ClinVar Miner

Variants in gene MAGEL2 with conflicting interpretations

Y axis minimum submission review status: Y axis collection method:
X axis minimum submission review status: X axis collection method:
Minimum conflict level:
Gene type:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic) 		Variants with a confidence conflict
(e.g. benign vs likely benign) 		Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects) 		Variants with a clinically significant conflict
(e.g. benign vs pathogenic) 		Variants with any conflict
701 124 0 47 36 0 1 73

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

pathogenic likely pathogenic uncertain significance likely benign benign
pathogenic 0 3 0 0 0
likely pathogenic 3 0 1 0 0
uncertain significance 0 1 0 33 14
likely benign 0 0 33 0 44
benign 0 0 14 44 0

All variants with conflicting interpretations #

Total variants: 73
Download table as spreadsheet
HGVS dbSNP gnomAD frequency
NM_019066.5(MAGEL2):c.3151C>A (p.Leu1051Ile) rs2233070 0.03565
NM_019066.5(MAGEL2):c.901C>T (p.Pro301Ser) rs138154793 0.01279
NM_019066.5(MAGEL2):c.2611G>T (p.Ala871Ser) rs2233066 0.00969
NM_019066.5(MAGEL2):c.2612C>T (p.Ala871Val) rs74004212 0.00969
NM_019066.5(MAGEL2):c.3229T>C (p.Leu1077=) rs2233071 0.00936
NM_019066.5(MAGEL2):c.1446T>C (p.Ala482=) rs2233065 0.00866
NM_019066.5(MAGEL2):c.383T>C (p.Leu128Pro) rs191559595 0.00841
NM_019066.5(MAGEL2):c.1079C>T (p.Ala360Val) rs111759069 0.00733
NM_019066.5(MAGEL2):c.1038G>C (p.Arg346Ser) rs115892604 0.00605
NM_019066.5(MAGEL2):c.678T>G (p.Gly226=) rs367737053 0.00589
NM_019066.5(MAGEL2):c.2633C>T (p.Pro878Leu) rs2233067 0.00519
NM_019066.5(MAGEL2):c.3017C>G (p.Thr1006Ser) rs138628273 0.00437
NM_019066.5(MAGEL2):c.1286C>T (p.Pro429Leu) rs2233061 0.00353
NM_019066.5(MAGEL2):c.225G>A (p.Pro75=) rs564216035 0.00309
NM_019066.5(MAGEL2):c.2784C>T (p.Ile928=) rs189752384 0.00284
NM_019066.5(MAGEL2):c.2886C>T (p.Ser962=) rs2233068 0.00262
NM_019066.5(MAGEL2):c.1470G>A (p.Pro490=) rs771501846 0.00157
NM_019066.5(MAGEL2):c.853G>A (p.Gly285Arg) rs143908070 0.00147
NM_019066.5(MAGEL2):c.2074G>A (p.Val692Ile) rs200926181 0.00142
NM_019066.5(MAGEL2):c.3657G>A (p.Ala1219=) rs140288382 0.00140
NM_019066.5(MAGEL2):c.1304C>T (p.Pro435Leu) rs2233062 0.00132
NM_019066.5(MAGEL2):c.406G>A (p.Gly136Arg) rs570335069 0.00131
NM_019066.5(MAGEL2):c.385A>G (p.Met129Val) rs188762916 0.00109
NM_019066.5(MAGEL2):c.639A>C (p.Pro213=) rs886042708 0.00091
NM_019066.5(MAGEL2):c.2281G>C (p.Ala761Pro) rs146970674 0.00083
NM_019066.5(MAGEL2):c.2362A>T (p.Ser788Cys) rs113329438 0.00083
NM_019066.5(MAGEL2):c.3690G>C (p.Glu1230Asp) rs34875116 0.00083
NM_019066.5(MAGEL2):c.687G>A (p.Met229Ile) rs574367928 0.00080
NM_019066.5(MAGEL2):c.2290G>A (p.Ala764Thr) rs201984254 0.00072
