.Leu2522=) rs1412640
NM_018136.4(ASPM):c.7761T>G (p.Tyr2587Ter) rs189678019
NM_018136.4(ASPM):c.7782_7783delGA (p.Lys2595Serfs) rs199422173
NM_018136.4(ASPM):c.7860G>C (p.Gln2620His) rs12138336
NM_018136.4(ASPM):c.9159delA (p.Lys3053Asnfs) rs199422184
NM_018136.4(ASPM):c.9178C>T (p.Gln3060Ter) rs137852994
NM_018136.4(ASPM):c.9190C>T (p.Arg3064Ter) rs199422185
NM_018136.4(ASPM):c.937A>G (p.Ile313Val) rs12025066
NM_018136.4(ASPM):c.9539A>C (p.Gln3180Pro) rs193251130
NM_018136.4(ASPM):c.9557C>G (p.Ser3186Ter) rs199422189
NM_018136.4(ASPM):c.9697C>T (p.Arg3233Ter) rs199422194
NM_018136.4(ASPM):c.9730C>T (p.Arg3244Ter) rs199422195
NM_018136.4(ASPM):c.9773A>G (p.His3258Arg) rs7528827
NM_018136.5(ASPM):c.9395T>G (p.Leu3132Arg) rs36004306
NM_018249.5(CDK5RAP2):c.246T>A (p.Tyr82Ter) rs199422126
NM_018249.5(CDK5RAP2):c.3134G>C (p.Arg1045Thr) rs3780679
NM_018249.5(CDK5RAP2):c.4005-15A>G rs387906274
NM_018249.5(CDK5RAP2):c.4618G>C (p.Val1540Leu) rs4837768
NM_018249.5(CDK5RAP2):c.4665G>T (p.Gln1555His) rs35909061
NM_018249.5(CDK5RAP2):c.547G>C (p.Ala183Pro) rs13287734
NM_018249.5(CDK5RAP2):c.764C>T (p.Ser255Leu) rs35199933
NM_018249.5(CDK5RAP2):c.865G>C (p.Glu289Gln) rs4836822
NM_018400.3(SCN3B):c.29T>C (p.Leu10Pro) rs121918282
NM_018418.4(SPATA7):c.1183C>T (p.Arg395Ter) rs75895925
NM_018418.4(SPATA7):c.1395delA (p.Gln465Hisfs) rs386834243
NM_018418.4(SPATA7):c.322C>T (p.Arg108Ter) rs80044281
NM_018418.4(SPATA7):c.960dupA (p.Pro321Thrfs) rs386834241
NM_018451.3(CENPJ):c.3305A>G (p.Asn1102Ser) rs41300592
NM_018451.4(CENPJ):c.163C>G (p.Pro55Ala) rs17081389
NM_018451.4(CENPJ):c.17delC (p.Ser7Leufs) rs199422202
NM_018451.4(CENPJ):c.187G>C (p.Asp63His) rs7336216
NM_018451.4(CENPJ):c.2635T>G (p.Ser879Ala) rs17402892
NM_018451.4(CENPJ):c.289A>G (p.Thr97Ala) rs41306027
NM_018451.4(CENPJ):c.3243_3246delTCAG (p.Ser1081Argfs) rs199422203
NM_018451.4(CENPJ):c.3704A>T (p.Glu1235Val) rs121434311
NM_018451.4(CENPJ):c.452A>G (p.Glu151Gly) rs34177811
NM_018648.3(NOP10):c.100C>T (p.Arg34Trp) rs121908092
NM_018713.2(SLC30A10):c.1235delA (p.Gln412Argfs) rs281860292
NM_018713.2(SLC30A10):c.266T>C (p.Leu89Pro) rs281860284
NM_018713.2(SLC30A10):c.314_322delCCCGGCCCG (p.Ala105_Pro107del) rs281860285
NM_018713.2(SLC30A10):c.507delG (p.Pro170Leufs) rs281860287
NM_018713.2(SLC30A10):c.585delG (p.Thr196Profs) rs281860288
NM_018941.3(CLN8):c.70C>G (p.Arg24Gly) rs104894064
NM_018965.3(TREM2):c.40+3_40+5del rs386834142
NM_018972.2(GDAP1):c.715C>T (p.Leu239Phe) rs104894080
NM_018972.3(GDAP1):c.347T>G (p.Met116Arg) rs281865060
NM_018972.3(GDAP1):c.358C>T (p.Arg120Trp) rs104894078
NM_018972.3(GDAP1):c.487C>T (p.Gln163Ter) rs104894077
NM_019098.4(CNGB3):c.1148delC (p.Thr383Ilefs) rs397515360
NM_019098.4(CNGB3):c.1304C>T (p.Ser435Phe) rs121918344
NM_020247.4(COQ8A):c.1844dupG (p.Ser616Leufs) rs764847439
NM_020247.4(COQ8A):c.811C>T (p.Arg271Cys) rs145034527
NM_020247.4(COQ8A):c.895C>T (p.Arg299Trp) rs201908721
NM_020247.4(COQ8A):c.993C>T (p.Phe331=) rs41303129
NM_020366.3(RPGRIP1):c.1639G>T (p.Ala547Ser) rs10151259
NM_020366.3(RPGRIP1):c.2480G>T (p.Arg827Leu) rs28937883
NM_020451.2(SELENON):c.943G>A (p.Gly315Ser) rs121908188
NM_020533.2(MCOLN1):c.1084G>T (p.Asp362Tyr) rs121908372
NM_020533.2(MCOLN1):c.514C>T (p.Arg172Ter) rs797044824
NM_020533.2(MCOLN1):c.920delT (p.Leu307Profs) rs755042147
NM_020533.2(MCOLN1):c.964C>T (p.Arg322Ter) rs121908371
NM_020638.2(FGF23):c.211A>G (p.Ser71Gly) rs104894342
NM_020806.4(GPHN):c.28A>T (p.Asn10Tyr) rs121908539
NM_020919.3(ALS2):c.1007_1008delTA (p.Ile336Thrfs) rs386134175
NM_020919.3(ALS2):c.138del (p.Ala47Profs) rs386134173
NM_020919.3(ALS2):c.1425_1426del (p.Glu476Glyfs) rs386134176
NM_020919.3(ALS2):c.1472_1481delTTTCCCCCAG rs387906316
NM_020919.3(ALS2):c.1867_1868del (p.Leu623Valfs) rs386134181
