ClinVar Miner

Variants in gene LDB3 with conflicting interpretations

See also:
Y axis minimum submission review status: Y axis collection method:
X axis minimum submission review status: X axis collection method:
Minimum conflict level:
Gene type:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
929 160 0 55 46 0 2 97

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

pathogenic likely pathogenic uncertain significance likely benign benign
pathogenic 0 0 1 0 0
likely pathogenic 0 0 1 0 0
uncertain significance 1 1 0 44 9
likely benign 0 0 44 0 55
benign 0 0 9 55 0

All variants with conflicting interpretations #

Total variants: 97
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_007078.3(LDB3):c.-24+8T>C rs2803558 0.72185
NM_007078.3(LDB3):c.1231+30C>G rs11597201 0.05370
NM_007078.3(LDB3):c.1074C>T (p.Ala358=) rs45459491 0.02688
NM_007078.3(LDB3):c.752A>G (p.Lys251Arg) rs34423165 0.01671
NM_007078.3(LDB3):c.609G>A (p.Ser203=) rs45531131 0.01554
NM_007078.3(LDB3):c.1231+24G>A rs45477098 0.00986
NM_007078.3(LDB3):c.302C>T (p.Pro101Leu) rs45592139 0.00960
NM_007078.3(LDB3):c.1506G>A (p.Pro502=) rs45579241 0.00941
NM_007078.3(LDB3):c.690-4A>G rs45529531 0.00427
NM_007078.3(LDB3):c.352G>A (p.Val118Met) rs35507268 0.00408
NM_007078.3(LDB3):c.1263G>A (p.Gly421=) rs139834701 0.00369
NM_007078.3(LDB3):c.147G>A (p.Val49=) rs45591834 0.00312
NM_007078.3(LDB3):c.163G>A (p.Val55Ile) rs3740343 0.00292
NM_007078.3(LDB3):c.2016C>T (p.Cys672=) rs45578640 0.00288
NM_007078.3(LDB3):c.-23-32C>A rs34972863 0.00282
NM_007078.3(LDB3):c.1460G>A (p.Arg487His) rs146265188 0.00189
NM_007078.3(LDB3):c.954C>T (p.Pro318=) rs45603139 0.00168
NM_007078.3(LDB3):c.1422G>A (p.Ser474=) rs142625982 0.00136
NM_007078.3(LDB3):c.689+10G>A rs45563234 0.00125
NM_007078.3(LDB3):c.897-6834C>T rs185972751 0.00101
NM_007078.3(LDB3):c.1653C>T (p.Cys551=) rs45581435 0.00096
NM_007078.3(LDB3):c.993G>A (p.Ala331=) rs140347820 0.00095
NM_007078.3(LDB3):c.295C>T (p.Pro99Ser) rs201693259 0.00088
NM_007078.3(LDB3):c.466G>A (p.Ala156Thr) rs200596619 0.00082
NM_007078.3(LDB3):c.1535A>C (p.Gln512Pro) rs138951890 0.00080
NM_001368067.1(LDB3):c.780C>T (p.Asn260=) rs372789789 0.00061
NM_007078.3(LDB3):c.1036G>A (p.Ala346Thr) rs201968775 0.00054
NM_007078.3(LDB3):c.566C>T (p.Ser189Leu) rs45487699 0.00049
NM_007078.3(LDB3):c.1312A>G (p.Thr438Ala) rs111941389 0.00048
NM_001368067.1(LDB3):c.771G>A (p.Thr257=) rs144445130 0.00040
NM_007078.3(LDB3):c.1594G>C (p.Ala532Pro) rs143764931 0.00036
NM_007078.3(LDB3):c.664G>A (p.Ala222Thr) rs139922045 0.00036
NM_007078.3(LDB3):c.1035C>T (p.Ile345=) rs121908336 0.00029
NM_007078.3(LDB3):c.1051A>G (p.Thr351Ala) rs138251566 0.00026
NM_007078.3(LDB3):c.2092G>A (p.Ala698Thr) rs45577134 0.00026
NM_007078.3(LDB3):c.1971C>T (p.Cys657=) rs140552419 0.00025
NM_007078.3(LDB3):c.1606G>A (p.Val536Ile) rs113817827 0.00024
NM_007078.3(LDB3):c.1049C>T (p.Thr350Ile) rs200796750 0.00022
NM_007078.3(LDB3):c.1910C>T (p.Ala637Val) rs141569007 0.00018
NM_007078.3(LDB3):c.1335C>T (p.Tyr445=) rs587781024 0.00017
NM_007078.3(LDB3):c.1858-10T>C rs202208256 0.00017
NM_007078.3(LDB3):c.897-14T>C rs763081924 0.00014
