ClinVar Miner

Variants from AiLife Diagnostics, AiLife Diagnostics with conflicting interpretations

Location: United States  Primary collection method: clinical testing
Minimum review status of the submission from AiLife Diagnostics, AiLife Diagnostics: Collection method of the submission from AiLife Diagnostics, AiLife Diagnostics:
Minimum review status of the other submission: Collection method of the other submission:
Minimum conflict level:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
1347 819 0 214 65 24 173 418

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

All submitters
AiLife Diagnostics, AiLife Diagnostics pathogenic likely pathogenic uncertain significance likely benign benign drug response established risk allele risk factor other
pathogenic 0 55 18 4 3 6 1 6 7
likely pathogenic 159 0 87 3 2 3 1 3 1
uncertain significance 24 52 0 62 12 0 0 0 1

Submitter to submitter summary #

Total submitters: 78
Download table as spreadsheet
Submitter Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
GeneDx 0 509 0 89 16 1 63 169
Invitae 0 151 0 46 30 0 19 95
Ambry Genetics 0 439 0 34 16 0 38 88
CeGaT Center for Human Genetics Tuebingen 0 139 0 42 13 0 13 68
PreventionGenetics, part of Exact Sciences 0 106 0 28 12 2 13 55
Eurofins Ntd Llc (ga) 0 114 0 30 2 5 14 51
Revvity Omics, Revvity 0 136 0 29 0 0 11 40
Mayo Clinic Laboratories, Mayo Clinic 0 84 0 29 0 0 10 39
Women's Health and Genetics/Laboratory Corporation of America, LabCorp 0 75 0 4 5 0 15 24
Joint Genome Diagnostic Labs from Nijmegen and Maastricht, Radboudumc and MUMC+ 0 68 0 17 0 0 5 22
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine 0 74 0 3 2 0 15 20
Athena Diagnostics Inc 0 45 0 13 2 0 4 19
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories 0 60 0 13 2 1 3 19
Clinical Genetics DNA and cytogenetics Diagnostics Lab, Erasmus MC, Erasmus Medical Center 0 59 0 14 0 0 5 19
OMIM 0 9 0 3 0 12 1 16
Clinical Genetics, Academic Medical Center 0 46 0 11 0 0 5 16
Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen 0 31 0 16 0 0 0 16
Color Diagnostics, LLC DBA Color Health 0 59 0 4 1 0 10 15
Diagnostic Laboratory, Department of Genetics, University Medical Center Groningen 0 44 0 10 0 0 4 14
Illumina Laboratory Services, Illumina 0 10 0 7 1 0 5 13
Stanford Center for Inherited Cardiovascular Disease, Stanford University 0 36 0 8 0 0 5 13
Genome Diagnostics Laboratory, University Medical Center Utrecht 0 42 0 8 0 0 4 12
Quest Diagnostics Nichols Institute San Juan Capistrano 0 48 0 7 2 0 3 12
Genetic Services Laboratory, University of Chicago 0 28 0 5 3 0 3 11
Institute for Clinical Genetics, University Hospital TU Dresden, University Hospital TU Dresden 0 21 0 7 1 0 3 11
Center for Pediatric Genomic Medicine, Children's Mercy Hospital and Clinics 0 15 0 4 0 0 7 11
PharmGKB 0 0 0 0 0 9 0 9
Blueprint Genetics 0 14 0 5 0 0 3 8
Centre for Mendelian Genomics, University Medical Centre Ljubljana 0 3 0 4 0 1 3 8
CSER _CC_NCGL, University of Washington 0 5 0 1 0 0 6 7
Genome Diagnostics Laboratory, Amsterdam University Medical Center 0 22 0 5 0 0 1 6
All of Us Research Program, National Institutes of Health 0 26 0 1 1 0 4 6
Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital 0 11 0 4 0 0 1 5
Kariminejad - Najmabadi Pathology & Genetics Center 0 2 0 4 0 0 1 5
Laboratory of Diagnostic Genome Analysis, Leiden University Medical Center (LUMC) 0 16 0 2 0 0 3 5
Greenwood Genetic Center Diagnostic Laboratories, Greenwood Genetic Center 0 11 0 3 0 0 1 4
Clinical Genetics and Genomics, Karolinska University Hospital 0 14 0 4 0 0 0 4
Molecular Diagnostic Laboratory for Inherited Cardiovascular Disease, Montreal Heart Institute 0 9 0 2 0 1 1 4
Gharavi Laboratory, Columbia University 0 8 0 4 0 0 0 4
Practice for Gait Abnormalities, David Pomarino, Competency Network Toe Walking c/o Practice Pomarino 0 4 0 3 0 0 1 4
DASA 0 2 0 4 0 0 0 4
Fulgent Genetics, Fulgent Genetics 0 36 0 2 0 0 1 3
