ClinVar Miner

Variants in gene MAGEL2 with conflicting interpretations

Y axis minimum submission review status: Y axis collection method:
X axis minimum submission review status: X axis collection method:
Minimum conflict level:
Gene type:
ClinVar version:

If a variant has more than two submissions, it may have multiple conflicts and therefore be counted in more than one conflict column. If this is the case, the "Variants with any kind of conflict" cell will be less than the sum of the conflicted variants cells to its left.

Variants with only 1 submission per condition Variants with at least 2 submissions on the same condition and no conflicts Variants with a synonymous conflict
(e.g. benign vs non-pathogenic)
Variants with a confidence conflict
(e.g. benign vs likely benign)
Variants with a benign or likely benign vs uncertain conflict Variants with a category conflict
(e.g. benign vs affects)
Variants with a clinically significant conflict
(e.g. benign vs pathogenic)
Variants with any conflict
150 13 0 12 12 0 0 22

Significance breakdown #

In the table below, cells that correspond to a term paired with itself represent synonymous conflicts, i.e. variants that have been annotated with different terms that map to the same standard term. To compare the terms that were actually submitted, check the box in the filters section at the top of this page.

pathogenic likely pathogenic uncertain significance likely benign benign
pathogenic 0 1 0 0 0
likely pathogenic 1 0 0 0 0
uncertain significance 0 0 0 6 8
likely benign 0 0 6 0 11
benign 0 0 8 11 0

All variants with conflicting interpretations #

Total variants: 22
Download table as spreadsheet
HGVS dbSNP
NM_019066.5(MAGEL2):c.1038G>C (p.Arg346Ser) rs115892604
NM_019066.5(MAGEL2):c.1079C>T (p.Ala360Val) rs111759069
NM_019066.5(MAGEL2):c.1175C>T (p.Thr392Met) rs781777662
NM_019066.5(MAGEL2):c.1286C>T (p.Pro429Leu) rs2233061
NM_019066.5(MAGEL2):c.1344ACCCGTGATCCGCCAGGCCCC[1] (p.442PVIRQAP[2]) rs794726941
NM_019066.5(MAGEL2):c.1404CCCACCTGTGATCCGCCAGGC[1] (p.464VIRQAPP[3]) rs1386125417
NM_019066.5(MAGEL2):c.1423G>T (p.Ala475Ser) rs760039339
NM_019066.5(MAGEL2):c.1470G>A (p.Pro490=) rs771501846
NM_019066.5(MAGEL2):c.1621C>T (p.Gln541Ter) rs1555374290
NM_019066.5(MAGEL2):c.2074G>A (p.Val692Ile) rs200926181
NM_019066.5(MAGEL2):c.2281G>C (p.Ala761Pro) rs146970674
NM_019066.5(MAGEL2):c.2611G>T (p.Ala871Ser) rs2233066
NM_019066.5(MAGEL2):c.2612C>T (p.Ala871Val) rs74004212
NM_019066.5(MAGEL2):c.3017C>G (p.Thr1006Ser) rs138628273
NM_019066.5(MAGEL2):c.3151C>A (p.Leu1051Ile) rs2233070
NM_019066.5(MAGEL2):c.3229T>C (p.Leu1077=) rs2233071
NM_019066.5(MAGEL2):c.3690G>C (p.Glu1230Asp) rs34875116
NM_019066.5(MAGEL2):c.383T>C (p.Leu128Pro) rs191559595
NM_019066.5(MAGEL2):c.406G>A (p.Gly136Arg) rs570335069
NM_019066.5(MAGEL2):c.639A>C (p.Pro213=) rs886042708
NM_019066.5(MAGEL2):c.919C>T (p.Pro307Ser) rs555920534
NM_019066.5(MAGEL2):c.939CCCACCTGCACAGCCGATGGC[1] (p.314PPAQPMA[1]) rs528108868

The information on this website is not intended for direct diagnostic use or medical decision-making without review by a genetics professional. Individuals should not change their health behavior solely on the basis of information contained on this website. Neither the University of Utah nor the National Institutes of Health independently verfies the submitted information. If you have questions about the information contained on this website, please see a health care professional.