NM_007078.3(LDB3):c.1956C>T (p.Asp652=) rs139213290 0.00013
NM_007078.3(LDB3):c.342C>T (p.Asn114=) rs151166414 0.00013
NM_007078.3(LDB3):c.714C>T (p.Ala238=) rs727503125 0.00013
NM_007078.3(LDB3):c.794G>A (p.Arg265His) rs45458895 0.00011
NM_007078.3(LDB3):c.897-16G>C rs45513100 0.00011
NM_007078.3(LDB3):c.273G>A (p.Thr91=) rs45613039 0.00010
NM_007078.3(LDB3):c.891G>A (p.Arg297=) rs374336814 0.00010
NM_007078.3(LDB3):c.1075G>A (p.Asp359Asn) rs557956141 0.00008
NM_007078.3(LDB3):c.715G>A (p.Val239Ile) rs201417512 0.00008
NM_007078.3(LDB3):c.1521C>T (p.Thr507=) rs200838004 0.00006
NM_007078.3(LDB3):c.1697T>G (p.Met566Arg) rs566463138 0.00006
NM_007078.3(LDB3):c.689+9C>T rs727503124 0.00006
NM_007078.3(LDB3):c.668C>T (p.Ser223Leu) rs375306400 0.00005
NM_007078.3(LDB3):c.793C>T (p.Arg265Cys) rs45521338 0.00005
NM_007078.3(LDB3):c.992C>T (p.Ala331Val) rs368053281 0.00005
NM_001368067.1(LDB3):c.802C>T (p.Arg268Cys) rs121908335 0.00004
NM_007078.3(LDB3):c.1225C>A (p.Gln409Lys) rs139104492 0.00004
NM_007078.3(LDB3):c.1403A>G (p.Asn468Ser) rs730880129 0.00004
NM_007078.3(LDB3):c.1667A>G (p.Asn556Ser) rs372583830 0.00004
NM_007078.3(LDB3):c.2017G>A (p.Asp673Asn) rs45514002 0.00004
NM_007078.3(LDB3):c.944C>T (p.Pro315Leu) rs371649487 0.00004
NM_007078.3(LDB3):c.1386C>T (p.Thr462=) rs764330273 0.00003
NM_007078.3(LDB3):c.1672A>G (p.Ile558Val) rs372331627 0.00003
NM_007078.3(LDB3):c.398C>T (p.Pro133Leu) rs200239096 0.00003
NM_007078.3(LDB3):c.897-10G>A rs77304928 0.00003
NM_007078.3(LDB3):c.900C>A (p.Thr300=) rs760071118 0.00003
NM_007078.3(LDB3):c.1256C>A (p.Ser419Tyr) rs368888118 0.00002
NM_007078.3(LDB3):c.162C>T (p.Gly54=) rs757856121 0.00002
NM_007078.3(LDB3):c.246-8T>A rs750671538 0.00002
NM_007078.3(LDB3):c.1437G>C (p.Gly479=) rs960379328 0.00001
NM_007078.3(LDB3):c.2091C>T (p.Cys697=) rs571356142 0.00001
NM_007078.3(LDB3):c.443G>A (p.Arg148Gln) rs751254270 0.00001
NM_007078.3(LDB3):c.550A>G (p.Lys184Glu) rs774886148 0.00001
NM_007078.3(LDB3):c.723C>T (p.Ser241=) rs200580597 0.00001
NM_007078.3(LDB3):c.991G>A (p.Ala331Thr) rs749520121 0.00001
NM_007078.3(LDB3):c.*13G>T rs397517207
NM_007078.3(LDB3):c.1232-12del rs752301693
NM_007078.3(LDB3):c.1232-12dup rs752301693
NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[1] (p.434APAYTPSP[1]) rs397517209
NM_007078.3(LDB3):c.1296CCCTGCCCCTGCCTACACCCCCTC[3] (p.434APAYTPSP[3]) rs397517209
NM_007078.3(LDB3):c.1318T>C (p.Ser440Pro) rs868594949
NM_007078.3(LDB3):c.1325C>T (p.Ala442Val) rs786205349
NM_007078.3(LDB3):c.1538C>A (p.Thr513Asn) rs748433510
NM_007078.3(LDB3):c.1609del (p.Gln537fs) rs727503129
NM_007078.3(LDB3):c.2130C>T (p.Tyr710=) rs752415111
NM_007078.3(LDB3):c.465C>T (p.Leu155=) rs45516997
NM_007078.3(LDB3):c.576G>A (p.Pro192=) rs45543741
NM_007078.3(LDB3):c.690-17CT[3] rs544039308
NM_007078.3(LDB3):c.860-15C>T rs727503126
NM_007078.3(LDB3):c.896+6669TC[11] rs71019410
NM_007078.3(LDB3):c.896+6669TC[12] rs71019410
NM_007078.3(LDB3):c.896+6669TC[13] rs71019410
NM_007078.3(LDB3):c.896+6694del rs796095449
NM_007078.3(LDB3):c.897-6707G>A rs537660741
NM_007078.3(LDB3):c.94-20C>T rs779928559

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.