ClinVar Miner

Variants from Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital with conflicting interpretations

Location: Denmark  Primary collection method: clinical testing
Minimum review status of the submission from Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital: Collection method of the submission from Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
2556 1922 60 1314 864 17 84 2014

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital pathogenic likely pathogenic uncertain significance likely benign benign affects association drug response established risk allele risk factor other
pathogenic 0 52 19 0 1 0 0 2 0 2 3
likely pathogenic 36 0 26 2 0 0 1 0 0 1 0
uncertain significance 15 23 21 394 139 1 3 2 0 1 1
likely benign 1 2 307 0 702 0 0 0 0 0 0
benign 2 2 143 524 39 0 0 0 1 4 0

Submitter to submitter summary #

Total submitters: 84
Download table as spreadsheet
Submitter Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
GeneDx 0 2085 0 655 268 1 25 949
Quest Diagnostics Nichols Institute San Juan Capistrano 0 873 0 331 230 0 12 573
Women's Health and Genetics/Laboratory Corporation of America, LabCorp 0 703 0 248 218 0 5 471
PreventionGenetics, part of Exact Sciences 0 1050 0 236 186 2 10 434
CeGaT Center for Human Genetics Tuebingen 0 645 0 158 147 0 10 315
Genetic Services Laboratory, University of Chicago 0 413 0 179 94 2 2 277
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories 0 638 0 178 71 1 8 258
CHEO Genetics Diagnostic Laboratory, Children's Hospital of Eastern Ontario 0 441 0 152 64 0 1 217
Invitae 0 495 0 67 79 1 14 161
Mayo Clinic Laboratories, Mayo Clinic 0 315 0 92 42 0 5 139
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine 0 139 0 56 78 0 2 136
Biesecker Lab/Clinical Genomics Section, National Institutes of Health 0 1 60 20 55 0 0 135
Laboratory of Diagnostic Genome Analysis, Leiden University Medical Center (LUMC) 0 291 0 112 19 0 0 131
Department of Pathology and Laboratory Medicine, Sinai Health System 0 206 0 59 57 0 9 125
Clinical Genetics, Academic Medical Center 0 266 0 85 30 0 0 115
Joint Genome Diagnostic Labs from Nijmegen and Maastricht, Radboudumc and MUMC+ 0 521 0 76 36 0 3 115
Eurofins Ntd Llc (ga) 0 276 0 71 38 2 3 114
Genome Diagnostics Laboratory, Amsterdam University Medical Center 0 281 0 62 40 0 1 103
Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center 0 274 0 53 37 0 1 91
Institute for Clinical Genetics, University Hospital TU Dresden, University Hospital TU Dresden 0 231 0 23 60 0 4 87
Genome Diagnostics Laboratory, University Medical Center Utrecht 0 166 0 58 23 0 1 82
Clinical Genetics Laboratory, Department of Pathology, Netherlands Cancer Institute 0 332 0 71 9 0 2 82
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen 0 173 0 29 25 0 2 56
Illumina Laboratory Services, Illumina 0 57 0 25 26 0 4 55
Mendelics 0 22 0 2 33 0 0 35
Athena Diagnostics Inc 0 72 0 23 9 0 0 32
Ambry Genetics 0 103 0 5 25 0 1 31
Fulgent Genetics, Fulgent Genetics 0 77 0 29 1 0 0 30
Center for Pediatric Genomic Medicine, Children's Mercy Hospital and Clinics 0 43 0 23 6 0 1 30
Foulkes Cancer Genetics LDI, Lady Davis Institute for Medical Research 0 36 0 6 13 0 5 24
Revvity Omics, Revvity 0 123 0 9 8 0 4 21
CSER _CC_NCGL, University of Washington 0 9 0 7 12 0 0 19
Leiden Open Variation Database 0 32 0 10 5 0 1 16
OMIM 0 8 0 2 0 9 3 14
Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen 0 55 0 7 0 0 3 10
King Laboratory, University of Washington 0 0 0 5 4 0 0 9
Clinical Genetics and Genomics, Karolinska University Hospital 0 72 0 5 0 0 2 7
Department of Pathology and Molecular Medicine, Queen's University 0 8 0 4 3 0 0 7
Research Molecular Genetics Laboratory, Women's College Hospital, University of Toronto 0 20 0 3 3 0 1 7
Genomic Diagnostic Laboratory, Division of Genomic Diagnostics, Children's Hospital of Philadelphia 0 13 0 1 4 0 1 6
Cancer Genetics and Genomics Laboratory, British Columbia Cancer Agency 0 54 0 6 0 0 0 6
University of Washington Department of Laboratory Medicine, University of Washington 0 5 0 2 1 1 2 6
AiLife Diagnostics, AiLife Diagnostics 0 11 0 4 0 0 1 5
Institute for Genomic Medicine (IGM) Clinical Laboratory, Nationwide Children's Hospital 0 1 0 4 0 0 0 4
Blueprint Genetics 0 2 0 1 0 0 3 4
Centre for Mendelian Genomics, University Medical Centre Ljubljana 0 2 0 1 2 0 1 4
Human Genomics Unit, Institute for molecular medicine Finland (FIMM) 0 1 0 1 1 0 2 4
3DMed Clinical Laboratory Inc 0 3 0 1 3 0 0 4
Gharavi Laboratory, Columbia University 0 7 0 1 1 0 1 3
CZECANCA consortium 0 25 0 1 0 0 2 3
Greenwood Genetic Center Diagnostic Laboratories, Greenwood Genetic Center 0 5 0 1 0 0 1 2
Counsyl 0 5 0 2 0 0 0 2
PharmGKB 0 0 0 0 0 2 0 2
GeneKor MSA 0 31 0 2 0 0 0 2
Medical Genetics Summaries 0 0 0 0 0 2 0 2
St. Jude Molecular Pathology, St. Jude Children's Research Hospital 0 7 0 0 0 0 2 2
Al Jalila Children's Genomics Center, Al Jalila Childrens Speciality Hospital 0 7 0 1 0 0 1 2
Unidad de Genómica Garrahan, Hospital de Pediatría Garrahan 0 7 0 2 0 0 0 2
Institute of Human Genetics, University Hospital Muenster 0 4 0 1 1 0 0 2
Practice for Gait Abnormalities, David Pomarino, Competency Network Toe Walking c/o Practice Pomarino 0 2 0 0 1 0 1 2
Baylor Genetics 0 5 0 0 0 0 1 1
Clinical Molecular Genetics Laboratory, Johns Hopkins All Children's Hospital 0 0 0 0 0 0 1 1
Natera, Inc. 0 4 0 1 0 0 0 1
Human Genome Sequencing Center Clinical Lab, Baylor College of Medicine 0 1 0 1 0 0 0 1
Genomic Research Center, Shahid Beheshti University of Medical Sciences 0 4 0 1 0 0 0 1
Foundation Medicine, Inc. 0 0 0 0 1 0 0 1
Oxford Medical Genetics Laboratories, Oxford University Hospitals NHS Foundation Trust 0 0 0 0 0 0 1 1
Australian Red Cross Blood Service 0 0 0 0 0 1 0 1
Centre de Biologie Pathologie Génétique, Centre Hospitalier Universitaire de Lille 0 0 0 1 0 0 0 1
Soonchunhyang University Bucheon Hospital, Soonchunhyang University Medical Center 0 0 0 1 0 0 0 1
NIHR Bioresource Rare Diseases, University of Cambridge 0 3 0 1 0 0 0 1
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego 0 4 0 1 0 0 0 1
Endocrine oncology group, Uppsala University 0 0 0 1 0 0 0 1
Laboratory of Medical Genetics Unit, Bambino Gesù Children's Hospital 0 2 0 1 0 0 0 1
Broad Center for Mendelian Genomics, Broad Institute of MIT and Harvard 0 0 0 0 1 0 0 1
Lab. Molecular Oncology, VUB, Free University of Brussels 0 3 0 0 1 0 0 1
Pathology and Clinical Laboratory Medicine, King Fahad Medical City 0 0 0 0 0 0 1 1
HLA Laboratory, Instituto Nacional de Enfermedades Respiratorias Ismael Cosio Villegas 0 0 0 0 0 0 1 1
Pediatric Oncology, Johns Hopkins University 0 0 0 1 0 0 0 1
Population Bio, Inc. 0 0 0 0 0 1 0 1
Center for Genomic Medicine, King Faisal Specialist Hospital and Research Center 0 1 0 0 0 0 1 1
DASA 0 4 0 0 0 0 1 1
Genomics England Pilot Project, Genomics England 0 0 0 1 0 0 0 1
Laboratorio de Genetica e Diagnostico Molecular, Hospital Israelita Albert Einstein 0 7 0 1 0 0 0 1

All variants with conflicting interpretations #

Total variants: 2014
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_000546.6(TP53):c.74+38C>G rs1642785 0.66254
NM_177438.3(DICER1):c.4206+9G>T rs1778057 0.25695
NM_003126.4(SPTA1):c.6531-12C>T rs28525570 0.25447
NM_177438.3(DICER1):c.4206+11del rs58202892 0.21617
NM_001042492.3(NF1):c.6642+45T>A rs17883614 0.12771
NM_003001.5(SDHC):c.77+32A>T rs77828459 0.12254
NM_003002.4(SDHD):c.315-32T>C rs4151637 0.11444
NM_003002.4(SDHD):c.170-29A>G rs9919624 0.11431
NM_003002.4(SDHD):c.204C>T (p.Ser68=) rs9919552 0.11428
NM_000410.4(HFE):c.187C>G (p.His63Asp) rs1799945 0.10170
NM_004329.3(BMPR1A):c.431-26T>A rs7920259 0.06507
NM_000051.4(ATM):c.378T>A (p.Asp126Glu) rs2234997 0.06244
NM_024675.4(PALB2):c.-47G>A rs8053188 0.04991
NM_000249.4(MLH1):c.1039-31del rs756911937 0.04867
NM_002691.4(POLD1):c.1495-44A>G rs3219396 0.04859
NM_001048174.2(MUTYH):c.22G>A (p.Val8Met) rs3219484 0.04794
NM_007294.4(BRCA1):c.1067A>G (p.Gln356Arg) rs1799950 0.04695
NM_000059.4(BRCA2):c.2971A>G (p.Asn991Asp) rs1799944 0.04357
NM_007194.4(CHEK2):c.252A>G (p.Glu84=) rs1805129 0.04009
NM_000410.4(HFE):c.845G>A (p.Cys282Tyr) rs1800562 0.03880
NM_000059.4(BRCA2):c.10234A>G (p.Ile3412Val) rs1801426 0.03864
NM_020975.6(RET):c.2508C>T (p.Ser836=) rs1800862 0.03791
NM_001042492.3(NF1):c.6148-29_6148-28insA rs66638017 0.03789
NM_000059.4(BRCA2):c.865A>C (p.Asn289His) rs766173 0.03693
NM_000249.4(MLH1):c.1039-29A>T rs6771325 0.03662
NM_000251.3(MSH2):c.2005+42G>T rs17218446 0.03590
NM_144997.7(FLCN):c.1233G>A (p.Glu411=) rs61750032 0.03557
NM_002354.3(EPCAM):c.904-12T>C rs62139669 0.03374
NM_004360.5(CDH1):c.48+5C>G rs77312180 0.03370
NM_000051.4(ATM):c.4578C>T (p.Pro1526=) rs1800889 0.03196
NM_000051.4(ATM):c.657T>C (p.Cys219=) rs2235003 0.02841
NM_020975.6(RET):c.1264-5C>T rs9282835 0.02749
NM_000791.4(DHFR):c.-400A>G rs2405875 0.02618
NM_000455.5(STK11):c.816C>T (p.Tyr272=) rs9282859 0.02603
NM_024675.4(PALB2):c.3300T>G (p.Thr1100=) rs45516100 0.02529
NM_000535.7(PMS2):c.1532C>T (p.Thr511Met) rs74902811 0.02492
NM_000051.4(ATM):c.8786+8A>C rs4986839 0.02488
NM_000249.4(MLH1):c.2152C>T (p.His718Tyr) rs2020873 0.02345
NM_000251.3(MSH2):c.380A>G (p.Asn127Ser) rs17217772 0.02317
NM_002354.3(EPCAM):c.859-7C>T rs72882786 0.02290
NM_000535.7(PMS2):c.1531A>G (p.Thr511Ala) rs2228007 0.02174
NM_024675.4(PALB2):c.2014G>C (p.Glu672Gln) rs45532440 0.02171
NM_000051.4(ATM):c.2639-17G>T rs2234994 0.02161
NM_000051.4(ATM):c.4138C>T (p.His1380Tyr) rs3092856 0.02156
NM_006231.4(POLE):c.4290+5C>T rs5744936 0.02053
NM_000077.5(CDKN2A):c.442G>A (p.Ala148Thr) rs3731249 0.02007
NM_000179.3(MSH6):c.2253T>C (p.Asn751=) rs2020913 0.02003
NM_001040108.2(MLH3):c.666G>A (p.Lys222=) rs28756980 0.01977
NM_001040108.2(MLH3):c.444G>C (p.Val148=) rs11556091 0.01944
NM_001040108.2(MLH3):c.4242+13C>G rs77157930 0.01890
NM_000051.4(ATM):c.1541G>A (p.Gly514Asp) rs2235000 0.01889
NM_001354604.2(MITF):c.1031+31T>C rs55754687 0.01857
NM_000059.4(BRCA2):c.5744C>T (p.Thr1915Met) rs4987117 0.01834
NM_177438.3(DICER1):c.4206+9_4206+17del rs772457274 0.01816
NM_177438.3(DICER1):c.2997T>G (p.Leu999=) rs12018992 0.01764
NM_000130.4(F5):c.1601G>A (p.Arg534Gln) rs6025 0.01762
NM_000245.4(MET):c.1124A>G (p.Asn375Ser) rs33917957 0.01723
NM_024675.4(PALB2):c.2993G>A (p.Gly998Glu) rs45551636 0.01717
NM_000251.3(MSH2):c.965G>A (p.Gly322Asp) rs4987188 0.01714
NM_000038.6(APC):c.7504G>A (p.Gly2502Ser) rs2229995 0.01693
NM_002354.2(EPCAM):c.*265A>T rs11554292 0.01658
NM_000535.7(PMS2):c.1866G>A (p.Met622Ile) rs1805324 0.01651
NM_004360.5(CDH1):c.2634C>T (p.Gly878=) rs2229044 0.01638
NM_000546.6(TP53):c.993+12T>C rs1800899 0.01614
NM_007194.4(CHEK2):c.1542+11T>A rs17881716 0.01583
NM_020975.6(RET):c.2944C>T (p.Arg982Cys) rs17158558 0.01567
NM_000051.4(ATM):c.2193C>T (p.Tyr731=) rs2229019 0.01543
NM_024675.4(PALB2):c.1010T>C (p.Leu337Ser) rs45494092 0.01508
NM_000143.4(FH):c.904+47G>A rs145209119 0.01502
NM_177438.3(DICER1):c.4206+9_4206+13del rs745445238 0.01449
NM_000465.4(BARD1):c.1670G>C (p.Cys557Ser) rs28997576 0.01443
NM_006231.4(POLE):c.6418G>A (p.Glu2140Lys) rs5745066 0.01416
NM_004360.5(CDH1):c.1849G>A (p.Ala617Thr) rs33935154 0.01412
NM_000051.4(ATM):c.6095+15T>C rs3212321 0.01395
NM_000051.4(ATM):c.2614C>T (p.Pro872Ser) rs3218673 0.01393
NM_000051.4(ATM):c.2685A>G (p.Leu895=) rs3218687 0.01393
NM_007294.4(BRCA1):c.*36C>G rs3092995 0.01385
NM_000179.3(MSH6):c.1164C>T (p.His388=) rs55708305 0.01384
NM_000179.3(MSH6):c.2272C>T (p.Leu758=) rs56371757 0.01363
NM_001040108.2(MLH3):c.691A>C (p.Lys231Gln) rs28756981 0.01348
NM_007294.4(BRCA1):c.4956G>A (p.Met1652Ile) rs1799967 0.01348
NM_006231.4(POLE):c.91G>T (p.Ala31Ser) rs34047482 0.01320
NM_002691.4(POLD1):c.2251-23A>G rs3218769 0.01319
NM_001370259.2(MEN1):c.512G>A (p.Arg171Gln) rs607969 0.01309
NM_003000.3(SDHB):c.8C>G (p.Ala3Gly) rs11203289 0.01309
NM_000249.4(MLH1):c.1039-27T>A rs9862158 0.01307
NM_000059.4(BRCA2):c.8830A>T (p.Ile2944Phe) rs4987047 0.01281
NM_000546.6(TP53):c.639A>G (p.Arg213=) rs1800372 0.01275
NM_000077.5(CDKN2A):c.-25C>T rs144481587 0.01273
NM_000051.4(ATM):c.3118A>G (p.Met1040Val) rs3092857 0.01233
NM_000051.4(ATM):c.4258C>T (p.Leu1420Phe) rs1800058 0.01150
NM_001040108.2(MLH3):c.1258G>A (p.Val420Ile) rs28756982 0.01142
NM_006231.4(POLE):c.2174-8G>A rs117409343 0.01137
NM_000051.4(ATM):c.6572+12G>T rs3218677 0.01112
NM_017763.6(RNF43):c.2280G>A (p.Pro760=) rs61746279 0.01112
NM_007294.4(BRCA1):c.3119G>A (p.Ser1040Asn) rs4986852 0.01109
NM_002878.4(RAD51D):c.698A>G (p.Glu233Gly) rs28363284 0.01102
NM_015450.3(POT1):c.1792+50A>G rs146966778 0.01095
NM_001048174.2(MUTYH):c.1517G>A (p.Arg506Gln) rs3219497 0.01092
NM_002691.4(POLD1):c.971-35C>T rs56368556 0.01086
NM_000051.4(ATM):c.735C>T (p.Val245=) rs3218674 0.01085
NM_006231.4(POLE):c.5811+46G>A rs5744992 0.01076
NM_000059.4(BRCA2):c.8487+19A>G rs11571743 0.01055
NM_007294.4(BRCA1):c.3418A>G (p.Ser1140Gly) rs2227945 0.01054
NM_001040108.2(MLH3):c.2896T>C (p.Ser966Pro) rs17782839 0.01052
NM_000410.4(HFE):c.193A>T (p.Ser65Cys) rs1800730 0.01042
NM_002691.4(POLD1):c.202+41G>A rs56055109 0.01037
NM_001083603.3(PTCH1):c.-132G>A rs118133906 0.01024
NM_007294.4(BRCA1):c.212+23T>A rs8176128 0.01018
NM_000551.4(VHL):c.340+648T>C rs73024533 0.01009
NM_177438.3(DICER1):c.4206+9del rs368080354 0.01007
NM_000535.7(PMS2):c.1789A>T (p.Thr597Ser) rs1805318 0.01006
NM_000388.4(CASR):c.2610G>A (p.Glu870=) rs143738711 0.01002
NM_139027.6(ADAMTS13):c.2195C>T (p.Ala732Val) rs41314453 0.01000
NM_001048174.2(MUTYH):c.1460C>T (p.Ser487Phe) rs140118273 0.00997
NM_002528.7(NTHL1):c.116-37T>C rs3211968 0.00990
NM_002691.4(POLD1):c.1686+47G>A rs3219399 0.00986
NM_000059.4(BRCA2):c.7319A>G (p.His2440Arg) rs4986860 0.00984
NM_002067.5(GNA11):c.736-6C>T rs116848044 0.00980
NM_000546.6(TP53):c.108G>A (p.Pro36=) rs1800370 0.00974
NM_007294.4(BRCA1):c.2458A>G (p.Lys820Glu) rs56082113 0.00964
NM_006231.4(POLE):c.1795-22C>T rs5744797 0.00955
NM_000791.4(DHFR):c.-416C>G rs2001675 0.00949
NM_001040108.2(MLH3):c.3570+28A>T rs67547819 0.00949
NM_000051.4(ATM):c.3993+40G>A rs3218709 0.00933
NM_004655.4(AXIN2):c.1573C>G (p.Pro525Ala) rs73346297 0.00930
NM_000546.6(TP53):c.1100+30A>T rs17880847 0.00929
NM_000249.4(MLH1):c.1732-19T>A rs77120160 0.00923
NM_003000.3(SDHB):c.487T>C (p.Ser163Pro) rs33927012 0.00921
NM_000249.4(MLH1):c.1039-26T>A rs1360955428 0.00920
NM_000038.6(APC):c.2608C>T (p.Pro870Ser) rs33974176 0.00917
NM_006231.4(POLE):c.3265_3275+15dup rs1555225627 0.00913
NM_000245.4(MET):c.2975C>T (p.Thr992Ile) rs56391007 0.00911
NM_001040108.2(MLH3):c.8A>G (p.Lys3Arg) rs114829239 0.00905
NM_006231.4(POLE):c.5804G>A (p.Cys1935Tyr) rs5744991 0.00898
UGT1A1*6 rs4148323 0.00891
NM_000059.4(BRCA2):c.7469T>C (p.Ile2490Thr) rs11571707 0.00868
NM_000535.7(PMS2):c.52A>G (p.Ile18Val) rs63750123 0.00861
NM_000059.4(BRCA2):c.7806-40A>G rs9590939 0.00858
NM_001162498.3(LPAR6):c.921G>T (p.Trp307Cys) rs17071686 0.00841
NM_000051.4(ATM):c.8419-19A>G rs12279930 0.00824
NM_000249.4(MLH1):c.637G>A (p.Val213Met) rs2308317 0.00818
NM_017763.6(RNF43):c.1585C>T (p.Arg529Trp) rs62636625 0.00813
NM_000059.4(BRCA2):c.8851G>A (p.Ala2951Thr) rs11571769 0.00809