Genomic Research Center, Shahid Beheshti University of Medical Sciences 0 1 0 2 0 0 1 3
Department of Pathology and Laboratory Medicine, Sinai Health System 0 15 0 1 0 1 1 3
CFTR-France 0 0 0 3 0 0 0 3
ClinGen Malignant Hyperthermia Susceptibility Variant Curation Expert Panel, ClinGen 0 7 0 1 0 0 2 3
Laboratorio de Genetica e Diagnostico Molecular, Hospital Israelita Albert Einstein 0 8 0 3 0 0 0 3
Genome Diagnostics Laboratory, The Hospital for Sick Children 0 5 0 2 0 0 0 2
CHEO Genetics Diagnostic Laboratory, Children's Hospital of Eastern Ontario 0 4 0 2 0 0 0 2
Biesecker Lab/Clinical Genomics Section, National Institutes of Health 0 16 0 0 0 0 2 2
Mendelics 0 5 0 0 2 0 0 2
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego 0 9 0 1 0 0 1 2
Institute of Human Genetics, University of Leipzig Medical Center 0 5 0 1 0 0 1 2
Center for Personalized Medicine, Children's Hospital Los Angeles 0 0 0 1 0 0 1 2
Klaassen Lab, Charite University Medicine Berlin 0 1 0 1 0 0 1 2
HLA Laboratory, Instituto Nacional de Enfermedades Respiratorias Ismael Cosio Villegas 0 0 0 0 0 1 1 2
Baylor Genetics 0 4 0 1 0 0 0 1
Clinical Molecular Genetics Laboratory, Johns Hopkins All Children's Hospital 0 2 0 1 0 0 0 1
Foulkes Cancer Genetics LDI, Lady Davis Institute for Medical Research 0 2 0 1 0 0 0 1
Division of Human Genetics, Children's Hospital of Philadelphia 0 1 0 0 0 0 1 1
Knight Diagnostic Laboratories, Oregon Health and Sciences University 0 3 0 1 0 0 0 1
Laboratory of Molecular Genetics (Pr. Bezieau's lab), CHU de Nantes 0 2 0 1 0 0 0 1
Institute of Human Genetics, University of Wuerzburg 0 0 0 0 0 0 1 1
Endocrine oncology group, Uppsala University 0 0 0 1 0 0 0 1
Inherited Neuropathy Consortium 0 0 0 0 0 0 1 1
Seattle Children's Hospital Molecular Genetics Laboratory, Seattle Children's Hospital 0 0 0 1 0 0 0 1
Pathology and Clinical Laboratory Medicine, King Fahad Medical City 0 0 0 0 0 0 1 1
Institute of Reproductive Genetics, University of Münster 0 2 0 1 0 0 0 1
University of Washington Department of Laboratory Medicine, University of Washington 0 2 0 0 0 1 0 1
deCODE genetics, Amgen 0 0 0 1 0 0 0 1
Institute for Genomic Statistics and Bioinformatics, University Hospital Bonn 0 0 0 1 0 0 0 1
Al Jalila Children's Genomics Center, Al Jalila Childrens Speciality Hospital 0 3 0 0 0 0 1 1
Molecular Genetics laboratory, Necker Hospital 0 0 0 1 0 0 0 1
New York Genome Center 0 3 0 1 0 0 0 1
ISTH-SSC Genomics in Thrombosis and Hemostasis, KU Leuven, Center for Molecular and Vascular Biology 0 0 0 0 0 0 1 1
Institute of Human Genetics, Clinical Exome/Genome Diagnostics Group, University Hospital Bonn 0 1 0 1 0 0 0 1
Molecular Genetics, Royal Melbourne Hospital 0 1 0 0 0 0 1 1
H3Africa Consortium 0 0 0 0 1 0 0 1

All variants with conflicting interpretations #

Total variants: 418
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_000041.4(APOE):c.388T>C (p.Cys130Arg) rs429358 0.16059
NM_000410.4(HFE):c.187C>G (p.His63Asp) rs1799945 0.10170
NM_000402.4(G6PD):c.466A>G (p.Asn156Asp) rs1050829 0.08672
NM_000410.4(HFE):c.845G>A (p.Cys282Tyr) rs1800562 0.03880
NM_000402.4(G6PD):c.292G>A (p.Val98Met) rs1050828 0.03616
NM_001127701.1(SERPINA1):c.863A>T (p.Glu288Val) rs17580 0.02950
NM_000237.3(LPL):c.953A>G (p.Asn318Ser) rs268 0.01327
NM_000518.5(HBB):c.20A>T (p.Glu7Val) rs334 0.01298
NM_001127701.1(SERPINA1):c.1096G>A (p.Glu366Lys) rs28929474 0.01282
NM_000492.4(CFTR):c.1210-11T>G rs73715573 0.00886
NM_002113.3(CFHR1):c.19del (p.Ser6_Val7insTer) rs769938205 0.00770
NM_170754.4(TNS2):c.3352A>G (p.Thr1118Ala) rs117152710 0.00706
NM_000041.4(APOE):c.487C>T (p.Arg163Cys) rs769455 0.00701
NM_012452.3(TNFRSF13B):c.542C>A (p.Ala181Glu) rs72553883 0.00518
NM_000371.4(TTR):c.424G>A (p.Val142Ile) rs76992529 0.00501
NM_000250.2(MPO):c.2031-2A>C rs35897051 0.00472
NM_012452.3(TNFRSF13B):c.310T>C (p.Cys104Arg) rs34557412 0.00403