NM_020919.3(ALS2):c.2143C>T (p.Gln715Ter) rs121908139
NM_020919.3(ALS2):c.2537_2538del (p.Asn846Ilefs) rs386134183
NM_020919.3(ALS2):c.2980-2A>G rs386134184
NM_020919.3(ALS2):c.2992C>T (p.Arg998Ter) rs121908137
NM_020919.3(ALS2):c.3619del (p.Met1207Terfs) rs386134187
NM_020919.3(ALS2):c.470G>A (p.Cys157Tyr) rs121908138
NM_020919.3(ALS2):c.4721del (p.Val1574Alafs) rs386134188
NM_020919.3(ALS2):c.553del (p.Thr185Leufs) rs386134174
NM_021625.4(TRPV4):c.1412_1414delTCT (p.Phe471del) rs515726154
NM_021625.4(TRPV4):c.1853T>C (p.Leu618Pro) rs515726163
NM_021625.4(TRPV4):c.2198G>A (p.Trp733Ter) rs200757159
NM_021625.4(TRPV4):c.557G>A (p.Arg186Gln) rs397514494
NM_021625.4(TRPV4):c.649G>T (p.Ala217Ser) rs187864727
NM_021625.4(TRPV4):c.806G>A (p.Arg269His) rs267607144
NM_021625.4(TRPV4):c.947G>A (p.Arg316His) rs387906905
NM_021828.4(HPSE2):c.1465_1466delAA (p.Asn489Profs) rs397515338
NM_021828.4(HPSE2):c.1516C>T (p.Arg506Ter) rs267606866
NM_021830.4(TWNK):c.1370C>T (p.Thr457Ile) rs80356544
NM_021830.4(TWNK):c.1523A>G (p.Tyr508Cys) rs80356540
NM_021830.4(TWNK):c.952G>A (p.Ala318Thr) rs80356542
NM_021830.4(TWNK):c.955A>G (p.Lys319Glu) rs80356543
NM_021926.4(ALX4):c.653G>A (p.Arg218Gln) rs104894193
NM_022081.5(HPS4):c.1891C>T (p.Gln631Ter) rs119471021
NM_022081.5(HPS4):c.2089_2093dupAAGCA (p.Lys699Serfs) rs281865100
NM_022081.5(HPS4):c.412G>T (p.Glu138Ter) rs119471024
NM_022081.5(HPS4):c.461A>G (p.His154Arg) rs281865098
NM_022081.5(HPS4):c.541C>T (p.Gln181Ter) rs119471022
NM_022081.5(HPS4):c.649C>T (p.Arg217Ter) rs119471023
NM_022081.5(HPS4):c.664G>T (p.Glu222Ter) rs119471025
NM_022081.5(HPS4):c.949_972dup24 (p.Glu324_Asn325insAlaCysProAspGlyArgLysGlu) rs281865164
NM_022124.5(CDH23):c.3178C>T (p.Arg1060Trp) rs201536811
NM_022124.5(CDH23):c.3625A>G (p.Thr1209Ala) rs41281314
NM_022124.5(CDH23):c.9565C>T (p.Arg3189Trp) rs121908353
NM_022787.3(NMNAT1):c.769G>A (p.Glu257Lys) rs150726175
NM_023036.4(DNAI2):c.787C>T (p.Arg263Ter) rs137852998
NM_023067.3(FOXL2):c.650C>T (p.Ser217Phe) rs797044527
NM_023073.3(CPLANE1):c.4006C>T (p.Arg1336Trp) rs367543061
NM_023073.3(CPLANE1):c.4804C>T (p.Arg1602Ter) rs367543063
NM_023073.3(CPLANE1):c.6407del (p.Pro2136Hisfs) rs367543064
NM_023073.3(CPLANE1):c.7400+1G>A rs367543062
NM_023073.3(CPLANE1):c.7477C>T (p.Arg2493Ter) rs139675596
NM_023073.3(CPLANE1):c.7957+288G>A rs111294855
NM_023110.2(FGFR1):c.1468G>C (p.Gly490Arg) rs869025670
NM_023110.2(FGFR1):c.1880G>C (p.Arg627Thr) rs869025671
NM_024075.4(TSEN34):c.172C>T (p.Arg58Trp) rs113994150
NM_024312.4(GNPTAB):c.1000C>T (p.Arg334Ter) rs281864969
NM_024312.4(GNPTAB):c.1042A>C (p.Ile348Leu) rs7958709
NM_024312.4(GNPTAB):c.1090C>T (p.Arg364Ter) rs200646278
NM_024312.4(GNPTAB):c.10A>C (p.Lys4Gln) rs34159654
NM_024312.4(GNPTAB):c.1120T>C (p.Phe374Leu) rs137852900
NM_024312.4(GNPTAB):c.1123C>T (p.Arg375Ter) rs397507447
NM_024312.4(GNPTAB):c.1220A>C (p.Asp407Ala) rs137852895
NM_024312.4(GNPTAB):c.136C>T (p.Arg46Ter) rs78347057
NM_024312.4(GNPTAB):c.1399delG (p.Asp467Ilefs) rs397507448
NM_024312.4(GNPTAB):c.1514G>A (p.Cys505Tyr) rs281864980
NM_024312.4(GNPTAB):c.1580delC (p.Cys528Valfs) rs36007394
NM_024312.4(GNPTAB):c.1625_1626insC (p.Glu542Aspfs) rs281865027
NM_024312.4(GNPTAB):c.1759C>T (p.Arg587Ter) rs281864982
NM_024312.4(GNPTAB):c.1959_1962delTAGT (p.Ser654Profs) rs281864983
NM_024312.4(GNPTAB):c.2051_2055delACTCA (p.Ser685Lysfs) rs34901902
NM_024312.4(GNPTAB):c.2275_2276delAA (p.Asn759Terfs) rs281864992
NM_024312.4(GNPTAB):c.2550_2554delGAAAA (p.Lys850Asnfs) rs281864996
NM_024312.4(GNPTAB):c.2574_2575delGA (p.Asn859Glnfs) rs281865029
NM_024312.4(GNPTAB):c.2681G>A (p.Trp894Ter) rs137852899
NM_024312.4(GNPTAB):c.2693delA (p.Lys898Serfs) rs281864999
NM_024312.4(GNPTAB):c.2715+1G>A rs281865031