NM_019066.5(MAGEL2):c.959C>A (p.Ala320Asp) rs541606785 0.00070
NM_019066.5(MAGEL2):c.919C>T (p.Pro307Ser) rs555920534 0.00063
NM_019066.5(MAGEL2):c.1887C>T (p.Pro629=) rs112088736 0.00061
NM_019066.5(MAGEL2):c.1404C>A (p.Ala468=) rs2233064 0.00049
NM_019066.5(MAGEL2):c.1175C>T (p.Thr392Met) rs781777662 0.00040
NM_019066.5(MAGEL2):c.1423G>T (p.Ala475Ser) rs760039339 0.00040
NM_019066.5(MAGEL2):c.41C>A (p.Pro14Gln) rs769643348 0.00038
NM_019066.5(MAGEL2):c.135T>A (p.Asp45Glu) rs1273933786 0.00024
NM_019066.5(MAGEL2):c.434C>T (p.Pro145Leu) rs372352945 0.00019
NM_019066.5(MAGEL2):c.1305G>A (p.Pro435=) rs755945170 0.00016
NM_019066.5(MAGEL2):c.2660G>A (p.Arg887Gln) rs199772480 0.00014
NM_019066.5(MAGEL2):c.539T>C (p.Val180Ala) rs58729661 0.00014
NM_019066.5(MAGEL2):c.3721G>A (p.Gly1241Ser) rs555657199 0.00011
NM_019066.5(MAGEL2):c.807C>A (p.Thr269=) rs377155487 0.00011
NM_019066.5(MAGEL2):c.474A>G (p.Pro158=) rs750481560 0.00009
NM_019066.5(MAGEL2):c.3483T>C (p.Phe1161=) rs185139848 0.00006
NM_019066.5(MAGEL2):c.3746G>A (p.Arg1249His) rs745776063 0.00006
NM_019066.5(MAGEL2):c.273G>A (p.Pro91=) rs374554976 0.00004
NM_019066.5(MAGEL2):c.1894G>A (p.Ala632Thr) rs777626175 0.00003
NM_019066.5(MAGEL2):c.2092G>A (p.Gly698Arg) rs752045093 0.00001
NM_019066.5(MAGEL2):c.2296C>T (p.Arg766Ter) rs1249139977 0.00001
NM_019066.5(MAGEL2):c.3012T>C (p.Ser1004=) rs371333192 0.00001
NM_019066.5(MAGEL2):c.42G>A (p.Pro14=) rs794726942 0.00001
NM_019066.5(MAGEL2):c.789T>C (p.Pro263=) rs993057859 0.00001
NM_019066.5(MAGEL2):c.1021C>T (p.Gln341Ter) rs2140717169
NM_019066.5(MAGEL2):c.1344ACCCGTGATCCGCCAGGCCCC[1] (p.442PVIRQAP[2]) rs794726941
NM_019066.5(MAGEL2):c.1344_1385del (p.442PVIRQAP[1])
NM_019066.5(MAGEL2):c.1386_1406del (p.Ala463_Pro469del) rs1273738588
NM_019066.5(MAGEL2):c.1404CCCACCTGTGATCCGCCAGGC[1] (p.464VIRQAPP[3]) rs1386125417
NM_019066.5(MAGEL2):c.1621C>T (p.Gln541Ter) rs1555374290
NM_019066.5(MAGEL2):c.1912C>T (p.Gln638Ter) rs797044883
NM_019066.5(MAGEL2):c.1922C>G (p.Pro641Arg) rs556296973
NM_019066.5(MAGEL2):c.1991C>T (p.Pro664Leu) rs201935129
NM_019066.5(MAGEL2):c.2408C>A (p.Ala803Asp) rs371119917
NM_019066.5(MAGEL2):c.2641C>T (p.Arg881Cys)
NM_019066.5(MAGEL2):c.2919G>A (p.Pro973=) rs544938560
NM_019066.5(MAGEL2):c.3046C>T (p.Pro1016Ser)
NM_019066.5(MAGEL2):c.3140T>C (p.Val1047Ala) rs576711188
NM_019066.5(MAGEL2):c.3257C>A (p.Ala1086Asp)
NM_019066.5(MAGEL2):c.3406C>A (p.Leu1136Met)
NM_019066.5(MAGEL2):c.479CCCATCCTCCTCCTCCGGGGACCCCGATGG[1] (p.160AHPPPPGTPM[1]) rs751352401
NM_019066.5(MAGEL2):c.579CCCTCCGGGGACACCGATGGCTCATCCTCC[1] (p.181HPPPPGTPMA[4])
NM_019066.5(MAGEL2):c.939CCCACCTGCACAGCCGATGGC[1] (p.314PPAQPMA[1]) rs528108868
NM_019066.5(MAGEL2):c.979G>A (p.Ala327Thr)

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.