NM_001048174.2(MUTYH):c.1103G>A (p.Gly368Asp) rs36053993 0.00341
NM_001089.3(ABCA3):c.875A>T (p.Glu292Val) rs149989682 0.00304
NM_000301.5(PLG):c.112A>G (p.Lys38Glu) rs73015965 0.00282
NM_012275.3(IL36RN):c.338C>T (p.Ser113Leu) rs144478519 0.00264
NM_004562.3(PRKN):c.1310C>T (p.Pro437Leu) rs149953814 0.00223
NM_000065.5(C6):c.1138del (p.Gln380fs) rs375762365 0.00206
NM_000041.4(APOE):c.137T>C (p.Leu46Pro) rs769452 0.00199
NM_005632.3(CAPN15):c.2192+8C>T rs144209708 0.00195
NM_000157.4(GBA1):c.1226A>G (p.Asn409Ser) rs76763715 0.00191
NM_000250.2(MPO):c.1705C>T (p.Arg569Trp) rs119468010 0.00173
NM_001354604.2(MITF):c.1273G>A (p.Glu425Lys) rs149617956 0.00160
NM_002693.3(POLG):c.1760C>T (p.Pro587Leu) rs113994096 0.00160
NM_002693.3(POLG):c.752C>T (p.Thr251Ile) rs113994094 0.00159
NM_001002294.3(FMO3):c.458C>T (p.Pro153Leu) rs72549326 0.00149
NM_001256317.3(TMPRSS3):c.413C>A (p.Ala138Glu) rs147231991 0.00146
NM_024570.4(RNASEH2B):c.529G>A (p.Ala177Thr) rs75184679 0.00141
NM_015102.5(NPHP4):c.800A>T (p.His267Leu) rs201124357 0.00124
NM_000038.6(APC):c.3920T>A (p.Ile1307Lys) rs1801155 0.00116
NM_020971.3(SPTBN4):c.3927C>G (p.His1309Gln) rs140544038 0.00106
NM_024301.5(FKRP):c.826C>A (p.Leu276Ile) rs28937900 0.00103
NM_022437.3(ABCG8):c.1083G>A (p.Trp361Ter) rs137852987 0.00102
NM_000053.4(ATP7B):c.2605G>A (p.Gly869Arg) rs191312027 0.00101
NM_174916.3(UBR1):c.5135G>A (p.Arg1712His) rs141828250 0.00099
NM_173842.3(IL1RN):c.370G>A (p.Ala124Thr) rs45507693 0.00097
NM_002693.3(POLG):c.2209G>C (p.Gly737Arg) rs121918054 0.00096
NM_002972.4(SBF1):c.898-4G>A rs377428323 0.00088
NM_139027.6(ADAMTS13):c.3178C>T (p.Arg1060Trp) rs142572218 0.00088
NM_001148.6(ANK2):c.4373A>G (p.Glu1458Gly) rs72544141 0.00085
NM_002693.3(POLG):c.2243G>C (p.Trp748Ser) rs113994097 0.00081
NM_000540.3(RYR1):c.2122G>A (p.Asp708Asn) rs138874610 0.00065
NM_001006658.3(CR2):c.2298G>A (p.Trp766Ter) rs151093663 0.00065
NM_001164508.2(NEB):c.18431A>G (p.His6144Arg) rs34504204 0.00061
NM_175914.5(HNF4A):c.1321A>G (p.Ile441Val) rs147638455 0.00061
NM_024876.4(COQ8B):c.1297-6T>G rs199934542 0.00056
NM_000064.4(C3):c.3490-10T>G rs372843505 0.00053
NM_017951.5(SMPD4):c.570G>A (p.Arg190=) rs143450222 0.00047
NM_020987.5(ANK3):c.11678G>C (p.Ser3893Thr) rs12260663 0.00044
NM_000091.5(COL4A3):c.4981C>T (p.Arg1661Cys) rs201697532 0.00039
NM_000492.4(CFTR):c.1865G>A (p.Gly622Asp) rs121908759 0.00039
NM_000152.5(GAA):c.752C>T (p.Ser251Leu) rs200856561 0.00038
NM_032607.3(CREB3L3):c.732dup (p.Lys245fs) rs780374391 0.00038
NM_001040151.2(SCN3B):c.29T>C (p.Leu10Pro) rs121918282 0.00036
NM_000152.5(GAA):c.2331+84C>G rs185905012 0.00034
NM_000492.4(CFTR):c.1327G>T (p.Asp443Tyr) rs147422190 0.00034
NM_000152.5(GAA):c.841C>T (p.Arg281Trp) rs142967546 0.00033
NM_000492.4(CFTR):c.3454G>C (p.Asp1152His) rs75541969 0.00033
NM_000540.3(RYR1):c.1453A>G (p.Met485Val) rs147723844 0.00033
NM_000057.4(BLM):c.3625T>A (p.Ser1209Thr) rs1801256 0.00031
NM_001013693.3(LDLRAD2):c.*1278C>T rs376645617 0.00031
NM_020207.7(ERCC6L2):c.19C>T (p.Gln7Ter) rs778926161 0.00031
NM_002471.4(MYH6):c.292G>A (p.Glu98Lys) rs140596256 0.00030
NM_002972.4(SBF1):c.3147-8G>C rs182956712 0.00030
NM_020451.3(SELENON):c.943G>A (p.Gly315Ser) rs121908188 0.00030
NM_033629.6(TREX1):c.341G>A (p.Arg114His) rs72556554 0.00030
NM_000540.3(RYR1):c.1598G>A (p.Arg533His) rs144336148 0.00029
NM_001930.4(DHPS):c.1014+1G>A rs142633494 0.00028
NM_006118.4(HAX1):c.91del (p.Glu31fs) rs764082747 0.00026
NM_007194.4(CHEK2):c.1283C>T (p.Ser428Phe) rs137853011 0.00026
NM_153240.5(NPHP3):c.2694-2_2694-1del rs751527253 0.00026
NM_000053.4(ATP7B):c.122A>G (p.Asn41Ser) rs201738967 0.00025
NM_000237.3(LPL):c.644G>A (p.Gly215Glu) rs118204057 0.00024
NM_000237.3(LPL):c.998G>A (p.Arg333His) rs144466625 0.00024
NM_002972.4(SBF1):c.4768A>G (p.Thr1590Ala) rs200488568 0.00024
NM_175914.5(HNF4A):c.582+20G>C rs370794722 0.00024
NM_000066.4(C8B):c.271C>T (p.Gln91Ter) rs146187042 0.00023