NM_024312.4(GNPTAB):c.2715+2T>G rs281865001
NM_024312.4(GNPTAB):c.3091C>T (p.Arg1031Ter) rs281865009
NM_024312.4(GNPTAB):c.310C>T (p.Gln104Ter) rs137852896
NM_024312.4(GNPTAB):c.3173C>G (p.Ser1058Ter) rs137852898
NM_024312.4(GNPTAB):c.3335+1G>A rs34940801
NM_024312.4(GNPTAB):c.3335+6T>G rs34788341
NM_024312.4(GNPTAB):c.3410T>A (p.Leu1137Ter) rs142065232
NM_024312.4(GNPTAB):c.342_343delCA (p.Thr115Asnfs) rs281864954
NM_024312.4(GNPTAB):c.3443_3446delTTTG (p.Val1148Alafs) rs281865018
NM_024312.4(GNPTAB):c.3474_3475delTA (p.His1158Glnfs) rs281865038
NM_024312.4(GNPTAB):c.3503_3504delTC (p.Leu1168Glnfs) rs34002892
NM_024312.4(GNPTAB):c.3565C>T (p.Arg1189Ter) rs137852897
NM_024312.4(GNPTAB):c.3613C>T (p.Arg1205Ter) rs35333334
NM_024312.4(GNPTAB):c.3741_3744delAGAA (p.Glu1248Leufs) rs281865022
NM_024312.4(GNPTAB):c.440delC (p.Asn148Thrfs) rs281864955
NM_024312.4(GNPTAB):c.569A>T (p.Asp190Val) rs34946266
NM_024312.4(GNPTAB):c.616_619delACAG (p.Thr206Tyrfs) rs281865024
NM_024312.4(GNPTAB):c.648_651delAGAA (p.Glu217Serfs) rs281864963
NM_024312.4(GNPTAB):c.749dupA (p.Asn250Lysfs) rs281864964
NM_024312.4(GNPTAB):c.771G>A (p.Leu257=) rs281865025
NM_024408.3(NOTCH2):c.1331G>A (p.Cys444Tyr) rs111033632
NM_024408.3(NOTCH2):c.5857C>T (p.Arg1953Cys) rs312262796
NM_024408.3(NOTCH2):c.5858G>A (p.Arg1953His) rs312262797
NM_024408.3(NOTCH2):c.5930-1G>A rs312262798
NM_024408.3(NOTCH2):c.6007C>T (p.Arg2003Ter) rs312262801
NM_024529.4(CDC73):c.1066+8T>C rs80356647
NM_024529.4(CDC73):c.679_680insAG (p.Arg227Lysfs) rs80356649
NM_024531.4(SLC52A2):c.1088C>T (p.Pro363Leu) rs797045202
NM_024531.4(SLC52A2):c.1258G>A (p.Ala420Thr) rs368924997
NM_024531.4(SLC52A2):c.155C>T (p.Ser52Phe) rs397514657
NM_024531.4(SLC52A2):c.935T>C (p.Leu312Pro) rs754320812
NM_024549.5(TCTN1):c.221-2A>G rs367543065
NM_024577.3(SH3TC2):c.1586G>A (p.Arg529His) rs80338923
NM_024577.3(SH3TC2):c.1747_1748delAG (p.Arg583Alafs) rs80338924
NM_024577.3(SH3TC2):c.1969G>A (p.Glu657Lys) rs80338925
NM_024577.3(SH3TC2):c.1972C>T (p.Arg658Cys) rs80338926
NM_024577.3(SH3TC2):c.2710C>T (p.Arg904Ter) rs80338931
NM_024577.3(SH3TC2):c.2829T>G (p.Tyr943Ter) rs80338932
NM_024577.3(SH3TC2):c.2860C>T (p.Arg954Ter) rs80338933
NM_024577.3(SH3TC2):c.3325C>T (p.Arg1109Ter) rs80338934
NM_024577.3(SH3TC2):c.505T>C (p.Tyr169His) rs80359890
NM_024577.3(SH3TC2):c.530-2A>G rs80338920
NM_024596.4(MCPH1):c.2482C>T (p.Pro828Ser) rs1057091
NM_024596.4(MCPH1):c.427dupA (p.Thr143Asnfs) rs199422125
NM_024596.4(MCPH1):c.74C>G (p.Ser25Ter) rs121434305
NM_024596.4(MCPH1):c.940G>C (p.Asp314His) rs930557
NM_024747.5(HPS6):c.1713_1716delTCTG (p.Leu572Alafs) rs281865113
NM_024757.4(EHMT1):c.2193-1G>C rs137852720
NM_024757.4(EHMT1):c.3218G>A (p.Cys1073Tyr) rs137852726
NM_024757.4(EHMT1):c.3502C>T (p.Arg1168Ter) rs121918301
NM_024757.4(EHMT1):c.3589C>T (p.Arg1197Trp) rs137852727
NM_024757.4(EHMT1):c.871C>T (p.Arg291Ter) rs137852714
NM_025114.3(CEP290):c.2991+1655A>G rs281865192
NM_025132.3(WDR19):c.3307C>T (p.Arg1103Ter) rs387906981
NM_025136.3(OPA3):c.143-1G>C rs80356523
NM_025136.3(OPA3):c.231T>C (p.Ala77=) rs3826860
NM_025136.3(OPA3):c.277G>A (p.Gly93Ser) rs80356524
NM_025136.3(OPA3):c.313C>G (p.Gln105Glu) rs80356525
NM_025136.3(OPA3):c.320_337del18 (p.Gln108_Glu113del) rs80356526
NM_025136.3(OPA3):c.415C>T (p.Gln139Ter) rs28937899
NM_025137.3(SPG11):c.118C>T (p.Gln40Ter) rs267607084
NM_025137.3(SPG11):c.1235C>G (p.Ser412Ter) rs312262723
NM_025137.3(SPG11):c.1388T>C (p.Phe463Ser) rs3759871
NM_025137.3(SPG11):c.1550_1551delTT (p.Cys518Serfs) rs312262730
NM_025137.3(SPG11):c.1735+3_1735+6delAAGT rs312262734
NM_025137.3(SPG11):c.1951C>T (p.Arg651Ter) rs199588440
NM_025137.3(SPG11):c.2146C>T (p.Gln716Ter) rs312262737
NM_025137.3(SPG11):c.2163dupT (p.Ile722Tyrfs) rs312262738