NM_000059.4(BRCA2):c.3264T>C (p.Pro1088=) rs36060526 0.00793
NM_000059.4(BRCA2):c.9730G>A (p.Val3244Ile) rs11571831 0.00792
NM_000059.4(BRCA2):c.5418A>G (p.Glu1806=) rs34351119 0.00791
NM_002439.5(MSH3):c.1567G>A (p.Glu523Lys) rs34058399 0.00789
NM_000535.7(PMS2):c.1711C>A (p.Leu571Ile) rs63750055 0.00784
NM_000051.4(ATM):c.2119T>C (p.Ser707Pro) rs4986761 0.00782
NM_177438.3(DICER1):c.2370G>A (p.Arg790=) rs112712209 0.00777
NM_001040108.2(MLH3):c.1870G>C (p.Glu624Gln) rs28756986 0.00772
NM_000059.4(BRCA2):c.1788T>C (p.Asp596=) rs11571642 0.00768
NM_002691.4(POLD1):c.970+49C>T rs3218761 0.00765
NM_000051.4(ATM):c.544G>C (p.Val182Leu) rs3218707 0.00757
NM_001142864.4(PIEZO1):c.7529C>T (p.Pro2510Leu) rs61745086 0.00748
NM_000465.4(BARD1):c.2212A>G (p.Ile738Val) rs61754118 0.00745
NM_000465.4(BARD1):c.1972C>T (p.Arg658Cys) rs3738888 0.00736
NM_144997.7(FLCN):c.1538+14T>G rs112111994 0.00721
NM_001127511.3(APC):c.-152C>T rs138386816 0.00719
NM_000051.4(ATM):c.146C>G (p.Ser49Cys) rs1800054 0.00712
NM_007294.4(BRCA1):c.1971A>G (p.Gln657=) rs28897679 0.00707
NM_002691.4(POLD1):c.88C>T (p.Arg30Trp) rs3218772 0.00706
NM_003002.4(SDHD):c.34G>A (p.Gly12Ser) rs34677591 0.00706
NM_000038.6(APC):c.4326T>A (p.Pro1442=) rs67622085 0.00705
NM_003001.5(SDHC):c.*84G>C rs201210474 0.00703
NM_003738.5(PTCH2):c.1073G>A (p.Arg358His) rs139624405 0.00701
NM_005359.6(SMAD4):c.1308+33_1308+34del rs201683280 0.00695
NM_000059.4(BRCA2):c.517-19C>T rs11571623 0.00693
NM_177438.3(DICER1):c.4206+17del rs746189044 0.00689
NM_003002.4(SDHD):c.149A>G (p.His50Arg) rs11214077 0.00679
NM_000038.6(APC):c.5265G>A (p.Ala1755=) rs34506289 0.00675
NM_002691.4(POLD1):c.2546G>A (p.Arg849His) rs3218775 0.00670
NM_000051.4(ATM):c.6995T>C (p.Leu2332Pro) rs4988111 0.00660
NM_000791.4(DHFR):c.-259C>T rs6151597 0.00658
NM_000059.3(BRCA2):c.5704G>A (p.Asp1902Asn) rs4987048 0.00655
NM_058216.3(RAD51C):c.859A>G (p.Thr287Ala) rs28363317 0.00653
NM_000051.4(ATM):c.*44A>G rs55900855 0.00643
NM_000245.4(MET):c.948A>G (p.Ile316Met) rs35225896 0.00641
NM_000051.4(ATM):c.3383A>G (p.Gln1128Arg) rs2229020 0.00636
NM_000455.5(STK11):c.369G>A (p.Gln123=) rs140112347 0.00636
NM_000121.4(EPOR):c.1460A>G (p.Asn487Ser) rs62638745 0.00627
NM_000443.4(ABCB4):c.1769G>A (p.Arg590Gln) rs45575636 0.00625
NM_000059.4(BRCA2):c.4258G>T (p.Asp1420Tyr) rs28897727 0.00609
NM_000051.4(ATM):c.5793T>C (p.Ala1931=) rs3092910 0.00608
NM_006231.4(POLE):c.776G>A (p.Arg259His) rs61732929 0.00604
NM_000051.4(ATM):c.*29C>G rs3218711 0.00603
NM_000051.4(ATM):c.4042T>C (p.Leu1348=) rs56355831 0.00599
NM_000059.4(BRCA2):c.9257-16T>C rs11571818 0.00597
NM_000059.4(BRCA2):c.9976A>T (p.Lys3326Ter) rs11571833 0.00597
NM_000143.4(FH):c.53C>T (p.Pro18Leu) rs201887750 0.00597
NM_001048174.2(MUTYH):c.1347G>C (p.Thr449=) rs74318065 0.00596
NM_000038.6(APC):c.1959G>A (p.Arg653=) rs72541809 0.00583
NM_000249.4(MLH1):c.589-15C>T rs55658850 0.00582
NM_177438.3(DICER1):c.5095+13C>T rs116247322 0.00577
NM_000038.6(APC):c.3949G>C (p.Glu1317Gln) rs1801166 0.00570
NM_000321.3(RB1):c.2521-11G>A rs4151624 0.00570
NM_000051.4(ATM):c.186-7C>T rs55674039 0.00568
NM_002067.5(GNA11):c.321+9G>A rs143987260 0.00567
NM_000179.3(MSH6):c.1186C>G (p.Leu396Val) rs2020908 0.00565
NM_000535.7(PMS2):c.1569C>G (p.Ser523=) rs141458772 0.00560
NM_007194.4(CHEK2):c.1343T>G (p.Ile448Ser) rs17886163 0.00555
NM_002691.4(POLD1):c.2250+46G>C rs138169420 0.00553
NM_001040108.2(MLH3):c.3217G>A (p.Asp1073Asn) rs28756993 0.00551
NM_006231.4(POLE):c.6494G>A (p.Arg2165His) rs5745068 0.00550
NM_144997.7(FLCN):c.*17G>T rs115885284 0.00549
NM_000059.4(BRCA2):c.-11C>T rs76874770 0.00539
NM_005359.6(SMAD4):c.*11C>T rs11663402 0.00538
NM_003000.3(SDHB):c.766-40C>T rs147408869 0.00536
NM_024675.4(PALB2):c.53A>G (p.Lys18Arg) rs138789658 0.00530
NM_000077.5(CDKN2A):c.379G>T (p.Ala127Ser) rs6413464 0.00527
NM_012452.3(TNFRSF13B):c.542C>A (p.Ala181Glu) rs72553883 0.00518
NM_000051.4(ATM):c.6088A>G (p.Ile2030Val) rs145847315 0.00517
NM_006231.4(POLE):c.6763A>T (p.Ile2255Phe) rs73155056 0.00513
NM_058216.3(RAD51C):c.572-17G>T rs193023469 0.00513
NM_000038.6(APC):c.532-32T>C rs112108777 0.00505
NM_006231.4(POLE):c.1359+9G>A rs75135381 0.00498
NM_001040108.2(MLH3):c.3987+15C>T rs117251698 0.00496
NM_000251.3(MSH2):c.984C>T (p.Ala328=) rs4987189 0.00495
NM_000535.7(PMS2):c.2445+30A>G rs549704870 0.00490
NM_000059.4(BRCA2):c.5199C>T (p.Ser1733=) rs28897734 0.00488
NM_002691.4(POLD1):c.1275C>T (p.Ala425=) rs3219392 0.00486
NM_000546.6(TP53):c.672+31A>G rs34949160 0.00479
NM_000251.3(MSH2):c.1666T>C (p.Leu556=) rs61756466 0.00471
NM_003000.3(SDHB):c.24C>T (p.Ser8=) rs148738139 0.00461
NM_002691.4(POLD1):c.589+31del rs572354560 0.00459
NM_000638.4(VTN):c.377A>T (p.Glu126Val) rs112887300 0.00458
NM_002878.4(RAD51D):c.695G>A (p.Arg232Gln) rs28363283 0.00457
NM_000465.4(BARD1):c.1738G>A (p.Glu580Lys) rs35306212 0.00455
NM_006231.4(POLE):c.1359+18C>T rs5744775 0.00455
NM_003001.5(SDHC):c.354T>C (p.Phe118=) rs61733156 0.00454
NM_024675.4(PALB2):c.2794G>A (p.Val932Met) rs45624036 0.00449
NM_000179.3(MSH6):c.2633T>C (p.Val878Ala) rs2020912 0.00448
NM_006231.4(POLE):c.6817A>T (p.Thr2273Ser) rs73481453 0.00444
NM_000051.4(ATM):c.5558A>T (p.Asp1853Val) rs1801673 0.00441
NM_000179.3(MSH6):c.457+13A>G rs1800933 0.00434
NM_007194.4(CHEK2):c.470T>C (p.Ile157Thr) rs17879961 0.00434
NM_004656.4(BAP1):c.2057-4G>T rs149499021 0.00433
NM_000051.4(ATM):c.1810C>T (p.Pro604Ser) rs2227922 0.00431
NM_004168.4(SDHA):c.969C>T (p.Gly323=) rs142849100 0.00430
NM_000051.4(ATM):c.5762+27G>A rs3218686 0.00428
NM_000186.4(CFH):c.2850G>T (p.Gln950His) rs149474608 0.00425
NM_000051.4(ATM):c.6437G>C (p.Ser2146Thr) rs56815840 0.00424
NM_001042492.3(NF1):c.7738+46G>A rs199641099 0.00422
NM_000245.4(MET):c.504G>T (p.Glu168Asp) rs55985569 0.00420
NM_000051.4(ATM):c.2250+22A>C rs3218692 0.00419
NM_007294.4(BRCA1):c.4039A>G (p.Arg1347Gly) rs28897689 0.00419
NM_001142864.4(PIEZO1):c.2423G>A (p.Arg808Gln) rs202103485 0.00418
NM_000249.4(MLH1):c.453+25A>G rs4647246 0.00414
NM_001142864.4(PIEZO1):c.2344G>A (p.Gly782Ser) rs200970763 0.00414
NM_000038.6(APC):c.933+30A>G rs145211300 0.00412
NM_003000.3(SDHB):c.-37T>C rs143031690 0.00411
NM_002439.5(MSH3):c.2254-19T>G rs41562717 0.00405
NM_012452.3(TNFRSF13B):c.310T>C (p.Cys104Arg) rs34557412 0.00403
NM_000249.4(MLH1):c.1852A>G (p.Lys618Glu) rs35001569 0.00399
NM_000249.4(MLH1):c.307-29C>A rs139620056 0.00398
NM_000251.3(MSH2):c.1662-9G>A rs17218356 0.00398
NM_004360.5(CDH1):c.532-18C>T rs200673941 0.00398
NM_000059.4(BRCA2):c.6347A>G (p.His2116Arg) rs55953736 0.00396
NM_001379610.1(SPINK1):c.163C>T (p.Pro55Ser) rs111966833 0.00389
NM_002691.4(POLD1):c.1384-35A>G rs115643912 0.00387
NM_004168.4(SDHA):c.456+20G>C rs193283468 0.00385
NM_000038.6(APC):c.729+23T>C rs75111475 0.00381
NM_001042492.3(NF1):c.-22G>C rs556823296 0.00381
NM_000051.4(ATM):c.5005+21_5005+22insGC rs547799081 0.00378
NM_000552.5(VWF):c.2561G>A (p.Arg854Gln) rs41276738 0.00377
NM_000535.7(PMS2):c.1609G>A (p.Glu537Lys) rs115052399 0.00370
NM_173648.4(CCDC141):c.2299G>A (p.Asp767Asn) rs141939661 0.00367
NM_002528.7(NTHL1):c.116-10C>G rs3211970 0.00366
NM_004064.5(CDKN1B):c.426G>A (p.Thr142=) rs149775942 0.00366
NM_004656.4(BAP1):c.1729+8T>C rs150945583 0.00364
NM_000051.4(ATM):c.5497-15G>C rs3092828 0.00363
NM_032043.3(BRIP1):c.517C>T (p.Arg173Cys) rs4988345 0.00363
NM_000038.6(APC):c.7862C>G (p.Ser2621Cys) rs72541816 0.00358
NM_001042492.3(NF1):c.2252-31A>T rs141082540 0.00355
NM_058216.3(RAD51C):c.376G>A (p.Ala126Thr) rs61758784 0.00349
NM_000455.5(STK11):c.1062C>G (p.Phe354Leu) rs59912467 0.00348
NM_000535.7(PMS2):c.1266G>A (p.Glu422=) rs138049175 0.00348
NM_001042492.3(NF1):c.6148-30T>A rs199874130 0.00348
NM_001048174.2(MUTYH):c.1103G>A (p.Gly368Asp) rs36053993 0.00341
NM_004064.5(CDKN1B):c.577C>T (p.Leu193Phe) rs73281150 0.00338
NM_000088.4(COL1A1):c.613C>G (p.Pro205Ala) rs72667032 0.00331
NM_000245.4(MET):c.-14-4G>A rs144126521 0.00331
NM_002439.5(MSH3):c.1896+18C>T rs150904071 0.00330
NM_004656.4(BAP1):c.1891-30G>C rs146661777 0.00328
NM_000245.4(MET):c.2908C>T (p.Arg970Cys) rs34589476 0.00327
NM_006231.4(POLE):c.4259C>T (p.Ala1420Val) rs41561818 0.00325
NM_001040108.2(MLH3):c.3315C>A (p.Asp1105Glu) rs28757008 0.00323
NM_000094.4(COL7A1):c.6654C>G (p.Gly2218=) rs151111203 0.00322
NM_058216.3(RAD51C):c.186A>G (p.Gln62=) rs28363303 0.00322
NM_006231.4(POLE):c.123G>A (p.Thr41=) rs5744734 0.00320
NM_020975.6(RET):c.1063+47G>A rs372177579 0.00315
NM_000251.3(MSH2):c.339G>A (p.Lys113=) rs35898375 0.00313
NM_006231.4(POLE):c.779G>A (p.Arg260Gln) rs5744752 0.00312
NM_024675.4(PALB2):c.1572A>G (p.Ser524=) rs45472400 0.00312
NM_004360.5(CDH1):c.1774G>A (p.Ala592Thr) rs35187787 0.00311
NM_004656.4(BAP1):c.1002A>G (p.Leu334=) rs28997577 0.00310
NM_020975.6(RET):c.166C>A (p.Leu56Met) rs145633958 0.00310
NM_024675.4(PALB2):c.1419A>C (p.Pro473=) rs62625275 0.00309
NM_000038.6(APC):c.3471G>A (p.Glu1157=) rs143927847 0.00308
NM_000059.4(BRCA2):c.3869G>A (p.Cys1290Tyr) rs41293485 0.00307
NM_001042492.3(NF1):c.5235G>A (p.Lys1745=) rs17887014 0.00305
NM_002528.7(NTHL1):c.113C>T (p.Ala38Val) rs202082304 0.00305
NM_032043.3(BRIP1):c.577G>A (p.Val193Ile) rs4988346 0.00305
NM_004656.4(BAP1):c.1026C>T (p.Ser342=) rs71651686 0.00304
NM_015450.3(POT1):c.903G>T (p.Gln301His) rs116916706 0.00304
NM_007294.4(BRCA1):c.557C>A (p.Ser186Tyr) rs55688530 0.00301
NM_001048174.2(MUTYH):c.1103-27C>T rs3219490 0.00300
NM_005918.4(MDH2):c.415G>A (p.Val139Ile) rs111879470 0.00300
NM_004655.4(AXIN2):c.1530G>A (p.Thr510=) rs141014640 0.00299
NM_025077.4(TOE1):c.-45G>A rs2275602 0.00299
NM_000249.4(MLH1):c.1963A>G (p.Ile655Val) rs55907433 0.00297
NM_002691.4(POLD1):c.783C>T (p.Val261=) rs34269084 0.00296
NM_000059.4(BRCA2):c.4068G>A (p.Leu1356=) rs28897724 0.00295
NM_002691.4(POLD1):c.778A>G (p.Ile260Val) rs8105725 0.00295
NM_006231.4(POLE):c.16G>C (p.Gly6Arg) rs202220778 0.00293
NM_002691.4(POLD1):c.1977C>T (p.Ile659=) rs45605236 0.00290
NM_000059.4(BRCA2):c.5640T>G (p.Asn1880Lys) rs11571657 0.00288
NM_001199138.2(NLRC4):c.2357G>T (p.Gly786Val) rs149451729 0.00287
NM_024675.4(PALB2):c.2590C>T (p.Pro864Ser) rs45568339 0.00287
NM_000038.6(APC):c.3165A>T (p.Ile1055=) rs61734287 0.00286
NM_005359.6(SMAD4):c.249+24A>G rs77389132 0.00278
NM_000059.4(BRCA2):c.68-7T>A rs81002830 0.00277
NM_144997.7(FLCN):c.1177-21G>A rs150687840 0.00276
NM_000059.4(BRCA2):c.4241C>T (p.Thr1414Met) rs70953664 0.00272
NM_000038.6(APC):c.4360A>G (p.Lys1454Glu) rs111866410 0.00271
NM_032043.3(BRIP1):c.2097+7G>A rs4988352 0.00271
NM_000298.6(PKLR):c.1456C>T (p.Arg486Trp) rs116100695 0.00270
NM_002439.5(MSH3):c.2511G>A (p.Leu837=) rs149628160 0.00270
NM_007194.4(CHEK2):c.592+50A>T rs17881298 0.00270
NM_000038.6(APC):c.4893T>C (p.Ser1631=) rs35634377 0.00268
NM_000059.4(BRCA2):c.6100C>T (p.Arg2034Cys) rs1799954 0.00268
NM_005359.6(SMAD4):c.354G>A (p.Ala118=) rs145988618 0.00268
NM_000314.8(PTEN):c.-165C>G rs575260016 0.00267
NM_000051.4(ATM):c.2362A>C (p.Ser788Arg) rs641252 0.00265
NM_000551.4(VHL):c.74C>T (p.Pro25Leu) rs35460768 0.00261
NM_004360.5(CDH1):c.1680G>C (p.Thr560=) rs35741240 0.00261
NM_000059.4(BRCA2):c.6323G>A (p.Arg2108His) rs35029074 0.00260
NM_017763.6(RNF43):c.582+30C>T rs79125070 0.00260
NM_013372.7(GREM1):c.103C>G (p.Pro35Ala) rs111262341 0.00259
NM_004329.3(BMPR1A):c.618A>G (p.Leu206=) rs55992440 0.00257
NM_000038.6(APC):c.3264G>A (p.Lys1088=) rs114774495 0.00255
NM_004360.5(CDH1):c.324A>G (p.Arg108=) rs116542018 0.00255
NM_000179.3(MSH6):c.3911G>A (p.Arg1304Lys) rs34625968 0.00253
NM_002691.4(POLD1):c.433G>A (p.Ala145Thr) rs137953986 0.00253
NM_007294.4(BRCA1):c.4987-20A>G rs80358035 0.00252
NM_000038.6(APC):c.3386T>C (p.Leu1129Ser) rs143638171 0.00250
NM_017763.6(RNF43):c.1010G>A (p.Arg337Gln) rs138844366 0.00248
NM_000051.4(ATM):c.2921+19dup rs56112367 0.00245
NM_000065.5(C6):c.2381+2T>C rs76202909 0.00242
NM_006231.4(POLE):c.4184A>G (p.Tyr1395Cys) rs5744933 0.00240
NM_006231.4(POLE):c.51C>G (p.Gly17=) rs780436496 0.00240
NM_007294.4(BRCA1):c.4535G>T (p.Ser1512Ile) rs1800744 0.00240
NM_177438.3(DICER1):c.1377-4T>G rs192490028 0.00240
NM_000059.4(BRCA2):c.8182G>A (p.Val2728Ile) rs28897749 0.00239
NM_000179.3(MSH6):c.4002-28_4002-26dup rs200989473 0.00238
NM_000179.3(MSH6):c.3439-16C>T rs192614006 0.00237
NM_021098.3(CACNA1H):c.6418G>A (p.Ala2140Thr) rs59487037 0.00237
NM_004360.5(CDH1):c.345G>A (p.Thr115=) rs1801023 0.00236
NM_007194.4(CHEK2):c.593-14C>T rs145754558 0.00235
NM_002439.5(MSH3):c.2732T>G (p.Leu911Trp) rs41545019 0.00233
NM_007294.4(BRCA1):c.114G>A (p.Lys38=) rs1800062 0.00233
NM_003000.3(SDHB):c.170A>G (p.His57Arg) rs35962811 0.00231
NM_000465.4(BARD1):c.1977A>G (p.Arg659=) rs147215925 0.00230
NM_000059.4(BRCA2):c.3516G>A (p.Ser1172=) rs1799952 0.00228
NM_005359.6(SMAD4):c.1086T>C (p.Phe362=) rs1801250 0.00228
NM_002439.5(MSH3):c.1571A>C (p.Asn524Thr) rs55724159 0.00220
NM_017763.6(RNF43):c.380G>A (p.Arg127Gln) rs35219874 0.00220
NM_001040108.2(MLH3):c.3987+7C>A rs28757028 0.00219
NM_000465.4(BARD1):c.620A>G (p.Lys207Arg) rs34969857 0.00218
NM_144997.7(FLCN):c.1333G>A (p.Ala445Thr) rs41419545 0.00217
NM_000038.6(APC):c.705A>G (p.Leu235=) rs147036141 0.00213
NM_000077.5(CDKN2A):c.150+37G>C rs45456595 0.00212
NM_000085.5(CLCNKB):c.171G>A (p.Gly57=) rs150723240 0.00210
NM_007294.4(BRCA1):c.2167A>G (p.Asn723Asp) rs4986845 0.00209
NM_058216.3(RAD51C):c.790G>A (p.Gly264Ser) rs147241704 0.00207
NM_000059.4(BRCA2):c.7150C>A (p.Gln2384Lys) rs55977008 0.00203
NM_000535.7(PMS2):c.2182A>G (p.Thr728Ala) rs141893001 0.00203
NM_001354604.2(MITF):c.880+9C>G rs181810413 0.00203
NM_000059.4(BRCA2):c.8503T>C (p.Ser2835Pro) rs11571746 0.00202
NM_001354604.2(MITF):c.366C>T (p.His122=) rs140663277 0.00201
NM_007194.4(CHEK2):c.254C>T (p.Pro85Leu) rs17883862 0.00201
NM_000051.4(ATM):c.162T>C (p.Tyr54=) rs3218690 0.00200
NM_032043.3(BRIP1):c.584T>C (p.Leu195Pro) rs4988347 0.00197
NM_000051.4(ATM):c.8269-14A>T rs114320959 0.00195
NM_001042492.3(NF1):c.5035A>G (p.Ile1679Val) rs147327414 0.00195
NM_000388.4(CASR):c.2730C>A (p.Pro910=) rs34200949 0.00194
NM_002439.5(MSH3):c.1887T>C (p.Tyr629=) rs139201310 0.00193
NM_024675.4(PALB2):c.2256A>G (p.Gly752=) rs147120218 0.00193
NM_000535.7(PMS2):c.2350G>A (p.Asp784Asn) rs143340522 0.00192
NM_004329.3(BMPR1A):c.777G>A (p.Ala259=) rs56108371 0.00192
NM_000059.4(BRCA2):c.231T>G (p.Thr77=) rs114446594 0.00191
NM_002439.5(MSH3):c.2480A>G (p.His827Arg) rs138339194 0.00191
NM_000551.4(VHL):c.340+5G>C rs61758376 0.00190
NM_000245.4(MET):c.1715G>A (p.Ser572Asn) rs199771406 0.00188
NM_000249.4(MLH1):c.790+10A>G rs182733777 0.00188
NM_002691.4(POLD1):c.378C>T (p.Arg126=) rs145324823 0.00188
NM_000051.4(ATM):c.1229T>C (p.Val410Ala) rs56128736 0.00186
NM_021098.3(CACNA1H):c.6717C>T (p.Gly2239=) rs143733790 0.00186
NM_000251.3(MSH2):c.23C>T (p.Thr8Met) rs17217716 0.00184
NM_033629.6(TREX1):c.797A>G (p.Glu266Gly) rs55999987 0.00184
NM_000791.4(DHFR):c.-367T>C rs141080879 0.00183
NM_000059.4(BRCA2):c.1792A>G (p.Thr598Ala) rs28897710 0.00182
NM_000535.7(PMS2):c.23+10G>C rs192027828 0.00182
NM_004168.4(SDHA):c.1911C>T (p.Val637=) rs11557098 0.00180
NM_003000.3(SDHB):c.423+20T>A rs190139590 0.00179
NM_004655.4(AXIN2):c.2272G>A (p.Ala758Thr) rs145007501 0.00179
NM_006231.4(POLE):c.2561+6T>C rs116231808 0.00179