NM_005529.7(HSPG2):c.4971C>T (p.Tyr1657=) rs138459752 0.00023
NM_002470.4(MYH3):c.4324G>A (p.Ala1442Thr) rs201602783 0.00021
NM_003085.5(SNCB):c.368C>A (p.Pro123His) rs104893937 0.00021
NM_000435.3(NOTCH3):c.2437G>A (p.Glu813Lys) rs375873637 0.00020
NM_000232.5(SGCB):c.341C>T (p.Ser114Phe) rs150518260 0.00019
NM_006019.4(TCIRG1):c.1674-1G>A rs139617644 0.00019
NM_015141.4(GPD1L):c.247G>A (p.Glu83Lys) rs72552292 0.00018
NM_004999.4(MYO6):c.188-3T>C rs373199401 0.00017
NM_004562.3(PRKN):c.719C>T (p.Thr240Met) rs137853054 0.00016
NM_006073.4(TRDN):c.1282C>T (p.Arg428Ter) rs202219343 0.00016
NM_020821.3(VPS13C):c.10954C>T (p.Arg3652Ter) rs138846118 0.00016
NM_000642.3(AGL):c.256C>T (p.Gln86Ter) rs193186112 0.00014
NM_001267550.2(TTN):c.103434C>A (p.Asp34478Glu) rs376371272 0.00014
NM_001267550.2(TTN):c.38122+2T>C rs781392575 0.00014
NM_000492.4(CFTR):c.617T>G (p.Leu206Trp) rs121908752 0.00013
NM_000540.3(RYR1):c.6721C>T (p.Arg2241Ter) rs200563280 0.00013
NM_004562.3(PRKN):c.1289G>A (p.Gly430Asp) rs191486604 0.00013
NM_001854.4(COL11A1):c.1504G>T (p.Asp502Tyr) rs1212773301 0.00012
NM_004055.5(CAPN5):c.297+11G>A rs374146255 0.00012
NM_174936.4(PCSK9):c.1069C>T (p.Arg357Cys) rs148562777 0.00012
NM_000256.3(MYBPC3):c.442G>A (p.Gly148Arg) rs397516050 0.00011
NM_000492.3(CFTR):c.3718-2477C>T rs75039782 0.00011
NM_000540.3(RYR1):c.1840C>T (p.Arg614Cys) rs118192172 0.00011
NM_001943.5(DSG2):c.2506C>G (p.Leu836Val) rs767979763 0.00011
NM_000256.3(MYBPC3):c.1504C>T (p.Arg502Trp) rs375882485 0.00010
NM_000719.7(CACNA1C):c.865C>A (p.Leu289Ile) rs770311259 0.00010
NM_001356.5(DDX3X):c.426A>C (p.Pro142=) rs779721240 0.00010
NM_002693.3(POLG):c.3139C>T (p.Arg1047Trp) rs181860632 0.00010
NM_000335.5(SCN5A):c.673C>T (p.Arg225Trp) rs199473072 0.00009
NM_000518.5(HBB):c.93-21G>A rs35004220 0.00009
NM_001486.4(GCKR):c.151C>T (p.Arg51Ter) rs375836361 0.00009
NM_002582.4(PARN):c.272A>G (p.Tyr91Cys) rs201765587 0.00009
NM_022089.4(ATP13A2):c.477+2T>G rs758014228 0.00009
NM_022436.3(ABCG5):c.1166G>A (p.Arg389His) rs119480069 0.00009
NM_022773.4(LMF1):c.295C>T (p.Gln99Ter) rs752473648 0.00009
NM_000152.5(GAA):c.1552-3C>G rs375470378 0.00008
NM_000218.3(KCNQ1):c.584G>A (p.Arg195Gln) rs138362632 0.00008
NM_000350.3(ABCA4):c.634C>T (p.Arg212Cys) rs61750200 0.00008
NM_002230.4(JUP):c.809T>A (p.Leu270Gln) rs794729040 0.00008
NM_000335.5(SCN5A):c.4975A>G (p.Ile1659Val) rs199473625 0.00007
NM_001292063.2(OTOG):c.7418del (p.Arg2473fs) rs751369871 0.00007
NM_005472.5(KCNE3):c.296G>A (p.Arg99His) rs121908441 0.00007
NM_000038.6(APC):c.8332G>T (p.Ala2778Ser) rs587778046 0.00006
NM_000152.5(GAA):c.761C>T (p.Ser254Leu) rs577915581 0.00006
NM_000157.4(GBA1):c.1604G>A (p.Arg535His) rs75822236 0.00006
NM_000256.3(MYBPC3):c.1624G>C (p.Glu542Gln) rs121909374 0.00006
NM_000492.4(CFTR):c.254G>A (p.Gly85Glu) rs75961395 0.00006
NM_000492.4(CFTR):c.2856G>C (p.Met952Ile) rs151048781 0.00006
NM_000501.4(ELN):c.1150+1G>A rs727503030 0.00006
NM_000540.3(RYR1):c.7300G>A (p.Gly2434Arg) rs121918593 0.00006
NM_001160372.4(TRAPPC9):c.3055+10C>T rs571622542 0.00006
NM_001267550.2(TTN):c.35890C>T (p.Arg11964Ter) rs1266298136 0.00006
NM_001267550.2(TTN):c.61876C>T (p.Arg20626Ter) rs72646846 0.00006
NM_001458.5(FLNC):c.6134G>A (p.Arg2045Gln) rs747196571 0.00006
NM_001848.3(COL6A1):c.717+4A>G rs762867111 0.00006
NM_003476.5(CSRP3):c.131T>C (p.Leu44Pro) rs104894205 0.00006
NM_004562.3(PRKN):c.98G>A (p.Arg33Gln) rs147757966 0.00006
NM_000219.6(KCNE1):c.226G>A (p.Asp76Asn) rs74315445 0.00005
NM_000335.5(SCN5A):c.4456A>C (p.Met1486Leu) rs199473258 0.00005
NM_000492.4(CFTR):c.3409A>G (p.Met1137Val) rs397508553 0.00005
NM_000540.3(RYR1):c.325C>T (p.Arg109Trp) rs118192173 0.00005
NM_001135146.2(SLC39A8):c.610G>T (p.Gly204Cys) rs779241085 0.00005
NM_001378969.1(KCND3):c.1798G>A (p.Gly600Arg) rs149344567 0.00005
NM_001927.4(DES):c.1371+1G>A rs748323823 0.00005
NM_003151.4(STAT4):c.921G>C (p.Leu307Phe) rs548245892 0.00005
NM_004168.4(SDHA):c.1534C>T (p.Arg512Ter) rs748089700 0.00005