NM_025137.3(SPG11):c.2198T>G (p.Leu733Ter) rs312262739
NM_025137.3(SPG11):c.2316+1G>A rs312262740
NM_025137.3(SPG11):c.2472_2473insT (p.Lys825Terfs) rs312262744
NM_025137.3(SPG11):c.267G>A (p.Trp89Ter) rs312262709
NM_025137.3(SPG11):c.3420G>A (p.Leu1140=) rs36014111
NM_025137.3(SPG11):c.4307_4308delAA (p.Gln1436Argfs) rs312262759
NM_025137.3(SPG11):c.442+1G>C rs312262715
NM_025137.3(SPG11):c.529_533delATATT (p.Ile177Serfs) rs312262716
NM_025137.3(SPG11):c.5410_5411delTG (p.Cys1804Profs) rs312262766
NM_025137.3(SPG11):c.5456_5457del (p.Glu1819Alafs) rs312262764
NM_025137.3(SPG11):c.5470C>T (p.Arg1824Ter) rs312262767
NM_025137.3(SPG11):c.5623C>T (p.Gln1875Ter) rs141848292
NM_025137.3(SPG11):c.5974C>T (p.Arg1992Ter) rs200793464
NM_025137.3(SPG11):c.6100C>T (p.Arg2034Ter) rs118203963
NM_025137.3(SPG11):c.6157G>A (p.Val2053Met) rs149003934
NM_025137.3(SPG11):c.642delT (p.Phe214Leufs) rs312262717
NM_025137.3(SPG11):c.6451delG (p.Ala2151Profs) rs312262779
NM_025137.3(SPG11):c.6737_6740delTTGA (p.Ile2246Serfs) rs312262781
NM_025137.3(SPG11):c.6739_6742delGAGT (p.Glu2247Leufs) rs312262782
NM_025137.3(SPG11):c.6856C>T (p.Arg2286Ter) rs312262785
NM_025137.3(SPG11):c.6898_6899delCT (p.Leu2300Alafs) rs312262786
NM_025137.3(SPG11):c.7023C>T (p.Tyr2341=) rs80338869
NM_025137.3(SPG11):c.7029dupT (p.Val2344Cysfs) rs312262788
NM_025137.3(SPG11):c.704_705delAT (p.His235Argfs) rs312262719
NM_025137.3(SPG11):c.7152-1G>C rs200079802
NM_025137.3(SPG11):c.733_734delAT (p.Met245Valfs) rs312262720
NM_025137.3(SPG11):c.808G>A (p.Val270Ile) rs80338868
NM_025137.3(SPG11):c.869+1G>A rs312262721
NM_025137.4(SPG11):c.3068dup (p.Glu1026Argfs) rs312262752
NM_025137.4(SPG11):c.3291+1G>T rs312262753
NM_025265.3(TSEN2):c.926A>G (p.Tyr309Cys) rs113994149
NM_030662.3(MAP2K2):c.401A>G (p.Tyr134Cys) rs727504370
NM_030777.3(SLC2A10):c.1330C>T (p.Arg444Ter) rs370547023
NM_030777.3(SLC2A10):c.243C>G (p.Ser81Arg) rs80358230
NM_030777.3(SLC2A10):c.313C>T (p.Arg105Cys) rs767864243
NM_030777.3(SLC2A10):c.394C>T (p.Arg132Trp) rs121908173
NM_030777.3(SLC2A10):c.691C>T (p.Arg231Trp) rs146579504
NM_030777.3(SLC2A10):c.692G>A (p.Arg231Gln) rs771028960
NM_030813.5(CLPB):c.1222A>G (p.Arg408Gly) rs144078282
NM_030813.5(CLPB):c.1882C>T (p.Arg628Cys) rs150343959
NM_030813.5(CLPB):c.803C>T (p.Thr268Met) rs200032855
NM_030973.3(MED25):c.1004C>T (p.Ala335Val) rs145770066
NM_031427.3(DNAL1):c.449A>G (p.Asn150Ser) rs387907021
NM_032119.3(ADGRV1):c.16377G>T (p.Gln5459His) rs371947306
NM_032122.4(DTNBP1):c.307C>T (p.Gln103Ter) rs104893945
NM_032383.4(HPS3):c.(-3010)_(217)+692del
NM_032383.4(HPS3):c.1163+1G>A rs201227603
NM_032383.4(HPS3):c.1189C>T (p.Arg397Trp) rs121908316
NM_032383.4(HPS3):c.1691+2T>G rs281865093
NM_032383.4(HPS3):c.2482-2A>G rs397507168
NM_032383.4(HPS3):c.2589+1G>C rs281865095
NM_032387.4(WNK4):c.3553C>T (p.Arg1185Cys) rs137853095
NM_032520.4(GNPTG):c.196C>T (p.Arg66Ter) rs193302848
NM_032520.4(GNPTG):c.316G>A (p.Gly106Ser) rs137852885
NM_032520.4(GNPTG):c.333G>A (p.Trp111Ter) rs137852884
NM_032520.4(GNPTG):c.611delG (p.Gly204Alafs) rs193302856
NM_032520.4(GNPTG):c.640_667del28 (p.Glu214Lysfs) rs193302859
NM_032520.4(GNPTG):c.857C>T (p.Thr286Met) rs193302860
NM_032580.3(HES7):c.73C>T (p.Arg25Trp) rs113994160
NM_032581.3(FAM126A):c.158T>C (p.Leu53Pro) rs72549407
NM_032581.3(FAM126A):c.414+1G>T rs72549406
NM_032581.3(FAM126A):c.51+1G>A rs72549405
NM_032601.3(MCEE):c.178A>C (p.Lys60Gln) rs147401037
NM_032601.3(MCEE):c.427C>T (p.Arg143Cys) rs138436961
NM_032645.4(RAPSN):c.264C>A (p.Asn88Lys) rs104894299
NM_032977.3(CASP10):c.1216A>C (p.Ile406Leu) rs80358239
NM_032977.3(CASP10):c.853C>T (p.Leu285Phe) rs17860403
NM_033022.3(RPS24):c.316C>T (p.Gln106Ter) rs104894188