NM_020975.6(RET):c.2372A>T (p.Tyr791Phe) rs77724903 0.00178
NM_000314.8(PTEN):c.210-39A>G rs370918174 0.00177
NM_000535.7(PMS2):c.383C>T (p.Ser128Leu) rs116373169 0.00177
NM_000465.4(BARD1):c.33G>T (p.Gln11His) rs143914387 0.00176
NM_002691.4(POLD1):c.773C>T (p.Thr258Met) rs76131127 0.00176
NM_177438.3(DICER1):c.3972G>A (p.Lys1324=) rs45562437 0.00174
NM_001126049.2(KLLN):c.339_340del (p.Ala115fs) rs749052307 0.00173
NM_001040108.2(MLH3):c.735C>T (p.Tyr245=) rs111782152 0.00172
NM_001040108.2(MLH3):c.1939C>T (p.Arg647Cys) rs28756987 0.00171
NM_000059.4(BRCA2):c.1798T>C (p.Tyr600His) rs75419644 0.00170
NM_006231.4(POLE):c.4523G>A (p.Arg1508His) rs142508245 0.00170
NM_000051.4(ATM):c.5071A>C (p.Ser1691Arg) rs1800059 0.00169
NM_004655.4(AXIN2):c.1713-18G>A rs147664289 0.00169
NM_000314.8(PTEN):c.132C>T (p.Gly44=) rs150651961 0.00168
NM_001040108.2(MLH3):c.1799G>A (p.Arg600Gln) rs28756984 0.00168
NM_001040108.2(MLH3):c.2167G>A (p.Val723Ile) rs28756989 0.00168
NM_006231.4(POLE):c.6453C>T (p.Tyr2151=) rs116076060 0.00167
NM_000051.4(ATM):c.609C>T (p.Asp203=) rs144709948 0.00166
NM_000051.4(ATM):c.7788+8G>T rs112775908 0.00165
NM_004655.4(AXIN2):c.1200+19T>C rs116931989 0.00165
NM_177438.3(DICER1):c.20A>G (p.Gln7Arg) rs117358479 0.00165
NM_000249.4(MLH1):c.885-24T>A rs201594027 0.00164
NM_000388.4(CASR):c.748G>A (p.Glu250Lys) rs62269092 0.00163
NM_004655.4(AXIN2):c.1200+18T>G rs117258157 0.00163
NM_003126.4(SPTA1):c.7104G>T (p.Lys2368Asn) rs112884419 0.00161
NM_001354604.2(MITF):c.1273G>A (p.Glu425Lys) rs149617956 0.00160
NM_006361.6(HOXB13):c.251G>A (p.Gly84Glu) rs138213197 0.00160
NM_177438.3(DICER1):c.1753-43G>A rs74899136 0.00160
NM_000251.3(MSH2):c.1277-8T>C rs145400590 0.00159
NM_002691.4(POLD1):c.80A>T (p.Asp27Val) rs150066950 0.00159
NM_004360.5(CDH1):c.2292C>T (p.Asp764=) rs61747636 0.00159
NM_000059.4(BRCA2):c.125A>G (p.Tyr42Cys) rs4987046 0.00158
NM_000059.4(BRCA2):c.8567A>C (p.Glu2856Ala) rs11571747 0.00158
NM_000179.3(MSH6):c.431G>T (p.Ser144Ile) rs3211299 0.00158
NM_177438.3(DICER1):c.2650+13del rs528577189 0.00158
NM_003000.3(SDHB):c.300T>C (p.Ser100=) rs11541235 0.00157
NM_002528.7(NTHL1):c.503T>C (p.Ile168Thr) rs1805378 0.00155
NM_000465.4(BARD1):c.2282G>A (p.Ser761Asn) rs142155101 0.00153
NM_004329.3(BMPR1A):c.1299C>T (p.Phe433=) rs150946485 0.00153
NM_002691.4(POLD1):c.971-4G>A rs200144991 0.00152
NM_007294.4(BRCA1):c.4113G>A (p.Gly1371=) rs147448807 0.00150
NM_006231.4(POLE):c.5124C>T (p.Phe1708=) rs114891564 0.00149
NM_000243.3(MEFV):c.2177T>C (p.Val726Ala) rs28940579 0.00147
NM_007294.4(BRCA1):c.2109A>G (p.Thr703=) rs4986844 0.00147
NM_000038.6(APC):c.8068G>A (p.Ala2690Thr) rs140868933 0.00146
NM_000059.4(BRCA2):c.3515C>T (p.Ser1172Leu) rs80358600 0.00146
NM_004360.5(CDH1):c.2440-6C>G rs139757930 0.00145
NM_007294.4(BRCA1):c.4600G>A (p.Val1534Met) rs55815649 0.00145
NM_000038.6(APC):c.6921G>A (p.Ser2307=) rs2229993 0.00143
NM_000249.4(MLH1):c.2146G>A (p.Val716Met) rs35831931 0.00143
NM_000251.3(MSH2):c.1387-8G>T rs187525243 0.00143
NM_002439.5(MSH3):c.1992G>A (p.Gln664=) rs144019582 0.00143
NM_004360.5(CDH1):c.1272C>T (p.Val424=) rs61756284 0.00143
NM_024675.4(PALB2):c.2742C>T (p.Phe914=) rs115759702 0.00143
NM_002691.4(POLD1):c.2967G>A (p.Thr989=) rs3218752 0.00142
NM_002691.4(POLD1):c.2577C>T (p.Gly859=) rs149366027 0.00140
NM_000051.4(ATM):c.1066-6T>G rs201686625 0.00139
NM_000251.3(MSH2):c.1737A>G (p.Lys579=) rs61756467 0.00138
NM_002528.7(NTHL1):c.244C>T (p.Gln82Ter) rs150766139 0.00138
NM_000051.4(ATM):c.998C>T (p.Ser333Phe) rs28904919 0.00137
NM_001146227.3(RPS20):c.*14C>T rs78022071 0.00137
NM_007294.4(BRCA1):c.2521C>T (p.Arg841Trp) rs1800709 0.00137
NM_002439.5(MSH3):c.792+8G>A rs147777411 0.00136
NM_001082486.2(ACD):c.80G>A (p.Arg27Gln) rs142507451 0.00135
NM_002691.4(POLD1):c.2007-4G>A rs202035484 0.00135
NM_000179.3(MSH6):c.3647-6T>A rs182871847 0.00134
NM_058195.4(CDKN2A):c.194-3652G>C rs531597737 0.00134
NM_000059.4(BRCA2):c.10110G>A (p.Arg3370=) rs28897762 0.00132
NM_002878.4(RAD51D):c.666A>G (p.Glu222=) rs114012742 0.00131
NM_002439.5(MSH3):c.1794G>A (p.Ser598=) rs61753791 0.00130
NM_004360.5(CDH1):c.88C>A (p.Pro30Thr) rs139866691 0.00129
NM_004655.4(AXIN2):c.1807G>C (p.Ala603Pro) rs145353986 0.00128
NM_177438.3(DICER1):c.4891T>G (p.Ser1631Ala) rs145551486 0.00128
NM_000059.4(BRCA2):c.8149G>T (p.Ala2717Ser) rs28897747 0.00127
NM_000791.4(DHFR):c.-443G>A rs577919981 0.00127
NM_000059.4(BRCA2):c.6821G>T (p.Gly2274Val) rs55712212 0.00126
NM_000791.4(DHFR):c.-419C>G rs1574197 0.00126
NM_000051.4(ATM):c.4473C>T (p.Phe1491=) rs4988008 0.00125
NM_001322934.2(NFKB2):c.1288C>T (p.Pro430Ser) rs202001697 0.00125
NM_006231.4(POLE):c.6675C>T (p.Arg2225=) rs149973644 0.00125
NM_000051.4(ATM):c.6067G>A (p.Gly2023Arg) rs11212587 0.00124
NM_000546.6(TP53):c.139C>T (p.Pro47Ser) rs1800371 0.00123
NM_004936.4(CDKN2B):c.256G>A (p.Asp86Asn) rs148421170 0.00123
NM_006231.4(POLE):c.861T>A (p.Asp287Glu) rs139075637 0.00122
NM_024675.4(PALB2):c.2816T>G (p.Leu939Trp) rs45478192 0.00121
NM_024675.4(PALB2):c.3495G>A (p.Ser1165=) rs45439097 0.00121
NM_177438.3(DICER1):c.5145C>T (p.Leu1715=) rs139500905 0.00121
NM_000059.4(BRCA2):c.9257-49T>C rs117850955 0.00120
NM_001370259.2(MEN1):c.1296G>A (p.Leu432=) rs138770431 0.00119
NM_000535.7(PMS2):c.2340C>T (p.Pro780=) rs142230276 0.00117
NM_007294.4(BRCA1):c.591C>T (p.Cys197=) rs1799965 0.00117
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys) rs1801155 0.00116
NM_002878.4(RAD51D):c.146C>T (p.Ala49Val) rs140317560 0.00116
NM_000249.4(MLH1):c.-7C>T rs104894994 0.00115
NM_000038.6(APC):c.423-17T>A rs534684461 0.00114
NM_000314.8(PTEN):c.-461G>A rs1209261790 0.00114
NM_000143.4(FH):c.-11C>T rs200942733 0.00113
NM_020461.4(TUBGCP6):c.589T>C (p.Ser197Pro) rs138586345 0.00113
NM_032043.3(BRIP1):c.890A>G (p.Lys297Arg) rs28997570 0.00113
NM_002439.5(MSH3):c.2041C>T (p.Pro681Ser) rs115198722 0.00112
NM_002691.4(POLD1):c.2979G>A (p.Thr993=) rs3218774 0.00112
NM_004655.4(AXIN2):c.2051C>T (p.Ala684Val) rs138287857 0.00112
NM_058216.3(RAD51C):c.837+13T>C rs188613030 0.00112
NM_002439.5(MSH3):c.2318+11A>G rs200378976 0.00111
NM_000249.4(MLH1):c.-28A>G rs56198082 0.00110
NM_002691.4(POLD1):c.2275G>A (p.Val759Ile) rs145473716 0.00110
NM_000059.4(BRCA2):c.1040A>G (p.Gln347Arg) rs55800493 0.00109
NM_000059.4(BRCA2):c.1911T>C (p.Gly637=) rs11571652 0.00109
NM_004655.4(AXIN2):c.1532C>T (p.Thr511Met) rs200883019 0.00109
NM_000059.4(BRCA2):c.175C>G (p.Pro59Ala) rs56091799 0.00108
NM_002067.5(GNA11):c.189C>T (p.His63=) rs61731116 0.00108
NM_007294.4(BRCA1):c.3083G>A (p.Arg1028His) rs80357459 0.00106
NM_058216.3(RAD51C):c.195A>G (p.Arg65=) rs45511291 0.00105
NM_001040108.2(MLH3):c.4351G>A (p.Glu1451Lys) rs28939071 0.00104
NM_005359.6(SMAD4):c.565C>T (p.Arg189Cys) rs140743238 0.00104
NM_032043.3(BRIP1):c.790C>T (p.Arg264Trp) rs28997569 0.00104
NM_000051.4(ATM):c.4388T>G (p.Phe1463Cys) rs138327406 0.00103
NM_002691.4(POLD1):c.3054G>A (p.Val1018=) rs369613619 0.00103
NM_024675.4(PALB2):c.1194G>A (p.Val398=) rs61755173 0.00103
NM_000059.4(BRCA2):c.6057C>T (p.Asn2019=) rs147961615 0.00102
NM_001040108.2(MLH3):c.394G>A (p.Ala132Thr) rs148095325 0.00102
NM_001082486.2(ACD):c.132C>T (p.Gly44=) rs138527794 0.00102
NM_001126108.2(SLC12A3):c.363G>C (p.Glu121Asp) rs146632606 0.00102
NM_000038.6(APC):c.423-16A>T rs78919815 0.00101
NM_000552.5(VWF):c.5191T>A (p.Ser1731Thr) rs61750603 0.00101
NM_006231.4(POLE):c.1360-6C>T rs139836643 0.00101
NM_001040108.2(MLH3):c.3488G>A (p.Gly1163Asp) rs28757011 0.00100
NM_024675.4(PALB2):c.2365C>T (p.Leu789=) rs145805054 0.00099
NM_177438.3(DICER1):c.4014G>A (p.Ala1338=) rs143454689 0.00099
NM_001082486.2(ACD):c.613A>G (p.Thr205Ala) rs139438549 0.00098
NM_002691.4(POLD1):c.1620C>T (p.Gly540=) rs140216790 0.00098
NM_007294.4(BRCA1):c.4883T>C (p.Met1628Thr) rs4986854 0.00098
NM_015450.3(POT1):c.1022A>G (p.Gln341Arg) rs554325914 0.00098
NM_000059.4(BRCA2):c.2883G>A (p.Gln961=) rs11571655 0.00097
NM_000051.4(ATM):c.2289T>A (p.Phe763Leu) rs34231402 0.00096
NM_000051.4(ATM):c.6860G>C (p.Gly2287Ala) rs1800061 0.00096
NM_000059.4(BRCA2):c.1938C>T (p.Ser646=) rs28897711 0.00096
NM_000179.3(MSH6):c.3265T>C (p.Leu1089=) rs34490141 0.00096
NM_002439.5(MSH3):c.1453+15T>C rs200717987 0.00096
NM_024529.5(CDC73):c.730-46A>G rs140402302 0.00096
NM_002691.4(POLD1):c.2250+33G>A rs3219422 0.00095
NM_007294.4(BRCA1):c.3022A>G (p.Met1008Val) rs56321129 0.00095
NM_004655.4(AXIN2):c.1101C>T (p.Pro367=) rs141697521 0.00094
NM_006231.4(POLE):c.1347G>A (p.Thr449=) rs142373951 0.00094
NM_000038.6(APC):c.7514G>A (p.Arg2505Gln) rs147549623 0.00093
NM_001040108.2(MLH3):c.2670G>A (p.Met890Ile) rs147021156 0.00093
NM_000038.6(APC):c.835-24A>T rs200399868 0.00091
NM_000038.6(APC):c.6821C>T (p.Ala2274Val) rs34919187 0.00088
NM_000535.7(PMS2):c.180C>G (p.Asp60Glu) rs200313585 0.00088
NM_000249.4(MLH1):c.1217G>A (p.Ser406Asn) rs41294980 0.00087
NM_000388.4(CASR):c.1631G>A (p.Arg544Gln) rs115230894 0.00086
NM_002528.7(NTHL1):c.274C>T (p.Arg92Cys) rs148104494 0.00086
NM_000551.4(VHL):c.341-38C>T rs185858030 0.00084
NM_004655.4(AXIN2):c.1985T>C (p.Leu662Pro) rs142476324 0.00084
NM_002691.4(POLD1):c.612C>T (p.His204=) rs147881471 0.00083
NM_000059.4(BRCA2):c.978C>A (p.Ser326Arg) rs28897706 0.00082
NM_006231.4(POLE):c.139C>T (p.Arg47Trp) rs143626223 0.00082
NM_000051.4(ATM):c.3925G>A (p.Ala1309Thr) rs149711770 0.00081
NM_001048174.2(MUTYH):c.1192C>T (p.Arg398Cys) rs150792276 0.00081
NM_004329.3(BMPR1A):c.1327C>T (p.Arg443Cys) rs35619497 0.00081
NM_001142864.4(PIEZO1):c.3602C>T (p.Thr1201Met) rs372935580 0.00080
NM_032043.3(BRIP1):c.2257+19A>C rs77851913 0.00079
NM_002691.4(POLD1):c.2565-17G>A rs200576676 0.00078
NM_032043.3(BRIP1):c.918+15T>A rs117820198 0.00078
NM_000051.4(ATM):c.2096A>G (p.Glu699Gly) rs147934285 0.00077
NM_000249.4(MLH1):c.1151T>A (p.Val384Asp) rs63750447 0.00077
NM_000455.5(STK11):c.*16+10G>A rs587781180 0.00077
NM_000535.7(PMS2):c.2187C>G (p.Leu729=) rs373630535 0.00077
NM_000051.4(ATM):c.3150T>C (p.Leu1050=) rs3092859 0.00076
NM_004655.4(AXIN2):c.270C>T (p.Asp90=) rs141655687 0.00076
NM_004655.4(AXIN2):c.1168A>G (p.Ser390Gly) rs139871607 0.00075
NM_017763.6(RNF43):c.1825C>T (p.Arg609Trp) rs139405076 0.00075
NM_000059.4(BRCA2):c.1151C>T (p.Ser384Phe) rs41293475 0.00074
NM_000059.4(BRCA2):c.1514T>C (p.Ile505Thr) rs28897708 0.00074
NM_058216.3(RAD51C):c.146-8A>G rs201079501 0.00074
NM_001040108.2(MLH3):c.2838C>A (p.Ser946=) rs181990057 0.00073
NM_006231.4(POLE):c.3718G>A (p.Glu1240Lys) rs113594027 0.00073
NM_000249.4(MLH1):c.2104-11G>A rs147984696 0.00072
NM_000535.7(PMS2):c.2149G>A (p.Val717Met) rs201671325 0.00072
NM_000051.4(ATM):c.1744T>C (p.Phe582Leu) rs2235006 0.00071
NM_005359.6(SMAD4):c.1573A>G (p.Ile525Val) rs149755320 0.00071
NM_006231.4(POLE):c.6004+11A>G rs201591857 0.00071
NM_144997.7(FLCN):c.959G>A (p.Arg320Gln) rs143483053 0.00071
NM_000551.4(VHL):c.150C>G (p.Ala50=) rs61751580 0.00070
NM_004655.4(AXIN2):c.1545C>T (p.His515=) rs139316692 0.00070
NM_007194.4(CHEK2):c.320-5T>A rs121908700 0.00070
NM_177438.3(DICER1):c.3428T>C (p.Leu1143Pro) rs139786661 0.00070
NM_177438.3(DICER1):c.59C>T (p.Ala20Val) rs147660793 0.00070
NM_177438.3(DICER1):c.924C>T (p.Ala308=) rs142397473 0.00070
NM_000059.4(BRCA2):c.5198C>T (p.Ser1733Phe) rs55639415 0.00069
NM_032043.3(BRIP1):c.3459T>C (p.Asp1153=) rs4987050 0.00069
NM_000245.4(MET):c.1039G>A (p.Ala347Thr) rs200074800 0.00068
NM_006231.4(POLE):c.3851G>A (p.Arg1284Gln) rs149462407 0.00068
NM_020975.6(RET):c.1465G>A (p.Asp489Asn) rs9282834 0.00068
NM_000179.3(MSH6):c.1526T>C (p.Val509Ala) rs63751005 0.00067
NM_000551.4(VHL):c.183C>G (p.Pro61=) rs63650860 0.00067
NM_000143.4(FH):c.105G>A (p.Ser35=) rs181655698 0.00066
NM_000264.5(PTCH1):c.3155C>T (p.Thr1052Met) rs138911275 0.00066
NM_007294.4(BRCA1):c.2733A>G (p.Gly911=) rs1800740 0.00066
NM_006231.4(POLE):c.3046G>A (p.Val1016Met) rs147692158 0.00065
NM_007194.4(CHEK2):c.-6G>A rs376995740 0.00065
NM_007294.4(BRCA1):c.3024G>A (p.Met1008Ile) rs1800704 0.00065
NM_007294.4(BRCA1):c.981A>G (p.Thr327=) rs1800063 0.00065
NM_000179.3(MSH6):c.663A>C (p.Glu221Asp) rs41557217 0.00064
NM_004360.5(CDH1):c.2520C>T (p.Ser840=) rs140328601 0.00064
NM_004655.4(AXIN2):c.1250C>T (p.Ala417Val) rs201460658 0.00064
NM_004655.4(AXIN2):c.2285G>A (p.Ser762Asn) rs117688560 0.00064
NM_007294.4(BRCA1):c.3302G>A (p.Ser1101Asn) rs41293447 0.00064
NM_007294.4(BRCA1):c.4812A>G (p.Gln1604=) rs28897693 0.00064
NM_017763.6(RNF43):c.970C>A (p.Gln324Lys) rs111856468 0.00064
NM_006231.4(POLE):c.4057A>G (p.Ser1353Gly) rs141619382 0.00063
NM_000249.4(MLH1):c.375A>G (p.Ala125=) rs1800144 0.00062
NM_002691.4(POLD1):c.455C>T (p.Ala152Val) rs41563714 0.00062
NM_017763.6(RNF43):c.1592G>A (p.Arg531His) rs148619997 0.00062
NM_000245.4(MET):c.467C>T (p.Ser156Leu) rs56311081 0.00061
NM_001040108.2(MLH3):c.1234A>G (p.Lys412Glu) rs61754769 0.00061
NM_002691.4(POLD1):c.581C>G (p.Ser194Cys) rs144656348 0.00061
NM_000455.5(STK11):c.945G>A (p.Pro315=) rs376329042 0.00060
NM_002691.4(POLD1):c.883G>A (p.Val295Met) rs199545019 0.00060
NM_007294.4(BRCA1):c.1487G>A (p.Arg496His) rs28897677 0.00060
NM_024675.4(PALB2):c.2996+17T>C rs180177128 0.00060
NM_000179.3(MSH6):c.1508C>G (p.Ser503Cys) rs63750897 0.00059
NM_000535.7(PMS2):c.86G>C (p.Gly29Ala) rs146176004 0.00059
NM_177438.3(DICER1):c.5203C>T (p.Leu1735=) rs188609628 0.00059
NM_000179.3(MSH6):c.1869C>T (p.Pro623=) rs141242295 0.00058
NM_000245.4(MET):c.406G>A (p.Val136Ile) rs199701987 0.00058
NM_001142864.4(PIEZO1):c.6905G>A (p.Arg2302His) rs200555745 0.00058
NM_004329.3(BMPR1A):c.1419T>G (p.Val473=) rs145756629 0.00058
NM_017763.6(RNF43):c.597G>A (p.Val199=) rs77499318 0.00058
NM_024675.4(PALB2):c.2851T>C (p.Ser951Pro) rs149522412 0.00058
NM_144997.7(FLCN):c.871+47G>A rs142934950 0.00058
NM_004360.5(CDH1):c.2439+10C>T rs35236080 0.00057
NM_000038.6(APC):c.3173A>G (p.Asp1058Gly) rs148725540 0.00056
NM_002691.4(POLD1):c.1138-8A>G rs41544624 0.00056
NM_004656.4(BAP1):c.294C>T (p.Ser98=) rs140641333 0.00056
NM_020975.6(RET):c.833C>A (p.Thr278Asn) rs35118262 0.00056
NM_000245.4(MET):c.71G>A (p.Gly24Glu) rs180985111 0.00055
NM_024675.4(PALB2):c.2749-18C>T rs182194007 0.00055
NM_032043.3(BRIP1):c.430G>A (p.Ala144Thr) rs116952709 0.00055
NM_000059.4(BRCA2):c.1964C>G (p.Pro655Arg) rs28897712 0.00054
NM_000059.4(BRCA2):c.2803G>A (p.Asp935Asn) rs28897716 0.00054
NM_003000.3(SDHB):c.21C>T (p.Leu7=) rs147815442 0.00054
NM_000038.6(APC):c.1240C>T (p.Arg414Cys) rs137854567 0.00053
NM_000051.4(ATM):c.4424A>G (p.Tyr1475Cys) rs34640941 0.00053
NM_000059.4(BRCA2):c.7435+6G>A rs81002852 0.00053
NM_000245.4(MET):c.3523-12C>G rs186524917 0.00053
NM_000251.3(MSH2):c.1563T>C (p.Tyr521=) rs63750330 0.00053
NM_000455.5(STK11):c.426C>T (p.Ser142=) rs758448869 0.00053
NM_001082486.2(ACD):c.22G>A (p.Val8Ile) rs149365469 0.00053
NM_002691.4(POLD1):c.1665C>T (p.Val555=) rs150238541 0.00053
NM_006231.4(POLE):c.6495C>T (p.Arg2165=) rs114778730 0.00053
NM_144997.7(FLCN):c.1269C>T (p.His423=) rs41464156 0.00053
NM_000051.4(ATM):c.8592C>T (p.Tyr2864=) rs56025670 0.00051
NM_000455.5(STK11):c.1211C>T (p.Ser404Phe) rs200078204 0.00051
NM_000551.4(VHL):c.463+8C>T rs5030834 0.00051
NM_001048174.2(MUTYH):c.841C>T (p.Arg281Cys) rs138089183 0.00051
NM_004329.3(BMPR1A):c.1243G>A (p.Glu415Lys) rs140592056 0.00051