NM_015202.5(KATNIP):c.-2G>A rs112949559 0.00005
NM_000069.3(CACNA1S):c.4415G>A (p.Arg1472His) rs201463541 0.00004
NM_000144.5(FXN):c.389G>T (p.Gly130Val) rs104894107 0.00004
NM_000238.4(KCNH2):c.2863C>G (p.Leu955Val) rs199473012 0.00004
NM_000256.3(MYBPC3):c.3330+2T>G rs387906397 0.00004
NM_000335.5(SCN5A):c.5827C>T (p.Arg1943Ter) rs794728940 0.00004
NM_000335.5(SCN5A):c.5869C>T (p.Arg1957Ter) rs757532106 0.00004
NM_000371.4(TTR):c.148G>A (p.Val50Met) rs28933979 0.00004
NM_000432.4(MYL2):c.403-1G>C rs199474813 0.00004
NM_000527.5(LDLR):c.1444G>A (p.Asp482Asn) rs139624145 0.00004
NM_000527.5(LDLR):c.798T>A (p.Asp266Glu) rs139043155 0.00004
NM_001035.3(RYR2):c.5588C>T (p.Thr1863Met) rs770863319 0.00004
NM_001267550.2(TTN):c.40409-1G>A rs1285884266 0.00004
NM_001371904.1(APOA5):c.823C>T (p.Gln275Ter) rs149808404 0.00004
NM_014049.5(ACAD9):c.868G>A (p.Gly290Arg) rs1018093316 0.00004
NM_017827.4(SARS2):c.1347G>A (p.Thr449=) rs200404654 0.00004
NM_170707.4(LMNA):c.992G>A (p.Arg331Gln) rs59301204 0.00004
NM_172201.2(KCNE2):c.229C>T (p.Arg77Trp) rs141423405 0.00004
NM_000152.5(GAA):c.1326+1G>A rs1205507761 0.00003
NM_000256.3(MYBPC3):c.1624+4A>T rs397515916 0.00003
NM_000256.3(MYBPC3):c.1828G>C (p.Asp610His) rs371564200 0.00003
NM_000257.4(MYH7):c.2389G>A (p.Ala797Thr) rs3218716 0.00003
NM_000257.4(MYH7):c.2572C>T (p.Arg858Cys) rs2754158 0.00003
NM_000257.4(MYH7):c.3133C>T (p.Arg1045Cys) rs45611033 0.00003
NM_000271.5(NPC1):c.2474A>G (p.Tyr825Cys) rs550562774 0.00003
NM_000335.5(SCN5A):c.393-1C>T rs759235726 0.00003
NM_000335.5(SCN5A):c.3953G>T (p.Gly1318Val) rs199473220 0.00003
NM_000393.5(COL5A2):c.3373G>A (p.Gly1125Arg) rs151187317 0.00003
NM_000540.3(RYR1):c.1589G>A (p.Arg530His) rs111888148 0.00003
NM_000660.7(TGFB1):c.466C>T (p.Arg156Cys) rs200482214 0.00003
NM_001037.5(SCN1B):c.363C>G (p.Cys121Trp) rs104894718 0.00003
NM_001080414.4(CCDC88C):c.4113-19C>T rs560507685 0.00003
NM_001114753.3(ENG):c.1134G>A (p.Ala378=) rs1329127701 0.00003
NM_001267550.2(TTN):c.6555_6556insTGTAAGGAAACAGACA (p.Lys2186fs) rs587780494 0.00003
NM_001848.3(COL6A1):c.1693C>T (p.Arg565Ter) rs1304888945 0.00003
NM_002834.5(PTPN11):c.794G>A (p.Arg265Gln) rs376607329 0.00003
NM_007194.4(CHEK2):c.917G>C (p.Gly306Ala) rs587780192 0.00003
NM_015599.3(PGM3):c.-2-194C>T rs753019951 0.00003
NM_000256.3(MYBPC3):c.2459G>A (p.Arg820Gln) rs2856655 0.00002
NM_000257.4(MYH7):c.2348G>A (p.Arg783His) rs397516142 0.00002
NM_000257.4(MYH7):c.4031G>A (p.Arg1344Gln) rs797045097 0.00002
NM_000335.5(SCN5A):c.655C>T (p.Arg219Cys) rs762012668 0.00002
NM_000335.5(SCN5A):c.845G>A (p.Arg282His) rs199473083 0.00002
NM_000352.6(ABCC8):c.208G>A (p.Gly70Arg) rs764349043 0.00002
NM_000363.5(TNNI3):c.434G>A (p.Arg145Gln) rs397516349 0.00002
NM_000432.4(MYL2):c.184A>T (p.Lys62Ter) rs201728041 0.00002
NM_000540.3(RYR1):c.1201C>T (p.Arg401Cys) rs193922764 0.00002
NM_001267550.2(TTN):c.107377+1G>A rs112188483 0.00002
NM_001267550.2(TTN):c.52406-2A>C rs753798236 0.00002
NM_001371904.1(APOA5):c.913C>T (p.Gln305Ter) rs1403296082 0.00002
NM_003560.4(PLA2G6):c.2215G>C (p.Asp739His) rs587784349 0.00002
NM_004999.4(MYO6):c.826C>T (p.Arg276Ter) rs727503326 0.00002
NM_024422.6(DSC2):c.943-1G>A rs796756333 0.00002
NM_024675.4(PALB2):c.212-2A>G rs730881879 0.00002
NM_024675.4(PALB2):c.3113G>A (p.Trp1038Ter) rs180177132 0.00002
NM_032607.3(CREB3L3):c.718G>A (p.Glu240Lys) rs778428363 0.00002
NM_053025.4(MYLK):c.1517-2A>G rs770709606 0.00002
NM_212482.4(FN1):c.2112A>G (p.Thr704=) rs1326049626 0.00002
NM_000053.4(ATP7B):c.2297C>T (p.Thr766Met) rs121907997 0.00001
NM_000053.4(ATP7B):c.2621C>T (p.Ala874Val) rs121907994 0.00001
NM_000093.5(COL5A1):c.2818G>A (p.Gly940Ser) rs1131691874 0.00001
NM_000138.5(FBN1):c.2926C>T (p.Arg976Cys) rs548296552 0.00001
NM_000138.5(FBN1):c.6724C>T (p.Arg2242Cys) rs779749926 0.00001
NM_000152.5(GAA):c.1799G>A (p.Arg600His) rs377544304 0.00001