NM_033022.3(RPS24):c.46C>T (p.Arg16Ter) rs104894189
NM_033022.3(RPS24):c.4_6delAACinsTACGGATAG (p.Asn2_Lys130delinsTyrGly) rs116840806
NM_033028.4(BBS4):c.*1G>C rs113678046
NM_033028.4(BBS4):c.1061T>C (p.Ile354Thr) rs2277598
NM_033028.4(BBS4):c.1451-45T>C rs75847960
NM_033028.4(BBS4):c.157-2A>G rs113994192
NM_033028.4(BBS4):c.220+1G>C rs113994190
NM_033028.4(BBS4):c.77-220delA rs113994189
NM_033056.3(PCDH15):c.16delT (p.Tyr6Ilefs) rs397517451
NM_033056.3(PCDH15):c.5601_5603delAAC (p.Thr1869del) rs113363047
NM_033056.3(PCDH15):c.733C>T (p.Arg245Ter) rs111033260
NM_033124.5(CCDC65):c.877_878del (p.Ile293Profs) rs863223325
NM_033409.3(SLC52A3):c.1048T>A (p.Leu350Met) rs76947760
NM_033409.3(SLC52A3):c.106G>A (p.Glu36Lys) rs267606686
NM_033409.3(SLC52A3):c.1238T>C (p.Val413Ala) rs267606687
NM_033409.3(SLC52A3):c.1325_1326delTC (p.Leu442Argfs) rs794728004
NM_033409.3(SLC52A3):c.1371C>G (p.Phe457Leu) rs145431028
NM_033409.3(SLC52A3):c.394C>T (p.Arg132Trp) rs267606684
NM_033409.3(SLC52A3):c.403A>G (p.Thr135Ala) rs527853872
NM_033409.3(SLC52A3):c.62A>G (p.Asn21Ser) rs199588390
NM_033409.3(SLC52A3):c.796C>T (p.Arg266Trp) rs370499474
NM_033409.3(SLC52A3):c.935C>T (p.Ala312Val) rs752218005
NM_033629.2(TREX1):c.341G>A (p.Arg114His) rs72556554
NM_033629.2(TREX1):c.490C>T (p.Arg164Ter) rs78218009
NM_033629.4(TREX1):c.397delC (p.Leu133Cysfs) rs78762691
NM_033629.4(TREX1):c.907A>C (p.Thr303Pro) rs76224909
NM_052845.3(MMAB):c.291-1G>A rs199971687
NM_052845.3(MMAB):c.403G>A (p.Ala135Thr) rs35648932
NM_052845.3(MMAB):c.569G>A (p.Arg190His) rs756414548
NM_052845.3(MMAB):c.571C>T (p.Arg191Trp) rs376128990
NM_052845.3(MMAB):c.656A>G (p.Tyr219Cys) rs765547005
NM_052873.2(IFT43):c.1A>G (p.Met1Val) rs387907107
NM_052910.2(SLITRK1):c.*689G>A rs191284403
NM_052910.2(SLITRK1):c.1264del (p.Leu422Phefs) rs193302861
NM_052985.3(IFT122):c.1118C>T (p.Ser373Phe) rs267607192
NM_052985.3(IFT122):c.1636G>A (p.Gly546Arg) rs397515568
NM_052985.3(IFT122):c.1658T>G (p.Val553Gly) rs267607191
NM_052985.3(IFT122):c.21G>C (p.Trp7Cys) rs267607193
NM_052985.3(IFT122):c.502+5G>A rs376595844
NM_053054.3(CATSPER1):c.539dupT (p.His182Profs) rs193929390
NM_053054.3(CATSPER1):c.944_948dupATGGC (p.Asp317Metfs) rs193929391
NM_054021.1(GPR101):c.1098C>A (p.Asp366Glu) rs1556379508
NM_054021.1(GPR101):c.924G>C (p.Glu308Asp) rs73637412
NM_080424.2(SP110):c.40delC (p.Gln14Serfs) rs397515362
NM_080424.2(SP110):c.642delC (p.Ser215Alafs) rs397515361
NM_080669.5(SLC46A1):c.1004C>A (p.Ala335Asp) rs281875208
NM_080669.5(SLC46A1):c.1012G>C (p.Gly338Arg) rs281875209
NM_080669.5(SLC46A1):c.1082-1G>A rs80338775
NM_080669.5(SLC46A1):c.1126C>T (p.Arg376Trp) rs80338773
NM_080669.5(SLC46A1):c.194delG (p.Gly65Alafs) rs80338769
NM_080669.5(SLC46A1):c.204_205delCC (p.Asn68Lysfs) rs397515391
NM_080669.5(SLC46A1):c.337C>A (p.Arg113Ser) rs80338770
NM_080669.5(SLC46A1):c.337C>T (p.Arg113Cys) rs80338770
NM_080669.5(SLC46A1):c.954C>G (p.Ser318Arg) rs80338772
NM_080738.3(EDARADD):c.335T>G (p.Leu112Arg) rs121908116
NM_080738.3(EDARADD):c.424G>A (p.Glu142Lys) rs74315309
NM_080860.3(RSPH1):c.727+5G>A (p.Ala244ValfsTer22) rs200382776
NM_101395.2(DYRK1A):c.208-1G>A rs552103257
NM_130837.2(OPA1):c.740G>A (p.Arg247His) rs138350727
NM_133378.4(TTN):c.100076_100086delAAGTAACATGGinsTGAAAGAAAAA (p.Glu33359_Trp33362delinsValLysGluLys) rs281864927
NM_133378.4(TTN):c.100136T>A (p.Ile33379Asn) rs281864928
NM_133378.4(TTN):c.100163T>C (p.Leu33388Pro) rs267607156
NM_133378.4(TTN):c.97820_97827delACCAAGTG (p.Gln32608Hisfs) rs199469665
NM_133647.1(SLC12A6):c.2023C>T (p.Arg675Ter) rs121908428
NM_138387.3(G6PC3):c.778G>C (p.Gly260Arg) rs200478425
NM_138477.2(CDAN1):c.156C>G (p.Phe52Leu) rs80338694
NM_138477.2(CDAN1):c.2015C>T (p.Pro672Leu) rs120074167
NM_138477.2(CDAN1):c.3128A>T (p.Asp1043Val) rs80338698