NM_007194.4(CHEK2):c.538C>T (p.Arg180Cys) rs77130927 0.00051
NM_032043.3(BRIP1):c.1935+11G>A rs79121306 0.00051
NM_004656.4(BAP1):c.501G>A (p.Ala167=) rs148631953 0.00050
NM_020975.6(RET):c.*29C>A rs199639914 0.00050
NM_021870.3(FGG):c.140C>T (p.Thr47Ile) rs138511699 0.00050
NM_000465.4(BARD1):c.215+12C>T rs373816832 0.00049
NM_000535.7(PMS2):c.354-34C>G rs200029834 0.00049
NM_001243133.2(NLRP3):c.2176A>G (p.Ser726Gly) rs147946775 0.00049
NM_017763.6(RNF43):c.2091C>T (p.His697=) rs199916345 0.00049
NM_017763.6(RNF43):c.319G>A (p.Val107Ile) rs199909371 0.00049
NM_000038.6(APC):c.295C>T (p.Arg99Trp) rs139196838 0.00048
NM_000059.4(BRCA2):c.7544C>T (p.Thr2515Ile) rs28897744 0.00048
NM_000059.4(BRCA2):c.7994A>G (p.Asp2665Gly) rs28897745 0.00048
NM_001040108.2(MLH3):c.2911G>A (p.Val971Ile) rs41555714 0.00048
NM_000059.4(BRCA2):c.9411T>G (p.Thr3137=) rs1799968 0.00047
NM_000059.4(BRCA2):c.9649-19G>A rs11571830 0.00047
NM_000455.5(STK11):c.1185A>G (p.Thr395=) rs370207155 0.00047
NM_006231.4(POLE):c.5659G>A (p.Val1887Met) rs114119067 0.00047
NM_020975.6(RET):c.3112A>G (p.Thr1038Ala) rs201740483 0.00047
NM_000051.4(ATM):c.1986T>C (p.Phe662=) rs1800055 0.00046
NM_000051.4(ATM):c.4709T>C (p.Val1570Ala) rs140856217 0.00046
NM_000059.4(BRCA2):c.7976+45G>C rs11571718 0.00046
NM_000251.3(MSH2):c.815C>T (p.Ala272Val) rs34136999 0.00046
NM_002691.4(POLD1):c.2103C>T (p.Tyr701=) rs201483538 0.00046
NM_004655.4(AXIN2):c.2052G>A (p.Ala684=) rs200573256 0.00046
NM_006231.4(POLE):c.1337G>A (p.Arg446Gln) rs151273553 0.00046
NM_007294.4(BRCA1):c.2566T>C (p.Tyr856His) rs80356892 0.00046
NM_017763.6(RNF43):c.575C>T (p.Pro192Leu) rs139557480 0.00046
NM_000059.4(BRCA2):c.5879G>A (p.Cys1960Tyr) rs56157628 0.00045
NM_000077.5(CDKN2A):c.273G>A (p.Leu91=) rs4987127 0.00045
NM_001048174.2(MUTYH):c.914-9C>T rs3219488 0.00045
NM_002691.4(POLD1):c.2052G>C (p.Gln684His) rs144143245 0.00045
NM_004360.5(CDH1):c.1744C>T (p.Leu582=) rs1801025 0.00045
NM_000051.4(ATM):c.3342G>A (p.Lys1114=) rs138393322 0.00044
NM_000059.4(BRCA2):c.4585G>A (p.Gly1529Arg) rs28897728 0.00044
NM_001048174.2(MUTYH):c.11C>T (p.Pro4Leu) rs79777494 0.00044
NM_001048174.2(MUTYH):c.32G>A (p.Gly11Asp) rs75321043 0.00044
NM_000251.3(MSH2):c.1680T>C (p.Asn560=) rs200056411 0.00043
NM_001048174.2(MUTYH):c.1365C>T (p.Thr455=) rs150269172 0.00043
NM_001127511.3(APC):c.-166C>T rs904001781 0.00043
NM_004655.4(AXIN2):c.733C>T (p.Pro245Ser) rs62640028 0.00043
NM_177438.3(DICER1):c.4206+11_4206+13del rs752585711 0.00043
NM_177438.3(DICER1):c.438+11T>C rs376038413 0.00043
NM_000038.6(APC):c.2322C>T (p.Asp774=) rs145792879 0.00041
NM_000249.4(MLH1):c.702G>A (p.Glu234=) rs35908749 0.00041
NM_001048174.2(MUTYH):c.1174C>A (p.Leu392Met) rs144079536 0.00041
NM_002691.4(POLD1):c.1932C>G (p.Asp644Glu) rs80214209 0.00041
NM_002691.4(POLD1):c.3068-14C>T rs3218758 0.00041
NM_002878.4(RAD51D):c.932T>A (p.Ile311Asn) rs145309168 0.00041
NM_003000.3(SDHB):c.158G>A (p.Gly53Glu) rs34916635 0.00041
NM_006231.4(POLE):c.1015G>A (p.Asp339Asn) rs149029910 0.00041
NM_006231.4(POLE):c.3881G>A (p.Arg1294His) rs115455318 0.00041
NM_022051.3(EGLN1):c.470A>G (p.Gln157Arg) rs748272071 0.00041
NM_032043.3(BRIP1):c.2220G>T (p.Gln740His) rs45589637 0.00041
NM_175914.5(HNF4A):c.726G>A (p.Val242=) rs145280017 0.00041
NM_000038.6(APC):c.2805C>T (p.Tyr935=) rs137854575 0.00040
NM_000249.4(MLH1):c.198C>T (p.Thr66=) rs61751642 0.00040
NM_000038.6(APC):c.2847G>T (p.Met949Ile) rs147394539 0.00039
NM_000251.3(MSH2):c.1168C>T (p.Leu390Phe) rs17224367 0.00039
NM_000535.7(PMS2):c.1560G>A (p.Ala520=) rs201167814 0.00039
NM_000551.4(VHL):c.241C>T (p.Pro81Ser) rs104893829 0.00039
NM_002691.4(POLD1):c.2954-29C>T rs368911467 0.00039
NM_000038.6(APC):c.3650A>C (p.Asn1217Thr) rs138933660 0.00038
NM_000051.4(ATM):c.7390T>C (p.Cys2464Arg) rs55801750 0.00038
NM_000251.3(MSH2):c.1511-41G>C rs202215396 0.00038
NM_000535.7(PMS2):c.1268C>G (p.Ala423Gly) rs756883400 0.00038
NM_002878.4(RAD51D):c.904-11T>A rs374449943 0.00038
NM_006231.4(POLE):c.2026+9C>T rs373790607 0.00038
NM_000179.3(MSH6):c.1449G>T (p.Val483=) rs35590297 0.00037
NM_000249.4(MLH1):c.977T>C (p.Val326Ala) rs63751049 0.00037
NM_000388.4(CASR):c.2064C>T (p.Phe688=) rs150869744 0.00037
NM_002878.4(RAD51D):c.26G>C (p.Cys9Ser) rs140825795 0.00037
NM_007194.4(CHEK2):c.*18C>T rs17884403 0.00037
NM_000051.4(ATM):c.6808-22C>A rs3218700 0.00036
NM_000051.4(ATM):c.6919C>T (p.Leu2307Phe) rs56009889 0.00035
NM_000455.5(STK11):c.1284G>A (p.Ser428=) rs369097329 0.00035
NM_001040108.2(MLH3):c.3440A>T (p.Asn1147Ile) rs142124529 0.00035
NM_001048174.2(MUTYH):c.850-2A>G rs77542170 0.00035
NM_004656.4(BAP1):c.1035G>C (p.Gly345=) rs369744075 0.00035
NM_024675.4(PALB2):c.1470C>T (p.Pro490=) rs45612837 0.00035
NM_000038.6(APC):c.607C>G (p.Gln203Glu) rs141576417 0.00034
NM_000051.4(ATM):c.2932T>C (p.Ser978Pro) rs139552233 0.00034
NM_000249.4(MLH1):c.1321G>A (p.Ala441Thr) rs63750365 0.00034
NM_001040108.2(MLH3):c.1637G>T (p.Arg546Ile) rs55725216 0.00034
NM_002691.4(POLD1):c.945C>T (p.Phe315=) rs150116169 0.00034
NM_006231.4(POLE):c.1359+19G>A rs375000942 0.00034
NM_006231.4(POLE):c.1534G>A (p.Ala512Thr) rs113998091 0.00034
NM_007194.4(CHEK2):c.1312G>T (p.Asp438Tyr) rs200050883 0.00034
NM_007294.4(BRCA1):c.1456T>C (p.Phe486Leu) rs55906931 0.00034
NM_032043.3(BRIP1):c.380-17T>A rs200050729 0.00034
NM_000251.3(MSH2):c.2154A>G (p.Gln718=) rs63750810 0.00033
NM_005359.6(SMAD4):c.1392C>T (p.Ala464=) rs140487104 0.00033
NM_000051.4(ATM):c.2494C>T (p.Arg832Cys) rs2229022 0.00032
NM_000059.4(BRCA2):c.223G>C (p.Ala75Pro) rs28897701 0.00032
NM_000059.4(BRCA2):c.8187G>T (p.Lys2729Asn) rs80359065 0.00032
NM_000179.3(MSH6):c.3488A>T (p.Glu1163Val) rs63750252 0.00032
NM_000535.7(PMS2):c.988+11T>C rs139969671 0.00032
NM_007194.4(CHEK2):c.1427C>T (p.Thr476Met) rs142763740 0.00032
NM_000038.6(APC):c.4905G>A (p.Gly1635=) rs137988845 0.00031
NM_000038.6(APC):c.7490C>T (p.Ser2497Leu) rs141010008 0.00031
NM_000059.4(BRCA2):c.5785A>G (p.Ile1929Val) rs79538375 0.00031
NM_000251.3(MSH2):c.435T>G (p.Ile145Met) rs63750124 0.00031
NM_001048174.2(MUTYH):c.1392+2C>T rs140288388 0.00031
NM_004655.4(AXIN2):c.1685C>T (p.Pro562Leu) rs149764887 0.00031
NM_004656.4(BAP1):c.1962A>C (p.Val654=) rs148624125 0.00031
NM_007294.4(BRCA1):c.3708T>G (p.Asn1236Lys) rs28897687 0.00031
NM_000051.4(ATM):c.4949A>G (p.Asn1650Ser) rs55870064 0.00030
NM_001040108.2(MLH3):c.1168T>A (p.Phe390Ile) rs61752721 0.00030
NM_001142864.4(PIEZO1):c.7471C>T (p.Arg2491Trp) rs201746476 0.00030
NM_000051.4(ATM):c.4324T>C (p.Tyr1442His) rs201666889 0.00029
NM_000075.4(CDK4):c.625C>T (p.Arg209Cys) rs140644696 0.00029
NM_000077.5(CDKN2A):c.-14C>T rs764244718 0.00029
NM_000251.3(MSH2):c.471C>A (p.Gly157=) rs61756463 0.00029
NM_000465.4(BARD1):c.346C>T (p.His116Tyr) rs144856889 0.00029
NM_000535.7(PMS2):c.572A>G (p.Tyr191Cys) rs375289386 0.00029
NM_002528.7(NTHL1):c.74G>A (p.Arg25Lys) rs2302172 0.00029
NM_006231.4(POLE):c.5496T>C (p.Leu1832=) rs147543146 0.00029
NM_007294.4(BRCA1):c.1648A>C (p.Asn550His) rs56012641 0.00029
NM_007294.4(BRCA1):c.536A>G (p.Tyr179Cys) rs56187033 0.00029
NM_144997.7(FLCN):c.268G>T (p.Ala90Ser) rs141140415 0.00029
NM_000038.6(APC):c.3511C>T (p.Arg1171Cys) rs201830995 0.00028
NM_000059.4(BRCA2):c.425+33A>G rs200065709 0.00028
NM_000137.4(FAH):c.1062+5G>A rs80338901 0.00028
NM_000179.3(MSH6):c.3217C>T (p.Pro1073Ser) rs142254875 0.00028
NM_000402.4(G6PD):c.653C>T (p.Ser218Phe) rs5030868 0.00028
NM_002439.5(MSH3):c.2262A>G (p.Ile754Met) rs200819607 0.00028
NM_004360.5(CDH1):c.892G>A (p.Ala298Thr) rs142822590 0.00028
NM_006231.4(POLE):c.2510T>C (p.Phe837Ser) rs139182500 0.00028
NM_007294.4(BRCA1):c.548-17G>T rs80358014 0.00028
NM_000179.3(MSH6):c.-18G>T rs199913053 0.00027
NM_000455.5(STK11):c.*8C>T rs587782259 0.00027
NM_002691.4(POLD1):c.1795G>A (p.Ala599Thr) rs149569984 0.00027
NM_004360.5(CDH1):c.303C>T (p.Tyr101=) rs150789339 0.00027
NM_007194.4(CHEK2):c.1604G>A (p.Arg535His) rs544216926 0.00027
NM_007294.4(BRCA1):c.3713C>T (p.Pro1238Leu) rs28897688 0.00027
NM_000038.6(APC):c.8266A>G (p.Ile2756Val) rs146115809 0.00026
NM_000051.4(ATM):c.4362A>C (p.Lys1454Asn) rs148993589 0.00026
NM_000059.4(BRCA2):c.1395A>C (p.Val465=) rs11571641 0.00026
NM_000059.4(BRCA2):c.4584C>T (p.Ser1528=) rs80359788 0.00026
NM_000059.4(BRCA2):c.4686A>G (p.Gln1562=) rs28897730 0.00026
NM_000059.4(BRCA2):c.6853A>G (p.Ile2285Val) rs56272235 0.00026
NM_000059.4(BRCA2):c.9292T>C (p.Tyr3098His) rs41293521 0.00026
NM_000077.5(CDKN2A):c.318G>A (p.Val106=) rs199888003 0.00026
NM_000179.3(MSH6):c.4002-10T>A rs545466048 0.00026
NM_000535.7(PMS2):c.1004A>G (p.Asn335Ser) rs200513014 0.00026
NM_002528.7(NTHL1):c.835C>T (p.Gln279Ter) rs146347092 0.00026
NM_004360.5(CDH1):c.2413G>A (p.Asp805Asn) rs200894246 0.00026
NM_007194.4(CHEK2):c.1283C>T (p.Ser428Phe) rs137853011 0.00026
NM_007194.4(CHEK2):c.444+19T>C rs200501745 0.00026
NM_007294.4(BRCA1):c.736T>G (p.Leu246Val) rs28897675 0.00026
NM_032043.3(BRIP1):c.1255C>T (p.Arg419Trp) rs150624408 0.00026
NM_000051.4(ATM):c.5975A>C (p.Lys1992Thr) rs150757822 0.00025
NM_000059.4(BRCA2):c.1786G>C (p.Asp596His) rs56328701 0.00025
NM_000059.4(BRCA2):c.440A>G (p.Gln147Arg) rs80358674 0.00025
NM_000535.7(PMS2):c.2324A>G (p.Asn775Ser) rs17420802 0.00025
NM_000546.6(TP53):c.704A>G (p.Asn235Ser) rs144340710 0.00025
NM_001142864.4(PIEZO1):c.5627G>A (p.Arg1876Lys) rs201967733 0.00025
NM_002878.4(RAD51D):c.413A>G (p.Asn138Ser) rs201676898 0.00025
NM_004655.4(AXIN2):c.1059+8C>T rs367595502 0.00025
NM_006231.4(POLE):c.1405C>T (p.Leu469=) rs368303888 0.00025
NM_177438.3(DICER1):c.1124C>G (p.Pro375Arg) rs148758903 0.00025
NM_000038.6(APC):c.5274T>A (p.Ser1758=) rs199600387 0.00024
NM_000059.4(BRCA2):c.6455C>A (p.Ser2152Tyr) rs80358881 0.00024
NM_000245.4(MET):c.967A>G (p.Ser323Gly) rs201467281 0.00024
NM_000251.3(MSH2):c.1277-16T>C rs368653974 0.00024
NM_000465.4(BARD1):c.668A>G (p.Glu223Gly) rs145009419 0.00024
NM_000791.4(DHFR):c.-349G>A rs146523896 0.00024
NM_002439.5(MSH3):c.2685C>T (p.Thr895=) rs61753792 0.00024
NM_002691.4(POLD1):c.885G>C (p.Val295=) rs201946114 0.00024
NM_004655.4(AXIN2):c.-33A>C rs190687283 0.00024
NM_006231.4(POLE):c.2683G>A (p.Ala895Thr) rs201115064 0.00024
NM_007294.4(BRCA1):c.4358-10C>T rs80358111 0.00024
NM_007294.4(BRCA1):c.528G>A (p.Thr176=) rs34545365 0.00024
NM_032043.3(BRIP1):c.139C>G (p.Pro47Ala) rs28903098 0.00024
NM_058195.4(CDKN2A):c.69C>T (p.Phe23=) rs374360796 0.00024
NM_058216.3(RAD51C):c.145+12T>G rs377297129 0.00024
NM_144997.7(FLCN):c.715C>T (p.Arg239Cys) rs78683075 0.00024
NM_000038.6(APC):c.6526T>C (p.Leu2176=) rs183468041 0.00023
NM_000059.4(BRCA2):c.5070A>C (p.Lys1690Asn) rs56087561 0.00023
NM_000179.3(MSH6):c.3438+11_3438+14del rs377746844 0.00023
NM_000179.3(MSH6):c.73G>T (p.Ala25Ser) rs267608026 0.00023
NM_000455.5(STK11):c.1194G>A (p.Ala398=) rs184271025 0.00023
NM_006231.4(POLE):c.5379-19C>T rs376722984 0.00023
NM_006231.4(POLE):c.691C>T (p.Arg231Cys) rs146592584 0.00023
NM_006231.4(POLE):c.761C>T (p.Pro254Leu) rs200211438 0.00023
NM_007294.4(BRCA1):c.1486C>T (p.Arg496Cys) rs28897676 0.00023
NM_017763.6(RNF43):c.1821G>A (p.Ser607=) rs200680078 0.00023
NM_000059.4(BRCA2):c.9038C>T (p.Thr3013Ile) rs28897755 0.00022
NM_000059.4(BRCA2):c.9502-12T>G rs81002803 0.00022
NM_000143.4(FH):c.7C>G (p.Arg3Gly) rs202166344 0.00022
NM_000249.4(MLH1):c.2066A>G (p.Gln689Arg) rs63750702 0.00022
NM_000249.4(MLH1):c.307-19A>G rs121909451 0.00022
NM_000251.3(MSH2):c.1787A>G (p.Asn596Ser) rs41295288 0.00022
NM_000535.7(PMS2):c.953A>G (p.Tyr318Cys) rs139438201 0.00022
NM_004360.5(CDH1):c.33G>C (p.Leu11=) rs730881654 0.00022
NM_015450.3(POT1):c.1228G>C (p.Asp410His) rs79314063 0.00022
NM_020975.6(RET):c.2410G>A (p.Val804Met) rs79658334 0.00022
NM_000038.6(APC):c.3352A>G (p.Asn1118Asp) rs140493115 0.00021
NM_000059.4(BRCA2):c.5312G>A (p.Gly1771Asp) rs80358755 0.00021
NM_000143.4(FH):c.1303G>A (p.Val435Met) rs147528200 0.00021
NM_000179.3(MSH6):c.*49_*68dup rs777409019 0.00021
NM_000245.4(MET):c.4105T>C (p.Leu1369=) rs45575438 0.00021
NM_000465.4(BARD1):c.1347A>G (p.Gln449=) rs373257776 0.00021
NM_000535.7(PMS2):c.1567T>A (p.Ser523Thr) rs63751132 0.00021
NM_002439.5(MSH3):c.1174-12A>G rs202083881 0.00021
NM_004360.5(CDH1):c.670C>T (p.Arg224Cys) rs200310662 0.00021
NM_006231.4(POLE):c.519C>T (p.Ala173=) rs187690610 0.00021
NM_006231.4(POLE):c.561C>T (p.Tyr187=) rs143938822 0.00021
NM_007294.4(BRCA1):c.2477C>A (p.Thr826Lys) rs28897683 0.00021
NM_007294.4(BRCA1):c.571G>A (p.Val191Ile) rs80357090 0.00021
NM_024675.4(PALB2):c.656A>G (p.Asp219Gly) rs45594034 0.00021
NM_177438.3(DICER1):c.5364+20A>T rs150893725 0.00021
NM_000038.6(APC):c.3006C>T (p.Ala1002=) rs72541810 0.00020
NM_000051.4(ATM):c.3402+17T>C rs3092825 0.00020
NM_000059.4(BRCA2):c.1385A>G (p.Glu462Gly) rs56403624 0.00020
NM_000059.4(BRCA2):c.198A>G (p.Gln66=) rs28897700 0.00020
NM_000059.4(BRCA2):c.5710C>G (p.Leu1904Val) rs55875643 0.00020
NM_000455.5(STK11):c.1296G>A (p.Gln432=) rs587781179 0.00020
NM_001048174.2(MUTYH):c.1102+17C>T rs369034810 0.00020
NM_003001.5(SDHC):c.120G>A (p.Arg40=) rs36097930 0.00020
NM_006231.4(POLE):c.1645T>C (p.Ser549Pro) rs115558715 0.00020
NM_024675.4(PALB2):c.2244A>G (p.Thr748=) rs750048627 0.00020
NM_144997.7(FLCN):c.246C>T (p.Cys82=) rs150712346 0.00020
NM_000038.6(APC):c.1488A>T (p.Thr496=) rs9282599 0.00019
NM_000038.6(APC):c.2205G>A (p.Ala735=) rs141001261 0.00019
NM_000051.4(ATM):c.1272T>C (p.Pro424=) rs35578748 0.00019
NM_000051.4(ATM):c.4980C>T (p.Asn1660=) rs144338238 0.00019
NM_000059.4(BRCA2):c.6322C>T (p.Arg2108Cys) rs55794205 0.00019
NM_000059.4(BRCA2):c.8905G>A (p.Val2969Met) rs59004709 0.00019
NM_000179.3(MSH6):c.3961A>G (p.Arg1321Gly) rs41295278 0.00019
NM_000179.3(MSH6):c.4001+11_4001+15dup rs587779302 0.00019
NM_000251.3(MSH2):c.138C>G (p.His46Gln) rs33946261 0.00019
NM_000535.7(PMS2):c.1243G>A (p.Val415Met) rs138387687 0.00019
NM_001040108.2(MLH3):c.3563C>G (p.Ser1188Ter) rs193219754 0.00019
NM_006231.4(POLE):c.3378+10A>G rs193075152 0.00019
NM_007294.4(BRCA1):c.4484+14A>G rs80358022 0.00019
NM_007294.4(BRCA1):c.5005G>T (p.Ala1669Ser) rs80357087 0.00019
NM_007294.4(BRCA1):c.828A>G (p.Thr276=) rs186274774 0.00019
NM_015450.3(POT1):c.64A>G (p.Ile22Val) rs375440229 0.00019
NM_032043.3(BRIP1):c.36G>T (p.Gly12=) rs45566938 0.00019
NM_144997.7(FLCN):c.592G>A (p.Asp198Asn) rs200168437 0.00019
NM_000038.6(APC):c.3374T>C (p.Val1125Ala) rs377278397 0.00018
NM_000038.6(APC):c.4237A>G (p.Met1413Val) rs141519952 0.00018
NM_000038.6(APC):c.5009C>T (p.Ala1670Val) rs202228932 0.00018
NM_000059.4(BRCA2):c.7976+23C>T rs183623188 0.00018
NM_000251.3(MSH2):c.1730T>C (p.Ile577Thr) rs63749910 0.00018
NM_000455.5(STK11):c.618G>A (p.Ala206=) rs370976710 0.00018
NM_000535.7(PMS2):c.2253T>C (p.Phe751=) rs1805325 0.00018
NM_000546.6(TP53):c.1014C>T (p.Phe338=) rs150293825 0.00018
NM_001040108.2(MLH3):c.3137G>A (p.Arg1046Gln) rs201303087 0.00018
NM_001048174.2(MUTYH):c.1102+9A>T rs587780742 0.00018
NM_001370259.2(MEN1):c.762G>A (p.Leu254=) rs199909967 0.00018
NM_002878.4(RAD51D):c.904-3C>T rs45478491 0.00018
NM_004360.5(CDH1):c.2412C>T (p.Pro804=) rs202075199 0.00018
NM_007294.4(BRCA1):c.5406+33A>T rs80358092 0.00018
NM_144997.7(FLCN):c.1523A>G (p.Lys508Arg) rs199643834 0.00018