NM_000152.5(GAA):c.670C>T (p.Arg224Trp) rs757700700 0.00001
NM_000157.4(GBA1):c.604C>T (p.Arg202Ter) rs1009850780 0.00001
NM_000157.4(GBA1):c.625C>T (p.Arg209Cys) rs398123532 0.00001
NM_000157.4(GBA1):c.764T>A (p.Phe255Tyr) rs74500255 0.00001
NM_000218.3(KCNQ1):c.1142G>A (p.Cys381Tyr) rs368507376 0.00001
NM_000218.3(KCNQ1):c.1765G>A (p.Gly589Ser) rs780676796 0.00001
NM_000218.3(KCNQ1):c.1781G>A (p.Arg594Gln) rs199472815 0.00001
NM_000218.3(KCNQ1):c.575G>A (p.Arg192His) rs199472698 0.00001
NM_000218.3(KCNQ1):c.604G>A (p.Asp202Asn) rs199472702 0.00001
NM_000218.3(KCNQ1):c.776G>A (p.Arg259His) rs199472720 0.00001
NM_000218.3(KCNQ1):c.806G>A (p.Gly269Asp) rs120074194 0.00001
NM_000237.3(LPL):c.397C>T (p.Gln133Ter) rs118204058 0.00001
NM_000237.3(LPL):c.829G>A (p.Asp277Asn) rs118204068 0.00001
NM_000238.4(KCNH2):c.188C>A (p.Pro63His) rs766379103 0.00001
NM_000238.4(KCNH2):c.2350C>T (p.Arg784Trp) rs12720441 0.00001
NM_000256.3(MYBPC3):c.1805C>T (p.Thr602Ile) rs730880551 0.00001
NM_000256.3(MYBPC3):c.3491-2A>T rs397516022 0.00001
NM_000257.4(MYH7):c.1633G>A (p.Asp545Asn) rs564101364 0.00001
NM_000257.4(MYH7):c.3169G>A (p.Gly1057Ser) rs397516179 0.00001
NM_000257.4(MYH7):c.5530G>A (p.Glu1844Lys) rs730880821 0.00001
NM_000335.5(SCN5A):c.1045G>A (p.Asp349Asn) rs779687673 0.00001
NM_000335.5(SCN5A):c.2441G>A (p.Arg814Gln) rs199473584 0.00001
NM_000335.5(SCN5A):c.4744C>T (p.Arg1582Cys) rs45514691 0.00001
NM_000335.5(SCN5A):c.4931C>T (p.Thr1644Met) rs199473288 0.00001
NM_000350.3(ABCA4):c.32T>C (p.Leu11Pro) rs62645946 0.00001
NM_000363.5(TNNI3):c.497C>T (p.Ser166Phe) rs727504242 0.00001
NM_000393.5(COL5A2):c.2104G>A (p.Gly702Arg) rs772811492 0.00001
NM_000527.5(LDLR):c.1238C>T (p.Thr413Met) rs368562025 0.00001
NM_000527.5(LDLR):c.1576C>T (p.Pro526Ser) rs730882106 0.00001
NM_000527.5(LDLR):c.190+4A>T rs769446356 0.00001
NM_000527.5(LDLR):c.2029T>C (p.Cys677Arg) rs775092314 0.00001
NM_000527.5(LDLR):c.301G>A (p.Glu101Lys) rs144172724 0.00001
NM_000527.5(LDLR):c.949G>A (p.Glu317Lys) rs746834464 0.00001
NM_000540.3(RYR1):c.10768G>A (p.Glu3590Lys) rs746611627 0.00001
NM_000540.3(RYR1):c.1597C>T (p.Arg533Cys) rs193922768 0.00001
NM_000540.3(RYR1):c.7036G>A (p.Val2346Met) rs193922799 0.00001
NM_000719.7(CACNA1C):c.2T>C (p.Met1Thr) rs761378545 0.00001
NM_000890.5(KCNJ5):c.214C>T (p.Arg72Trp) rs757877367 0.00001
NM_000891.3(KCNJ2):c.845T>G (p.Leu282Trp) rs758092571 0.00001
NM_001005242.3(PKP2):c.1379-1998C>T rs151212477 0.00001
NM_001013838.3(CARMIL2):c.882del (p.Leu295fs) rs767941878 0.00001
NM_001035.3(RYR2):c.14869T>A (p.Cys4957Ser) rs758500988 0.00001
NM_001037.5(SCN1B):c.266G>A (p.Arg89His) rs138381632 0.00001
NM_001134363.3(RBM20):c.1901G>A (p.Arg634Gln) rs267607001 0.00001
NM_001151.4(SLC25A4):c.368C>A (p.Ala123Asp) rs121912683 0.00001
NM_001267550.2(TTN):c.10303+2T>C rs371596417 0.00001
NM_001267550.2(TTN):c.14093-1G>A rs869312099 0.00001
NM_001267550.2(TTN):c.26482+1G>C rs1440418037 0.00001
NM_001267550.2(TTN):c.67349-2A>C rs753948675 0.00001
NM_001267550.2(TTN):c.78178G>T (p.Glu26060Ter) rs794729289 0.00001
NM_001267550.2(TTN):c.89258T>A (p.Leu29753His) rs369279892 0.00001
NM_001267550.2(TTN):c.95195C>T (p.Pro31732Leu) rs753334568 0.00001
NM_001276345.2(TNNT2):c.601-1G>A rs483352835 0.00001
NM_001289808.2(CRYAB):c.2T>C (p.Met1Thr) rs577253222 0.00001
NM_001371904.1(APOA5):c.888del (p.Ile296fs) rs1477198098 0.00001
NM_001457.4(FLNB):c.6794A>G (p.Lys2265Arg) rs757365085 0.00001
NM_001486.4(GCKR):c.1312C>T (p.His438Tyr) rs745955443 0.00001
NM_001943.5(DSG2):c.3G>A (p.Met1Ile) rs1021457619 0.00001
NM_002470.4(MYH3):c.1260+18G>A rs771181525 0.00001
NM_002524.5(NRAS):c.35G>A (p.Gly12Asp) rs121913237 0.00001
NM_002693.3(POLG):c.2870C>T (p.Ala957Val) rs753160398 0.00001
NM_003098.3(SNTA1):c.1169C>T (p.Ala390Val) rs121434500 0.00001
NM_003280.3(TNNC1):c.91G>A (p.Ala31Thr) rs397514616 0.00001
NM_003476.5(CSRP3):c.364C>T (p.Arg122Ter) rs902082118 0.00001
NM_003476.5(CSRP3):c.369T>A (p.Cys123Ter) rs1216811263 0.00001