NM_138477.4(CDAN1):c.2140C>T (p.Arg714Trp) rs80338696
NM_138477.4(CDAN1):c.3124C>T (p.Arg1042Trp) rs80338697
NM_138477.4(CDAN1):c.3389C>T (p.Pro1130Leu) rs80338699
NM_138477.4(CDAN1):c.386G>A (p.Arg129His) rs12441516
NM_138638.4(CFL2):c.103G>A (p.Ala35Thr) rs80358250
NM_139241.3(FGD4):c.1762-2A>G rs281865065
NM_139241.3(FGD4):c.823C>T (p.Arg275Ter) rs118203974
NM_139241.3(FGD4):c.893T>C (p.Met298Thr) rs63749871
NM_139241.3(FGD4):c.893T>G (p.Met298Arg) rs63749871
NM_139276.2(STAT3):c.1144C>T (p.Arg382Trp) rs113994135
NM_139276.2(STAT3):c.1145G>A (p.Arg382Gln) rs113994136
NM_139276.2(STAT3):c.1268G>A (p.Arg423Gln) rs113994137
NM_139276.2(STAT3):c.1387_1389delGTG (p.Val463del) rs113994138
NM_139276.2(STAT3):c.1909G>A (p.Val637Met) rs113994139
NM_144997.5(FLCN):c.1285delC (p.His429Thrfs) rs80338682
NM_144997.5(FLCN):c.1285dupC (p.His429Profs) rs80338682
NM_145038.4(DRC1):c.352C>T (p.Gln118Ter) rs142371860
NM_145239.2(PRRT2):c.647C>G (p.Pro216Arg) rs76335820
NM_145239.2(PRRT2):c.649dupC (p.Arg217Profs) rs587778771
NM_152263.2(TPM3):c.502C>G (p.Arg168Gly) rs121964854
NM_152263.3(TPM3):c.26T>G (p.Met9Arg) rs80358247
NM_152263.3(TPM3):c.298C>A (p.Leu100Met) rs121964853
NM_152263.3(TPM3):c.502C>T (p.Arg168Cys) rs121964854
NM_152263.3(TPM3):c.503G>A (p.Arg168His) rs121964852
NM_152263.3(TPM3):c.857A>C (p.Ter286Ser) rs199474720
NM_152296.3(ATP1A3):c.2767G>A (p.Asp923Asn) rs267606670
NM_152296.4(ATP1A3):c.2267G>A (p.Arg756His) rs606231435
NM_152296.4(ATP1A3):c.2452G>A (p.Glu818Lys) rs587777771
NM_152296.5(ATP1A3):c.2417T>G (p.Met806Arg) rs549006436
NM_152443.2(RDH12):c.806_810delCCCTG (p.Ala269Glyfs) rs386834261
NM_152594.2(SPRED1):c.1044T>C (p.Val348=) rs3751526
NM_152594.2(SPRED1):c.291G>A (p.Lys97=) rs7182445
NM_152703.4(SAMD9L):c.2640C>A (p.His880Gln) rs878855336
NM_152703.4(SAMD9L):c.3587G>C (p.Cys1196Ser) rs878855337
NM_152722.4(HEPACAM):c.265G>A (p.Gly89Ser) rs387907053
NM_152722.4(HEPACAM):c.274C>T (p.Arg92Trp) rs387907055
NM_152722.4(HEPACAM):c.275G>A (p.Arg92Gln) rs387907050
NM_152778.2(MFSD8):c.754+2T>A rs587778809
NM_152778.2(MFSD8):c.881C>A (p.Thr294Lys) rs140948465
NM_153026.2(PRICKLE1):c.1414T>C (p.Tyr472His) rs281865564
NM_153026.2(PRICKLE1):c.311G>A (p.Arg104Gln) rs113994140
NM_153026.2(PRICKLE1):c.431G>A (p.Arg144His) rs281865563
NM_153676.3(USH1C):c.496+59_479-35GAGCAGGGCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGG[7]GAGCAGGTCAGTACTCCATGACGGTGGGAGGGAGGGAGGGCGGGG[2] rs55983148
NM_153704.5(TMEM67):c.1843T>C (p.Cys615Arg) rs201893408
NM_153704.5(TMEM67):c.2241G>A (p.=) rs115563233
NM_153704.5(TMEM67):c.958A>T (p.Ser320Cys) rs111619594
NM_170707.3(LMNA):c.1303C>T (p.Arg435Cys) rs150840924
NM_170707.3(LMNA):c.1411C>T (p.Arg471Cys) rs28928902
NM_170707.3(LMNA):c.16C>T (p.Gln6Ter) rs61046466
NM_170707.3(LMNA):c.607G>A (p.Glu203Lys) rs61195471
NM_170707.3(LMNA):c.892C>T (p.Arg298Cys) rs59885338
NM_170784.2(MKKS):c.117C>T (p.Pro39=) rs16991547
NM_170784.2(MKKS):c.534C>T (p.Ile178=) rs17852625
NM_172107.3(KCNQ2):c.1058G>A (p.Arg353His) rs796052645
NM_172107.3(KCNQ2):c.1259C>T (p.Pro420Leu) rs139164500
NM_172107.3(KCNQ2):c.1602G>A (p.Pro534=) rs775089685
NM_172107.3(KCNQ2):c.1639C>T (p.Arg547Trp) rs796052650
NM_172107.3(KCNQ2):c.1689C>T (p.Asp563=) rs35450031
NM_172107.3(KCNQ2):c.1732A>G (p.Met578Val) rs1057516123
NM_172107.3(KCNQ2):c.1742G>A (p.Arg581Gln) rs118192235
NM_172107.3(KCNQ2):c.1887+5G>A rs777916008
NM_172107.3(KCNQ2):c.1A>G (p.Met1Val) rs118192185
NM_172107.3(KCNQ2):c.2599_2603dup (p.Arg871Glyfs) rs1555850151
NM_172107.3(KCNQ2):c.2613G>T (p.Arg871Ser) rs587780369
NM_172107.3(KCNQ2):c.365C>T (p.Ser122Leu) rs118192194
NM_172107.3(KCNQ2):c.601C>T (p.Arg201Cys) rs796052623
NM_172107.3(KCNQ2):c.602G>A (p.Arg201His) rs1057516085