NM_177438.3(DICER1):c.4819C>T (p.Arg1607Trp) rs189119295 0.00018
NM_198253.3(TERT):c.604G>A (p.Ala202Thr) rs121918661 0.00018
NM_000051.4(ATM):c.1009C>T (p.Arg337Cys) rs138398778 0.00017
NM_000051.4(ATM):c.2467-31T>C rs141761716 0.00017
NM_000249.4(MLH1):c.1040C>A (p.Thr347Asn) rs201541505 0.00017
NM_000535.7(PMS2):c.2012C>T (p.Thr671Met) rs587780046 0.00017
NM_000791.4(DHFR):c.-197G>A rs534679562 0.00017
NM_007294.4(BRCA1):c.3748G>A (p.Glu1250Lys) rs28897686 0.00017
NM_144997.7(FLCN):c.580C>T (p.Arg194Trp) rs138070947 0.00017
NM_177438.3(DICER1):c.4207-3C>T rs376041812 0.00017
NM_000038.6(APC):c.6510A>C (p.Pro2170=) rs138571760 0.00016
NM_000038.6(APC):c.6669A>G (p.Ser2223=) rs372680843 0.00016
NM_000051.4(ATM):c.3403-16_3403-15insA rs569564716 0.00016
NM_000051.4(ATM):c.7224G>A (p.Ser2408=) rs145747513 0.00016
NM_000051.4(ATM):c.9086G>A (p.Gly3029Asp) rs201199629 0.00016
NM_000059.4(BRCA2):c.3417G>A (p.Lys1139=) rs145625991 0.00016
NM_000059.4(BRCA2):c.9649-20C>T rs56177715 0.00016
NM_000077.5(CDKN2A):c.384G>A (p.Arg128=) rs199901898 0.00016
NM_000179.3(MSH6):c.3160A>T (p.Ile1054Phe) rs267608075 0.00016
NM_000249.4(MLH1):c.65G>C (p.Gly22Ala) rs41295280 0.00016
NM_000251.3(MSH2):c.1275A>G (p.Glu425=) rs63751650 0.00016
NM_000314.8(PTEN):c.234C>T (p.Thr78=) rs35917308 0.00016
NM_000535.7(PMS2):c.53T>C (p.Ile18Thr) rs201343342 0.00016
NM_001040108.2(MLH3):c.713A>C (p.Tyr238Ser) rs144707485 0.00016
NM_001048174.2(MUTYH):c.616G>A (p.Val206Met) rs200165598 0.00016
NM_002691.4(POLD1):c.2185G>A (p.Glu729Lys) rs200931999 0.00016
NM_002691.4(POLD1):c.2337G>A (p.Ala779=) rs147108748 0.00016
NM_004168.4(SDHA):c.955A>C (p.Ile319Leu) rs377509915 0.00016
NM_004655.4(AXIN2):c.1242G>A (p.Arg414=) rs200325634 0.00016
NM_004655.4(AXIN2):c.780T>C (p.Ser260=) rs147681058 0.00016
NM_004656.4(BAP1):c.376-4G>A rs369277958 0.00016
NM_005981.5(TSPAN31):c.*2031T>A rs370609910 0.00016
NM_006231.4(POLE):c.154C>T (p.Arg52Trp) rs115452881 0.00016
NM_006231.4(POLE):c.3245G>A (p.Arg1082His) rs201744227 0.00016
NM_006231.4(POLE):c.3862G>A (p.Ala1288Thr) rs200398117 0.00016
NM_006231.4(POLE):c.6597C>T (p.Ile2199=) rs147611144 0.00016
NM_007294.4(BRCA1):c.3296C>T (p.Pro1099Leu) rs80357201 0.00016
NM_024675.4(PALB2):c.3054G>C (p.Glu1018Asp) rs183489969 0.00016
NM_032043.3(BRIP1):c.2440C>T (p.Arg814Cys) rs201869624 0.00016
NM_144997.7(FLCN):c.1278C>T (p.Ile426=) rs41459448 0.00016
NM_000038.6(APC):c.6985A>G (p.Ile2329Val) rs146048493 0.00015
NM_000535.7(PMS2):c.1467G>A (p.Glu489=) rs542522853 0.00015
NM_004360.5(CDH1):c.2329G>A (p.Asp777Asn) rs372989292 0.00015
NM_006231.4(POLE):c.2974G>A (p.Ala992Thr) rs115193764 0.00015
NM_007194.4(CHEK2):c.190G>A (p.Glu64Lys) rs141568342 0.00015
NM_000038.6(APC):c.6609T>C (p.Val2203=) rs149328018 0.00014
NM_000059.4(BRCA2):c.4061C>T (p.Thr1354Met) rs80358656 0.00014
NM_000143.4(FH):c.122C>T (p.Ala41Val) rs201486221 0.00014
NM_000179.3(MSH6):c.884A>G (p.Lys295Arg) rs267608051 0.00014
NM_000249.4(MLH1):c.803A>G (p.Glu268Gly) rs63750650 0.00014
NM_000465.4(BARD1):c.279A>G (p.Gln93=) rs370000575 0.00014
NM_000546.6(TP53):c.869G>A (p.Arg290His) rs55819519 0.00014
NM_001370259.2(MEN1):c.1351-4C>T rs764408631 0.00014
NM_004064.5(CDKN1B):c.482C>G (p.Ser161Cys) rs373917399 0.00014
NM_004329.3(BMPR1A):c.676-6A>C rs186999445 0.00014
NM_004655.4(AXIN2):c.1305G>A (p.Pro435=) rs369221405 0.00014
NM_006231.4(POLE):c.4237G>A (p.Glu1413Lys) rs372901803 0.00014
NM_006231.4(POLE):c.6004+5G>T rs372169366 0.00014
NM_007194.4(CHEK2):c.-4C>T rs374938148 0.00014
NM_020975.6(RET):c.1063+9G>A rs765463636 0.00014
NM_020975.6(RET):c.1699G>A (p.Asp567Asn) rs147219360 0.00014
NM_024675.4(PALB2):c.2586+10A>G rs373321719 0.00014
NM_032043.3(BRIP1):c.-30-3T>C rs370728413 0.00014
NM_144997.7(FLCN):c.1463C>T (p.Ala488Val) rs200660337 0.00014
NM_000051.4(ATM):c.1773T>C (p.Asn591=) rs61734356 0.00013
NM_000051.4(ATM):c.8671+9T>G rs200190537 0.00013
NM_000059.4(BRCA2):c.3445A>G (p.Met1149Val) rs80358589 0.00013
NM_000085.5(CLCNKB):c.112T>C (p.Trp38Arg) rs375301415 0.00013
NM_000179.3(MSH6):c.59C>T (p.Ala20Val) rs63750664 0.00013
NM_000179.3(MSH6):c.650A>G (p.Asp217Gly) rs554012110 0.00013
NM_000251.3(MSH2):c.505A>G (p.Ile169Val) rs63750716 0.00013
NM_000455.5(STK11):c.1071G>T (p.Glu357Asp) rs556651007 0.00013
NM_000535.7(PMS2):c.1556A>G (p.Tyr519Cys) rs63750649 0.00013
NM_000535.7(PMS2):c.240C>T (p.Phe80=) rs143162541 0.00013
NM_000535.7(PMS2):c.255G>A (p.Leu85=) rs200491279 0.00013
NM_000535.7(PMS2):c.620G>A (p.Gly207Glu) rs374704824 0.00013
NM_000551.4(VHL):c.629G>A (p.Arg210Gln) rs138780791 0.00013
NM_001127511.3(APC):c.-109C>G rs761634030 0.00013
NM_002439.5(MSH3):c.1177G>A (p.Val393Met) rs761779919 0.00013
NM_002439.5(MSH3):c.562C>T (p.Arg188Cys) rs147289289 0.00013
NM_002691.4(POLD1):c.1017G>T (p.Ser339=) rs373404887 0.00013
NM_002691.4(POLD1):c.371T>C (p.Val124Ala) rs199993010 0.00013
NM_004360.5(CDH1):c.-49G>T rs564350060 0.00013
NM_004360.5(CDH1):c.2635G>A (p.Gly879Ser) rs200911775 0.00013
NM_004655.4(AXIN2):c.144C>T (p.Pro48=) rs144099816 0.00013
NM_004656.4(BAP1):c.1735G>A (p.Gly579Arg) rs370004702 0.00013
NM_007294.4(BRCA1):c.1911T>C (p.Thr637=) rs62625305 0.00013
NM_007294.4(BRCA1):c.2773A>C (p.Ile925Leu) rs4986847 0.00013
NM_024675.4(PALB2):c.232G>A (p.Val78Ile) rs515726085 0.00013
NM_024675.4(PALB2):c.48+7G>C rs190626072 0.00013
NM_000038.6(APC):c.1631T>C (p.Ile544Thr) rs144056494 0.00012
NM_000038.6(APC):c.450A>G (p.Lys150=) rs116020626 0.00012
NM_000038.6(APC):c.6873A>T (p.Gln2291His) rs148878262 0.00012
NM_000059.4(BRCA2):c.1889C>T (p.Thr630Ile) rs80358479 0.00012
NM_000059.4(BRCA2):c.2919G>A (p.Ser973=) rs45525041 0.00012
NM_000059.4(BRCA2):c.3055C>G (p.Leu1019Val) rs55638633 0.00012
NM_000179.3(MSH6):c.3203G>A (p.Arg1068Gln) rs398123230 0.00012
NM_000249.4(MLH1):c.1050A>G (p.Pro350=) rs137937003 0.00012
NM_000314.8(PTEN):c.1197A>G (p.Gln399=) rs374684043 0.00012
NM_000465.4(BARD1):c.1152C>T (p.Ser384=) rs368291318 0.00012
NM_017763.6(RNF43):c.1302C>T (p.Pro434=) rs201383492 0.00012
NM_032043.3(BRIP1):c.3069C>T (p.Leu1023=) rs61754142 0.00012
NM_000038.6(APC):c.7621A>G (p.Ile2541Val) rs587778033 0.00011
NM_000051.4(ATM):c.5890A>G (p.Lys1964Glu) rs201963507 0.00011
NM_000051.4(ATM):c.7919C>T (p.Thr2640Ile) rs4988125 0.00011
NM_000059.4(BRCA2):c.2680G>A (p.Val894Ile) rs28897715 0.00011
NM_000059.4(BRCA2):c.6317T>C (p.Leu2106Pro) rs56172926 0.00011
NM_000059.4(BRCA2):c.9501+9A>C rs81002867 0.00011
NM_000143.4(FH):c.6C>T (p.Tyr2=) rs199971078 0.00011
NM_000179.3(MSH6):c.628-7C>A rs373129248 0.00011
NM_000249.4(MLH1):c.884+16A>G rs377598055 0.00011
NM_000251.3(MSH2):c.198C>T (p.Tyr66=) rs730881784 0.00011
NM_000251.3(MSH2):c.2203A>G (p.Ile735Val) rs2229061 0.00011
NM_000251.3(MSH2):c.508C>G (p.Gln170Glu) rs63750843 0.00011
NM_000314.8(PTEN):c.235G>A (p.Ala79Thr) rs202004587 0.00011
NM_000455.5(STK11):c.825G>A (p.Pro275=) rs202011521 0.00011
NM_000535.7(PMS2):c.1559C>T (p.Ala520Val) rs63751300 0.00011
NM_000546.6(TP53):c.217G>A (p.Val73Met) rs587782423 0.00011
NM_000546.6(TP53):c.97-9C>T rs202217267 0.00011
NM_001023.4(RPS20):c.228G>A (p.Thr76=) rs540124601 0.00011
NM_001048174.2(MUTYH):c.1464G>A (p.Pro488=) rs143796254 0.00011
NM_002691.4(POLD1):c.1785C>T (p.Asp595=) rs769563176 0.00011
NM_002691.4(POLD1):c.521G>A (p.Arg174Gln) rs141976385 0.00011
NM_002878.4(RAD51D):c.145-40C>T rs370850037 0.00011
NM_004329.3(BMPR1A):c.961C>T (p.Leu321=) rs377412651 0.00011
NM_004329.3(BMPR1A):c.98C>G (p.Thr33Ser) rs142454490 0.00011
NM_004360.5(CDH1):c.1223C>T (p.Ala408Val) rs138135866 0.00011
NM_004655.4(AXIN2):c.1882C>T (p.Arg628Trp) rs200201811 0.00011
NM_006231.4(POLE):c.285+13C>A rs76960367 0.00011
NM_006231.4(POLE):c.4169G>A (p.Arg1390His) rs200776293 0.00011
NM_007294.4(BRCA1):c.2002C>T (p.Leu668Phe) rs80357250 0.00011
NM_007294.4(BRCA1):c.2596C>T (p.Arg866Cys) rs41286300 0.00011
NM_007294.4(BRCA1):c.3823A>G (p.Ile1275Val) rs80357280 0.00011
NM_007294.4(BRCA1):c.441+18C>T rs371973519 0.00011
NM_007294.4(BRCA1):c.5158A>G (p.Thr1720Ala) rs56195342 0.00011
NM_007294.4(BRCA1):c.693G>A (p.Thr231=) rs62625298 0.00011
NM_020975.6(RET):c.1522+35C>T rs377130948 0.00011
NM_024675.4(PALB2):c.1250C>A (p.Ser417Tyr) rs45510998 0.00011
NM_032043.3(BRIP1):c.3444C>A (p.Asp1148Glu) rs28997573 0.00011
NM_058216.3(RAD51C):c.*25C>G rs28363336 0.00011
NM_000038.6(APC):c.388A>G (p.Ser130Gly) rs150973053 0.00010
NM_000038.6(APC):c.4918C>T (p.Arg1640Trp) rs373440614 0.00010
NM_000051.4(ATM):c.1703G>T (p.Arg568Ile) rs200381392 0.00010
NM_000059.4(BRCA2):c.8633-16C>G rs81002818 0.00010
NM_000179.3(MSH6):c.1875C>T (p.Ser625=) rs63749886 0.00010
NM_000179.3(MSH6):c.3245C>T (p.Pro1082Leu) rs191109849 0.00010
NM_000179.3(MSH6):c.3788G>A (p.Arg1263His) rs147852216 0.00010
NM_000249.4(MLH1):c.1964T>C (p.Ile655Thr) rs63751225 0.00010
NM_000455.5(STK11):c.787T>C (p.Leu263=) rs372378119 0.00010
NM_000465.4(BARD1):c.2002-11C>T rs187240320 0.00010
NM_000546.6(TP53):c.673-37C>T rs374907737 0.00010
NM_000551.4(VHL):c.598C>T (p.Arg200Trp) rs28940298 0.00010
NM_001048174.2(MUTYH):c.-6-7G>A rs780029247 0.00010
NM_002439.5(MSH3):c.3000T>G (p.Asp1000Glu) rs139205893 0.00010
NM_002528.7(NTHL1):c.115+17G>A rs377258199 0.00010
NM_002691.4(POLD1):c.1731C>T (p.Gly577=) rs376473853 0.00010
NM_002691.4(POLD1):c.666G>A (p.Pro222=) rs746678748 0.00010
NM_002878.4(RAD51D):c.137C>G (p.Ser46Cys) rs587780102 0.00010
NM_003000.3(SDHB):c.113G>A (p.Arg38His) rs143058777 0.00010
NM_004655.4(AXIN2):c.1907+17G>A rs201487132 0.00010
NM_004655.4(AXIN2):c.2142-20C>T rs764171738 0.00010
NM_005359.6(SMAD4):c.21G>A (p.Thr7=) rs142292491 0.00010
NM_005359.6(SMAD4):c.424+5G>A rs200772603 0.00010
NM_006231.4(POLE):c.6531+6G>T rs774747998 0.00010
NM_017763.6(RNF43):c.434G>A (p.Arg145Gln) rs151209912 0.00010
NM_000038.6(APC):c.1958+10G>T rs375175370 0.00009
NM_000038.6(APC):c.2586C>G (p.Asn862Lys) rs147972247 0.00009
NM_000038.6(APC):c.3786T>C (p.Tyr1262=) rs147411334 0.00009
NM_000038.6(APC):c.645+50A>G rs377697545 0.00009
NM_000038.6(APC):c.6525A>G (p.Thr2175=) rs200151646 0.00009
NM_000038.6(APC):c.95A>G (p.Asn32Ser) rs539108537 0.00009
NM_000051.4(ATM):c.4414T>G (p.Leu1472Val) rs539676759 0.00009
NM_000051.4(ATM):c.5005+7_5005+8del rs587780626 0.00009
NM_000051.4(ATM):c.5583G>A (p.Leu1861=) rs781383087 0.00009
NM_000051.4(ATM):c.670A>G (p.Lys224Glu) rs145053092 0.00009
NM_000059.4(BRCA2):c.1568A>G (p.His523Arg) rs80358443 0.00009
NM_000059.4(BRCA2):c.2538A>C (p.Ser846=) rs11571654 0.00009
NM_000059.4(BRCA2):c.4314C>T (p.Val1438=) rs730881590 0.00009
NM_000059.4(BRCA2):c.4614T>C (p.Ser1538=) rs45520945 0.00009
NM_000059.4(BRCA2):c.516+18T>C rs81002834 0.00009
NM_000059.4(BRCA2):c.5455C>T (p.Pro1819Ser) rs80358768 0.00009
NM_000059.4(BRCA2):c.6338A>G (p.Asn2113Ser) rs80358874 0.00009
NM_000059.4(BRCA2):c.7435+23A>G rs761412178 0.00009
NM_000059.4(BRCA2):c.7601C>T (p.Ala2534Val) rs74047012 0.00009
NM_000179.3(MSH6):c.3024C>T (p.Thr1008=) rs587780675 0.00009
NM_000179.3(MSH6):c.3172+20T>C rs3136335 0.00009
NM_000179.3(MSH6):c.3439-10T>A rs730881819 0.00009
NM_000179.3(MSH6):c.3727A>T (p.Thr1243Ser) rs147453999 0.00009
NM_000249.4(MLH1):c.1808C>G (p.Pro603Arg) rs63750876 0.00009
NM_000251.3(MSH2):c.317G>A (p.Arg106Lys) rs41295286 0.00009
NM_000455.5(STK11):c.735-9G>A rs201899557 0.00009
NM_000465.4(BARD1):c.1059C>G (p.Pro353=) rs368649242 0.00009
NM_000465.4(BARD1):c.1694G>A (p.Arg565His) rs146946984 0.00009
NM_000546.6(TP53):c.847C>T (p.Arg283Cys) rs149633775 0.00009
NM_001040108.2(MLH3):c.2356G>A (p.Val786Ile) rs372089146 0.00009
NM_001040108.2(MLH3):c.2435G>C (p.Ser812Thr) rs763408801 0.00009
NM_001048174.2(MUTYH):c.606+14C>G rs752537118 0.00009
NM_001048174.2(MUTYH):c.650G>A (p.Arg217His) rs140342925 0.00009
NM_002528.7(NTHL1):c.607C>T (p.Leu203=) rs369076851 0.00009
NM_002878.4(RAD51D):c.196G>A (p.Val66Met) rs56026142 0.00009
NM_002878.4(RAD51D):c.864C>T (p.Gly288=) rs138557828 0.00009
NM_004168.4(SDHA):c.1661G>A (p.Arg554Gln) rs376391115 0.00009
NM_004360.5(CDH1):c.1359C>T (p.His453=) rs114861467 0.00009
NM_004655.4(AXIN2):c.2406-8C>G rs143905290 0.00009
NM_006231.4(POLE):c.1905C>T (p.Ile635=) rs145203544 0.00009
NM_006231.4(POLE):c.4047G>A (p.Ala1349=) rs201746181 0.00009
NM_006231.4(POLE):c.4719C>T (p.Leu1573=) rs115219846 0.00009
NM_007194.4(CHEK2):c.*7T>C rs121908710 0.00009
NM_007194.4(CHEK2):c.1095+19G>A rs200020484 0.00009
NM_007194.4(CHEK2):c.319+2T>A rs587782401 0.00009
NM_007194.4(CHEK2):c.349A>G (p.Arg117Gly) rs28909982 0.00009
NM_007194.4(CHEK2):c.444+1G>A rs121908698 0.00009
NM_007194.4(CHEK2):c.556A>C (p.Asn186His) rs146198085 0.00009
NM_007294.4(BRCA1):c.314A>G (p.Tyr105Cys) rs28897673 0.00009
NM_024675.4(PALB2):c.12T>C (p.Pro4=) rs567706422 0.00009
NM_024675.4(PALB2):c.3251C>T (p.Ser1084Leu) rs62625271 0.00009
NM_024675.4(PALB2):c.3508C>T (p.His1170Tyr) rs200283306 0.00009
NM_058216.3(RAD51C):c.506T>C (p.Val169Ala) rs587780256 0.00009
NM_144997.7(FLCN):c.1539-6C>T rs779028759 0.00009
NM_177438.3(DICER1):c.5527+7T>A rs375239471 0.00009
NM_000038.6(APC):c.6724A>G (p.Ser2242Gly) rs201375478 0.00008
NM_000038.6(APC):c.721G>A (p.Glu241Lys) rs777603154 0.00008
NM_000051.4(ATM):c.2466+7A>G rs55812024 0.00008
NM_000059.4(BRCA2):c.5635G>A (p.Glu1879Lys) rs55996097 0.00008
NM_000059.4(BRCA2):c.6748A>G (p.Thr2250Ala) rs80358899 0.00008
NM_000059.4(BRCA2):c.9501+3A>T rs61757642 0.00008
NM_000179.3(MSH6):c.1474A>G (p.Met492Val) rs61754783 0.00008
NM_000249.4(MLH1):c.1742C>T (p.Pro581Leu) rs63751684 0.00008
NM_000251.3(MSH2):c.1488A>G (p.Leu496=) rs267607960 0.00008
NM_000251.3(MSH2):c.1690A>G (p.Thr564Ala) rs55778204 0.00008
NM_000251.3(MSH2):c.4G>A (p.Ala2Thr) rs63750466 0.00008
NM_000455.5(STK11):c.598-7G>A rs377502057 0.00008
NM_000465.4(BARD1):c.1409A>G (p.Asn470Ser) rs587781976 0.00008
NM_000535.7(PMS2):c.2127C>T (p.Phe709=) rs199943748 0.00008
NM_000551.4(VHL):c.5C>T (p.Pro2Leu) rs111246617 0.00008
NM_000969.5(RPL5):c.418G>A (p.Gly140Ser) rs121434406 0.00008
NM_001082486.2(ACD):c.493+7T>C rs199626332 0.00008
NM_002691.4(POLD1):c.2317G>A (p.Ala773Thr) rs753865441 0.00008
NM_004360.5(CDH1):c.1020G>A (p.Thr340=) rs61747632 0.00008
NM_004360.5(CDH1):c.164T>G (p.Val55Gly) rs587778174 0.00008
NM_004655.4(AXIN2):c.475G>T (p.Asp159Tyr) rs753036084 0.00008
NM_005359.6(SMAD4):c.852A>G (p.Gln284=) rs144378484 0.00008
NM_006231.4(POLE):c.3378+7G>T rs755370377 0.00008
NM_007194.4(CHEK2):c.1111C>T (p.His371Tyr) rs531398630 0.00008
NM_007294.4(BRCA1):c.4644G>A (p.Thr1548=) rs28897692 0.00008
NM_020461.4(TUBGCP6):c.5263_5273dup (p.Arg1763fs) rs775659848 0.00008
NM_144997.7(FLCN):c.687C>T (p.Phe229=) rs754710935 0.00008
NM_000038.6(APC):c.7717A>G (p.Ile2573Val) rs145444830 0.00007
NM_000038.6(APC):c.8389A>G (p.Ser2797Gly) rs147287751 0.00007
NM_000051.4(ATM):c.2021A>G (p.His674Arg) rs201762714 0.00007
NM_000059.4(BRCA2):c.1167G>A (p.Pro389=) rs148607710 0.00007
NM_000059.4(BRCA2):c.1644G>A (p.Gln548=) rs55986646 0.00007
NM_000059.4(BRCA2):c.3568C>T (p.Arg1190Trp) rs80358604 0.00007
NM_000059.4(BRCA2):c.3839A>T (p.Asp1280Val) rs56337919 0.00007
NM_000059.4(BRCA2):c.8953+16C>T rs81002892 0.00007
NM_000179.3(MSH6):c.2384T>C (p.Ile795Thr) rs202127474 0.00007
NM_000249.4(MLH1):c.1379A>C (p.Glu460Ala) rs202038499 0.00007
NM_000249.4(MLH1):c.545+19G>T rs41285099 0.00007