NM_003673.4(TCAP):c.66G>A (p.Trp22Ter) rs141019458 0.00001
NM_005630.3(SLCO2A1):c.1259G>T (p.Cys420Phe) rs387907295 0.00001
NM_014875.3(KIF14):c.103C>T (p.Arg35Ter) rs774318019 0.00001
NM_015046.7(SETX):c.994C>T (p.Arg332Trp) rs29001665 0.00001
NM_020433.5(JPH2):c.421T>C (p.Tyr141His) rs387906897 0.00001
NM_020774.4(MIB1):c.1417C>T (p.Gln473Ter) rs1386314249 0.00001
NM_022773.4(LMF1):c.359C>G (p.Ser120Ter) rs768161861 0.00001
NM_022773.4(LMF1):c.697C>T (p.Arg233Ter) rs199953320 0.00001
NM_024422.6(DSC2):c.631-2A>G rs397514042 0.00001
NM_033056.4(PCDH15):c.4592_4627dup (p.Ser1543Ter) rs1442366836 0.00001
NM_170707.4(LMNA):c.1303C>T (p.Arg435Cys) rs150840924 0.00001
NM_170707.4(LMNA):c.949G>A (p.Glu317Lys) rs56816490 0.00001
NM_206933.4(USH2A):c.14546G>A (p.Trp4849Ter) rs1656936749 0.00001
NM_206933.4(USH2A):c.9799T>C (p.Cys3267Arg) rs111033263 0.00001
NM_000051.4(ATM):c.3245_3247delinsTGAT (p.His1082fs) rs587776549
NM_000051.4(ATM):c.5319+2T>C rs1555105842
NM_000051.4(ATM):c.7638_7646del (p.Arg2547_Ser2549del) rs587776547
NM_000057.4(BLM):c.2207_2212delinsTAGATTC (p.Tyr736fs) rs113993962
NM_000059.4(BRCA2):c.4154C>G (p.Ser1385Ter) rs886038101
NM_000063.6(C2):c.841_849+19del rs9332736
NM_000077.5(CDKN2A):c.-16GGCGGCGGGGAGCAGCATGGAGCC[3] (p.Ala4_Pro11dup) rs587780668
NM_000077.5(CDKN2A):c.238C>T (p.Arg80Ter) rs121913388
NM_000093.5(COL5A1):c.2989G>A (p.Gly997Ser) rs863223445
NM_000095.3(COMP):c.2156G>A (p.Gly719Asp) rs137852655
NM_000138.5(FBN1):c.1379G>A (p.Cys460Tyr) rs1597581001
NM_000152.5(GAA):c.1650dup (p.Thr551fs) rs766398206
NM_000152.5(GAA):c.2237G>C (p.Trp746Ser) rs752921215
NM_000152.5(GAA):c.2238G>C (p.Trp746Cys) rs1800312
NM_000152.5(GAA):c.546G>C (p.Thr182=) rs143523371
NM_000152.5(GAA):c.766_785delinsC (p.Tyr256fs) rs786204532
NM_000157.4(GBA1):c.1448T>C (p.Leu483Pro) rs421016
NM_000162.5(GCK):c.214G>A (p.Gly72Arg) rs193922289
NM_000162.5(GCK):c.952G>A (p.Gly318Arg) rs193922340
NM_000169.3(GLA):c.983G>T (p.Gly328Val) rs28935492
NM_000188.3(HK1):c.1334C>T (p.Ser445Leu) rs1064794848
NM_000218.3(KCNQ1):c.1075C>T (p.Gln359Ter) rs397508075
NM_000218.3(KCNQ1):c.1097G>A (p.Arg366Gln) rs199473410
NM_000218.3(KCNQ1):c.1771C>T (p.Arg591Cys) rs199473483
NM_000218.3(KCNQ1):c.1893dup (p.Arg632fs) rs397508104
NM_000218.3(KCNQ1):c.797T>C (p.Leu266Pro) rs199473460
NM_000219.6(KCNE1):c.199C>T (p.Arg67Cys) rs199473645
NM_000237.3(LPL):c.1250G>A (p.Trp417Ter) rs2128839600
NM_000238.4(KCNH2):c.1946-1G>A rs794728375
NM_000243.3(MEFV):c.2230G>T (p.Ala744Ser) rs61732874
NM_000250.2(MPO):c.1555_1568del (p.Met519fs) rs536522394
NM_000256.3(MYBPC3):c.3330+5G>C rs373746463
NM_000256.3(MYBPC3):c.3628-41_3628-17del rs36212066
NM_000257.4(MYH7):c.1750G>C (p.Gly584Arg) rs121913626
NM_000258.3(MYL3):c.170C>G (p.Ala57Gly) rs139794067
NM_000335.5(SCN5A):c.3097C>T (p.Gln1033Ter) rs2125871040
NM_000363.5(TNNI3):c.204del (p.Arg69fs) rs727504872
NM_000363.5(TNNI3):c.529AAG[1] (p.Lys178del) rs397516351
NM_000432.4(MYL2):c.188del (p.Asn63fs) rs1177936172
NM_000432.4(MYL2):c.3+1G>T rs730880948
NM_000432.4(MYL2):c.64G>A (p.Glu22Lys) rs104894368
NM_000435.3(NOTCH3):c.3944G>A (p.Cys1315Tyr) rs1432396805
NM_000484.4(APP):c.2030A>G (p.His677Arg) rs63749953
NM_000492.3(CFTR):c.1521_1523del (p.Phe508del) rs113993960
NM_000492.4(CFTR):c.350G>A (p.Arg117His) rs78655421
NM_000516.7(GNAS):c.310G>T (p.Glu104Ter) rs2146178875
NM_000527.5(LDLR):c.1027G>A (p.Gly343Ser)
NM_000527.5(LDLR):c.1103G>A (p.Cys368Tyr)
NM_000527.5(LDLR):c.1145G>T (p.Gly382Val) rs752951310
NM_000527.5(LDLR):c.1432G>A (p.Gly478Arg)
NM_000527.5(LDLR):c.1745T>C (p.Leu582Pro) rs875989930
NM_000527.5(LDLR):c.2438G>A (p.Trp813Ter) rs879255212
NM_000540.3(RYR1):c.14416A>G (p.Asn4806Asp) rs886039586
NM_000540.3(RYR1):c.7039GAG[1] (p.Glu2348del) rs121918596
NM_000540.3(RYR1):c.7463_7475del (p.Pro2488fs) rs794727683
NM_000551.4(VHL):c.335A>G (p.Tyr112Cys) rs869025633
NM_000834.5(GRIN2B):c.1177C>T (p.Arg393Ter) rs1555112396