NM_172107.3(KCNQ2):c.637C>T (p.Arg213Trp) rs118192203
NM_172107.3(KCNQ2):c.638G>A (p.Arg213Gln) rs397514581
NM_172107.3(KCNQ2):c.640C>T (p.Arg214Trp) rs28939684
NM_172107.3(KCNQ2):c.793G>A (p.Ala265Thr) rs794727740
NM_172107.3(KCNQ2):c.794C>T (p.Ala265Val) rs587777219
NM_172107.3(KCNQ2):c.802C>T (p.Leu268Phe) rs1057516094
NM_172107.3(KCNQ2):c.841G>A (p.Gly281Arg) rs794727813
NM_172107.3(KCNQ2):c.901G>A (p.Gly301Ser) rs1057516099
NM_172107.3(KCNQ2):c.917C>T (p.Ala306Val) rs864321707
NM_172107.3(KCNQ2):c.998G>A (p.Arg333Gln) rs118192216
NM_172250.2(MMAA):c.161G>A (p.Trp54Ter) rs864309725
NM_172250.3(MMAA):c.266T>C (p.Leu89Pro) rs864309726
NM_172250.3(MMAA):c.650T>A (p.Leu217Ter) rs140356252
NM_172250.3(MMAA):c.733+1G>A rs779939886
NM_173477.4(USH1G):c.832_851del20 (p.Ser278Profs) rs397515345
NM_173500.3(TTBK2):c.1284_1285delAG (p.Glu429Aspfs) rs80356539
NM_173500.3(TTBK2):c.1329dupA (p.Arg444Thrfs) rs80356538
NM_174936.3(PCSK9):c.1120G>T (p.Asp374Tyr) rs137852912
NM_174936.3(PCSK9):c.1486C>T (p.Arg496Trp) rs374603772
NM_174936.3(PCSK9):c.381T>A (p.Ser127Arg) rs28942111
NM_174936.3(PCSK9):c.644G>A (p.Arg215His) rs794728683
NM_175875.4(SIX5):c.1093G>A (p.Gly365Arg) rs80356463
NM_175875.4(SIX5):c.1655C>T (p.Thr552Met) rs80356464
NM_175875.4(SIX5):c.472G>A (p.Ala158Thr) rs80356461
NM_175875.4(SIX5):c.886G>A (p.Ala296Thr) rs80356462
NM_177400.2(NKX6-2):c.196delC (p.Arg66Glyfs) rs1554961118
NM_177924.4(ASAH1):c.125C>T (p.Thr42Met) rs145873635
NM_178452.5(DNAAF1):c.524T>G (p.Leu175Arg) rs267607227
NM_178452.5(DNAAF1):c.811C>T (p.Arg271Ter) rs267607225
NM_181426.1(CCDC39):c.1072delA (p.Thr358Glnfs) rs587778822
NM_181426.1(CCDC39):c.2190del (p.Glu731Asnfs) rs587778820
NM_181426.2(CCDC39):c.357+1G>C rs397515392
NM_181507.1(HPS5):c.2025_2028delAGTT (p.Val676Metfs) rs281865103
NM_181507.1(HPS5):c.2593C>T (p.Arg865Ter) rs281865104
NM_181507.1(HPS5):c.2624delT (p.Leu875Cysfs) rs281865105
NM_181507.1(HPS5):c.2928_2929dupGA (p.Thr977Argfs) rs397507169
NM_181507.1(HPS5):c.3293C>T (p.Thr1098Ile) rs61884288
NM_181507.1(HPS5):c.879dupC (p.Lys294Glnfs) rs281865101
NM_181523.2(PIK3R1):c.1615_1617delATT (p.Ile539del) rs397514046
NM_181714.3(LCA5):c.-1688_-298+207del1598
NM_181714.3(LCA5):c.1151delC (p.Pro384Glnfs) rs386834252
NM_181714.3(LCA5):c.1476dupA (p.Pro493Thrfs) rs386834253
NM_181714.3(LCA5):c.835C>T (p.Gln279Ter) rs121918165
NM_181882.2(PRX):c.1951G>A (p.Asp651Asn) rs3814290
NM_181882.2(PRX):c.2145T>A (p.Cys715Ter) rs104894707
NM_181882.2(PRX):c.3208C>T (p.Arg1070Ter) rs104894708
NM_182760.3(SUMF1):c.463T>C (p.Ser155Pro) rs137852850
NM_182760.3(SUMF1):c.739G>C (p.Gly247Arg) rs1057517363
NM_183050.2(BCKDHB):c.548G>C (p.Arg183Pro) rs79761867
NM_183050.3(BCKDHB):c.1114G>T (p.Glu372Ter) rs386834234
NM_183050.3(BCKDHB):c.832G>A (p.Gly278Ser) rs386834233
NM_183059.2(RD3):c.296+1G>A rs386834260
NM_183357.2(ADCY5):c.1252C>T (p.Arg418Trp) rs864309483
NM_194248.2(OTOF):c.1194T>A (p.Asp398Glu) rs181805996
NM_194248.2(OTOF):c.1544T>C (p.Ile515Thr) rs80356586
NM_194248.2(OTOF):c.158C>T (p.Ala53Val) rs1879761
NM_194248.2(OTOF):c.2022C>T (p.Asp674=) rs13004993
NM_194248.2(OTOF):c.2025G>A (p.Glu675=) rs61746988
NM_194248.2(OTOF):c.2122C>T (p.Arg708Ter) rs80356590
NM_194248.2(OTOF):c.2239G>T (p.Glu747Ter) rs397515591
NM_194248.2(OTOF):c.2317C>T (p.Arg773Cys) rs80356569
NM_194248.2(OTOF):c.2348delG (p.Gly783Alafs) rs80356591
NM_194248.2(OTOF):c.2381G>A (p.Arg794His) rs80356592
NM_194248.2(OTOF):c.244C>T (p.Arg82Cys) rs13031859
NM_194248.2(OTOF):c.2464C>T (p.Arg822Trp) rs80356570
NM_194248.2(OTOF):c.2485C>T (p.Gln829Ter) rs80356593
NM_194248.2(OTOF):c.2580C>G (p.Val860=) rs2272069
NM_194248.2(OTOF):c.2887C>T (p.Arg963Ter) rs80356595
NM_194248.2(OTOF):c.2977_2978delAG (p.Gln994Valfs) rs397515597