NM_000249.4(MLH1):c.649C>T (p.Arg217Cys) rs4986984 0.00007
NM_000251.3(MSH2):c.1045C>G (p.Pro349Ala) rs267607939 0.00007
NM_000251.3(MSH2):c.1560A>G (p.Gly520=) rs63750820 0.00007
NM_000251.3(MSH2):c.2732T>G (p.Leu911Arg) rs41295182 0.00007
NM_000388.4(CASR):c.2356A>G (p.Ile786Val) rs371882068 0.00007
NM_000388.4(CASR):c.848T>C (p.Ile283Thr) rs142745096 0.00007
NM_000535.7(PMS2):c.230A>C (p.Glu77Ala) rs777095030 0.00007
NM_000535.7(PMS2):c.384G>A (p.Ser128=) rs371342884 0.00007
NM_002691.4(POLD1):c.1503C>T (p.Asn501=) rs371647100 0.00007
NM_002691.4(POLD1):c.2178G>C (p.Gln726His) rs747483140 0.00007
NM_004360.5(CDH1):c.1297G>A (p.Asp433Asn) rs199886166 0.00007
NM_004360.5(CDH1):c.1298A>G (p.Asp433Gly) rs376097289 0.00007
NM_006231.4(POLE):c.6111C>T (p.Ala2037=) rs541439106 0.00007
NM_007194.4(CHEK2):c.1421G>A (p.Arg474His) rs121908706 0.00007
NM_007294.4(BRCA1):c.1865C>T (p.Ala622Val) rs56039126 0.00007
NM_007294.4(BRCA1):c.5332+13G>T rs372391060 0.00007
NM_177438.3(DICER1):c.4050+8A>G rs746668314 0.00007
NM_000038.6(APC):c.1005A>G (p.Leu335=) rs3797704 0.00006
NM_000038.6(APC):c.5026A>G (p.Arg1676Gly) rs370560998 0.00006
NM_000038.6(APC):c.5140G>A (p.Asp1714Asn) rs148275069 0.00006
NM_000038.6(APC):c.7399C>A (p.Pro2467Thr) rs372305287 0.00006
NM_000038.6(APC):c.7929A>G (p.Leu2643=) rs138796072 0.00006
NM_000051.4(ATM):c.1010G>A (p.Arg337His) rs202160435 0.00006
NM_000051.4(ATM):c.610G>A (p.Gly204Arg) rs147915571 0.00006
NM_000059.4(BRCA2):c.1011C>T (p.Asn337=) rs41293473 0.00006
NM_000059.4(BRCA2):c.1362A>G (p.Lys454=) rs55919657 0.00006
NM_000059.4(BRCA2):c.1662T>G (p.Cys554Trp) rs80358451 0.00006
NM_000059.4(BRCA2):c.2490C>T (p.Asn830=) rs56331088 0.00006
NM_000059.4(BRCA2):c.3715A>G (p.Lys1239Glu) rs374191973 0.00006
NM_000059.4(BRCA2):c.4828G>A (p.Val1610Met) rs80358705 0.00006
NM_000059.4(BRCA2):c.6325G>A (p.Val2109Ile) rs79456940 0.00006
NM_000059.4(BRCA2):c.831T>G (p.Asn277Lys) rs28897705 0.00006
NM_000059.4(BRCA2):c.8662C>T (p.Arg2888Cys) rs80359123 0.00006
NM_000179.3(MSH6):c.1050C>T (p.Ala350=) rs730881802 0.00006
NM_000179.3(MSH6):c.178T>C (p.Leu60=) rs35819209 0.00006
NM_000179.3(MSH6):c.3986C>T (p.Ser1329Leu) rs199594809 0.00006
NM_000249.4(MLH1):c.1013A>G (p.Asn338Ser) rs63751467 0.00006
NM_000249.4(MLH1):c.1360G>C (p.Gly454Arg) rs63750527 0.00006
NM_000249.4(MLH1):c.1733A>G (p.Glu578Gly) rs63751612 0.00006
NM_000249.4(MLH1):c.2174G>A (p.Arg725His) rs566928243 0.00006
NM_000249.4(MLH1):c.955G>A (p.Glu319Lys) rs63750796 0.00006
NM_000251.3(MSH2):c.499G>C (p.Asp167His) rs63750255 0.00006
NM_000251.3(MSH2):c.944G>T (p.Gly315Val) rs202026056 0.00006
NM_000314.8(PTEN):c.720C>T (p.Tyr240=) rs190070312 0.00006
NM_000455.5(STK11):c.*16+12C>T rs730881966 0.00006
NM_000455.5(STK11):c.734+17C>G rs751929304 0.00006
NM_000455.5(STK11):c.992G>A (p.Arg331Gln) rs371264852 0.00006
NM_000535.7(PMS2):c.1145-10G>A rs533551639 0.00006
NM_000535.7(PMS2):c.1379G>A (p.Gly460Asp) rs150201462 0.00006
NM_000535.7(PMS2):c.477G>A (p.Val159=) rs147701251 0.00006
NM_000546.6(TP53):c.1015G>A (p.Glu339Lys) rs17882252 0.00006
NM_001040108.2(MLH3):c.2224C>T (p.Arg742Cys) rs774817891 0.00006
NM_001040108.2(MLH3):c.3312C>T (p.Ser1104=) rs149369905 0.00006
NM_001048174.2(MUTYH):c.305-13C>G rs201207780 0.00006
NM_001048174.2(MUTYH):c.461G>T (p.Arg154Leu) rs143353451 0.00006
NM_002439.5(MSH3):c.1258A>G (p.Ser420Gly) rs55660516 0.00006
NM_002691.4(POLD1):c.17G>A (p.Arg6Gln) rs778275831 0.00006
NM_002691.4(POLD1):c.1893-6A>C rs963949260 0.00006
NM_002691.4(POLD1):c.2700C>T (p.His900=) rs769965495 0.00006
NM_002691.4(POLD1):c.3218+5G>A rs569395274 0.00006
NM_002691.4(POLD1):c.651G>A (p.Pro217=) rs199622672 0.00006
NM_002878.4(RAD51D):c.145-4G>A rs201361465 0.00006
NM_003001.5(SDHC):c.179+10G>A rs532455044 0.00006
NM_004360.5(CDH1):c.1422C>T (p.Thr474=) rs375843744 0.00006
NM_004360.5(CDH1):c.393C>T (p.Ser131=) rs145430811 0.00006
NM_004655.4(AXIN2):c.1201-7C>T rs760667639 0.00006
NM_004655.4(AXIN2):c.1267C>T (p.Leu423Phe) rs376630432 0.00006
NM_004655.4(AXIN2):c.2237+3G>A rs376584101 0.00006
NM_004655.4(AXIN2):c.623C>T (p.Ala208Val) rs201531372 0.00006
NM_004656.4(BAP1):c.37+31G>C rs200628603 0.00006
NM_006231.4(POLE):c.1288G>A (p.Ala430Thr) rs140566004 0.00006
NM_006231.4(POLE):c.2468+12C>T rs776938447 0.00006
NM_007194.4(CHEK2):c.1023C>T (p.Asn341=) rs377668478 0.00006
NM_007194.4(CHEK2):c.1556G>T (p.Arg519Leu) rs587780180 0.00006
NM_007194.4(CHEK2):c.542G>A (p.Arg181His) rs121908701 0.00006
NM_007294.4(BRCA1):c.1534C>T (p.Leu512Phe) rs41286294 0.00006
NM_007294.4(BRCA1):c.1617G>A (p.Thr539=) rs372002119 0.00006
NM_007294.4(BRCA1):c.2412G>C (p.Gln804His) rs55746541 0.00006
NM_007294.4(BRCA1):c.2428A>T (p.Asn810Tyr) rs28897682 0.00006
NM_007294.4(BRCA1):c.301+7G>A rs80358113 0.00006
NM_007294.4(BRCA1):c.3608G>A (p.Arg1203Gln) rs55930959 0.00006
NM_007294.4(BRCA1):c.3739G>A (p.Val1247Ile) rs80357191 0.00006
NM_007294.4(BRCA1):c.4636G>A (p.Asp1546Asn) rs28897691 0.00006
NM_007294.4(BRCA1):c.5278-14C>G rs80358105 0.00006
NM_015450.3(POT1):c.939C>T (p.Asp313=) rs746756338 0.00006
NM_024675.4(PALB2):c.1001A>G (p.Tyr334Cys) rs200620434 0.00006
NM_032043.3(BRIP1):c.3103C>T (p.Arg1035Cys) rs45437094 0.00006
NM_058216.3(RAD51C):c.870T>A (p.Ile290=) rs376402418 0.00006
NM_000038.6(APC):c.1409-26T>G rs9282598 0.00005
NM_000038.6(APC):c.2438A>G (p.Asn813Ser) rs201522866 0.00005
NM_000051.4(ATM):c.2376+20G>C rs140364468 0.00005
NM_000051.4(ATM):c.7983T>C (p.Asp2661=) rs143972422 0.00005
NM_000059.4(BRCA2):c.2550A>G (p.Gln850=) rs80359785 0.00005
NM_000059.4(BRCA2):c.426-37T>A rs81002859 0.00005
NM_000059.4(BRCA2):c.5552T>G (p.Ile1851Ser) rs80358776 0.00005
NM_000059.4(BRCA2):c.750G>A (p.Val250=) rs143214959 0.00005
NM_000059.4(BRCA2):c.8525G>A (p.Arg2842His) rs80359105 0.00005
NM_000179.3(MSH6):c.147C>T (p.Ala49=) rs768803986 0.00005
NM_000179.3(MSH6):c.2239C>T (p.Leu747=) rs63751305 0.00005
NM_000179.3(MSH6):c.3852G>A (p.Thr1284=) rs2229018 0.00005
NM_000245.4(MET):c.100G>A (p.Glu34Lys) rs764246939 0.00005
NM_000245.4(MET):c.632T>G (p.Leu211Trp) rs45483396 0.00005
NM_000249.4(MLH1):c.438A>G (p.Gln146=) rs377279035 0.00005
NM_000455.5(STK11):c.465-18G>T rs587781177 0.00005
NM_000455.5(STK11):c.465-5C>T rs567202367 0.00005
NM_000455.5(STK11):c.920+6C>T rs730881964 0.00005
NM_000465.4(BARD1):c.738A>G (p.Pro246=) rs587780859 0.00005
NM_000546.6(TP53):c.782+12C>T rs17881780 0.00005
NM_002691.4(POLD1):c.1322C>T (p.Thr441Met) rs376711125 0.00005
NM_004360.5(CDH1):c.699C>T (p.His233=) rs115494727 0.00005
NM_004655.4(AXIN2):c.2140C>T (p.Arg714Trp) rs148765149 0.00005
NM_006231.4(POLE):c.5253C>T (p.Ala1751=) rs765888059 0.00005
NM_006231.4(POLE):c.6668A>G (p.Lys2223Arg) rs367970442 0.00005
NM_007294.4(BRCA1):c.1974G>C (p.Met658Ile) rs55678461 0.00005
NM_007294.4(BRCA1):c.5117G>C (p.Gly1706Ala) rs80356860 0.00005
NM_007294.4(BRCA1):c.670+16G>A rs199916228 0.00005
NM_017763.6(RNF43):c.1556G>A (p.Arg519Gln) rs200166143 0.00005
NM_024675.4(PALB2):c.2442G>A (p.Glu814=) rs140776736 0.00005
NM_000038.6(APC):c.1762G>A (p.Val588Ile) rs372416031 0.00004
NM_000038.6(APC):c.3245C>G (p.Thr1082Ser) rs730881244 0.00004
NM_000038.6(APC):c.4073C>T (p.Ala1358Val) rs730881249 0.00004
NM_000038.6(APC):c.449A>G (p.Lys150Arg) rs371085910 0.00004
NM_000038.6(APC):c.5894A>C (p.His1965Pro) rs773776516 0.00004
NM_000038.6(APC):c.6019T>C (p.Tyr2007His) rs745811356 0.00004
NM_000038.6(APC):c.6135C>T (p.Ser2045=) rs187297940 0.00004
NM_000038.6(APC):c.6682A>G (p.Arg2228Gly) rs199648202 0.00004
NM_000038.6(APC):c.7402T>C (p.Ser2468Pro) rs375586273 0.00004
NM_000038.6(APC):c.8061A>G (p.Ser2687=) rs746180965 0.00004
NM_000038.6(APC):c.8261G>A (p.Ser2754Asn) rs369721828 0.00004
NM_000051.4(ATM):c.-18G>A rs374303671 0.00004
NM_000051.4(ATM):c.1888G>A (p.Val630Met) rs148191382 0.00004
NM_000051.4(ATM):c.2040C>T (p.Phe680=) rs587780855 0.00004
NM_000051.4(ATM):c.3577-6G>A rs56006345 0.00004
NM_000051.4(ATM):c.6101G>A (p.Arg2034Gln) rs3218670 0.00004
NM_000051.4(ATM):c.6114C>T (p.His2038=) rs774993357 0.00004
NM_000059.4(BRCA2):c.2987T>G (p.Leu996Arg) rs80358545 0.00004
NM_000059.4(BRCA2):c.4570T>G (p.Phe1524Val) rs56386506 0.00004
NM_000059.4(BRCA2):c.6290C>T (p.Thr2097Met) rs80358866 0.00004
NM_000059.4(BRCA2):c.8918G>A (p.Arg2973His) rs80359143 0.00004
NM_000077.5(CDKN2A):c.197A>G (p.His66Arg) rs756750256 0.00004
NM_000077.5(CDKN2A):c.405G>A (p.Gly135=) rs751586391 0.00004
NM_000128.4(F11):c.400C>T (p.Gln134Ter) rs756908183 0.00004
NM_000143.4(FH):c.-3A>G rs202145941 0.00004
NM_000143.4(FH):c.302G>A (p.Arg101Gln) rs75086406 0.00004
NM_000179.3(MSH6):c.2904C>G (p.Val968=) rs150683226 0.00004
NM_000179.3(MSH6):c.3557-3A>T rs41295274 0.00004
NM_000179.3(MSH6):c.3729A>G (p.Thr1243=) rs773807182 0.00004
NM_000249.4(MLH1):c.1269G>A (p.Arg423=) rs373076967 0.00004
NM_000249.4(MLH1):c.1565G>A (p.Arg522Gln) rs63751630 0.00004
NM_000249.4(MLH1):c.794G>A (p.Arg265His) rs63751448 0.00004
NM_000251.3(MSH2):c.2211-6C>A rs267608003 0.00004
NM_000400.4(ERCC2):c.1459C>T (p.Arg487Trp) rs562132292 0.00004
NM_000455.5(STK11):c.42G>A (p.Glu14=) rs758769888 0.00004
NM_000455.5(STK11):c.651G>A (p.Pro217=) rs368348370 0.00004
NM_000455.5(STK11):c.723T>C (p.Ala241=) rs533550278 0.00004
NM_000465.4(BARD1):c.253G>T (p.Val85Leu) rs370359540 0.00004
NM_000465.4(BARD1):c.783A>G (p.Leu261=) rs201862973 0.00004
NM_000535.7(PMS2):c.*17G>C rs556089649 0.00004
NM_000535.7(PMS2):c.1A>G (p.Met1Val) rs587779333 0.00004
NM_000535.7(PMS2):c.2356C>A (p.Leu786Met) rs576055272 0.00004
NM_000535.7(PMS2):c.831G>A (p.Thr277=) rs116481522 0.00004
NM_000546.6(TP53):c.255T>C (p.Pro85=) rs775515332 0.00004
NM_000546.6(TP53):c.554G>A (p.Ser185Asn) rs150607408 0.00004
NM_000546.6(TP53):c.642T>G (p.His214Gln) rs587781386 0.00004
NM_000546.6(TP53):c.998G>A (p.Arg333His) rs573154688 0.00004
NM_001040108.2(MLH3):c.3723C>T (p.Tyr1241=) rs145627040 0.00004
NM_001048174.2(MUTYH):c.305-6C>T rs376600220 0.00004
NM_001048174.2(MUTYH):c.87C>T (p.Asn29=) rs141679570 0.00004
NM_001048174.2(MUTYH):c.954G>A (p.Ser318=) rs372673338 0.00004
NM_002528.7(NTHL1):c.354+4G>T rs771353497 0.00004
NM_002691.4(POLD1):c.2429C>T (p.Ala810Val) rs765981178 0.00004
NM_002878.4(RAD51D):c.796C>T (p.Arg266Cys) rs587781813 0.00004
NM_003000.3(SDHB):c.552C>T (p.Tyr184=) rs202098600 0.00004
NM_003001.5(SDHC):c.490A>T (p.Met164Leu) rs200375156 0.00004
NM_004329.3(BMPR1A):c.1474-10T>C rs369633360 0.00004
NM_004360.5(CDH1):c.1224G>A (p.Ala408=) rs200161607 0.00004
NM_004360.5(CDH1):c.2280C>T (p.Gly760=) rs768547540 0.00004
NM_004360.5(CDH1):c.2387G>A (p.Arg796Gln) rs587782549 0.00004
NM_004360.5(CDH1):c.2494G>A (p.Val832Met) rs35572355 0.00004
NM_004360.5(CDH1):c.84C>T (p.Cys28=) rs587780789 0.00004
NM_004655.4(AXIN2):c.2083G>T (p.Ala695Ser) rs140510381 0.00004
NM_004656.4(BAP1):c.878C>T (p.Pro293Leu) rs777664260 0.00004
NM_005359.6(SMAD4):c.228A>G (p.Arg76=) rs587780556 0.00004
NM_006231.4(POLE):c.1357C>G (p.Gln453Glu) rs781360770 0.00004
NM_006231.4(POLE):c.155G>A (p.Arg52Gln) rs372459649 0.00004
NM_006231.4(POLE):c.3275+16A>G rs5744858 0.00004
NM_006231.4(POLE):c.330+3G>A rs369152225 0.00004
NM_006231.4(POLE):c.5174-6G>C rs770466844 0.00004
NM_006231.4(POLE):c.6135C>T (p.Pro2045=) rs368662693 0.00004
NM_006231.4(POLE):c.6445C>T (p.Arg2149Cys) rs771490182 0.00004
NM_006231.4(POLE):c.6539C>T (p.Ala2180Val) rs552452448 0.00004
NM_006516.4(SLC2A1):c.179C>T (p.Thr60Met) rs142986731 0.00004
NM_007194.4(CHEK2):c.1336A>G (p.Asn446Asp) rs121908705 0.00004
NM_007294.4(BRCA1):c.1616C>T (p.Thr539Met) rs80357374 0.00004
NM_007294.4(BRCA1):c.2351C>T (p.Ser784Leu) rs55914168 0.00004
NM_007294.4(BRCA1):c.4036G>A (p.Glu1346Lys) rs80357407 0.00004
NM_007294.4(BRCA1):c.427G>A (p.Glu143Lys) rs80356991 0.00004
NM_007294.4(BRCA1):c.4357+17A>G rs80358180 0.00004
NM_007294.4(BRCA1):c.446A>C (p.Glu149Ala) rs397507233 0.00004
NM_007294.4(BRCA1):c.4625C>G (p.Ser1542Cys) rs41293457 0.00004
NM_007294.4(BRCA1):c.4676-8C>G rs80358021 0.00004
NM_007294.4(BRCA1):c.4729T>C (p.Ser1577Pro) rs80356909 0.00004
NM_007294.4(BRCA1):c.5252G>A (p.Arg1751Gln) rs80357442 0.00004
NM_007294.4(BRCA1):c.75C>T (p.Pro25=) rs80356839 0.00004
NM_015450.3(POT1):c.1793-25G>A rs575804706 0.00004
NM_024675.4(PALB2):c.1699C>T (p.His567Tyr) rs370422990 0.00004
NM_024675.4(PALB2):c.194C>T (p.Pro65Leu) rs62625272 0.00004
NM_024675.4(PALB2):c.2289G>C (p.Leu763Phe) rs373478248 0.00004
NM_032043.3(BRIP1):c.297C>T (p.Asp99=) rs201617644 0.00004
NM_058216.3(RAD51C):c.1062A>G (p.Ala354=) rs201000407 0.00004
NM_058216.3(RAD51C):c.774del (p.Thr259fs) rs754367349 0.00004
NM_144997.7(FLCN):c.1300+12C>T rs565983064 0.00004
NM_177438.3(DICER1):c.4554T>A (p.Val1518=) rs752773026 0.00004
NM_000038.6(APC):c.756C>T (p.Thr252=) rs771535363 0.00003
NM_000038.6(APC):c.757G>A (p.Gly253Ser) rs772806807 0.00003
NM_000051.4(ATM):c.496+18T>A rs762171014 0.00003
NM_000051.4(ATM):c.6888A>T (p.Ala2296=) rs200735689 0.00003
NM_000059.4(BRCA2):c.1744A>C (p.Thr582Pro) rs80358457 0.00003
NM_000059.4(BRCA2):c.316+12A>G rs186419778 0.00003
NM_000059.4(BRCA2):c.3462C>T (p.Thr1154=) rs4986856 0.00003
NM_000059.4(BRCA2):c.3910A>G (p.Thr1304Ala) rs28897723 0.00003
NM_000059.4(BRCA2):c.6275_6276del (p.Leu2092fs) rs11571658 0.00003
NM_000059.4(BRCA2):c.6935A>T (p.Asp2312Val) rs80358916 0.00003
NM_000059.4(BRCA2):c.6938-26T>C rs774079948 0.00003
NM_000059.4(BRCA2):c.8010G>A (p.Ser2670=) rs146430937 0.00003
NM_000059.4(BRCA2):c.9256+28T>A rs779846458 0.00003
NM_000179.3(MSH6):c.4002-14T>C rs587781041 0.00003
NM_000249.4(MLH1):c.453+20G>T rs759417195 0.00003
NM_000251.3(MSH2):c.2120G>A (p.Cys707Tyr) rs373226409 0.00003
NM_000251.3(MSH2):c.2205C>T (p.Ile735=) rs533553381 0.00003
NM_000251.3(MSH2):c.835C>G (p.Leu279Val) rs375351205 0.00003
NM_000298.6(PKLR):c.401T>A (p.Val134Asp) rs574051756 0.00003
NM_000314.8(PTEN):c.1061C>A (p.Pro354Gln) rs375709098 0.00003
NM_000455.5(STK11):c.552C>T (p.Leu184=) rs587780719 0.00003
NM_000455.5(STK11):c.615G>A (p.Ala205=) rs532889728 0.00003
NM_000465.4(BARD1):c.1028C>T (p.Thr343Ile) rs201032007 0.00003
NM_000465.4(BARD1):c.568G>A (p.Asp190Asn) rs369561166 0.00003
NM_000535.7(PMS2):c.2113G>A (p.Glu705Lys) rs267608161 0.00003
NM_000535.7(PMS2):c.751G>A (p.Val251Met) rs142434011 0.00003
NM_000535.7(PMS2):c.883C>T (p.Arg295Trp) rs182246929 0.00003
NM_000546.6(TP53):c.509C>T (p.Thr170Met) rs779000871 0.00003
NM_000546.6(TP53):c.903A>G (p.Pro301=) rs72661120 0.00003
NM_001354604.2(MITF):c.1179+4C>T rs749869303 0.00003
NM_001354604.2(MITF):c.1569G>A (p.Glu523=) rs200830148 0.00003
NM_001385012.1(NBEA):c.73G>A (p.Ala25Thr) rs1363004176 0.00003
NM_002439.5(MSH3):c.582C>G (p.Asp194Glu) rs749446559 0.00003
NM_002691.4(POLD1):c.841-10A>G rs140160345 0.00003
NM_003000.3(SDHB):c.-6G>A rs2295056 0.00003
NM_004360.5(CDH1):c.1161C>T (p.Asn387=) rs111266450 0.00003
NM_004360.5(CDH1):c.1417G>A (p.Val473Ile) rs36087757 0.00003
NM_004360.5(CDH1):c.2331C>T (p.Asp777=) rs114265540 0.00003
NM_004360.5(CDH1):c.304G>A (p.Ala102Thr) rs368492235 0.00003
NM_004360.5(CDH1):c.499G>A (p.Glu167Lys) rs769076258 0.00003
NM_004655.4(AXIN2):c.2405+4A>G rs377423720 0.00003
NM_006231.4(POLE):c.-47G>T rs1014146082 0.00003
NM_006231.4(POLE):c.2271C>T (p.Thr757=) rs765532123 0.00003
NM_006231.4(POLE):c.3582+5C>T rs775661457 0.00003