NM_001005242.3(PKP2):c.144_165del (p.Gln49fs) rs930283260
NM_001018005.2(TPM1):c.574G>A (p.Glu192Lys) rs199476315
NM_001042492.3(NF1):c.7153AACTTT[1] (p.2385NF[1]) rs864622639
NM_001048174.2(MUTYH):c.307T>A (p.Trp103Arg) rs730881832
NM_001126128.2(PROK2):c.297dup (p.Gly100fs) rs768413190
NM_001134363.3(RBM20):c.3267dup (p.Ile1090fs) rs760334885
NM_001148.6(ANK2):c.2944C>T (p.Arg982Ter) rs1588354762
NM_001267550.2(TTN):c.103360del (p.Glu34454fs) rs760768093
NM_001267550.2(TTN):c.30356_30359del (p.Glu10119fs) rs2154290001
NM_001267550.2(TTN):c.3351dup (p.Ser1118fs) rs2092847994
NM_001267550.2(TTN):c.36087_36090del (p.Ser12030fs) rs2154260181
NM_001267550.2(TTN):c.38442dup (p.Pro12815fs) rs752101551
NM_001267550.2(TTN):c.40558G>C (p.Val13520Leu) rs587780488
NM_001267550.2(TTN):c.4724_4728del (p.Met1575fs) rs756433029
NM_001267550.2(TTN):c.94180delinsTCTAGCAG (p.Pro31394fs) rs727503547
NM_001276345.2(TNNT2):c.508GAG[3] (p.Glu173del) rs397516470
NM_001282225.2(ADA2):c.140G>T (p.Gly47Val) rs200930463
NM_001353921.2(ARHGEF9):c.332G>A (p.Arg111Gln) rs1556401714
NM_001363711.2(DUOX2):c.3751del (p.Leu1251fs) rs1566971699
NM_001374258.1(BRAF):c.1523T>C (p.Phe508Ser) rs397507473
NM_001399.5(EDA):c.1069C>T (p.Arg357Trp) rs886039347
NM_001737.5(C9):c.1209_1222del (p.Asp403fs) rs767328870
NM_001849.4(COL6A2):c.3058T>C (p.Ter1020Gln) rs886044576
NM_001927.4(DES):c.985C>T (p.Gln329Ter) rs759320891
NM_001943.4(DSG2):c.1015del rs794728094
NM_001943.5(DSG2):c.1319_1320del (p.Val440fs) rs775256998
NM_001943.5(DSG2):c.2434G>T (p.Gly812Cys) rs121913010
NM_001943.5(DSG2):c.3059_3062del (p.Glu1020fs) rs397516706
NM_001943.5(DSG2):c.523+1G>A rs553299589
NM_001943.5(DSG2):c.829_840del (p.Leu277_Met280del) rs794728093
NM_002693.3(POLG):c.830A>T (p.His277Leu) rs138929605
NM_002834.5(PTPN11):c.217A>C (p.Thr73Pro) rs397507513
NM_002834.5(PTPN11):c.5C>T (p.Thr2Ile) rs267606990
NM_003476.5(CSRP3):c.286_287del (p.Pro96fs) rs960577385
NM_003560.4(PLA2G6):c.319del (p.Leu107fs) rs776376695
NM_003924.4(PHOX2B):c.741_758dup (p.Ala255_Ala260dup) rs771383153
NM_004092.4(ECHS1):c.410_411del (p.Tyr137fs) rs777218310
NM_004722.4(AP4M1):c.1321C>T (p.Arg441Ter) rs886041126
NM_004960.4(FUS):c.1394-2del rs1555509569
NM_004985.5(KRAS):c.179G>T (p.Gly60Val) rs727503108
NM_006073.4(TRDN):c.1166-1G>A rs1298986609
NM_006073.4(TRDN):c.1794del (p.Lys598fs) rs1412913007
NM_006231.4(POLE):c.5379-15C>T rs2138511721
NM_006245.4(PPP2R5D):c.619T>C (p.Trp207Arg) rs869320691
NM_007294.4(BRCA1):c.4675+1G>A rs80358044
NM_014000.3(VCL):c.1225C>T (p.Arg409Ter) rs202005455
NM_015311.3(OBSL1):c.4535dup (p.Ile1513fs) rs1434485676
NM_017946.4(FKBP14):c.362dup (p.Glu122fs) rs542489955
NM_018489.3(ASH1L):c.2134dup (p.Arg712fs) rs1558150870
NM_018714.3(COG1):c.2665dup (p.Arg889fs) rs747606976
NM_020207.7(ERCC6L2):c.1051_1054del (p.Ala351fs) rs1829586683
NM_020738.4(KIDINS220):c.4417dup (p.Leu1473fs) rs34141362
NM_022162.3(NOD2):c.3019dup (p.Leu1007fs) rs2066847
NM_022436.3(ABCG5):c.575del (p.Gly192fs) rs762031825
NM_024422.6(DSC2):c.2398del (p.Ala800fs) rs397517399
NM_024426.6(WT1):c.1354+5G>A rs2132919246
NM_024757.5(EHMT1):c.82G>C (p.Glu28Gln) rs1342402816
NM_025137.4(SPG11):c.6737_6740del (p.Ile2246fs) rs312262781
NM_032578.4(MYPN):c.1273G>T (p.Gly425Ter) rs777033025
NM_032607.3(CREB3L3):c.523C>T (p.Arg175Ter) rs531932249
NM_033056.4(PCDH15):c.4409_4413del (p.Asn1470fs) rs749884609
NM_033056.4(PCDH15):c.5364_5373del (p.Pro1789fs) rs753690225
NM_033337.3(CAV3):c.10_17del (p.Glu4fs) rs778914298
NM_033337.3(CAV3):c.57C>A (p.Cys19Ter) rs1182984115
NM_130797.4(DPP6):c.157_184del (p.Pro53fs) rs2129062565
NM_152296.5(ATP1A3):c.569C>T (p.Pro190Leu) rs1599723609
NM_152419.3(HGSNAT):c.710C>A (p.Pro237Gln) rs727503962
NM_170707.4(LMNA):c.1146C>T (p.Gly382=) rs57508089
NM_170707.4(LMNA):c.674G>A (p.Arg225Gln) rs199474724
NM_174916.3(UBR1):c.2190+20T>C rs2141316539

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.