ClinVar Miner

Variants in gene LDB3 with conflicting interpretations

See also:
Y axis minimum submission review status: Y axis collection method:
X axis minimum submission review status: X axis collection method:
Minimum conflict level:
Gene type:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
492 60 0 30 21 0 3 51

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

pathogenic likely pathogenic uncertain significance likely benign benign
pathogenic 0 0 1 0 0
likely pathogenic 0 0 2 1 0
uncertain significance 1 2 0 19 3
likely benign 0 1 19 0 30
benign 0 0 3 30 0

All variants with conflicting interpretations #

Total variants: 51
Download table as spreadsheet
HGVS dbSNP
NM_007078.3(LDB3):c.-24+8T>C rs2803558
NM_007078.3(LDB3):c.1014A>G (p.Thr338=) rs150209221
NM_007078.3(LDB3):c.1035C>T (p.Ile345=) rs121908336
NM_007078.3(LDB3):c.1036G>A (p.Ala346Thr) rs201968775
NM_007078.3(LDB3):c.1049C>T (p.Thr350Ile) rs200796750
NM_007078.3(LDB3):c.1051A>G (p.Thr351Ala) rs138251566
NM_007078.3(LDB3):c.1231+30C>G rs11597201
NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[1] (p.434APAYTPSP[1]) rs397517209
NM_007078.3(LDB3):c.1335C>T (p.Tyr445=) rs587781024
NM_007078.3(LDB3):c.1422G>A (p.Ser474=) rs142625982
NM_007078.3(LDB3):c.1460G>A (p.Arg487His) rs146265188
NM_007078.3(LDB3):c.147G>A (p.Val49=) rs45591834
NM_007078.3(LDB3):c.1535A>C (p.Gln512Pro) rs138951890
NM_007078.3(LDB3):c.1594G>C (p.Ala532Pro) rs143764931
NM_007078.3(LDB3):c.1609del (p.Gln537fs) rs727503129
NM_007078.3(LDB3):c.163G>A (p.Val55Ile) rs3740343
NM_007078.3(LDB3):c.1672A>G (p.Ile558Val) rs372331627
NM_007078.3(LDB3):c.1697T>G (p.Met566Arg) rs566463138
NM_007078.3(LDB3):c.1858-10T>C rs202208256
NM_007078.3(LDB3):c.1956C>T (p.Asp652=) rs139213290
NM_007078.3(LDB3):c.2016C>T (p.Cys672=) rs45578640
NM_007078.3(LDB3):c.273G>A (p.Thr91=) rs45613039
NM_007078.3(LDB3):c.295C>T (p.Pro99Ser) rs201693259
NM_007078.3(LDB3):c.302C>T (p.Pro101Leu) rs45592139
NM_007078.3(LDB3):c.352G>A (p.Val118Met) rs35507268
NM_007078.3(LDB3):c.378G>A (p.Ala126=) rs149872184
NM_007078.3(LDB3):c.465C>T (p.Leu155=) rs45516997
NM_007078.3(LDB3):c.466G>A (p.Ala156Thr) rs200596619
NM_007078.3(LDB3):c.493C>T (p.Arg165Trp) rs45610637
NM_007078.3(LDB3):c.566C>T (p.Ser189Leu) rs45487699
NM_007078.3(LDB3):c.576G>A (p.Pro192=) rs45543741
NM_007078.3(LDB3):c.668C>T (p.Ser223Leu) rs375306400
NM_007078.3(LDB3):c.689+10G>A rs45563234
NM_007078.3(LDB3):c.689+9C>T rs727503124
NM_007078.3(LDB3):c.690-4A>G rs45529531
NM_007078.3(LDB3):c.714C>T (p.Ala238=) rs727503125
NM_007078.3(LDB3):c.723C>T (p.Ser241=) rs200580597
NM_007078.3(LDB3):c.752A>G (p.Lys251Arg) rs34423165
NM_007078.3(LDB3):c.793C>T (p.Arg265Cys) rs45521338
NM_007078.3(LDB3):c.794G>A (p.Arg265His) rs45458895
NM_007078.3(LDB3):c.860-15C>T rs727503126
NM_007078.3(LDB3):c.896+6669TC[12] rs71019410
NM_007078.3(LDB3):c.896+6722G>A rs144445130
NM_007078.3(LDB3):c.896+6731C>T rs372789789
NM_007078.3(LDB3):c.896+6753C>T rs121908335
NM_007078.3(LDB3):c.897-10G>A rs77304928
NM_007078.3(LDB3):c.897-16G>C rs45513100
NM_007078.3(LDB3):c.900C>A (p.Thr300=) rs760071118
NM_007078.3(LDB3):c.954C>T (p.Pro318=) rs45603139
NM_007078.3(LDB3):c.991G>A (p.Ala331Thr) rs749520121
NM_007078.3(LDB3):c.993G>A (p.Ala331=) rs140347820

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.