NM_007194.4(CHEK2):c.1133C>T (p.Thr378Ile) rs587780167 0.00003
NM_007194.4(CHEK2):c.917G>C (p.Gly306Ala) rs587780192 0.00003
NM_007294.4(BRCA1):c.1881C>G (p.Val627=) rs80356838 0.00003
NM_007294.4(BRCA1):c.2123C>A (p.Ser708Tyr) rs80357182 0.00003
NM_007294.4(BRCA1):c.5347A>C (p.Met1783Leu) rs80357012 0.00003
NM_007294.4(BRCA1):c.612G>C (p.Leu204Phe) rs80357394 0.00003
NM_007294.4(BRCA1):c.671-8A>G rs80358144 0.00003
NM_007294.4(BRCA1):c.811G>A (p.Val271Met) rs80357244 0.00003
NM_017763.6(RNF43):c.1948C>T (p.Arg650Ter) rs371553160 0.00003
NM_020975.6(RET):c.3185A>G (p.Tyr1062Cys) rs587778659 0.00003
NM_032043.3(BRIP1):c.2748C>T (p.Tyr916=) rs555200296 0.00003
NM_032043.3(BRIP1):c.728T>C (p.Ile243Thr) rs587781860 0.00003
NM_058216.3(RAD51C):c.905-19T>C rs368114768 0.00003
NM_000038.6(APC):c.1554G>A (p.Thr518=) rs546568052 0.00002
NM_000038.6(APC):c.4310A>G (p.Lys1437Arg) rs745825088 0.00002
NM_000038.6(APC):c.6512G>A (p.Gly2171Glu) rs748745776 0.00002
NM_000038.6(APC):c.6539A>G (p.Lys2180Arg) rs762955111 0.00002
NM_000038.6(APC):c.7821C>T (p.Ser2607=) rs532235331 0.00002
NM_000038.6(APC):c.8199A>G (p.Gln2733=) rs372365378 0.00002
NM_000051.4(ATM):c.2159G>A (p.Arg720His) rs55830714 0.00002
NM_000051.4(ATM):c.3219A>G (p.Val1073=) rs752849892 0.00002
NM_000059.4(BRCA2):c.10089A>G (p.Ile3363Met) rs80358390 0.00002
NM_000059.4(BRCA2):c.10202C>T (p.Thr3401Met) rs55853199 0.00002
NM_000059.4(BRCA2):c.167A>C (p.Asn56Thr) rs80358454 0.00002
NM_000059.4(BRCA2):c.179A>G (p.Asn60Ser) rs80358463 0.00002
NM_000059.4(BRCA2):c.1804G>A (p.Gly602Arg) rs80358466 0.00002
NM_000059.4(BRCA2):c.2944A>C (p.Ile982Leu) rs28897717 0.00002
NM_000059.4(BRCA2):c.3310A>C (p.Thr1104Pro) rs80358577 0.00002
NM_000059.4(BRCA2):c.353G>A (p.Arg118His) rs80358603 0.00002
NM_000059.4(BRCA2):c.3916G>A (p.Val1306Ile) rs80358636 0.00002
NM_000059.4(BRCA2):c.7413A>G (p.Thr2471=) rs138067005 0.00002
NM_000059.4(BRCA2):c.7534C>T (p.Leu2512Phe) rs80358980 0.00002
NM_000059.4(BRCA2):c.800G>A (p.Gly267Glu) rs80359036 0.00002
NM_000059.4(BRCA2):c.8331+16C>G rs730881595 0.00002
NM_000059.4(BRCA2):c.8360G>A (p.Arg2787His) rs80359078 0.00002
NM_000059.4(BRCA2):c.9285C>T (p.Asp3095=) rs80359198 0.00002
NM_000077.5(CDKN2A):c.198C>T (p.His66=) rs374984975 0.00002
NM_000179.3(MSH6):c.3226C>T (p.Arg1076Cys) rs63750617 0.00002
NM_000249.4(MLH1):c.303T>G (p.Gly101=) rs4647220 0.00002
NM_000249.4(MLH1):c.595G>C (p.Glu199Gln) rs63749887 0.00002
NM_000251.3(MSH2):c.1276+7A>G rs748554540 0.00002
NM_000251.3(MSH2):c.2635-11A>G rs201291595 0.00002
NM_000455.5(STK11):c.-9G>A rs770466669 0.00002
NM_000455.5(STK11):c.1109-14C>T rs780434041 0.00002
NM_000546.6(TP53):c.466C>T (p.Arg156Cys) rs563378859 0.00002
NM_000546.6(TP53):c.582T>C (p.Leu194=) rs370216745 0.00002
NM_000546.6(TP53):c.743G>A (p.Arg248Gln) rs11540652 0.00002
NM_001040108.2(MLH3):c.4289G>A (p.Arg1430His) rs760305520 0.00002
NM_001048174.2(MUTYH):c.460C>T (p.Arg154Cys) rs747993448 0.00002
NM_002691.4(POLD1):c.258G>A (p.Ala86=) rs200687128 0.00002
NM_002691.4(POLD1):c.3219-4G>A rs756232002 0.00002
NM_002878.4(RAD51D):c.620C>T (p.Ser207Leu) rs370228071 0.00002
NM_004360.5(CDH1):c.388-8C>T rs774601444 0.00002
NM_006231.4(POLE):c.3913G>A (p.Gly1305Arg) rs563990655 0.00002
NM_006231.4(POLE):c.910-5G>A rs750101293 0.00002
NM_007294.4(BRCA1):c.3657G>C (p.Glu1219Asp) rs80356876 0.00002
NM_007294.4(BRCA1):c.5074+6C>G rs80358032 0.00002
NM_007294.4(BRCA1):c.509G>A (p.Arg170Gln) rs80357264 0.00002
NM_007294.4(BRCA1):c.5334T>C (p.Asp1778=) rs754152768 0.00002
NM_024675.4(PALB2):c.1767G>A (p.Thr589=) rs769849072 0.00002
NM_024675.4(PALB2):c.2228A>G (p.Tyr743Cys) rs141749524 0.00002
NM_024675.4(PALB2):c.2903C>G (p.Ala968Gly) rs369132015 0.00002
NM_032043.3(BRIP1):c.1433A>G (p.His478Arg) rs45501097 0.00002
NM_032043.3(BRIP1):c.2804T>G (p.Val935Gly) rs4988356 0.00002
NM_032043.3(BRIP1):c.778A>G (p.Thr260Ala) rs138743097 0.00002
NM_058216.3(RAD51C):c.706-2A>G rs587780259 0.00002
NM_000038.6(APC):c.3161A>C (p.His1054Pro) rs777538550 0.00001
NM_000038.6(APC):c.3313C>T (p.Arg1105Trp) rs768454793 0.00001
NM_000038.6(APC):c.3323A>G (p.Asn1108Ser) rs151286353 0.00001
NM_000038.6(APC):c.3378C>G (p.Ser1126Arg) rs149353082 0.00001
NM_000038.6(APC):c.5712A>G (p.Gln1904=) rs755851369 0.00001
NM_000038.6(APC):c.5805G>A (p.Gln1935=) rs377040690 0.00001
NM_000038.6(APC):c.6948A>G (p.Pro2316=) rs202144406 0.00001
NM_000038.6(APC):c.933+5C>A rs573528468 0.00001
NM_000051.4(ATM):c.332-1G>A rs747855862 0.00001
NM_000051.4(ATM):c.3576G>A (p.Lys1192=) rs587776551 0.00001
NM_000051.4(ATM):c.4612-4T>G rs569983068 0.00001
NM_000051.4(ATM):c.5674+6C>G rs780204400 0.00001
NM_000051.4(ATM):c.6681C>T (p.Arg2227=) rs775850434 0.00001
NM_000051.4(ATM):c.7502A>G (p.Asn2501Ser) rs531617441 0.00001
NM_000051.4(ATM):c.8532T>C (p.Ile2844=) rs730881278 0.00001
NM_000051.4(ATM):c.8730C>G (p.Leu2910=) rs551041839 0.00001
NM_000059.4(BRCA2):c.10076A>G (p.Glu3359Gly) rs80358389 0.00001
NM_000059.4(BRCA2):c.116C>T (p.Ala39Val) rs398122724 0.00001
NM_000059.4(BRCA2):c.1466C>G (p.Ser489Cys) rs587782535 0.00001
NM_000059.4(BRCA2):c.1550A>G (p.Asn517Ser) rs80358439 0.00001
NM_000059.4(BRCA2):c.2416G>C (p.Asp806His) rs56404215 0.00001
NM_000059.4(BRCA2):c.2771A>T (p.Asn924Ile) rs80358530 0.00001
NM_000059.4(BRCA2):c.2924T>A (p.Ile975Asn) rs398122756 0.00001
NM_000059.4(BRCA2):c.3101T>C (p.Ile1034Thr) rs545974734 0.00001
NM_000059.4(BRCA2):c.441A>G (p.Gln147=) rs80358676 0.00001
NM_000059.4(BRCA2):c.5529A>C (p.Ala1843=) rs372951842 0.00001
NM_000059.4(BRCA2):c.6231G>C (p.Lys2077Asn) rs541826447 0.00001
NM_000059.4(BRCA2):c.6437A>G (p.Asn2146Ser) rs768512381 0.00001
NM_000059.4(BRCA2):c.6443C>A (p.Ser2148Tyr) rs80358880 0.00001
NM_000059.4(BRCA2):c.6458C>T (p.Pro2153Leu) rs276174873 0.00001
NM_000059.4(BRCA2):c.6772G>A (p.Glu2258Lys) rs730881549 0.00001
NM_000059.4(BRCA2):c.682-13A>G rs81002888 0.00001
NM_000059.4(BRCA2):c.6943A>C (p.Ile2315Leu) rs80358918 0.00001
NM_000059.4(BRCA2):c.7055C>T (p.Pro2352Leu) rs80358934 0.00001
NM_000059.4(BRCA2):c.7436-4A>G rs81002904 0.00001
NM_000059.4(BRCA2):c.7759C>T (p.Leu2587Phe) rs56335340 0.00001
NM_000059.4(BRCA2):c.7878G>C (p.Trp2626Cys) rs80359013 0.00001
NM_000059.4(BRCA2):c.7992T>A (p.Ile2664=) rs80359800 0.00001
NM_000059.4(BRCA2):c.8117A>G (p.Asn2706Ser) rs80359055 0.00001
NM_000059.4(BRCA2):c.8351G>A (p.Arg2784Gln) rs80359076 0.00001
NM_000059.4(BRCA2):c.909T>G (p.Ser303=) rs757430441 0.00001
NM_000059.4(BRCA2):c.9205T>C (p.Cys3069Arg) rs398122611 0.00001
NM_000059.4(BRCA2):c.9242T>C (p.Val3081Ala) rs80359189 0.00001
NM_000059.4(BRCA2):c.927A>G (p.Ser309=) rs80359806 0.00001
NM_000059.4(BRCA2):c.9509A>G (p.Asp3170Gly) rs80359224 0.00001
NM_000059.4(BRCA2):c.971G>C (p.Arg324Thr) rs397507435 0.00001
NM_000059.4(BRCA2):c.9735A>G (p.Ser3245=) rs773112850 0.00001
NM_000059.4(BRCA2):c.987G>A (p.Arg329=) rs561002197 0.00001
NM_000143.4(FH):c.1048C>T (p.Arg350Trp) rs755436052 0.00001
NM_000143.4(FH):c.151C>T (p.Arg51Trp) rs778678782 0.00001
NM_000143.4(FH):c.648T>A (p.Asp216Glu) rs199536615 0.00001
NM_000143.4(FH):c.655G>A (p.Asp219Asn) rs11545656 0.00001
NM_000179.3(MSH6):c.3801+6T>C rs749922503 0.00001
NM_000179.3(MSH6):c.3879T>C (p.Ala1293=) rs752369374 0.00001
NM_000179.3(MSH6):c.4002-8A>C rs778957100 0.00001
NM_000251.3(MSH2):c.2006-4G>A rs369853630 0.00001
NM_000251.3(MSH2):c.2211-7G>A rs764972956 0.00001
NM_000314.8(PTEN):c.210-9T>C rs751744545 0.00001
NM_000342.3(SLC4A1):c.1462G>A (p.Val488Met) rs28931584 0.00001
NM_000388.4(CASR):c.1189G>A (p.Gly397Arg) rs1064794291 0.00001
NM_000388.4(CASR):c.40A>G (p.Thr14Ala) rs199515839 0.00001
NM_000455.5(STK11):c.1039G>A (p.Ala347Thr) rs369744528 0.00001
NM_000455.5(STK11):c.559G>A (p.Gly187Ser) rs587782032 0.00001
NM_000455.5(STK11):c.765C>T (p.Phe255=) rs769912677 0.00001
NM_000455.5(STK11):c.921-8G>A rs863224362 0.00001
NM_000535.7(PMS2):c.-18G>C rs200624125 0.00001
NM_000535.7(PMS2):c.1674C>T (p.Thr558=) rs876658134 0.00001
NM_000546.6(TP53):c.221C>T (p.Ala74Val) rs587781832 0.00001
NM_000546.6(TP53):c.542G>A (p.Arg181His) rs397514495 0.00001
NM_000546.6(TP53):c.572C>G (p.Pro191Arg) rs587778718 0.00001
NM_000546.6(TP53):c.919+7A>C rs199527475 0.00001
NM_000551.4(VHL):c.-35G>A rs587780992 0.00001
NM_000551.4(VHL):c.340+770T>C rs1346312258 0.00001
NM_000552.5(VWF):c.3390C>T (p.Cys1130=) rs1591865617 0.00001
NM_001040108.2(MLH3):c.3784C>T (p.Pro1262Ser) rs372912259 0.00001
NM_001048174.2(MUTYH):c.1102+1G>A rs587781337 0.00001
NM_001048174.2(MUTYH):c.800C>T (p.Pro267Leu) rs374950566 0.00001
NM_001126108.2(SLC12A3):c.2660G>A (p.Arg887Gln) rs369360334 0.00001
NM_002439.5(MSH3):c.2436-3T>C rs374901174 0.00001
NM_002439.5(MSH3):c.909G>C (p.Lys303Asn) rs757164724 0.00001
NM_002528.7(NTHL1):c.-1C>T rs532310992 0.00001
NM_002528.7(NTHL1):c.621G>A (p.Pro207=) rs745383145 0.00001
NM_002691.4(POLD1):c.1608G>A (p.Ala536=) rs568549476 0.00001
NM_002691.4(POLD1):c.2250+3C>T rs779097933 0.00001
NM_002691.4(POLD1):c.2327G>A (p.Arg776Gln) rs141801845 0.00001
NM_002691.4(POLD1):c.2599G>A (p.Val867Ile) rs367680864 0.00001
NM_002691.4(POLD1):c.3231C>T (p.Pro1077=) rs770660636 0.00001
NM_003000.3(SDHB):c.143A>T (p.Asp48Val) rs202101384 0.00001
NM_003000.3(SDHB):c.689G>A (p.Arg230His) rs587782604 0.00001
NM_003001.5(SDHC):c.148C>T (p.Arg50Cys) rs587778661 0.00001
NM_004329.3(BMPR1A):c.1536C>T (p.Leu512=) rs758796892 0.00001
NM_004329.3(BMPR1A):c.230+37G>A rs201927554 0.00001
NM_004360.5(CDH1):c.27G>A (p.Ser9=) rs786201257 0.00001
NM_004360.5(CDH1):c.604G>A (p.Val202Ile) rs546716073 0.00001
NM_004360.5(CDH1):c.870C>T (p.Asp290=) rs755215407 0.00001
NM_004655.4(AXIN2):c.13A>G (p.Met5Val) rs148691166 0.00001
NM_004655.4(AXIN2):c.1962C>A (p.Gly654=) rs377642903 0.00001
NM_006231.4(POLE):c.4236C>T (p.Asn1412=) rs377245595 0.00001
NM_006231.4(POLE):c.4490A>G (p.Lys1497Arg) rs557957962 0.00001
NM_006231.4(POLE):c.5361del (p.Cys1788fs) rs752558475 0.00001
NM_006231.4(POLE):c.5812-1G>T rs1296022681 0.00001
NM_006231.4(POLE):c.90G>A (p.Ser30=) rs369224511 0.00001
NM_006563.5(KLF1):c.954G>C (p.Trp318Cys) rs769526751 0.00001
NM_007194.4(CHEK2):c.1036C>T (p.Arg346Cys) rs201206424 0.00001
NM_007194.4(CHEK2):c.1260-1G>A rs786201906 0.00001
NM_007194.4(CHEK2):c.1420C>T (p.Arg474Cys) rs540635787 0.00001
NM_007194.4(CHEK2):c.1452G>A (p.Pro484=) rs749156425 0.00001
NM_007194.4(CHEK2):c.1593G>A (p.Glu531=) rs758555487 0.00001
NM_007194.4(CHEK2):c.683+9T>C rs1060504691 0.00001
NM_007294.4(BRCA1):c.1333G>C (p.Glu445Gln) rs80356915 0.00001
NM_007294.4(BRCA1):c.230C>T (p.Thr77Met) rs80357209 0.00001
NM_007294.4(BRCA1):c.2597G>A (p.Arg866His) rs80356911 0.00001
NM_007294.4(BRCA1):c.3327A>C (p.Lys1109Asn) rs41293449 0.00001
NM_007294.4(BRCA1):c.3416G>T (p.Ser1139Ile) rs80357228 0.00001
NM_007294.4(BRCA1):c.3541G>A (p.Val1181Ile) rs56336919 0.00001
NM_007294.4(BRCA1):c.4204C>T (p.His1402Tyr) rs80357365 0.00001
NM_007294.4(BRCA1):c.4357+14G>T rs760989937 0.00001
NM_007294.4(BRCA1):c.4689C>G (p.Tyr1563Ter) rs80357433 0.00001
NM_007294.4(BRCA1):c.508C>T (p.Arg170Trp) rs80357325 0.00001
NM_007294.4(BRCA1):c.5096G>A (p.Arg1699Gln) rs41293459 0.00001
NM_007294.4(BRCA1):c.5153-13A>G rs45471406 0.00001
NM_007294.4(BRCA1):c.5412C>T (p.Val1804=) rs730881456 0.00001
NM_015450.3(POT1):c.1369+10T>A rs773549874 0.00001
NM_024675.4(PALB2):c.1697G>A (p.Arg566His) rs144617793 0.00001
NM_024675.4(PALB2):c.2277A>G (p.Gln759=) rs786202524 0.00001
NM_024675.4(PALB2):c.2456A>G (p.Lys819Arg) rs587778585 0.00001
NM_024675.4(PALB2):c.2505C>T (p.Ser835=) rs756502783 0.00001
NM_024675.4(PALB2):c.2922G>T (p.Lys974Asn) rs730881892 0.00001
NM_024675.4(PALB2):c.315G>C (p.Glu105Asp) rs515726108 0.00001
NM_024675.4(PALB2):c.495C>T (p.Gly165=) rs200937538 0.00001
NM_032043.3(BRIP1):c.1455T>C (p.Ala485=) rs773489367 0.00001
NM_032043.3(BRIP1):c.1473+6A>G rs587780827 0.00001
NM_032043.3(BRIP1):c.1474-3T>C rs552752779 0.00001
NM_032043.3(BRIP1):c.627+5G>A rs745727200 0.00001
NM_058195.4(CDKN2A):c.-39G>A rs1064793537 0.00001
NM_058216.3(RAD51C):c.905-2_905-1del rs587781995 0.00001
NM_058216.3(RAD51C):c.905-2del rs876658652 0.00001
NM_144997.7(FLCN):c.1227C>T (p.Tyr409=) rs561236067 0.00001
NM_177438.3(DICER1):c.5529A>G (p.Glu1843=) rs768311617 0.00001
NM_177438.3(DICER1):c.884C>G (p.Ser295Cys) rs548231008 0.00001
NM_000038.6(APC):c.259C>T (p.Leu87=) rs569640184
NM_000038.6(APC):c.3462AGA[2] (p.Glu1157del) rs386833391
NM_000038.6(APC):c.423-17dup rs35031194
NM_000038.6(APC):c.423-4del rs730881230
NM_000038.6(APC):c.423-4dup rs730881230
NM_000038.6(APC):c.4702GAT[3] (p.Asp1571del) rs587782888
NM_000038.6(APC):c.4765C>G (p.Arg1589Gly) rs72541813
NM_000038.6(APC):c.5421CAA[1] (p.Asn1808del) rs587782002
NM_000038.6(APC):c.6354TGC[5] (p.Ala2122dup) rs587780602
NM_000038.6(APC):c.6493C>A (p.Pro2165Thr) rs775501375
NM_000038.6(APC):c.6907G>A (p.Gly2303Arg) rs544549596
NM_000051.4(ATM):c.1066-31dup rs35813860
NM_000051.4(ATM):c.1236-3del rs34325032
NM_000051.4(ATM):c.1236-3dup rs34325032
NM_000051.4(ATM):c.1236-4_1236-3del rs34325032
NM_000051.4(ATM):c.1236-4_1236-3dup rs34325032
NM_000051.4(ATM):c.1898+2T>G rs587782124
NM_000051.4(ATM):c.2442C>A (p.Asp814Glu) rs3218695
NM_000051.4(ATM):c.2639-27_2639-22del rs4987971
NM_000051.4(ATM):c.2805G>C (p.Thr935=) rs55934812
NM_000051.4(ATM):c.2922-8del rs373881770
NM_000051.4(ATM):c.2922-9_2922-8del
NM_000051.4(ATM):c.3154-4G>A rs199543313
NM_000051.4(ATM):c.3994-11_3994-4del rs1060501665
NM_000051.4(ATM):c.4179C>A (p.Ile1393=) rs775688446
NM_000051.4(ATM):c.478_482del (p.Ser160fs) rs587780624
NM_000051.4(ATM):c.497-4del rs768748099
NM_000051.4(ATM):c.497-4dup rs768748099
NM_000051.4(ATM):c.6347+31dup rs58978479
NM_000051.4(ATM):c.7516-9del rs573494809
NM_000051.4(ATM):c.7516-9dup rs573494809
NM_000051.4(ATM):c.8395_8404del (p.Phe2799fs) rs786202800
NM_000059.4(BRCA2):c.1166C>A (p.Pro389Gln) rs397507263
NM_000059.4(BRCA2):c.1545T>G (p.Thr515=) rs786202158
NM_000059.4(BRCA2):c.162CAA[1] (p.Asn56del) rs11571587
NM_000059.4(BRCA2):c.1773_1776del (p.Ile591fs) rs80359304
NM_000059.4(BRCA2):c.1909+22del rs276174816
NM_000059.4(BRCA2):c.1909+22dup rs276174816
NM_000059.4(BRCA2):c.1909+9_1909+10del rs527732001
NM_000059.4(BRCA2):c.3503T>A (p.Met1168Lys) rs80358598
NM_000059.4(BRCA2):c.3772A>G (p.Ile1258Val) rs587782720
NM_000059.4(BRCA2):c.4090A>C (p.Ile1364Leu) rs56248502
NM_000059.4(BRCA2):c.4143AGA[1] (p.Glu1382del) rs80359432
NM_000059.4(BRCA2):c.4320A>C (p.Lys1440Asn) rs769535925
NM_000059.4(BRCA2):c.4513A>G (p.Thr1505Ala) rs80358682
NM_000059.4(BRCA2):c.5095G>A (p.Asp1699Asn) rs80358731
NM_000059.4(BRCA2):c.516+14del rs1336445194
NM_000059.4(BRCA2):c.516G>A (p.Lys172=) rs80359790
NM_000059.4(BRCA2):c.5596T>C (p.Phe1866Leu) rs80358779
NM_000059.4(BRCA2):c.5634C>T (p.Asn1878=) rs80358784
NM_000059.4(BRCA2):c.575T>C (p.Met192Thr) rs80358805
NM_000059.4(BRCA2):c.6304G>A (p.Val2102Ile) rs80358869
NM_000059.4(BRCA2):c.631+7A>G rs431825339
NM_000059.4(BRCA2):c.6513G>T (p.Val2171=) rs206076
NM_000059.4(BRCA2):c.68-7del rs276174878
NM_000059.4(BRCA2):c.68-7dup rs276174878
NM_000059.4(BRCA2):c.7188G>A (p.Leu2396=) rs587780871
NM_000059.4(BRCA2):c.7331A>T (p.Asp2444Val) rs431825352
NM_000059.4(BRCA2):c.7618-21G>T rs376957350
NM_000059.4(BRCA2):c.7976G>A (p.Arg2659Lys) rs80359027
NM_000059.4(BRCA2):c.7987G>A (p.Glu2663Lys) rs80359030