NM_194248.2(OTOF):c.3032T>C (p.Leu1011Pro) rs80356596
NM_194248.2(OTOF):c.3189G>A (p.Ala1063=) rs80356573
NM_194248.2(OTOF):c.3247G>C (p.Ala1083Pro) rs80356574
NM_194248.2(OTOF):c.3470G>A (p.Arg1157Gln) rs56054534
NM_194248.2(OTOF):c.372A>G (p.Thr124=) rs11687696
NM_194248.2(OTOF):c.3966C>G (p.Asp1322Glu) rs80356576
NM_194248.2(OTOF):c.4227+1G>T rs397515601
NM_194248.2(OTOF):c.4483C>T (p.Arg1495Ter) rs147321712
NM_194248.2(OTOF):c.4491T>A (p.Tyr1497Ter) rs80356600
NM_194248.2(OTOF):c.4559G>A (p.Arg1520Gln) rs80356601
NM_194248.2(OTOF):c.4677G>A (p.Val1559=) rs2272071
NM_194248.2(OTOF):c.4718T>C (p.Ile1573Thr) rs111033405
NM_194248.2(OTOF):c.4767C>T (p.Arg1589=) rs80356578
NM_194248.2(OTOF):c.4936C>T (p.Pro1646Ser) rs17005371
NM_194248.2(OTOF):c.4960+1G>C rs80356602
NM_194248.2(OTOF):c.5098G>C rs199766465
NM_194248.2(OTOF):c.5410_5412delGAG (p.Glu1804del) rs397515607
NM_194248.2(OTOF):c.5473C>G (p.Pro1825Ala) rs28937591
NM_194248.2(OTOF):c.5815C>T (p.Arg1939Trp) rs368790049
NM_194248.2(OTOF):c.766-2A>G rs80356584
NM_194248.2(OTOF):c.945G>A (p.Lys315=) rs41288779
NM_194279.3(ISCA2):c.229G>A (p.Gly77Ser) rs730882246
NM_194318.3(B3GLCT):c.347+5G>A rs80338850
NM_194318.3(B3GLCT):c.660+1G>A rs80338851
NM_198056.2(SCN5A):c.1535C>T (p.Thr512Ile) rs199473118
NM_198056.2(SCN5A):c.3694C>T (p.Arg1232Trp) rs199473207
NM_198056.2(SCN5A):c.4859C>T (p.Thr1620Met) rs199473282
NM_198253.2(TERT):c.1234C>T (p.His412Tyr) rs34094720
NM_198253.2(TERT):c.164T>A (p.Leu55Gln) rs387907247
NM_198253.2(TERT):c.1892G>A (p.Arg631Gln) rs199422294
NM_198253.2(TERT):c.2080G>A (p.Val694Met) rs121918662
NM_198253.2(TERT):c.2110C>T (p.Pro704Ser) rs199422297
NM_198253.2(TERT):c.2177C>T (p.Thr726Met) rs149566858
NM_198253.2(TERT):c.2178G>A (p.Thr726=) rs199422288
NM_198253.2(TERT):c.219+1G>A rs199422309
NM_198253.2(TERT):c.2240delT (p.Val747Alafs) rs199422300
NM_198253.2(TERT):c.2315A>G (p.Tyr772Cys) rs121918663
NM_198253.2(TERT):c.2431C>T (p.Arg811Cys) rs199422301
NM_198253.2(TERT):c.2583-2A>C rs111576740
NM_198253.2(TERT):c.2594G>A (p.Arg865His) rs121918666
NM_198253.2(TERT):c.2701C>T (p.Arg901Trp) rs199422304
NM_198253.2(TERT):c.2706G>C (p.Lys902Asn) rs121918665
NM_198253.2(TERT):c.2935C>T (p.Arg979Trp) rs199422305
NM_198253.2(TERT):c.3184G>A (p.Ala1062Thr) rs35719940
NM_198253.2(TERT):c.3268G>A (p.Val1090Met) rs121918664
NM_198253.2(TERT):c.3329C>T (p.Thr1110Met) rs199422306
NM_198253.2(TERT):c.430G>A (p.Val144Met) rs199422291
NM_198253.2(TERT):c.604G>A (p.Ala202Thr) rs121918661
NM_198253.2(TERT):c.835G>A (p.Ala279Thr) rs61748181
NM_198578.3(LRRK2):c.1000G>A (p.Glu334Lys) rs78501232
NM_198578.3(LRRK2):c.149A>G (p.His50Arg) rs2256408
NM_198578.3(LRRK2):c.1653C>G (p.Asn551Lys) rs7308720
NM_198578.3(LRRK2):c.2022A>C (p.Val674=) rs72546319
NM_198578.3(LRRK2):c.2167A>G (p.Ile723Val) rs10878307
NM_198578.3(LRRK2):c.2264C>T (p.Pro755Leu) rs34410987
NM_198578.3(LRRK2):c.2378G>T (p.Arg793Met) rs35173587
NM_198578.3(LRRK2):c.2428A>G (p.Ile810Val) rs72546337
NM_198578.3(LRRK2):c.2481T>C (p.Ser827=) rs76890302
NM_198578.3(LRRK2):c.2769G>C (p.Gln923His) rs58559150
NM_198578.3(LRRK2):c.2857T>C (p.Leu953=) rs7966550
NM_198578.3(LRRK2):c.3018A>G (p.Ile1006Met) rs113217062
NM_198578.3(LRRK2):c.3333G>T (p.Gln1111His) rs78365431
NM_198578.3(LRRK2):c.3364A>G (p.Ile1122Val) rs34805604
NM_198578.3(LRRK2):c.3451G>A (p.Ala1151Thr) rs74985840
NM_198578.3(LRRK2):c.356T>C (p.Leu119Pro) rs33995463
NM_198578.3(LRRK2):c.3683G>C (p.Ser1228Thr) rs60185966
NM_198578.3(LRRK2):c.3974G>A (p.Arg1325Gln) rs72546338
NM_198578.3(LRRK2):c.4111A>G (p.Ile1371Val) rs17466213
NM_198578.3(LRRK2):c.4193G>A (p.Arg1398His) rs7133914
NM_198578.3(LRRK2):c.4229C>T (p.Thr1410Met) rs72546327
NM_198578.3(LRRK2):c.4269G>A (p.Lys1423=) rs11175964