NM_000059.4(BRCA2):c.8165C>G (p.Thr2722Arg) rs80359062
NM_000059.4(BRCA2):c.8331+2T>C rs398122602
NM_000059.4(BRCA2):c.8488-5T>C rs533806629
NM_000059.4(BRCA2):c.8754+3G>C rs397508007
NM_000059.4(BRCA2):c.8850G>T (p.Lys2950Asn) rs28897754
NM_000059.4(BRCA2):c.9257-8C>T rs11571819
NM_000059.4(BRCA2):c.9257G>C (p.Gly3086Ala) rs574271678
NM_000063.6(C2):c.841_849+19del rs9332736
NM_000075.4(CDK4):c.752C>G (p.Pro251Arg) rs143670820
NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[1] (p.Ala4_Pro11del) rs587780668
NM_000077.5(CDKN2A):c.369T>A (p.His123Gln) rs6413463
NM_000132.4(F8):c.5587-93C>T rs1264918703
NM_000143.4(FH):c.1237-50TC[15] rs144131869
NM_000143.4(FH):c.1237-50TC[20] rs144131869
NM_000143.4(FH):c.1237-50TC[21] rs144131869
NM_000143.4(FH):c.1237-50TC[22] rs144131869
NM_000143.4(FH):c.1237-50TC[23] rs144131869
NM_000143.4(FH):c.1237-50TC[24] rs144131869
NM_000143.4(FH):c.1237-50TC[26] rs144131869
NM_000143.4(FH):c.1431_1433dup (p.Lys477dup) rs367543046
NM_000143.4(FH):c.186G>A (p.Val62=)
NM_000143.4(FH):c.555+22dup rs569920379
NM_000179.3(MSH6):c.*24_*28del rs587779200
NM_000179.3(MSH6):c.-17C>G rs370816858
NM_000179.3(MSH6):c.-6G>T rs730881822
NM_000179.3(MSH6):c.1483C>T (p.Arg495Ter) rs587779212
NM_000179.3(MSH6):c.3151G>A (p.Val1051Ile) rs576269342
NM_000179.3(MSH6):c.3173-18T>A rs189672273
NM_000179.3(MSH6):c.3246G>T (p.Pro1082=) rs3136351
NM_000179.3(MSH6):c.3259C>T (p.Pro1087Ser) rs63750998
NM_000179.3(MSH6):c.3260C>A (p.Pro1087His) rs63750753
NM_000179.3(MSH6):c.334A>G (p.Asn112Asp) rs864622397
NM_000179.3(MSH6):c.3384T>C (p.Tyr1128=) rs544518097
NM_000179.3(MSH6):c.3439-26_3439-25del rs750310368
NM_000179.3(MSH6):c.3556+36_3556+39del rs55684722
NM_000179.3(MSH6):c.3557-4del rs267608102
NM_000179.3(MSH6):c.3557-5_3557-4del
NM_000179.3(MSH6):c.3758T>A (p.Val1253Glu) rs202066386
NM_000179.3(MSH6):c.3799_3800del (p.Met1267fs) rs267608114
NM_000179.3(MSH6):c.4001+2TAAC[2] rs267608132
NM_000179.3(MSH6):c.4001+2TAAC[4] rs267608132
NM_000179.3(MSH6):c.4001+50_4001+51dup rs199687113
NM_000179.3(MSH6):c.4002-10del rs59056100
NM_000179.3(MSH6):c.4002-10dup rs59056100
NM_000179.3(MSH6):c.4002-11_4002-10del rs59056100
NM_000179.3(MSH6):c.4002-12_4002-10dup rs59056100
NM_000179.3(MSH6):c.4002-13_4002-10del
NM_000179.3(MSH6):c.4068_4071dup (p.Lys1358delinsAspTer) rs55740729
NM_000179.3(MSH6):c.4071_*4dup (p.Ile1357_Ter1361=) rs1491544951
NM_000179.3(MSH6):c.457+32TG[12] rs397839804
NM_000179.3(MSH6):c.627+25_627+27del rs560035113
NM_000204.5(CFI):c.1253A>T (p.His418Leu) rs121964912
NM_000245.4(MET):c.1701+58del rs112241458
NM_000245.4(MET):c.2584-10_2584-9del rs57349036
NM_000245.4(MET):c.2584-7del rs587780736
NM_000245.4(MET):c.2584-9dup rs57349036
NM_000245.4(MET):c.3936-13_3936-10del rs745366999
NM_000249.4(MLH1):c.*32CTT[1] rs193922366
NM_000249.4(MLH1):c.1039-11_1039-8dup rs57509953
NM_000249.4(MLH1):c.1039-31_1039-24del rs755745938
NM_000249.4(MLH1):c.1039-31_1039-25del rs563315461
NM_000249.4(MLH1):c.1039-33_1039-26del rs766706153
NM_000249.4(MLH1):c.1039-6dup rs1553650466
NM_000249.4(MLH1):c.1039-8_1039-7insTA rs535965616
NM_000249.4(MLH1):c.1039-8del rs57509953
NM_000249.4(MLH1):c.1853A>C (p.Lys618Thr) rs63750449
NM_000249.4(MLH1):c.1975C>T (p.Arg659Ter) rs63751310
NM_000249.4(MLH1):c.2041G>A (p.Ala681Thr) rs63750217
NM_000249.4(MLH1):c.790+1G>A rs267607789
NM_000249.4(MLH1):c.794G>C (p.Arg265Pro) rs63751448
NM_000249.4(MLH1):c.885-21TC[2] rs267607804
NM_000251.3(MSH2):c.*10_*12del rs764232113
NM_000251.3(MSH2):c.1276+23del rs587779081
NM_000251.3(MSH2):c.1661+17T>G rs377461923
NM_000251.3(MSH2):c.1661+1G>A rs267607969
NM_000251.3(MSH2):c.212-4del rs746333570
NM_000251.3(MSH2):c.212-4dup rs746333570
NM_000251.3(MSH2):c.2714C>T (p.Thr905Ile) rs267608022
NM_000251.3(MSH2):c.273TCT[2] (p.Leu94del) rs267607919
NM_000251.3(MSH2):c.2801C>T (p.Thr934Met) rs587779969
NM_000251.3(MSH2):c.403C>G (p.Leu135Val) rs193096019
NM_000251.3(MSH2):c.646-1G>T rs1114167888
NM_000251.3(MSH2):c.942+17_942+29del rs11309117
NM_000251.3(MSH2):c.942+20_942+29del rs11309117
NM_000251.3(MSH2):c.942+23_942+29del rs11309117
NM_000251.3(MSH2):c.942+24_942+29del rs11309117
NM_000251.3(MSH2):c.942+25_942+29del rs11309117
NM_000251.3(MSH2):c.942+28_942+29del rs11309117
NM_000251.3(MSH2):c.942+29del rs11309117
NM_000251.3(MSH2):c.942+29dup rs11309117
NM_000298.6(PKLR):c.1705C>T (p.Arg569Trp)
NM_000303.3(PMM2):c.710C>G (p.Thr237Arg) rs80338708
NM_000314.8(PTEN):c.*10dup rs756681683
NM_000314.8(PTEN):c.-500GGC[6] rs1237307954
NM_000314.8(PTEN):c.-511G>A rs12573787
NM_000314.8(PTEN):c.-546GGC[6] rs34413673
NM_000314.8(PTEN):c.165-24TTTG[2] rs786204877
NM_000314.8(PTEN):c.210-7_210-3del rs587780544
NM_000314.8(PTEN):c.802-3del rs34003473
NM_000314.8(PTEN):c.802-4_802-3del rs34003473
NM_000314.8(PTEN):c.802-4_802-3dup rs34003473
NM_000314.8(PTEN):c.802-51_802-14del rs557364463
NM_000314.8(PTEN):c.802-5_802-3dup rs34003473
NM_000314.8(PTEN):c.94ATT[1] (p.Ile33del) rs1554893765
NM_000342.4(SLC4A1):c.2057+1G>A rs2047371081
NM_000441.2(SLC26A4):c.1263+1G>A rs1057517000
NM_000455.5(STK11):c.1225C>T (p.Arg409Trp) rs368466538
NM_000455.5(STK11):c.464+44dup rs544282452
NM_000455.5(STK11):c.465-4G>A rs587780009
NM_000455.5(STK11):c.597+21dup rs534445875
NM_000455.5(STK11):c.747C>T (p.Thr249=) rs759546076
NM_000465.4(BARD1):c.1075_1095del (p.Leu359_Pro365del) rs28997575
NM_000465.4(BARD1):c.1935_1954dup (p.Glu652fs) rs587780024
NM_000465.4(BARD1):c.216-15_216-14del rs56130510
NM_000465.4(BARD1):c.216-29dup rs56130510
NM_000465.4(BARD1):c.2300_2301del (p.Val767fs) rs750413473
NM_000492.3(CFTR):c.1521_1523del (p.Phe508del) rs113993960
NM_000518.5(HBB):c.27dup (p.Ser10fs) rs35699606
NM_000535.6(PMS2):c.-33C>T rs562800874
NM_000535.7(PMS2):c.*2C>T rs764124442
NM_000535.7(PMS2):c.*3G>A rs776493195
NM_000535.7(PMS2):c.1437C>G (p.His479Gln) rs63750685
NM_000535.7(PMS2):c.1688G>T (p.Arg563Leu) rs63750668
NM_000535.7(PMS2):c.1733G>A (p.Arg578His) rs63750770
NM_000535.7(PMS2):c.2160G>A (p.Gly720=) rs546441038
NM_000535.7(PMS2):c.2186_2187del (p.Leu729fs) rs587779335
NM_000535.7(PMS2):c.2559C>T (p.Ile853=) rs371673459
NM_000535.7(PMS2):c.706-4del rs60794673
NM_000535.7(PMS2):c.706-5_706-4del rs60794673
NM_000535.7(PMS2):c.706-5_706-4dup
NM_000535.7(PMS2):c.706-6_706-4del rs60794673
NM_000535.7(PMS2):c.780C>A (p.Ser260=) rs1805319
NM_000535.7(PMS2):c.830C>A (p.Thr277Lys) rs1805322
NM_000546.6(TP53):c.1073A>T (p.Glu358Val) rs773553186
NM_000546.6(TP53):c.1079G>T (p.Gly360Val) rs35993958
NM_000546.6(TP53):c.31G>C (p.Glu11Gln) rs201382018
NM_000546.6(TP53):c.451C>A (p.Pro151Thr) rs28934874
NM_000546.6(TP53):c.63C>T (p.Asp21=) rs1800369
NM_000546.6(TP53):c.672+48G>A rs17884607
NM_000546.6(TP53):c.672+9T>C rs1057521030
NM_000546.6(TP53):c.783-16_783-15del rs1064793810
NM_000546.6(TP53):c.818G>A (p.Arg273His) rs28934576
NM_000551.4(VHL):c.154G>A (p.Glu52Lys) rs373068386
NM_000552.5(VWF):c.3797C>A (p.Pro1266Gln) rs61749370
NM_000587.4(C7):c.1561C>A (p.Arg521Ser) rs121964920
NM_000791.4(DHFR):c.-231C>A
NM_000791.4(DHFR):c.-417_-416insGCGCTGCGGCCGCTGCGG rs758718643
NM_000791.4(DHFR):c.-418GGCCGCTGC[1] rs758960105
NM_000791.4(DHFR):c.-418GGCCGCTGC[3] rs758960105
NM_000791.4(DHFR):c.-437GGGGCGCTG[1] rs60484572
NM_000791.4(DHFR):c.-437GGGGCGCTG[3] rs60484572
NM_000791.4(DHFR):c.-437GGGGCGCTG[4] rs60484572
NM_000791.4(DHFR):c.-437GGGGCGCTG[5] rs60484572
NM_001040108.2(MLH3):c.149T>A (p.Phe50Tyr) rs148409389
NM_001040108.2(MLH3):c.3570+29AT[10] rs145063005
NM_001040108.2(MLH3):c.3786G>T (p.Pro1262=) rs28757027
NM_001042492.3(NF1):c.3198-5_3198-4dup rs371047262
NM_001042492.3(NF1):c.61-4del rs551568608
NM_001042492.3(NF1):c.6148-28del rs398100472
NM_001042492.3(NF1):c.6148-29_6148-28del rs398100472
NM_001042492.3(NF1):c.730+32del rs71142032
NM_001048174.2(MUTYH):c.228C>T (p.Tyr76=) rs121908380
NM_001048174.2(MUTYH):c.369_374dup (p.Trp124_Met125insIleTrp) rs876660190
NM_001048174.2(MUTYH):c.606+21C>A rs148552450
NM_001048174.2(MUTYH):c.633A>G (p.Val211=) rs1557474374
NM_001127511.3(APC):c.-126dup rs565045828
NM_001127511.3(APC):c.-131G>C rs572582235
NM_001127511.3(APC):c.-132G>T rs182500056
NM_001127511.3(APC):c.-134_-133insG rs1561393341
NM_001127511.3(APC):c.-191T>C rs879253783
NM_001142864.4(PIEZO1):c.6058G>A (p.Ala2020Thr) rs587776989
NM_001370259.2(MEN1):c.655-5dup rs772016629
NM_001370259.2(MEN1):c.784-19TC[2] rs764290037
NM_002016.2(FLG):c.7339C>T (p.Arg2447Ter) rs138726443
NM_002067.5(GNA11):c.889+8G>C rs73527836
NM_002439.5(MSH3):c.1764-9_1764-8del rs41559616
NM_002473.6(MYH9):c.5521G>A (p.Glu1841Lys) rs80338834
NM_002528.7(NTHL1):c.354+30dup rs3211971
NM_002691.4(POLD1):c.1384-13C>G rs536467012
NM_002691.4(POLD1):c.1494+5C>T rs565428379
NM_002691.4(POLD1):c.208G>A (p.Val70Ile) rs147911699
NM_002691.4(POLD1):c.2821-48C>G rs3219439
NM_002691.4(POLD1):c.3219-25_3219-20dup rs375276363
NM_002691.4(POLD1):c.632G>A (p.Arg211His) rs373192520
NM_002878.4(RAD51D):c.145-39G>T rs7207508
NM_002878.4(RAD51D):c.145-4G>T rs201361465
NM_002878.4(RAD51D):c.412A>C (p.Asn138His) rs141690729
NM_003000.2(SDHB):c.424-16_424-14dup rs34261028
NM_003000.3(SDHB):c.424-37TTC[10] rs34261028
NM_003000.3(SDHB):c.424-37TTC[6] rs34261028
NM_003000.3(SDHB):c.424-37TTC[7] rs34261028
NM_003001.5(SDHC):c.406-14dup rs34744926
NM_004064.5(CDKN1B):c.-31AG[1] rs774454456
NM_004064.5(CDKN1B):c.397C>A (p.Pro133Thr) rs137985549
NM_004069.6(AP2S1):c.3+41dup
NM_004168.4(SDHA):c.-7A>C rs751633537
NM_004168.4(SDHA):c.1A>T (p.Met1Leu) rs1061517
NM_004329.3(BMPR1A):c.233C>T (p.Thr78Ile) rs1064793490
NM_004329.3(BMPR1A):c.431-30A>G
NM_004360.5(CDH1):c.1308G>A (p.Leu436=) rs557551011
NM_004360.5(CDH1):c.2440-12CTT[2] rs587782757
NM_004360.5(CDH1):c.32TGC[6] (p.Leu15dup) rs587782476
NM_004360.5(CDH1):c.820G>A (p.Gly274Ser) rs781513008
NM_004380.3(CREBBP):c.5345C>T (p.Ala1782Val) rs2051858361
NM_004655.4(AXIN2):c.1235A>G (p.Asn412Ser) rs115931022
NM_004655.4(AXIN2):c.1380T>C (p.Tyr460=) rs566313620
NM_004655.4(AXIN2):c.1404CCA[5] (p.His474del) rs570443161
NM_004655.4(AXIN2):c.1404CCA[7] (p.His474dup) rs570443161
NM_004655.4(AXIN2):c.2124G>C (p.Ser708=) rs143243661
NM_005359.6(SMAD4):c.1139+44T>C rs28539779
NM_005359.6(SMAD4):c.756A>G (p.Gly252=) rs1244121412
NM_005359.6(SMAD4):c.904+45del rs386387676
NM_005359.6(SMAD4):c.904+45dup rs386387676
NM_006231.4(POLE):c.-6G>C rs534524789
NM_006231.4(POLE):c.1145G>A (p.Ser382Asn) rs761600715
NM_006231.4(POLE):c.1794+35_1794+36del rs368632925
NM_006231.4(POLE):c.1A>T (p.Met1Leu) rs878854847
NM_006231.4(POLE):c.2089C>G (p.Pro697Ala) rs5744800
NM_006231.4(POLE):c.2089C>T (p.Pro697Ser) rs5744800
NM_006231.4(POLE):c.2090C>G (p.Pro697Arg) rs36120395
NM_006231.4(POLE):c.2382C>T (p.Cys794=) rs767271169
NM_006231.4(POLE):c.2731del (p.Gln911fs) rs1555226051
NM_006231.4(POLE):c.2865-17_2865-16dup rs369732588
NM_006231.4(POLE):c.2865-4del rs369732588
NM_006231.4(POLE):c.2865-4dup rs369732588
NM_006231.4(POLE):c.2865-5_2865-4del rs369732588
NM_006231.4(POLE):c.2T>C (p.Met1Thr) rs879254126
NM_006231.4(POLE):c.3264_3275+13del rs761516512
NM_006231.4(POLE):c.4952+17_4952+19dup rs571641918
NM_006231.4(POLE):c.6765C>T (p.Ile2255=) rs376336585
NM_006767.4(LZTR1):c.1199T>C (p.Met400Thr)
NM_006949.4(STXBP2):c.1586G>C (p.Arg529Pro) rs35490401
NM_007194.4(CHEK2):c.1183G>C (p.Val395Leu) rs587780170
NM_007194.4(CHEK2):c.231CCAAGAACCTGAGGA[1] (p.77DQEPE[1]) rs587780181
NM_007194.4(CHEK2):c.480AGA[1] (p.Glu161del) rs587782008
NM_007194.4(CHEK2):c.593-11_593-7del rs863224414
NM_007194.4(CHEK2):c.907T>C (p.Leu303=) rs752359705
NM_007294.4(BRCA1):c.115T>G (p.Cys39Gly) rs80357164
NM_007294.4(BRCA1):c.132C>T (p.Cys44=) rs876658362
NM_007294.4(BRCA1):c.1843TCT[1] (p.Ser616del) rs80358329
NM_007294.4(BRCA1):c.2083G>T (p.Asp695Tyr) rs28897681
NM_007294.4(BRCA1):c.2232T>C (p.Ala744=) rs4986846
NM_007294.4(BRCA1):c.302-41T>C rs8176135
NM_007294.4(BRCA1):c.302-5T>C rs778668665
NM_007294.4(BRCA1):c.3230G>A (p.Gly1077Glu) rs1567792424
NM_007294.4(BRCA1):c.3776A>C (p.Asn1259Thr) rs483353090
NM_007294.4(BRCA1):c.4096+3A>G rs80358015
NM_007294.4(BRCA1):c.4185+11TG[5] rs273900723
NM_007294.4(BRCA1):c.4186-10G>A rs80358172
NM_007294.4(BRCA1):c.426C>T (p.Pro142=) rs542687218
NM_007294.4(BRCA1):c.439T>C (p.Leu147=) rs794727800
NM_007294.4(BRCA1):c.4675+1G>A rs80358044
NM_007294.4(BRCA1):c.4951T>C (p.Ser1651Pro) rs879254042
NM_007294.4(BRCA1):c.5106A>G (p.Lys1702=) rs1060504574
NM_007294.4(BRCA1):c.5138T>C (p.Val1713Ala) rs80357132
NM_007294.4(BRCA1):c.5165C>T (p.Ser1722Phe) rs80357104
NM_007294.4(BRCA1):c.5207T>C (p.Val1736Ala) rs45553935
NM_007294.4(BRCA1):c.5266dup (p.Gln1756fs) rs80357906
NM_007294.4(BRCA1):c.5365G>T (p.Ala1789Ser) rs80357078
NM_007294.4(BRCA1):c.547+14del rs273902771
NM_007294.4(BRCA1):c.66A>G (p.Leu22=) rs786202533
NM_007294.4(BRCA1):c.671-12del rs273902781
NM_007294.4(BRCA1):c.671-18_671-16del rs398122354
NM_007294.4(BRCA1):c.695A>T (p.Asp232Val) rs398122708
NM_007294.4(BRCA1):c.81-14C>T rs80358006
NM_007294.4(BRCA1):c.823G>A (p.Gly275Ser) rs8176153
NM_007294.4(BRCA1):c.953A>G (p.His318Arg) rs776278453
NM_015450.3(POT1):c.1505+7TGTTT[5] rs66826272
NM_017415.3(KLHL3):c.1079G>A (p.Arg360Gln) rs1561586322
NM_017763.6(RNF43):c.1880T>C (p.Val627Ala) rs199831923
NM_017763.6(RNF43):c.1976dup (p.Pro660fs) rs755128667
NM_017763.6(RNF43):c.576G>A (p.Pro192=) rs76384648
NM_018975.4(TERF2IP):c.307C>T (p.Pro103Ser)
NM_018975.4(TERF2IP):c.795+19C>A rs72561501
NM_020822.3(KCNT1):c.2061_2066del (p.Gly691_Gly692del) rs754629346
NM_020975.6(RET):c.1146G>A (p.Gln382=) rs770637118
NM_020975.6(RET):c.1858T>C (p.Cys620Arg) rs77316810
NM_020975.6(RET):c.2342A>G (p.Gln781Arg) rs377767416
NM_020975.6(RET):c.2752A>G (p.Met918Val) rs377767442
NM_020975.6(RET):c.2753T>C (p.Met918Thr) rs74799832
NM_024529.5(CDC73):c.-4dup rs545666726
NM_024529.5(CDC73):c.729+33GA[8] rs80356646
NM_024675.4(PALB2):c.1684+18TGA[9] rs368593832
NM_024675.4(PALB2):c.1724G>A (p.Trp575Ter) rs730881876
NM_024675.4(PALB2):c.18G>T (p.Gly6=) rs587782462
NM_024675.4(PALB2):c.211+1G>T rs1555462026
NM_024675.4(PALB2):c.2508C>T (p.Val836=) rs786203603
NM_024675.4(PALB2):c.2607C>T (p.Ser869=) rs45542234
NM_024675.4(PALB2):c.3054G>T (p.Glu1018Asp) rs183489969
NM_024675.4(PALB2):c.3307G>A (p.Val1103Met) rs201657283
NM_030787.4(CFHR5):c.485_486dup (p.Glu163fs) rs565457964
NM_032043.3(BRIP1):c.2400C>T (p.Tyr800=) rs574552037
NM_032043.3(BRIP1):c.2493-10T>A rs776255327
NM_032043.3(BRIP1):c.2990_2993del (p.Thr997fs) rs771028677
NM_032043.3(BRIP1):c.380-17dup rs545021924
NM_032043.3(BRIP1):c.380-28G>A rs4988343
NM_058216.3(RAD51C):c.572-11del rs587780258
NM_144997.7(FLCN):c.75G>A (p.Leu25=) rs200350612
NM_144997.7(FLCN):c.871+22C>T
NM_145239.3(PRRT2):c.649del (p.Arg217fs) rs587778771
NM_177438.3(DICER1):c.145-22dup rs558991368
NM_177438.3(DICER1):c.1510-4del rs546524688
NM_177438.3(DICER1):c.2651-14T>G rs753857234
NM_177438.3(DICER1):c.4206+7_4206+8dup rs1555368535
NM_177438.3(DICER1):c.4206+9GT[13] rs71838494
NM_177438.3(DICER1):c.4206+9GT[19] rs71838494
NM_177438.3(DICER1):c.4206+9GT[21] rs71838494
NM_177438.3(DICER1):c.4254GGA[2] (p.Glu1420del) rs544960260
NM_177438.3(DICER1):c.4889G>T (p.Arg1630Leu) rs368343829
NM_199242.3(UNC13D):c.2954+432del
UGT1A1*28 rs3064744

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.